Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CATSPER4	378807	broad.mit.edu	37	1	26524882	26524882	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26524882G>A	uc010oez.1	+	6	784	c.784G>A	c.(784-786)GGC>AGC	p.G262S	CATSPER4_uc010oey.1_Missense_Mutation_p.G84S|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	262					cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		CACCCAGGACGGCTGGGTGGA	0.557																0.068783	-5.983309	30.351938	13	176	KEEP	---	---	---	---	8	5	97	84	-1	capture	Missense_Mutation	SNP	26524882	26524882	CATSPER4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2666	21
RSU1	6251	broad.mit.edu	37	10	16794981	16794981	+	Missense_Mutation	SNP	T	C	C	rs149666298	byFrequency	TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:16794981T>C	uc001iok.2	-	5	721	c.419A>G	c.(418-420)TAT>TGT	p.Y140C	RSU1_uc001iol.2_Missense_Mutation_p.Y140C|RSU1_uc001iom.2_Missense_Mutation_p.Y87C|RSU1_uc001ion.2_Missense_Mutation_p.Y140C	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2	140	LRR 5.				cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		GTCACTTAGATAGAGTGCACG	0.398																0.047059	-7.368276	11.204785	4	81	KEEP	---	---	---	---	3	3	51	43	-1	capture	Missense_Mutation	SNP	16794981	16794981	RSU1	10	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	13608	21
MAP3K8	1326	broad.mit.edu	37	10	30739369	30739369	+	Silent	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:30739369A>G	uc001ivi.1	+	5	1383	c.687A>G	c.(685-687)GAA>GAG	p.E229E	MAP3K8_uc009xlf.1_Silent_p.E229E|MAP3K8_uc001ivj.1_Silent_p.E229E	NM_005204	NP_005195	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase	229	Protein kinase.				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			breast(3)|central_nervous_system(1)	4		Prostate(175;0.151)				GAGAATTTGAAATTATTTGGG	0.418					197											0.026087	-22.163747	6.399251	3	112	KEEP	---	---	---	---	2	1	59	61	-1	capture	Silent	SNP	30739369	30739369	MAP3K8	10	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	9170	21
ZNF37A	7587	broad.mit.edu	37	10	38407378	38407378	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:38407378C>A	uc001izk.2	+	8	2118	c.1299C>A	c.(1297-1299)CAC>CAA	p.H433Q	ZNF37A_uc001izl.2_Missense_Mutation_p.H433Q|ZNF37A_uc001izm.2_Missense_Mutation_p.H433Q	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	433	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						TAAGAACTCACACAGGTGAGA	0.383																0.054795	-6.563884	8.678608	4	69	KEEP	---	---	---	---	2	2	36	40	0.5	capture	Missense_Mutation	SNP	38407378	38407378	ZNF37A	10	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	17752	21
ANK3	288	broad.mit.edu	37	10	61831909	61831909	+	Silent	SNP	G	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:61831909G>A	uc001jky.2	-	37	8922	c.8730C>T	c.(8728-8730)AAC>AAT	p.N2910N	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	2910					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						AGAGAGAGCCGTTTGTTAACA	0.378																0.091743	3.466094	21.769134	10	99	KEEP	---	---	---	---	4	6	52	51	-1	capture	Silent	SNP	61831909	61831909	ANK3	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	619	21
OR4C15	81309	broad.mit.edu	37	11	55322828	55322828	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55322828A>T	uc010rig.1	+	1	1046	c.1046A>T	c.(1045-1047)CAG>CTG	p.Q349L		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	295	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GAAGTAAAACAGGCCATGAGG	0.328													HNSCC(20;0.049)			0.048387	-14.960361	11.938595	6	118	KEEP	---	---	---	---	6	0	62	60	-1	capture	Missense_Mutation	SNP	55322828	55322828	OR4C15	11	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	10952	21
