Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SPSB1	80176	broad.mit.edu	37	1	9416221	9416221	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:9416221G>A	uc010oae.1	+	2	610	c.271G>A	c.(271-273)GTC>ATC	p.V91I	SPSB1_uc001apv.2_Missense_Mutation_p.V91I	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box	91	B30.2/SPRY.				intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CAGGGGCAAAGTCGGGTATAC	0.632																0.370892	230.296996	233.405166	79	134	KEEP	---	---	---	---	43	48	81	70	-1	capture	Missense_Mutation	SNP	9416221	9416221	SPSB1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	15004	39
CYP4B1	1580	broad.mit.edu	37	1	47279693	47279693	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47279693C>T	uc001cqm.3	+	6	814	c.730C>T	c.(730-732)CGC>TGC	p.R244C	CYP4B1_uc009vyl.1_Missense_Mutation_p.R81C|CYP4B1_uc001cqn.3_Missense_Mutation_p.R245C|CYP4B1_uc009vym.2_Missense_Mutation_p.R230C|CYP4B1_uc010omk.1_Missense_Mutation_p.R81C|CYP4B1_uc010oml.1_Missense_Mutation_p.R82C	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	244					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					CCCACATGGCCGCCGCTTCCT	0.592																0.2103	115.875108	133.94837	49	184	KEEP	---	---	---	---	45	45	132	147	-1	capture	Missense_Mutation	SNP	47279693	47279693	CYP4B1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4145	39
GPR161	23432	broad.mit.edu	37	1	168065791	168065791	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168065791G>A	uc001gfc.2	-	5	1368	c.1054C>T	c.(1054-1056)CGA>TGA	p.R352*	GPR161_uc001gfb.2_Nonsense_Mutation_p.R220*|GPR161_uc010pll.1_Nonsense_Mutation_p.R262*|GPR161_uc010plm.1_Nonsense_Mutation_p.R238*|GPR161_uc009wvo.2_Nonsense_Mutation_p.R369*|GPR161_uc001gfd.2_Nonsense_Mutation_p.R352*|GPR161_uc010pln.1_Nonsense_Mutation_p.R372*|GPR161_uc001gfe.1_Nonsense_Mutation_p.R352*	NM_153832	NP_722561	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161 isoform 2	352	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_hematologic(923;0.215)					GTCCTCTGTCGTTGCACAAAT	0.512																0.305785	101.933112	106.001742	37	84	KEEP	---	---	---	---	14	25	53	38	-1	capture	Nonsense_Mutation	SNP	168065791	168065791	GPR161	1	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	6599	39
HMCN1	83872	broad.mit.edu	37	1	186008959	186008959	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186008959T>C	uc001grq.1	+	39	6357	c.6128T>C	c.(6127-6129)CTG>CCG	p.L2043P		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2043	Ig-like C2-type 18.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GCCCCAAGTCTGACCTGGTTG	0.443																0.056872	-14.880396	28.632921	12	199	KEEP	---	---	---	---	7	6	119	107	-1	capture	Missense_Mutation	SNP	186008959	186008959	HMCN1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	7145	39
DSTYK	25778	broad.mit.edu	37	1	205129369	205129369	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205129369G>A	uc001hbw.2	-	8	2042	c.1978C>T	c.(1978-1980)CGG>TGG	p.R660W	DSTYK_uc001hbx.2_Missense_Mutation_p.R660W|DSTYK_uc001hby.1_Missense_Mutation_p.R121W	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	660	Protein kinase.|ATP (By similarity).					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						TACTGGCCCCGGCCCAGTTCC	0.498					236											0.043614	-40.72118	30.903381	14	307	KEEP	---	---	---	---	7	10	174	186	-1	capture	Missense_Mutation	SNP	205129369	205129369	DSTYK	1	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	4740	39
TRIM58	25893	broad.mit.edu	37	1	248023987	248023987	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248023987C>T	uc001ido.2	+	2	537	c.489C>T	c.(487-489)AAC>AAT	p.N163N		NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	163						intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGGAGGCCAACGTGGGGAAAA	0.483																0.214953	57.093778	65.099012	23	84	KEEP	---	---	---	---	12	15	51	47	-1	capture	Silent	SNP	248023987	248023987	TRIM58	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16414	39
ZNF33B	7582	broad.mit.edu	37	10	43088980	43088980	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:43088980T>C	uc001jaf.1	-	5	1533	c.1418A>G	c.(1417-1419)GAG>GGG	p.E473G	ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Missense_Mutation_p.E361G|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B	473	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TTTCCCACACTCAAGACATTC	0.383	Melanoma(137;1247 1767 16772 25727 43810)															0.038217	-23.386299	12.822137	6	151	KEEP	---	---	---	---	3	6	81	78	-1	capture	Missense_Mutation	SNP	43088980	43088980	ZNF33B	10	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17735	39
PTEN	5728	broad.mit.edu	37	10	89653809	89653809	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89653809G>A	uc001kfb.2	+	3	1138	c.107G>A	c.(106-108)GGA>GAA	p.G36E		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	36	Phosphatase tensin-type.		G -> R (in endometrial hyperplasia).|G -> E (in glioma).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(4)|p.G36E(4)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G36V(2)|p.G36fs*18(1)|p.G36*(1)|p.A34_G36del(1)|p.G36R(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ATTGCTATGGGATTTCCTGCA	0.284			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.407407	138.478288	139.287941	44	64	KEEP	---	---	---	---	30	22	38	35	-1	capture	Missense_Mutation	SNP	89653809	89653809	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12633	39
