Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
UBE4B	10277	broad.mit.edu	37	1	10192468	10192468	+	Silent	SNP	C	G	G			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10192468C>G	uc001aqs.3	+	15	2666	c.1953C>G	c.(1951-1953)GGC>GGG	p.G651G	UBE4B_uc001aqr.3_Silent_p.G522G|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Silent_p.G106G|UBE4B_uc001aqt.1_5'UTR	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	651					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TGTTAAATGGCGAAACCCGTG	0.373																0.212121	40.413085	45.468888	14	52	KEEP	---	---	---	---	11	8	26	38	-1	capture	Silent	SNP	10192468	10192468	UBE4B	1	C	G	G	G	1	0	0	0	0	0	0	0	1	340	27	4	4	16765	58
GRIK3	2899	broad.mit.edu	37	1	37307528	37307528	+	Missense_Mutation	SNP	C	T	T	rs114307108	by1000genomes	TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37307528C>T	uc001caz.2	-	10	1474	c.1339G>A	c.(1339-1341)GTC>ATC	p.V447I	GRIK3_uc001cba.1_Missense_Mutation_p.V447I	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	447	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CGAAACATGACGAAGGGCTCC	0.577																0.352227	245.655728	250.410449	87	160	KEEP	---	---	---	---	50	44	84	97	-1	capture	Missense_Mutation	SNP	37307528	37307528	GRIK3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6708	58
C1orf175	374977	broad.mit.edu	37	1	55148429	55148429	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55148429G>A	uc010ooe.1	+	14	2806	c.2482G>A	c.(2482-2484)GTC>ATC	p.V828I	C1orf175_uc001cxq.2_RNA|C1orf175_uc010ooc.1_Missense_Mutation_p.V396I|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Missense_Mutation_p.V346I|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc010oog.1_Missense_Mutation_p.V828I|C1orf175_uc010ooh.1_RNA|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_RNA|C1orf175_uc009vzr.1_Missense_Mutation_p.V30I	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	828						integral to membrane	binding				0						GGAGAAGCCCGTCACCAAGGA	0.622																0.352941	132.155411	134.750661	48	88	KEEP	---	---	---	---	21	28	41	53	-1	capture	Missense_Mutation	SNP	55148429	55148429	C1orf175	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1998	58
COL24A1	255631	broad.mit.edu	37	1	86340334	86340334	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86340334G>A	uc001dlj.2	-	35	3178	c.3136C>T	c.(3136-3138)CGG>TGG	p.R1046W	COL24A1_uc001dli.2_Missense_Mutation_p.R182W|COL24A1_uc010osd.1_Missense_Mutation_p.R346W|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1046	Collagen-like 9.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		GCACTCACCCGTAAACCTGGT	0.408																0.169014	22.856536	30.220082	12	59	KEEP	---	---	---	---	7	9	35	31	-1	capture	Missense_Mutation	SNP	86340334	86340334	COL24A1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	3648	58
CFHR4	10877	broad.mit.edu	37	1	196884116	196884116	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196884116C>A	uc001gto.2	+	5	716	c.647C>A	c.(646-648)CCT>CAT	p.P216H	CFHR4_uc009wyy.2_Missense_Mutation_p.P462H|CFHR4_uc001gtp.2_Missense_Mutation_p.P463H	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	216	Sushi 4.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						CCTCCTCCACCTATTAGCAAT	0.378																0.271318	91.562451	97.649411	35	94	KEEP	---	---	---	---	44	39	113	131	0.469879518072	capture	Missense_Mutation	SNP	196884116	196884116	CFHR4	1	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	3253	58