KRTAP5-10	387273	broad.mit.edu	37	11	71277242	71277242	+	Nonstop_Mutation	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71277242A>G	uc001oqt.1	+	1	634	c.609A>G	c.(607-609)TGA>TGG	p.*203W		NM_001012710	NP_001012728	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	203						keratin filament				skin(1)	1						GTAAGATCTGAGGCTCTGAAC	0.323																0.021898	-28.201476	6.766804	3	134	KEEP	---	---	---	---	2	1	84	70	-1	capture	Nonstop_Mutation	SNP	71277242	71277242	KRTAP5-10	11	A	G	G	G	1	0	0	0	0	0	0	0	0	143	11	5	3	8479	21
BIRC2	329	broad.mit.edu	37	11	102220791	102220791	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102220791G>T	uc001pgy.2	+	2	1605	c.206G>T	c.(205-207)CGT>CTT	p.R69L	BIRC2_uc010ruq.1_Missense_Mutation_p.R20L|BIRC2_uc010rur.1_Missense_Mutation_p.R69L	NM_001166	NP_001157	Q13490	BIRC2_HUMAN	baculoviral IAP repeat-containing protein 2	69	BIR 1.				cell surface receptor linked signaling pathway|cellular component disassembly involved in apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteasomal ubiquitin-dependent protein catabolic process|protein polyubiquitination	CD40 receptor complex|cytosol|internal side of plasma membrane	protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		AGTCTTGCTCGTGCTGGTTTT	0.423					113											0.116788	22.522786	42.294791	16	121	KEEP	---	---	---	---	10	8	69	57	0.555555555556	capture	Missense_Mutation	SNP	102220791	102220791	BIRC2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	1423	21
KLRC3	3823	broad.mit.edu	37	12	10573038	10573038	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10573038T>C	uc001qyf.2	-	1	157	c.112A>G	c.(112-114)ATA>GTA	p.I38V	KLRC3_uc001qyh.2_Intron|KLRC3_uc001qyi.1_Missense_Mutation_p.I38V|KLRC3_uc010shc.1_Missense_Mutation_p.I38V|KLRC3_uc010shd.1_Missense_Mutation_p.I38V	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	38	Cytoplasmic (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						ACTTGGAATATTTCCTGTTCG	0.378																0.057778	-10.515795	35.631186	13	212	KEEP	---	---	---	---	8	7	149	104	-1	capture	Missense_Mutation	SNP	10573038	10573038	KLRC3	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	8337	21
KLRC3	3823	broad.mit.edu	37	12	10588474	10588474	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10588474T>C	uc001qyh.2	-	1	119	c.112A>G	c.(112-114)ATA>GTA	p.I38V	KLRC2_uc010she.1_Missense_Mutation_p.I38V|KLRC2_uc001qyk.2_Missense_Mutation_p.I38V	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	38	Cytoplasmic (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						ACTTGGAATATTTCCTGTTCG	0.383																0.013587	-89.85989	9.405165	5	363	KEEP	---	---	---	---	4	3	236	174	-1	capture	Missense_Mutation	SNP	10588474	10588474	KLRC3	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	8337	21
TMCC3	57458	broad.mit.edu	37	12	94975965	94975965	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:94975965A>G	uc001tdj.2	-	2	546	c.428T>C	c.(427-429)ATC>ACC	p.I143T	TMCC3_uc001tdi.2_Missense_Mutation_p.I112T	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	143	Potential.					integral to membrane				ovary(1)|skin(1)	2						ATTCTGCTCGATCTCTCTGAG	0.458																0.044025	-17.905006	17.477628	7	152	KEEP	---	---	---	---	5	4	99	61	-1	capture	Missense_Mutation	SNP	94975965	94975965	TMCC3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	15879	21
DTX1	1840	broad.mit.edu	37	12	113515335	113515335	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113515335T>G	uc001tuk.1	+	2	702	c.366T>G	c.(364-366)GAT>GAG	p.D122E		NM_004416	NP_004407	Q86Y01	DTX1_HUMAN	deltex homolog 1	122	WWE 2.				negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4						CGGCCTACGATATGGACATCT	0.622					106											0.067568	-7.212963	7.084933	5	69	KEEP	---	---	---	---	0	5	42	42	-1	capture	Missense_Mutation	SNP	113515335	113515335	DTX1	12	T	G	G	G	1	0	0	0	0	1	0	0	0	634	49	4	4	4748	21