GPR120	338557	broad.mit.edu	37	10	95347103	95347103	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:95347103A>C	uc010qnt.1	+	4	927	c.871A>C	c.(871-873)ATC>CTC	p.I291L	GPR120_uc010qnu.1_Missense_Mutation_p.I275L	NM_181745	NP_859529	Q5NUL3	O3FA1_HUMAN	G protein-coupled receptor 120	291	Helical; Name=6; (Potential).				negative regulation of cytokine secretion|negative regulation of inflammatory response|regulation of glucose transport	integral to membrane|plasma membrane	fatty acid binding				0		Colorectal(252;0.122)				CTCCTTCTTCATCATGTGGAG	0.582																0.056034	-14.622043	33.456025	13	219	KEEP	---	---	---	---	7	6	114	118	-1	capture	Missense_Mutation	SNP	95347103	95347103	GPR120	10	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	6570	39
IFITM3	10410	broad.mit.edu	37	11	320606	320606	+	Missense_Mutation	SNP	G	T	T	rs149004156	by1000genomes	TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:320606G>T	uc001lpa.2	-	1	309	c.208C>A	c.(208-210)CCC>ACC	p.P70T	uc001loz.2_Intron	NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	70	Interaction with SPP1.|Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane		p.P70T(1)		central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGGCAGCAGGGGTTCATGAAG	0.632																0.02994	-31.939759	8.548239	5	162	KEEP	---	---	---	---	2	4	106	78	0.333333333333	capture	Missense_Mutation	SNP	320606	320606	IFITM3	11	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	7453	39
MUC2	4583	broad.mit.edu	37	11	1101144	1101144	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1101144G>A	uc001lsx.1	+	44	14656	c.14629G>A	c.(14629-14631)GAC>AAC	p.D4877N		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4877	VWFC 1.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CAACCCTGCCGACACCTGCTG	0.622																0.423077	136.58819	137.12371	44	60	KEEP	---	---	---	---	30	40	51	43	-1	capture	Missense_Mutation	SNP	1101144	1101144	MUC2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9885	39
OR51T1	401665	broad.mit.edu	37	11	4903141	4903141	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4903141C>A	uc010qyp.1	+	1	93	c.93C>A	c.(91-93)TTC>TTA	p.F31L		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	4	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCAATATTCAATAACACCA	0.368																0.072993	-5.169542	20.535197	10	127	KEEP	---	---	---	---	3	9	69	68	0.75	capture	Missense_Mutation	SNP	4903141	4903141	OR51T1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	11010	39
OR10A6	390093	broad.mit.edu	37	11	7949484	7949484	+	Silent	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7949484G>A	uc010rbh.1	-	1	726	c.726C>T	c.(724-726)GCC>GCT	p.A242A		NM_001004461	NP_001004461	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGAGGTGAGCGGCACAGGTGG	0.453																0.512821	133.504536	133.515868	40	38	KEEP	---	---	---	---	25	18	20	21	-1	capture	Silent	SNP	7949484	7949484	OR10A6	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10798	39
MADD	8567	broad.mit.edu	37	11	47345856	47345856	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47345856G>A	uc001ner.1	+	32	4774	c.4583G>A	c.(4582-4584)CGC>CAC	p.R1528H	MADD_uc001neq.2_Missense_Mutation_p.R1469H|MADD_uc001nev.1_Missense_Mutation_p.R1426H|MADD_uc001nes.1_Missense_Mutation_p.R1446H|MADD_uc001net.1_Missense_Mutation_p.R1489H|MADD_uc009yln.1_Missense_Mutation_p.R1422H|MADD_uc001neu.1_Missense_Mutation_p.R1426H|MADD_uc001nex.2_Missense_Mutation_p.R1528H|MADD_uc001nez.2_Missense_Mutation_p.R1425H|MADD_uc001new.2_Missense_Mutation_p.R1468H|MADD_uc009ylo.2_Missense_Mutation_p.R442H	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	1528					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		AGCATGGAGCGCGCTGCCGCC	0.592					5											0.333333	53.282292	54.757203	20	40	KEEP	---	---	---	---	10	15	25	27	-1	capture	Missense_Mutation	SNP	47345856	47345856	MADD	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9067	39
MS4A7	58475	broad.mit.edu	37	11	60150731	60150731	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60150731C>T	uc001npe.2	+	2	262	c.117C>T	c.(115-117)AAC>AAT	p.N39N	MS4A7_uc001npf.2_Silent_p.N39N|MS4A7_uc001npg.2_Silent_p.N39N|MS4A7_uc001nph.2_Silent_p.N39N|MS4A14_uc001npi.2_Intron|MS4A7_uc009ymx.1_Silent_p.N39N	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	39	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2						ACCTGCAGAACGGGCTGCCAA	0.438																0.344086	91.574473	93.570005	32	61	KEEP	---	---	---	---	23	18	33	35	-1	capture	Silent	SNP	60150731	60150731	MS4A7	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9776	39
NADSYN1	55191	broad.mit.edu	37	11	71191823	71191823	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71191823C>T	uc001oqn.2	+	11	1022	c.896C>T	c.(895-897)CCC>CTC	p.P299L	NADSYN1_uc001oqo.2_Missense_Mutation_p.P39L|NADSYN1_uc001oqp.2_5'UTR	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1	299	CN hydrolase.				NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	AGCCCCTACCCCAGAGTGAAG	0.587	Ovarian(79;763 1781 6490 50276)															0.358974	86.777276	88.143797	28	50	KEEP	---	---	---	---	19	18	40	42	-1	capture	Missense_Mutation	SNP	71191823	71191823	NADSYN1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10048	39
SPATA19	219938	broad.mit.edu	37	11	133714446	133714446	+	Silent	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:133714446G>A	uc001qgv.1	-	3	276	c.225C>T	c.(223-225)TCC>TCT	p.S75S		NM_174927	NP_777587	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19 precursor	75					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrial outer membrane					0	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		GGGTGGGAGGGGAGTCAGTGG	0.552																0.041667	-19.849172	12.640368	6	138	KEEP	---	---	---	---	5	3	82	86	-1	capture	Silent	SNP	133714446	133714446	SPATA19	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	14896	39