CENPF	1063	broad.mit.edu	37	1	214815836	214815836	+	Silent	SNP	C	T	T	rs139914723	by1000genomes	TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214815836C>T	uc001hkm.2	+	12	4329	c.4155C>T	c.(4153-4155)GAC>GAT	p.D1385D		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CTCCATTGGACGAGAGTAATT	0.423	Colon(80;575 1284 11000 14801 43496)															0.340426	89.169375	91.285979	32	62	KEEP	---	---	---	---	14	22	34	38	-1	capture	Silent	SNP	214815836	214815836	CENPF	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3199	58
RBP3	5949	broad.mit.edu	37	10	48389546	48389546	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48389546G>A	uc001jez.2	-	1	1446	c.1332C>T	c.(1330-1332)TTC>TTT	p.F444F		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	444	4 X approximate tandem repeats.|2.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	CAAAACTATCGAAGCGCAGGT	0.617																0.425926	67.915023	68.173709	23	31	KEEP	---	---	---	---	10	15	16	19	-1	capture	Silent	SNP	48389546	48389546	RBP3	10	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	13052	58
CTBP2	1488	broad.mit.edu	37	10	126691658	126691658	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:126691658C>T	uc009yak.2	-	5	516	c.229G>A	c.(229-231)GTG>ATG	p.V77M	CTBP2_uc009yal.2_Missense_Mutation_p.V77M|CTBP2_uc001lif.3_Missense_Mutation_p.V77M|CTBP2_uc001lih.3_Missense_Mutation_p.V77M|CTBP2_uc001lid.3_Missense_Mutation_p.V145M|CTBP2_uc001lie.3_Missense_Mutation_p.V617M	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1	77					negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		ATGGCGCCCACGGCTTCGTTT	0.627					463											0.42029	86.563015	86.945638	29	40	KEEP	---	---	---	---	15	20	25	22	-1	capture	Missense_Mutation	SNP	126691658	126691658	CTBP2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3962	58
OR5M9	390162	broad.mit.edu	37	11	56230656	56230656	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56230656G>A	uc010rjj.1	-	1	222	c.222C>T	c.(220-222)AAC>AAT	p.N74N		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	74	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					TGGGGGTAACGTTGGAGGAGA	0.438																0.316456	68.646714	71.013473	25	54	KEEP	---	---	---	---	11	15	27	32	-1	capture	Silent	SNP	56230656	56230656	OR5M9	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11081	58
B4GALNT3	283358	broad.mit.edu	37	12	657400	657400	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:657400C>T	uc001qii.1	+	9	790	c.790C>T	c.(790-792)CGA>TGA	p.R264*	B4GALNT3_uc001qij.1_Nonsense_Mutation_p.R166*	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	264	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CTTCCAGTGGCGACGGAACGA	0.582																0.305556	84.428702	88.074334	33	75	KEEP	---	---	---	---	22	13	48	45	-1	capture	Nonsense_Mutation	SNP	657400	657400	B4GALNT3	12	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	1257	58
CHD4	1108	broad.mit.edu	37	12	6691851	6691851	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6691851G>A	uc001qpn.2	-	28	4357	c.4279C>T	c.(4279-4281)CCA>TCA	p.P1427S	CHD4_uc001qpo.2_Missense_Mutation_p.P1434S|CHD4_uc001qpp.2_Missense_Mutation_p.P1459S|uc001qpq.1_Nonsense_Mutation_p.W18*|SCARNA11_uc001qpr.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1434					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TCCTGAGGTGGCATACCATAT	0.473	Colon(32;586 792 4568 16848 45314)															0.017668	-66.754183	7.496776	5	278	KEEP	---	---	---	---	5	1	165	194	-1	capture	Missense_Mutation	SNP	6691851	6691851	CHD4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3293	58