SACS	26278	broad.mit.edu	37	13	23928995	23928995	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23928995A>G	uc001uon.2	-	8	2345	c.1756T>C	c.(1756-1758)TAC>CAC	p.Y586H	SACS_uc001uoo.2_Missense_Mutation_p.Y439H|SACS_uc001uop.1_Missense_Mutation_p.Y373H|SACS_uc001uoq.1_Missense_Mutation_p.Y439H	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	586					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GTTTTTGTGTATTCTAAATTT	0.468					738											0.088235	10.708361	34.004521	12	124	KEEP	---	---	---	---	8	4	70	63	-1	capture	Missense_Mutation	SNP	23928995	23928995	SACS	13	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	13696	21
UBE3A	7337	broad.mit.edu	37	15	25616938	25616938	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:25616938T>C	uc001zaq.2	-	4	392	c.392A>G	c.(391-393)GAG>GGG	p.E131G	uc001zae.2_Intron|UBE3A_uc001zar.2_Missense_Mutation_p.E108G|UBE3A_uc001zas.2_Missense_Mutation_p.E128G|UBE3A_uc001zat.2_Missense_Mutation_p.E108G	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	131					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		ATATACCTTCTCTTCTGTTAA	0.308																0.082192	4.791988	17.757254	6	67	KEEP	---	---	---	---	2	4	32	43	-1	capture	Missense_Mutation	SNP	25616938	25616938	UBE3A	15	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16761	21
MIS12	79003	broad.mit.edu	37	17	5392643	5392643	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5392643A>G	uc002gcd.2	+	2	790	c.461A>G	c.(460-462)CAG>CGG	p.Q154R	MIS12_uc002gce.2_Missense_Mutation_p.Q154R	NM_024039	NP_076944	Q9H081	MIS12_HUMAN	MIS12 homolog	154	Potential.				cell division|chromosome segregation|kinetochore assembly|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding				0						AAACTCAAACAGACGTTGACT	0.393																0.019499	-80.7061	12.382039	7	352	KEEP	---	---	---	---	5	2	209	188	-1	capture	Missense_Mutation	SNP	5392643	5392643	MIS12	17	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9506	21
MYH2	4620	broad.mit.edu	37	17	10430104	10430104	+	Silent	SNP	G	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10430104G>A	uc010coi.2	-	30	4127	c.3999C>T	c.(3997-3999)AAC>AAT	p.N1333N	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.N1333N|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1333	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GCGCCAGGGCGTTCTTGGCCT	0.498																0.05102	-11.307644	9.61905	5	93	KEEP	---	---	---	---	4	1	51	46	-1	capture	Silent	SNP	10430104	10430104	MYH2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9945	21
MALT1	10892	broad.mit.edu	37	18	56378165	56378165	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56378165A>G	uc002lhm.1	+	7	1196	c.938A>G	c.(937-939)GAG>GGG	p.E313G	MALT1_uc002lhn.1_Intron	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	313					activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						AGAACAGATGAGGCAGTGGAG	0.388					549	T	BIRC3	MALT								0.034483	-13.14984	7.36611	3	84	KEEP	---	---	---	---	0	3	60	38	-1	capture	Missense_Mutation	SNP	56378165	56378165	MALT1	18	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	9116	21
ZNF844	284391	broad.mit.edu	37	19	12187443	12187443	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12187443C>G	uc002mtb.2	+	4	1651	c.1508C>G	c.(1507-1509)CCT>CGT	p.P503R	ZNF844_uc010dym.1_Missense_Mutation_p.P346R	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	503					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGAGAAACCCTATGAGTGTA	0.413																0.037037	-12.0504	6.761271	3	78	KEEP	---	---	---	---	1	2	33	51	-1	capture	Missense_Mutation	SNP	12187443	12187443	ZNF844	19	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	18066	21