C12orf50	160419	broad.mit.edu	37	12	88379716	88379716	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:88379716G>A	uc001tam.1	-	11	1205	c.1037C>T	c.(1036-1038)GCG>GTG	p.A346V	C12orf50_uc001tan.2_Missense_Mutation_p.A361V	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	346										skin(2)|ovary(1)	3						TGCATTCAACGCGACAGTCCT	0.478																0.401914	248.258381	250.016376	84	125	KEEP	---	---	---	---	46	45	74	73	-1	capture	Missense_Mutation	SNP	88379716	88379716	C12orf50	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1681	39
TPTE2	93492	broad.mit.edu	37	13	20039688	20039688	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20039688G>A	uc001umd.2	-	9	740	c.529C>T	c.(529-531)CGA>TGA	p.R177*	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Nonsense_Mutation_p.R66*|TPTE2_uc001ume.2_Nonsense_Mutation_p.R100*|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	177						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTAGAAGTCGAACTAAATGT	0.289																0.416667	77.96433	78.328174	25	35	KEEP	---	---	---	---	11	14	17	18	-1	capture	Nonsense_Mutation	SNP	20039688	20039688	TPTE2	13	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	16314	39
ZC3H13	23091	broad.mit.edu	37	13	46544544	46544544	+	Missense_Mutation	SNP	C	T	T	rs144621814		TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46544544C>T	uc010tfw.1	-	12	2531	c.2525G>A	c.(2524-2526)CGT>CAT	p.R842H	ZC3H13_uc001vaq.2_5'Flank|ZC3H13_uc001vas.1_Missense_Mutation_p.R842H|ZC3H13_uc001vat.1_Missense_Mutation_p.R842H	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	842	Arg/Glu-rich.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		AGAATGTTCACGCCGGCGCTT	0.438	Esophageal Squamous(187;747 2077 11056 31291 44172)															0.302789	213.105349	221.818895	76	175	KEEP	---	---	---	---	44	49	111	110	-1	capture	Missense_Mutation	SNP	46544544	46544544	ZC3H13	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17445	39
RB1	5925	broad.mit.edu	37	13	49033823	49033823	+	Splice_Site	SNP	G	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49033823G>T	uc001vcb.2	+	20	2127	c.1961_splice	c.e20-1	p.V654_splice		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(10)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TATTCCCACAGTGTATCGGCT	0.363			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.295775	58.945652	61.595338	21	50	KEEP	---	---	---	---	20	25	38	48	0.444444444444	capture	Splice_Site	SNP	49033823	49033823	RB1	13	G	T	T	T	1	0	0	0	0	0	0	1	0	468	36	5	4	12993	39
RB1	5925	broad.mit.edu	37	13	49033839	49033839	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49033839A>T	uc001vcb.2	+	20	2142	c.1976A>T	c.(1975-1977)TAT>TTT	p.Y659F		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	659	Pocket; binds T and E1A.|Domain B.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.Y659F(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CGGCTAGCCTATCTCCGGCTA	0.378			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.42623	83.936533	84.226598	26	35	KEEP	---	---	---	---	13	18	18	30	-1	capture	Missense_Mutation	SNP	49033839	49033839	RB1	13	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	12993	39
SYNE2	23224	broad.mit.edu	37	14	64496750	64496750	+	Silent	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64496750G>A	uc001xgm.2	+	44	7082	c.6852G>A	c.(6850-6852)GCG>GCA	p.A2284A	SYNE2_uc001xgl.2_Silent_p.A2284A	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2284	Cytoplasmic (Potential).|Potential.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATCAAATAGCGGTTGAGGAAA	0.363																0.263158	57.364453	61.220368	20	56	KEEP	---	---	---	---	14	9	27	38	-1	capture	Silent	SNP	64496750	64496750	SYNE2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15334	39
PROX2	283571	broad.mit.edu	37	14	75329430	75329430	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75329430G>A	uc001xqr.1	-	1	1108	c.1108C>T	c.(1108-1110)CAG>TAG	p.Q370*	PROX2_uc001xqq.1_Intron	NM_001080408	NP_001073877	Q3B8N5	PROX2_HUMAN	prospero homeobox 2	370					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		GGGTGCCTCTGGGAAGATGAG	0.542																0.192308	32.075384	38.97564	15	63	KEEP	---	---	---	---	9	8	37	31	-1	capture	Nonsense_Mutation	SNP	75329430	75329430	PROX2	14	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	12457	39
KCNK10	54207	broad.mit.edu	37	14	88729810	88729810	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88729810C>T	uc001xwo.2	-	2	580	c.123G>A	c.(121-123)CCG>CCA	p.P41P	KCNK10_uc001xwm.2_Silent_p.P46P|KCNK10_uc001xwn.2_Silent_p.P46P	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	41	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						TGGACAGGCGCGGAGTTGGAG	0.652																0.217617	99.371085	113.542242	42	151	KEEP	---	---	---	---	22	25	72	97	-1	capture	Silent	SNP	88729810	88729810	KCNK10	14	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7981	39
ISLR	3671	broad.mit.edu	37	15	74467595	74467595	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74467595C>T	uc002axg.1	+	2	678	c.396C>T	c.(394-396)AAC>AAT	p.N132N	ISLR_uc002axh.1_Silent_p.N132N	NM_005545	NP_005536	O14498	ISLR_HUMAN	immunoglobulin superfamily containing	132	LRR 4.				cell adhesion	extracellular region				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						TGGACAGCAACGAGCTGACCT	0.592																0.238532	62.946279	69.717856	26	83	KEEP	---	---	---	---	17	11	41	50	-1	capture	Silent	SNP	74467595	74467595	ISLR	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7781	39