PIK3C2G	5288	broad.mit.edu	37	12	18716419	18716419	+	Silent	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18716419C>T	uc001rdt.2	+	27	3882	c.3766C>T	c.(3766-3768)CTG>TTG	p.L1256L	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Silent_p.L1297L|PIK3C2G_uc010sic.1_Silent_p.L1075L	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1256	PX.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				GTTTGCATCACTGACTCTCCC	0.398					655											0.033333	-14.75922	6.621846	3	87	KEEP	---	---	---	---	0	3	47	62	-1	capture	Silent	SNP	18716419	18716419	PIK3C2G	12	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	11814	58
PDE3A	5139	broad.mit.edu	37	12	20522696	20522696	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:20522696G>A	uc001reh.1	+	1	500	c.478G>A	c.(478-480)GCT>ACT	p.A160T		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	160	Helical; (Potential).				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	CCTGCCTCTGGCTGTCGCGCT	0.701																0.314286	29.208357	30.284771	11	24	KEEP	---	---	---	---	6	17	30	20	-1	capture	Missense_Mutation	SNP	20522696	20522696	PDE3A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11540	58
C12orf12	196477	broad.mit.edu	37	12	91348191	91348191	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91348191C>T	uc001tbj.2	-	1	763	c.329G>A	c.(328-330)CGG>CAG	p.R110Q		NM_152638	NP_689851	Q8TC90	CL012_HUMAN	hypothetical protein LOC196477	110										central_nervous_system(1)|pancreas(1)	2						GCCATACACCCGAAACACTTG	0.647																0.236842	21.655999	24.061807	9	29	KEEP	---	---	---	---	3	6	24	17	-1	capture	Missense_Mutation	SNP	91348191	91348191	C12orf12	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1662	58
BTBD11	121551	broad.mit.edu	37	12	108013833	108013833	+	Silent	SNP	C	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108013833C>A	uc001tmk.1	+	11	3044	c.2523C>A	c.(2521-2523)CTC>CTA	p.L841L	BTBD11_uc009zut.1_Silent_p.L722L|BTBD11_uc001tmj.2_Silent_p.L841L|BTBD11_uc001tml.1_Silent_p.L378L	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	841	ANK 5.					integral to membrane	DNA binding			skin(2)|ovary(1)	3						GCAGGCCTCTCATCCAGTGCT	0.507																0.310811	57.185944	59.552074	23	51	KEEP	---	---	---	---	12	12	31	27	0.5	capture	Silent	SNP	108013833	108013833	BTBD11	12	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	1527	58
FAM48A	55578	broad.mit.edu	37	13	37607599	37607599	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:37607599G>A	uc001uwg.2	-	10	942	c.694C>T	c.(694-696)CGC>TGC	p.R232C	FAM48A_uc010abt.2_Missense_Mutation_p.R233C|FAM48A_uc001uwh.2_Missense_Mutation_p.R233C|FAM48A_uc001uwi.2_Missense_Mutation_p.R232C|FAM48A_uc001uwj.2_Missense_Mutation_p.R233C|FAM48A_uc001uwk.2_Missense_Mutation_p.R232C|FAM48A_uc010tes.1_Missense_Mutation_p.R220C|FAM48A_uc001uwl.1_Missense_Mutation_p.R232C	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A	232					autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		TTCATTGGGCGAGTGTTCATC	0.428																0.357542	372.596036	378.996855	128	230	KEEP	---	---	---	---	74	75	133	144	-1	capture	Missense_Mutation	SNP	37607599	37607599	FAM48A	13	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5520	58
MDP1	145553	broad.mit.edu	37	14	24683351	24683351	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24683351G>A	uc001wnl.1	-	6	490	c.410C>T	c.(409-411)ACC>ATC	p.T137I	TM9SF1_uc010tob.1_5'UTR|CHMP4A_uc001wni.2_5'Flank|CHMP4A_uc010toc.1_RNA|CHMP4A_uc001wnj.2_5'UTR|MDP1_uc001wnk.1_3'UTR|CHMP4A_uc001wnm.1_Silent_p.Y90Y	NM_138476	NP_612485	Q86V88	MGDP1_HUMAN	magnesium-dependent phosphatase 1	137							metal ion binding|protein tyrosine phosphatase activity				0						GTGAATGCAGGTAACACCTAG	0.433																0.443709	202.297042	202.715096	67	84	KEEP	---	---	---	---	43	34	47	47	-1	capture	Missense_Mutation	SNP	24683351	24683351	MDP1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9329	58