ZNF28	7576	broad.mit.edu	37	19	53303147	53303147	+	Missense_Mutation	SNP	C	T	T	rs146037495		TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53303147C>T	uc002qad.2	-	4	2071	c.1951G>A	c.(1951-1953)GTA>ATA	p.V651I	ZNF28_uc002qac.2_Missense_Mutation_p.V598I|ZNF28_uc010eqe.2_Missense_Mutation_p.V597I	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	651	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TGATGGTATACGAGGGATGAC	0.423																0.090323	13.054149	65.54434	28	282	KEEP	---	---	---	---	15	18	177	137	-1	capture	Missense_Mutation	SNP	53303147	53303147	ZNF28	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17693	21
GFPT1	2673	broad.mit.edu	37	2	69583664	69583664	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69583664T>C	uc002sfh.2	-	7	748	c.569A>G	c.(568-570)AAA>AGA	p.K190R	GFPT1_uc002sfi.1_Missense_Mutation_p.K32R	NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate	190	Glutamine amidotransferase type-2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						ATGAACACTTTTAAACACAAG	0.358																0.085561	13.566763	46.113074	16	171	KEEP	---	---	---	---	14	4	106	98	-1	capture	Missense_Mutation	SNP	69583664	69583664	GFPT1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	6285	21
SCRN3	79634	broad.mit.edu	37	2	175287615	175287615	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:175287615A>G	uc002uiq.2	+	6	845	c.757A>G	c.(757-759)AAT>GAT	p.N253D	SCRN3_uc010zen.1_Missense_Mutation_p.N246D|SCRN3_uc010zeo.1_Missense_Mutation_p.N51D|SCRN3_uc002uis.2_5'UTR	NM_024583	NP_078859	Q0VDG4	SCRN3_HUMAN	secernin 3	253					proteolysis		dipeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.229)			TTCTCTAGGAAATATAACTTT	0.318																0.044118	-8.034909	7.093545	3	65	KEEP	---	---	---	---	4	0	39	31	-1	capture	Missense_Mutation	SNP	175287615	175287615	SCRN3	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	13833	21
QRICH1	54870	broad.mit.edu	37	3	49094721	49094721	+	Silent	SNP	A	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49094721A>G	uc010hkq.2	-	4	1208	c.912T>C	c.(910-912)CCT>CCC	p.P304P	QRICH1_uc003cvu.2_Silent_p.P304P|QRICH1_uc003cvv.2_Silent_p.P304P	NM_198880	NP_942581	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	304	Gln-rich.									ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TTTCTCCTGTAGGGCTAGTAA	0.557																0.029703	-18.132588	6.371782	3	98	KEEP	---	---	---	---	2	1	46	58	-1	capture	Silent	SNP	49094721	49094721	QRICH1	3	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	12774	21
N4BP2	55728	broad.mit.edu	37	4	40122570	40122570	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40122570G>T	uc003guy.3	+	9	3177	c.2839G>T	c.(2839-2841)GGA>TGA	p.G947*	N4BP2_uc010ifq.2_Nonsense_Mutation_p.G867*|N4BP2_uc010ifr.2_Nonsense_Mutation_p.G867*	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	947						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						CTCCAATCTAGGAAGTTCTGA	0.408					693											0.078431	-1.286315	17.246088	8	94	KEEP	---	---	---	---	3	6	45	59	0.333333333333	capture	Nonsense_Mutation	SNP	40122570	40122570	N4BP2	4	G	T	T	T	1	0	0	0	0	0	1	0	0	455	35	5	4	10020	21
LRRC66	339977	broad.mit.edu	37	4	52883712	52883712	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:52883712T>C	uc003gzi.2	-	1	81	c.68A>G	c.(67-69)AAT>AGT	p.N23S		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	23	Helical; (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						TCTTGATGCATTTGTCATTAT	0.299																0.122807	12.184812	20.120672	7	50	KEEP	---	---	---	---	5	2	26	26	-1	capture	Missense_Mutation	SNP	52883712	52883712	LRRC66	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	8933	21