CHP2	63928	broad.mit.edu	37	16	23767768	23767768	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23767768C>T	uc002dmb.1	+	5	835	c.412C>T	c.(412-414)CAG>TAG	p.Q138*		NM_022097	NP_071380	O43745	CHP2_HUMAN	hepatocellular carcinoma antigen gene 520	138	EF-hand 3.						calcium ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(48;0.0144)		TGAGATGCTGCAGGTTGGCAG	0.537																0.219512	39.299824	45.247604	18	64	KEEP	---	---	---	---	6	15	37	38	-1	capture	Nonsense_Mutation	SNP	23767768	23767768	CHP2	16	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	3332	39
CES1	1066	broad.mit.edu	37	16	55855414	55855414	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:55855414G>A	uc002eim.2	-	5	664	c.556C>T	c.(556-558)CGG>TGG	p.R186W	CES1_uc002eil.2_Missense_Mutation_p.R187W|CES1_uc002ein.2_Missense_Mutation_p.R186W	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	186				R -> G (in Ref. 18; CAA37147).	response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	CAGTTCCCCCGGCTGTGTTCA	0.602	NSCLC(162;1801 2756 42904 52896)															0.191781	30.804746	37.28704	14	59	KEEP	---	---	---	---	6	8	46	25	-1	capture	Missense_Mutation	SNP	55855414	55855414	CES1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	3237	39
TP53	7157	broad.mit.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578457C>T	uc002gim.2	-	5	667	c.473G>A	c.(472-474)CGC>CAC	p.R158H	TP53_uc002gig.1_Missense_Mutation_p.R158H|TP53_uc002gih.2_Missense_Mutation_p.R158H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26H|TP53_uc010cng.1_Missense_Mutation_p.R26H|TP53_uc002gii.1_Missense_Mutation_p.R26H|TP53_uc010cnh.1_Missense_Mutation_p.R158H|TP53_uc010cni.1_Missense_Mutation_p.R158H|TP53_uc002gij.2_Missense_Mutation_p.R158H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65H|TP53_uc002gio.2_Missense_Mutation_p.R26H|TP53_uc010vug.1_Missense_Mutation_p.R119H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R158H(58)|p.R158L(55)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R65L(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*21(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCCATGGCGCGGACGCGGGT	0.627	Pancreas(47;798 1329 9957 10801)		111	p.R158H(MOLT16-Tumor)|p.R158L(NCIH747-Tumor)|p.R158P(NCIH2110-Tumor)|p.R158L(NCIH661-Tumor)|p.R158L(NCIH441-Tumor)|p.R158H(ST486-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.361702	97.42588	99.007443	34	60	KEEP	---	---	---	---	19	21	38	31	-1	capture	Missense_Mutation	SNP	7578457	7578457	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	39
SLC25A39	51629	broad.mit.edu	37	17	42400868	42400868	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42400868C>T	uc002ign.2	-	2	217	c.63G>A	c.(61-63)GGG>GGA	p.G21G	SLC25A39_uc002igm.2_Silent_p.G21G|SLC25A39_uc002igo.2_Silent_p.G21G|SLC25A39_uc010wiw.1_Silent_p.G21G|SLC25A39_uc010czu.2_Intron|SLC25A39_uc010wix.1_Silent_p.G21G|SLC25A39_uc010wiy.1_Silent_p.G21G	NM_001143780	NP_001137252	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39 isoform a	21	Solcar 1.|Helical; Name=1; (Potential).				heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane				upper_aerodigestive_tract(1)	1		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TAACCACAGCCCCGGTGCCTG	0.617																0.764706	48.284324	49.373776	13	4	KEEP	---	---	---	---	6	8	1	4	-1	capture	Silent	SNP	42400868	42400868	SLC25A39	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14395	39
UNC13D	201294	broad.mit.edu	37	17	73827417	73827417	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73827417C>T	uc002jpp.2	-	26	2840	c.2460G>A	c.(2458-2460)CTG>CTA	p.L820L	UNC13D_uc010wsk.1_Silent_p.L820L|UNC13D_uc002jpq.1_3'UTR	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	820	MHD2.				positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGGTCCAGAGCAGGGTCAGGA	0.667												Familial_Hemophagocytic_Lymphohistiocytosis				0.42	57.151131	57.433465	21	29	KEEP	---	---	---	---	18	8	15	16	-1	capture	Silent	SNP	73827417	73827417	UNC13D	17	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	16869	39
SEMA6B	10501	broad.mit.edu	37	19	4555533	4555533	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4555533G>C	uc010duc.1	-	6	553	c.515C>G	c.(514-516)GCC>GGC	p.A172G	SEMA6B_uc010dud.2_Missense_Mutation_p.A172G|SEMA6B_uc010xih.1_Missense_Mutation_p.A172G	NM_032108	NP_115484	Q9H3T3	SEM6B_HUMAN	semaphorin 6B precursor	172	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGCAGCGGGCCATACCGCT	0.622																0.204301	51.068754	58.617916	19	74	KEEP	---	---	---	---	10	11	63	35	-1	capture	Missense_Mutation	SNP	4555533	4555533	SEMA6B	19	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	13933	39
ILF3	3609	broad.mit.edu	37	19	10799315	10799315	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10799315G>A	uc002mpn.2	+	19	2829	c.2512G>A	c.(2512-2514)GGA>AGA	p.G838R	ILF3_uc002mpo.2_Missense_Mutation_p.G842R|ILF3_uc002mpq.2_Silent_p.A140A	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	838	Interaction with PRMT1.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GGGCTACGGCGGAGGTTCTGG	0.667																0.037559	-32.882267	16.418783	8	205	KEEP	---	---	---	---	6	2	139	107	-1	capture	Missense_Mutation	SNP	10799315	10799315	ILF3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7635	39
GPR45	11250	broad.mit.edu	37	2	105859310	105859310	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:105859310G>A	uc002tco.1	+	1	1111	c.995G>A	c.(994-996)CGC>CAC	p.R332H		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	332	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						AAAAAATTCCGCGAGGCCTGC	0.557																0.299517	167.300246	174.717346	62	145	KEEP	---	---	---	---	27	39	74	92	-1	capture	Missense_Mutation	SNP	105859310	105859310	GPR45	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6629	39