RBM25	58517	broad.mit.edu	37	14	73578261	73578261	+	Silent	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73578261T>C	uc001xno.2	+	16	2251	c.2043T>C	c.(2041-2043)CCT>CCC	p.P681P	RBM25_uc010ttu.1_Silent_p.P681P|RBM25_uc001xnp.2_Silent_p.P476P	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	681					apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		CTGGTCAGCCTAATTCTGTGA	0.388																0.021583	-28.20159	7.346833	3	136	KEEP	---	---	---	---	4	1	73	85	-1	capture	Silent	SNP	73578261	73578261	RBM25	14	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	13020	58
EML5	161436	broad.mit.edu	37	14	89084607	89084607	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:89084607G>A	uc001xxg.2	-	41	5793	c.5607C>T	c.(5605-5607)GCC>GCT	p.A1869A	EML5_uc001xxf.2_Silent_p.A656A|EML5_uc001xxd.2_Silent_p.A34A|EML5_uc001xxe.2_Silent_p.A218A	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	1861						cytoplasm|microtubule				ovary(3)	3						TGTCAATAGCGGCATGATCCA	0.378																0.09434	3.536284	12.296013	5	48	KEEP	---	---	---	---	3	3	33	21	-1	capture	Silent	SNP	89084607	89084607	EML5	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5055	58
SERPINA1	5265	broad.mit.edu	37	14	94847444	94847444	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94847444G>A	uc001ycx.3	-	3	942	c.681C>T	c.(679-681)ACC>ACT	p.T227T	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Silent_p.T227T|SERPINA1_uc010aux.2_Silent_p.T227T|SERPINA1_uc001ycy.3_Silent_p.T227T|SERPINA1_uc010auy.2_Silent_p.T227T|SERPINA1_uc001ycz.3_Silent_p.T227T|SERPINA1_uc010auz.2_Silent_p.T227T|SERPINA1_uc010ava.2_Silent_p.T227T|SERPINA1_uc001ydb.3_Silent_p.T227T|SERPINA1_uc010avb.2_Silent_p.T227T|SERPINA1_uc001ydc.3_Silent_p.T227T|SERPINA1_uc001yda.1_Silent_p.T227T	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	227					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	CCTCTTCCTCGGTGTCCTTGA	0.517												Alpha-1-Antitrypsin_Deficiency				0.609756	84.283038	84.715577	25	16	KEEP	---	---	---	---	10	17	7	11	-1	capture	Silent	SNP	94847444	94847444	SERPINA1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13979	58
HHIPL1	84439	broad.mit.edu	37	14	100118715	100118715	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100118715C>T	uc010avs.2	+	2	475	c.410C>T	c.(409-411)GCG>GTG	p.A137V	HHIPL1_uc001ygl.1_Missense_Mutation_p.A137V	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a	137					carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				GAGCTCTGGGCGCTGGAGGGC	0.602																0.478873	97.642348	97.670007	34	37	KEEP	---	---	---	---	14	21	24	15	-1	capture	Missense_Mutation	SNP	100118715	100118715	HHIPL1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7018	58
EIF2AK4	440275	broad.mit.edu	37	15	40247830	40247830	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40247830G>T	uc001zkm.1	+	6	654	c.604G>T	c.(604-606)GAA>TAA	p.E202*	EIF2AK4_uc001zkl.2_Nonsense_Mutation_p.E202*|EIF2AK4_uc010bbj.1_5'UTR	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	202					translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GGAACGTTTGGAAATTGCTAG	0.378					876											0.210526	59.519454	69.836248	28	105	KEEP	---	---	---	---	17	13	56	57	0.566666666667	capture	Nonsense_Mutation	SNP	40247830	40247830	EIF2AK4	15	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	4954	58