ENOPH1	58478	broad.mit.edu	37	4	83372300	83372300	+	Silent	SNP	G	A	A	rs143039236	by1000genomes	TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83372300G>A	uc003hmv.2	+	3	548	c.291G>A	c.(289-291)GTG>GTA	p.V97V	ENOPH1_uc003hmw.2_Silent_p.V9V|ENOPH1_uc003hmx.2_Intron	NM_021204	NP_067027	Q9UHY7	ENOPH_HUMAN	enolase-phosphatase 1	97					L-methionine salvage from methylthioadenosine	cytoplasm|nucleus	2,3-diketo-5-methylthiopentyl-1-phosphate enolase activity|2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase activity|acireductone synthase activity|magnesium ion binding|phosphoglycolate phosphatase activity				0						TAGATAATGTGTGCTGGCAGA	0.562																0.089744	1.760424	15.017362	7	71	KEEP	---	---	---	---	4	3	35	42	-1	capture	Silent	SNP	83372300	83372300	ENOPH1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	5079	21
ABCG2	9429	broad.mit.edu	37	4	89053011	89053011	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89053011T>C	uc003hrg.2	-	4	815	c.322A>G	c.(322-324)ATA>GTA	p.I108V	ABCG2_uc003hrh.2_Missense_Mutation_p.I108V|ABCG2_uc003hrf.2_5'UTR|ABCG2_uc003hri.1_Missense_Mutation_p.I108V|ABCG2_uc003hrj.1_Missense_Mutation_p.I108V|ABCG2_uc003hrk.1_Missense_Mutation_p.I108V	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2	108	ABC transporter.|Cytoplasmic (Potential).				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	GCTCCATTTATCAGAACATCT	0.378																0.061538	-1.951932	11.084045	4	61	KEEP	---	---	---	---	1	3	27	37	-1	capture	Missense_Mutation	SNP	89053011	89053011	ABCG2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	69	21
PCDHA13	56136	broad.mit.edu	37	5	140263677	140263677	+	Silent	SNP	G	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263677G>A	uc003lif.2	+	1	1824	c.1824G>A	c.(1822-1824)TCG>TCA	p.S608S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Silent_p.S608S|PCDHA13_uc003lid.2_Silent_p.S608S	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	608	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGCTTTCGTATGAATTGC	0.682	Melanoma(147;1739 1852 5500 27947 37288)															0.098485	8.203579	29.470131	13	119	KEEP	---	---	---	---	8	6	83	83	-1	capture	Silent	SNP	140263677	140263677	PCDHA13	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11426	21
PCDHB14	56122	broad.mit.edu	37	5	140604583	140604583	+	Silent	SNP	C	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140604583C>A	uc003ljb.2	+	1	1506	c.1506C>A	c.(1504-1506)TCC>TCA	p.S502S	PCDHB14_uc011dal.1_Silent_p.S349S	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	502	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTCGCCTCCTTGGTCTCCA	0.647	Ovarian(141;50 1831 27899 33809 37648)															0.086735	3.612297	37.522092	17	179	KEEP	---	---	---	---	11	12	107	120	0.521739130435	capture	Silent	SNP	140604583	140604583	PCDHB14	5	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	11442	21
C2	717	broad.mit.edu	37	6	31901955	31901955	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31901955G>A	uc003nyf.2	+	6	992	c.728G>A	c.(727-729)CGT>CAT	p.R243H	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron|C2_uc003nye.3_Missense_Mutation_p.R243H|C2_uc010jtk.2_Missense_Mutation_p.R111H|C2_uc011doq.1_Missense_Mutation_p.R214H|C2_uc003nyg.2_Intron|CFB_uc011dor.1_Intron|C2_uc003nyh.1_5'Flank	NM_000063	NP_000054	P06681	CO2_HUMAN	complement component 2 isoform 1 preproprotein	243					complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity			ovary(1)|skin(1)	2		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		AGCCTGGGCCGTAAAATCCAA	0.547																0.019841	-57.343838	7.855708	5	247	KEEP	---	---	---	---	1	4	131	135	-1	capture	Missense_Mutation	SNP	31901955	31901955	C2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2056	21