ITGA4	3676	broad.mit.edu	37	2	182360642	182360642	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:182360642C>T	uc002unu.2	+	14	2281	c.1518C>T	c.(1516-1518)GGC>GGT	p.G506G	ITGA4_uc010frj.1_5'Flank	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	506	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	CATATAAGGGCAAGGAAGTTC	0.428																0.238281	143.132486	159.159972	61	195	KEEP	---	---	---	---	33	40	108	126	-1	capture	Silent	SNP	182360642	182360642	ITGA4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	7801	39
ZDBF2	57683	broad.mit.edu	37	2	207175047	207175047	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207175047G>A	uc002vbp.2	+	5	6045	c.5795G>A	c.(5794-5796)CGT>CAT	p.R1932H		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1932							nucleic acid binding|zinc ion binding			ovary(3)	3						CAAAAGGGGCGTGTGGCTTCT	0.433																0.258065	79.033444	85.619621	32	92	KEEP	---	---	---	---	26	11	55	51	-1	capture	Missense_Mutation	SNP	207175047	207175047	ZDBF2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17479	39
ANGPT4	51378	broad.mit.edu	37	20	858921	858921	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:858921T>A	uc002wei.2	-	7	1206	c.1103A>T	c.(1102-1104)CAC>CTC	p.H368L	ANGPT4_uc010zpn.1_Missense_Mutation_p.H362L	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	368	Fibrinogen C-terminal.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						GGTGAGCTGGTGCACCACTTC	0.612	Pancreas(181;481 2077 3259 31286 49856)															0.216216	36.867019	42.36	16	58	KEEP	---	---	---	---	7	12	40	29	-1	capture	Missense_Mutation	SNP	858921	858921	ANGPT4	20	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	609	39
CHGB	1114	broad.mit.edu	37	20	5903619	5903619	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5903619C>T	uc002wmg.2	+	4	1135	c.829C>T	c.(829-831)CGA>TGA	p.R277*	CHGB_uc010zqz.1_Translation_Start_Site	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	277						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GGTGGACAAACGACGCACGAG	0.607																0.3125	26.637329	27.639425	10	22	KEEP	---	---	---	---	5	5	9	16	-1	capture	Nonsense_Mutation	SNP	5903619	5903619	CHGB	20	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	3305	39
RNF160	26046	broad.mit.edu	37	21	30354691	30354691	+	Splice_Site	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:30354691C>T	uc002ymr.2	-	5	728	c.715_splice	c.e5-1	p.V239_splice	RNF160_uc010gll.1_Splice_Site	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294								ligase activity|zinc ion binding				0						CCTGCAGCACCTACAAAGGGG	0.378																0.258065	92.039646	98.617498	32	92	KEEP	---	---	---	---	17	21	44	64	-1	capture	Splice_Site	SNP	30354691	30354691	RNF160	21	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	13347	39
EIF3L	51386	broad.mit.edu	37	22	38274115	38274115	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38274115C>T	uc003auf.2	+	11	1599	c.1512C>T	c.(1510-1512)AGC>AGT	p.S504S	EIF3L_uc003aue.1_Silent_p.S504S|EIF3L_uc011ann.1_Silent_p.S456S|EIF3L_uc003aug.2_Silent_p.S396S|EIF3L_uc003auh.2_Silent_p.S237S	NM_016091	NP_057175	Q9Y262	EIF3L_HUMAN	eukaryotic translation initiation factor 3	504						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1						TGTGGACCAGCGGTATCTCAG	0.517																0.262712	160.040875	172.062149	62	174	KEEP	---	---	---	---	47	26	89	107	-1	capture	Silent	SNP	38274115	38274115	EIF3L	22	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	4977	39
THRB	7068	broad.mit.edu	37	3	24231704	24231704	+	Silent	SNP	C	T	T	rs138865141		TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:24231704C>T	uc003ccx.3	-	5	493	c.144G>A	c.(142-144)ACG>ACA	p.T48T	THRB_uc010hfe.2_Silent_p.T48T|THRB_uc003ccy.3_Silent_p.T48T|THRB_uc003ccz.3_Silent_p.T43T|THRB_uc003cdc.2_Silent_p.T43T|THRB_uc003cdd.2_Silent_p.T43T|THRB_uc003cde.1_Silent_p.T43T	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta	48	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	CATTTTTCAACGTGCTGCGCC	0.493	Melanoma(21;896 1043 15021 37958)															0.253061	156.0145	169.597583	62	183	KEEP	---	---	---	---	43	24	84	113	-1	capture	Silent	SNP	24231704	24231704	THRB	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	15760	39
BSN	8927	broad.mit.edu	37	3	49691996	49691996	+	Silent	SNP	T	C	C			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49691996T>C	uc003cxe.3	+	5	5121	c.5007T>C	c.(5005-5007)CGT>CGC	p.R1669R		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1669					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TAGACCTCCGTACAGCTGTCA	0.597																0.294118	94.414991	98.281014	30	72	KEEP	---	---	---	---	11	26	46	34	-1	capture	Silent	SNP	49691996	49691996	BSN	3	T	C	C	C	1	0	0	0	0	0	0	0	1	730	57	3	3	1518	39
BSN	8927	broad.mit.edu	37	3	49693009	49693009	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49693009G>A	uc003cxe.3	+	5	6134	c.6020G>A	c.(6019-6021)GGT>GAT	p.G2007D		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	2007					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CTCTTCCAGGGTCCTGGACGA	0.597																0.344086	175.939998	179.935222	64	122	KEEP	---	---	---	---	28	49	63	71	-1	capture	Missense_Mutation	SNP	49693009	49693009	BSN	3	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	1518	39
CCDC66	285331	broad.mit.edu	37	3	56651395	56651395	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:56651395G>A	uc003dhz.2	+	14	2186	c.2099G>A	c.(2098-2100)AGG>AAG	p.R700K	CCDC66_uc003dhy.2_Missense_Mutation_p.R336K|CCDC66_uc003dhu.2_Missense_Mutation_p.R666K|CCDC66_uc003dhx.2_RNA|CCDC66_uc003dia.2_Missense_Mutation_p.R68K	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1	700										breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TATCCTAAAAGGCCTGATTGG	0.353																0.21519	44.029781	49.945616	17	62	KEEP	---	---	---	---	6	13	43	30	-1	capture	Missense_Mutation	SNP	56651395	56651395	CCDC66	3	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	2812	39