SPTBN5	51332	broad.mit.edu	37	15	42167085	42167085	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42167085G>A	uc001zos.2	-	23	4685	c.4352C>T	c.(4351-4353)GCC>GTC	p.A1451V		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1486	Spectrin 11.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CGGGGAGGCGGCCATGCCATG	0.632																0.046875	-7.627042	6.375763	3	61	KEEP	---	---	---	---	2	1	36	46	-1	capture	Missense_Mutation	SNP	42167085	42167085	SPTBN5	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15014	58
PIAS1	8554	broad.mit.edu	37	15	68468841	68468841	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:68468841G>T	uc002aqz.2	+	11	1426	c.1330G>T	c.(1330-1332)GTA>TTA	p.V444L	PIAS1_uc002ara.2_Missense_Mutation_p.V52L	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	444					androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						GGAGCATCAGGTAGCGTCTCA	0.423																0.277457	132.136525	139.839731	48	125	KEEP	---	---	---	---	32	22	62	80	0.592592592593	capture	Missense_Mutation	SNP	68468841	68468841	PIAS1	15	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11778	58
C15orf58	390637	broad.mit.edu	37	15	90784827	90784827	+	Silent	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90784827C>T	uc002bpc.2	+	4	866	c.687C>T	c.(685-687)CCC>CCT	p.P229P		NM_001013657	NP_001013679	Q6ZNW5	VTC2_HUMAN	hypothetical protein LOC390637	229					glucose metabolic process	cytoplasm	GDP-D-glucose phosphorylase activity				0						ACAGACTGCCCGTGGAGCAGG	0.637																0.375	75.494889	76.447651	27	45	KEEP	---	---	---	---	18	12	28	27	-1	capture	Silent	SNP	90784827	90784827	C15orf58	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1792	58
CDYL2	124359	broad.mit.edu	37	16	80718568	80718568	+	Silent	SNP	G	A	A	rs149557557		TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:80718568G>A	uc002ffs.2	-	2	588	c.483C>T	c.(481-483)GCC>GCT	p.A161A		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	161						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						TCTCAGAGCCGGCGTCCCCAT	0.512																0.232432	108.442211	120.561499	43	142	KEEP	---	---	---	---	29	20	65	87	-1	capture	Silent	SNP	80718568	80718568	CDYL2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3155	58
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	C	C	rs121912666		TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578190T>C	uc002gim.2	-	6	853	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	TP53_uc002gig.1_Missense_Mutation_p.Y220C|TP53_uc002gih.2_Missense_Mutation_p.Y220C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y88C|TP53_uc010cng.1_Missense_Mutation_p.Y88C|TP53_uc002gii.1_Missense_Mutation_p.Y88C|TP53_uc010cnh.1_Missense_Mutation_p.Y220C|TP53_uc010cni.1_Missense_Mutation_p.Y220C|TP53_uc002gij.2_Missense_Mutation_p.Y220C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y127C|TP53_uc002gio.2_Missense_Mutation_p.Y88C|TP53_uc010vug.1_Missense_Mutation_p.Y181C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	220	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y220C(205)|p.Y220N(12)|p.Y220H(9)|p.Y220S(9)|p.0?(7)|p.Y220fs*27(4)|p.Y220*(3)|p.Y220D(2)|p.Y127C(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.?(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*1(1)|p.Y220fs*2(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGCGGCTCATAGGGCACCAC	0.557	Pancreas(47;798 1329 9957 10801)		111	p.Y220C(HCC2935-Tumor)|p.Y220C(BXPC3-Tumor)|p.Y220C(HCC366-Tumor)|p.Y220C(TE8-Tumor)|p.Y220C(NUGC3-Tumor)|p.Y220C(HUH7-Tumor)|p.Y220C(COV362-Tumor)|p.Y220C(HCC1419-Tumor)|p.Y220C(MFE319-Tumor)|p.Y220C(T3M4-Tumor)|p.Y220C(NCIH2342-Tumor)|p.Y220C(MFE296-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.316667	59.106059	60.89801	19	41	KEEP	---	---	---	---	9	12	23	22	-1	capture	Missense_Mutation	SNP	7578190	7578190	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	16264	58