POM121	9883	broad.mit.edu	37	7	72398976	72398976	+	Missense_Mutation	SNP	A	G	G	rs147859349		TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72398976A>G	uc003twk.2	+	4	1076	c.1076A>G	c.(1075-1077)AAT>AGT	p.N359S	POM121_uc003twj.2_Missense_Mutation_p.N94S|POM121_uc010lam.1_Missense_Mutation_p.N94S	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	359	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				CTGGTGGCCAATGGAGTCCCC	0.468																0.020725	-83.437252	15.82477	8	378	KEEP	---	---	---	---	7	3	221	209	-1	capture	Missense_Mutation	SNP	72398976	72398976	POM121	7	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12141	21
ZFAT	57623	broad.mit.edu	37	8	135533235	135533235	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:135533235T>G	uc003yup.2	-	13	3300	c.3125A>C	c.(3124-3126)AAG>ACG	p.K1042T	ZFAT_uc011ljj.1_Missense_Mutation_p.K161T|ZFAT_uc003yun.2_Missense_Mutation_p.K1030T|ZFAT_uc003yuo.2_Missense_Mutation_p.K1030T|ZFAT_uc010meh.2_Missense_Mutation_p.K1030T|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Missense_Mutation_p.K1030T|ZFAT_uc010mej.2_Missense_Mutation_p.K980T	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	1042	C2H2-type 19.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AACAGGACACTTCAAACCACC	0.408																0.148936	12.091319	17.654398	7	40	KEEP	---	---	---	---	3	5	19	24	-1	capture	Missense_Mutation	SNP	135533235	135533235	ZFAT	8	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	17512	21
IARS	3376	broad.mit.edu	37	9	95004467	95004467	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95004467G>C	uc004art.1	-	29	3403	c.3146C>G	c.(3145-3147)TCG>TGG	p.S1049W	IARS_uc004ars.1_Missense_Mutation_p.S894W|IARS_uc004aru.3_Missense_Mutation_p.S1049W|IARS_uc010mqr.2_Missense_Mutation_p.S939W|IARS_uc010mqt.2_Missense_Mutation_p.S272W	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	1049					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	GACTTTATCCGATGGAGAAAC	0.388																0.018293	-36.429685	6.43127	3	161	KEEP	---	---	---	---	3	1	109	82	-1	capture	Missense_Mutation	SNP	95004467	95004467	IARS	9	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	7398	21
DCAF12L2	340578	broad.mit.edu	37	X	125298905	125298905	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125298905G>A	uc004euk.1	-	1	1030	c.1003C>T	c.(1003-1005)CGC>TGC	p.R335C		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	335										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						TGGCGCTGGCGCGGATCCAGG	0.627																0.134021	20.011771	32.611613	13	84	KEEP	---	---	---	---	11	4	55	33	-1	capture	Missense_Mutation	SNP	125298905	125298905	DCAF12L2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4224	21
OGDH	4967	broad.mit.edu	37	7	44684936	44684936	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0141-01	TCGA-06-0141-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44684936delT	uc003tln.2	+	3	342	c.233delT	c.(232-234)ATTfs	p.I78fs	OGDH_uc003tlm.2_Frame_Shift_Del_p.I78fs|OGDH_uc011kbx.1_Frame_Shift_Del_p.I78fs|OGDH_uc011kby.1_Intron|OGDH_uc003tlp.2_Frame_Shift_Del_p.I78fs|OGDH_uc011kbz.1_5'UTR|OGDH_uc003tlo.1_5'UTR	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	78					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	TCATGGGACATTTTTTTTCGC	0.577																0.02			8	371		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	44684936	44684936	OGDH	7	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	10744	21