CADPS	8618	broad.mit.edu	37	3	62860671	62860671	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:62860671C>G	uc003dll.2	-	1	394	c.34G>C	c.(34-36)GAT>CAT	p.D12H	CADPS_uc003dlm.2_Missense_Mutation_p.D12H|CADPS_uc003dln.2_Missense_Mutation_p.D12H	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	12					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ACGATCTCATCCGATTCTTCT	0.697																0.210526	22.9788	25.924075	8	30	KEEP	---	---	---	---	2	8	19	24	-1	capture	Missense_Mutation	SNP	62860671	62860671	CADPS	3	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	2546	39
PDZRN3	23024	broad.mit.edu	37	3	73673955	73673955	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:73673955A>G	uc003dpl.1	-	1	118	c.22T>C	c.(22-24)TTC>CTC	p.F8L		NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	8							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCGCCGTCGAAGCGGTCCAGC	0.557																0.25	12.092561	13.001239	4	12	KEEP	---	---	---	---	1	4	5	9	-1	capture	Missense_Mutation	SNP	73673955	73673955	PDZRN3	3	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11612	39
CNTN3	5067	broad.mit.edu	37	3	74535739	74535739	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:74535739G>A	uc003dpm.1	-	3	306	c.226C>T	c.(226-228)CGT>TGT	p.R76C		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	76	Ig-like C2-type 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AACTTATAACGATGTTCCATA	0.353																0.269663	131.521475	140.04176	48	130	KEEP	---	---	---	---	32	21	74	77	-1	capture	Missense_Mutation	SNP	74535739	74535739	CNTN3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3607	39
MCM2	4171	broad.mit.edu	37	3	127318380	127318380	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:127318380G>A	uc003ejp.2	+	2	283	c.226G>A	c.(226-228)GGC>AGC	p.G76S	MCM2_uc011bkm.1_5'UTR|MCM2_uc010hsl.2_RNA	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	76	Interaction with MYST2 (By similarity).				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						CATTGGAGATGGCATGGAAAG	0.567																0.406977	116.209939	116.860089	35	51	KEEP	---	---	---	---	20	16	17	38	-1	capture	Missense_Mutation	SNP	127318380	127318380	MCM2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	9299	39
RUFY3	22902	broad.mit.edu	37	4	71644115	71644115	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71644115T>A	uc003hfq.2	+	8	1449	c.854T>A	c.(853-855)GTA>GAA	p.V285E	RUFY3_uc003hfp.3_Missense_Mutation_p.V345E|RUFY3_uc011cax.1_Missense_Mutation_p.V303E|RUFY3_uc003hfr.2_Missense_Mutation_p.V285E|RUFY3_uc011cay.1_Missense_Mutation_p.V221E	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2	285	Potential.				negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			CAGGCAAAAGTAGATGCATTA	0.313																0.23	58.902153	65.564214	23	77	KEEP	---	---	---	---	17	9	53	42	-1	capture	Missense_Mutation	SNP	71644115	71644115	RUFY3	4	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	13632	39
LARP1B	55132	broad.mit.edu	37	4	128999066	128999066	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:128999066G>C	uc003iga.2	+	4	297	c.166G>C	c.(166-168)GGT>CGT	p.G56R	LARP1B_uc003ifw.1_Missense_Mutation_p.G56R|LARP1B_uc003ifx.2_Missense_Mutation_p.G56R|LARP1B_uc003ify.2_Missense_Mutation_p.G56R|LARP1B_uc003ifz.1_Missense_Mutation_p.G56R	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2	56							RNA binding				0						AAATGGTCCTGGTGAAAACGT	0.343																0.141176	22.637773	33.200043	12	73	KEEP	---	---	---	---	5	11	45	40	-1	capture	Missense_Mutation	SNP	128999066	128999066	LARP1B	4	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	8549	39
PHF17	79960	broad.mit.edu	37	4	129770219	129770219	+	Silent	SNP	C	G	G			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:129770219C>G	uc003igk.2	+	5	661	c.381C>G	c.(379-381)GGC>GGG	p.G127G	PHF17_uc003igj.2_Silent_p.G127G|PHF17_uc003igl.2_Silent_p.G115G|PHF17_uc011cgy.1_Silent_p.G127G|PHF17_uc003igm.2_Silent_p.G127G	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	127					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0						CCGAGTTGGGCTATGTGGACA	0.488																0.025157	-30.83366	8.900316	4	155	KEEP	---	---	---	---	4	0	94	74	-1	capture	Silent	SNP	129770219	129770219	PHF17	4	C	G	G	G	1	0	0	0	0	0	0	0	1	353	28	4	4	11731	39
PCDH18	54510	broad.mit.edu	37	4	138442740	138442740	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:138442740C>G	uc003ihe.3	-	4	3238	c.2851G>C	c.(2851-2853)GGG>CGG	p.G951R	PCDH18_uc003ihf.3_Missense_Mutation_p.G943R|PCDH18_uc011cgz.1_Missense_Mutation_p.G162R|PCDH18_uc003ihg.3_Missense_Mutation_p.G730R|PCDH18_uc011cha.1_Missense_Mutation_p.G131R	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	951	Interaction with DAB1 (By similarity).|Cytoplasmic (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					AATTCTTCCCCTGGAATGAAC	0.532																0.245033	187.874786	205.781687	74	228	KEEP	---	---	---	---	32	50	109	144	-1	capture	Missense_Mutation	SNP	138442740	138442740	PCDH18	4	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	11416	39
CDH18	1016	broad.mit.edu	37	5	19747261	19747261	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19747261C>T	uc003jgc.2	-	3	690	c.313G>A	c.(313-315)GAT>AAT	p.D105N	CDH18_uc003jgd.2_Missense_Mutation_p.D105N|CDH18_uc011cnm.1_Missense_Mutation_p.D105N	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	105	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCCGTGGTATCGTCAATGATA	0.438																0.224852	95.663325	107.416487	38	131	KEEP	---	---	---	---	16	25	75	71	-1	capture	Missense_Mutation	SNP	19747261	19747261	CDH18	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3074	39
ADAMTS12	81792	broad.mit.edu	37	5	33683134	33683134	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33683134C>T	uc003jia.1	-	5	1067	c.904G>A	c.(904-906)GAA>AAA	p.E302K	ADAMTS12_uc010iuq.1_Missense_Mutation_p.E302K	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	302	Poly-Glu.|Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCTTCTTCTTCGAGTAGAATG	0.423													HNSCC(64;0.19)			0.266667	75.854392	81.0168	28	77	KEEP	---	---	---	---	19	15	42	51	-1	capture	Missense_Mutation	SNP	33683134	33683134	ADAMTS12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	257	39
MATR3	9782	broad.mit.edu	37	5	138657666	138657666	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:138657666G>A	uc003ldu.2	+	13	2109	c.1682G>A	c.(1681-1683)GGG>GAG	p.G561E	MATR3_uc010jfb.2_Missense_Mutation_p.G561E|MATR3_uc003ldt.2_Missense_Mutation_p.G223E|MATR3_uc003ldw.2_Missense_Mutation_p.G561E|MATR3_uc003ldx.2_Missense_Mutation_p.G561E|MATR3_uc010jfc.2_Missense_Mutation_p.G561E|MATR3_uc003ldy.2_Missense_Mutation_p.G238E|MATR3_uc011czb.1_Missense_Mutation_p.G273E|MATR3_uc003ldz.2_Missense_Mutation_p.G561E|MATR3_uc003lea.2_Missense_Mutation_p.G561E|MATR3_uc003leb.2_Missense_Mutation_p.G223E|MATR3_uc003lec.2_Missense_Mutation_p.G238E	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3	561	RRM 2.					nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGGTTTCAGGGGAGATGTGTG	0.348																0.284264	159.40381	167.645107	56	141	KEEP	---	---	---	---	28	34	78	87	-1	capture	Missense_Mutation	SNP	138657666	138657666	MATR3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9250	39
PCDHGC3	5098	broad.mit.edu	37	5	140856716	140856716	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140856716G>A	uc003lkv.1	+	1	1148	c.1033G>A	c.(1033-1035)GTG>ATG	p.V345M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lku.1_Missense_Mutation_p.V345M|PCDHGC3_uc003lkw.1_Intron	NM_002588	NP_002579	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3 isoform 1	345	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTGTGGATGTGAATGACAA	0.547																0.242105	53.563399	59.339952	23	72	KEEP	---	---	---	---	12	13	36	41	-1	capture	Missense_Mutation	SNP	140856716	140856716	PCDHGC3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11472	39
EBF1	1879	broad.mit.edu	37	5	158140057	158140057	+	Silent	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:158140057G>A	uc010jip.2	-	13	1592	c.1290C>T	c.(1288-1290)CAC>CAT	p.H430H	EBF1_uc011ddw.1_Silent_p.H298H|EBF1_uc011ddx.1_Silent_p.H431H|EBF1_uc003lxl.3_Silent_p.H399H	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	430					multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCATCCCTGCGTGGACCGAGG	0.557						T	HMGA2	lipoma								0.30719	128.068599	133.139209	47	106	KEEP	---	---	---	---	34	20	65	52	-1	capture	Silent	SNP	158140057	158140057	EBF1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4835	39
FGD2	221472	broad.mit.edu	37	6	36993651	36993651	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36993651C>T	uc010jwp.1	+	14	1713	c.1542C>T	c.(1540-1542)TAC>TAT	p.Y514Y	FGD2_uc003ong.2_Silent_p.Y236Y|FGD2_uc011dtv.1_Silent_p.Y142Y|FGD2_uc003onj.1_Silent_p.Y91Y	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	514	FYVE-type.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						TCCACTGCTACGCATTCCTCA	0.612																0.395062	95.481464	96.262551	32	49	KEEP	---	---	---	---	19	23	32	32	-1	capture	Silent	SNP	36993651	36993651	FGD2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5779	39
REV3L	5980	broad.mit.edu	37	6	111696862	111696862	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111696862A>T	uc003puy.3	-	13	3019	c.2696T>A	c.(2695-2697)TTT>TAT	p.F899Y	REV3L_uc003pux.3_Missense_Mutation_p.F821Y|REV3L_uc003puz.3_Missense_Mutation_p.F821Y	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	899					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TCCATCTCCAAAGTGACAGTC	0.378											DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					0.426752	196.996553	197.731908	67	90	KEEP	---	---	---	---	44	30	55	46	-1	capture	Missense_Mutation	SNP	111696862	111696862	REV3L	6	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	13135	39
DNAH11	8701	broad.mit.edu	37	7	21698496	21698496	+	Silent	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21698496C>T	uc003svc.2	+	30	5221	c.5190C>T	c.(5188-5190)TAC>TAT	p.Y1730Y		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1730	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TAGTGGCCTACGAGGAAAAAC	0.443												Kartagener_syndrome				0.266667	20.385293	21.86148	8	22	KEEP	---	---	---	---	4	5	14	13	-1	capture	Silent	SNP	21698496	21698496	DNAH11	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4557	39
ZAN	7455	broad.mit.edu	37	7	100364655	100364655	+	Silent	SNP	G	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100364655G>T	uc003uwj.2	+	25	4800	c.4635G>T	c.(4633-4635)TCG>TCT	p.S1545S	ZAN_uc003uwk.2_Silent_p.S1545S|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Silent_p.S122S	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1545	Extracellular (Potential).|VWFD 2.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCACAGCCTCGGGTGACCCCC	0.607																0.119565	62.411528	114.617786	44	324	KEEP	---	---	---	---	43	27	168	250	0.614285714286	capture	Silent	SNP	100364655	100364655	ZAN	7	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	17394	39
CUL1	8454	broad.mit.edu	37	7	148457457	148457457	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148457457G>A	uc010lpg.2	+	7	1184	c.658G>A	c.(658-660)GCA>ACA	p.A220T	CUL1_uc003wey.2_Missense_Mutation_p.A220T|CUL1_uc003wez.2_Missense_Mutation_p.A110T	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	220					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGATGCATTTGCAAAGGGCCC	0.338																0.3	227.592788	237.968479	87	203	KEEP	---	---	---	---	52	49	128	106	-1	capture	Missense_Mutation	SNP	148457457	148457457	CUL1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4014	39
CNTLN	54875	broad.mit.edu	37	9	17135249	17135249	+	Silent	SNP	G	A	A			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:17135249G>A	uc003zmz.2	+	1	212	c.186G>A	c.(184-186)GGG>GGA	p.G62G	CNTLN_uc003zmx.3_Silent_p.G62G|CNTLN_uc003zmy.2_Silent_p.G62G|CNTLN_uc003zmw.1_Silent_p.G62G	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	62						centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		GTGAAGAAGGGTCAGGGGGCC	0.672																0.411765	20.527096	20.641113	7	10	KEEP	---	---	---	---	4	4	4	7	-1	capture	Silent	SNP	17135249	17135249	CNTLN	9	G	A	A	A	1	0	0	0	0	0	0	0	1	561	44	2	2	3604	39
TEK	7010	broad.mit.edu	37	9	27229172	27229172	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27229172C>T	uc003zqi.3	+	23	3759	c.3317C>T	c.(3316-3318)ACG>ATG	p.T1106M	TEK_uc011lno.1_Missense_Mutation_p.T1063M|TEK_uc011lnp.1_Missense_Mutation_p.T958M	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	1106	Cytoplasmic (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	p.T1106M(1)		ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		GTGAATACCACGCTTTATGAG	0.453					493											0.266667	167.488998	179.293831	64	176	KEEP	---	---	---	---	44	28	86	119	-1	capture	Missense_Mutation	SNP	27229172	27229172	TEK	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15636	39
NFX1	4799	broad.mit.edu	37	9	33294757	33294757	+	Missense_Mutation	SNP	A	C	C	rs147195056		TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33294757A>C	uc003zsq.2	+	2	426	c.365A>C	c.(364-366)CAG>CCG	p.Q122P	SUGT1P1_uc010mjq.1_Intron|NFX1_uc011lnw.1_Missense_Mutation_p.Q122P|NFX1_uc003zso.2_Missense_Mutation_p.Q122P|NFX1_uc003zsp.1_Missense_Mutation_p.Q122P|NFX1_uc010mjr.1_Missense_Mutation_p.Q122P|NFX1_uc003zsr.2_Missense_Mutation_p.Q122P	NM_002504	NP_002495	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	122					inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		AAGAAAGCACAGAGTCTTGCT	0.483																0.286738	229.281072	240.666395	80	199	KEEP	---	---	---	---	35	51	97	126	-1	capture	Missense_Mutation	SNP	33294757	33294757	NFX1	9	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	10294	39
BTK	695	broad.mit.edu	37	X	100611084	100611084	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100611084C>T	uc004ehg.2	-	15	1715	c.1522G>A	c.(1522-1524)GCC>ACC	p.A508T	BTK_uc004ehf.2_Missense_Mutation_p.A8T|BTK_uc010nnh.2_Intron|BTK_uc010nni.2_Intron|BTK_uc004ehe.2_Intron|BTK_uc010nnj.2_RNA|BTK_uc010nnk.2_Intron|BTK_uc010nnl.2_Intron|BTK_uc010nnm.2_Missense_Mutation_p.A78T|BTK_uc010nnn.2_Intron|BTK_uc010nno.2_Missense_Mutation_p.A542T|BTK_uc004ehh.1_Intron|BTK_uc004ehi.2_Missense_Mutation_p.A508T	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	508	Protein kinase.		A -> D (in XLA).		calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	p.A508T(1)		lung(3)|central_nervous_system(2)|ovary(1)	6						TATTCCATGGCTTCACAGACA	0.547					247							Agammaglobulinemia_X-linked				0.589286	323.440085	324.608029	99	69	KEEP	---	---	---	---	59	53	40	47	-1	capture	Missense_Mutation	SNP	100611084	100611084	BTK	23	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	1545	39
CD1D	912	broad.mit.edu	37	1	158151257	158151257	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158151257delT	uc001frr.2	+	3	573	c.74delT	c.(73-75)CTTfs	p.L25fs	CD1D_uc009wsr.1_Frame_Shift_Del_p.L25fs|CD1D_uc009wss.2_Frame_Shift_Del_p.L25fs|CD1D_uc009wst.1_Intron	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	25	Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					CCGCAAAGGCTTTTCCCCCTC	0.592																0.01			7	936		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	158151257	158151257	CD1D	1	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	2948	39
NF1	4763	broad.mit.edu	37	17	29665808	29665808	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29665808delG	uc002hgg.2	+	46	7239	c.6906delG	c.(6904-6906)CAGfs	p.Q2302fs	NF1_uc002hgh.2_Frame_Shift_Del_p.Q2281fs|NF1_uc010cso.2_Frame_Shift_Del_p.Q490fs|NF1_uc010wbt.1_Intron|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2302					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.Q2302fs*17(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCAAATTACAGCCACTTCTTA	0.333					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.25			39	118		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	29665808	29665808	NF1	17	G	-	-	-	1	0	1	0	1	0	0	0	0	438	34	5	5	10263	39
GNAT3	346562	broad.mit.edu	37	7	80088110	80088110	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0184-01	TCGA-06-0184-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80088110delT	uc011kgu.1	-	8	942	c.942delA	c.(940-942)AAAfs	p.K314fs	CD36_uc003uhc.2_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	314					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						CCTTATCTTCTTTTTTTAAAT	0.328																0.25			14	43		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	80088110	80088110	GNAT3	7	T	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	6449	39