ABCA10	10349	broad.mit.edu	37	17	67148603	67148603	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67148603C>T	uc010dfa.1	-	36	5035	c.4156G>A	c.(4156-4158)GTT>ATT	p.V1386I	ABCA10_uc002jhz.2_5'Flank|ABCA10_uc010wqs.1_Missense_Mutation_p.V378I|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	1386	ABC transporter 2.				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TTGTTTTTAACGGTAGCCTGA	0.423																0.141304	18.815389	30.234582	13	79	KEEP	---	---	---	---	11	5	49	49	-1	capture	Missense_Mutation	SNP	67148603	67148603	ABCA10	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	29	58
MYOM1	8736	broad.mit.edu	37	18	3134669	3134669	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:3134669T>C	uc002klp.2	-	16	2697	c.2363A>G	c.(2362-2364)AAC>AGC	p.N788S	MYOM1_uc002klq.2_Missense_Mutation_p.N788S	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	788	Fibronectin type-III 3.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CACGGGGTTGTTGTTACAGGG	0.577																0.235294	28.962508	32.244404	12	39	KEEP	---	---	---	---	5	7	24	16	-1	capture	Missense_Mutation	SNP	3134669	3134669	MYOM1	18	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	10001	58
CDH7	1005	broad.mit.edu	37	18	63477003	63477003	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:63477003A>G	uc002ljz.2	+	3	599	c.274A>G	c.(274-276)AGT>GGT	p.S92G	CDH7_uc002lka.2_Missense_Mutation_p.S92G|CDH7_uc002lkb.2_Missense_Mutation_p.S92G	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	92	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				CGAAGGGGCAAGTTCCATTTT	0.448																0.134752	35.823643	54.064576	19	122	KEEP	---	---	---	---	11	11	74	64	-1	capture	Missense_Mutation	SNP	63477003	63477003	CDH7	18	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	3086	58
REXO1	57455	broad.mit.edu	37	19	1816329	1816329	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1816329C>T	uc002lua.3	-	15	3567	c.3472G>A	c.(3472-3474)GTG>ATG	p.V1158M	REXO1_uc010dsq.2_Missense_Mutation_p.V467M|REXO1_uc010xgs.1_Missense_Mutation_p.V144M|MIR1909_hsa-mir-1909|MI0008330_5'Flank	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	1158	Exonuclease.					nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGTCCACCACGGTGCTGTGG	0.682																0.333333	8.121843	8.343327	3	6	KEEP	---	---	---	---	2	1	2	5	-1	capture	Missense_Mutation	SNP	1816329	1816329	REXO1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13136	58
OR2Z1	284383	broad.mit.edu	37	19	8841802	8841802	+	Missense_Mutation	SNP	C	T	T	rs58741481	byFrequency;by1000genomes	TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8841802C>T	uc010xkg.1	+	1	412	c.412C>T	c.(412-414)CGC>TGC	p.R138C		NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2						ACTTATGAGACGCCAGGTATG	0.557																0.286408	154.334564	162.769834	59	147	KEEP	---	---	---	---	27	40	109	71	-1	capture	Missense_Mutation	SNP	8841802	8841802	OR2Z1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10940	58
SARS2	54938	broad.mit.edu	37	19	39408375	39408375	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39408375G>A	uc002oka.2	-	12	1309	c.1149C>T	c.(1147-1149)GGC>GGT	p.G383G	SARS2_uc002ojz.2_Silent_p.G193G|SARS2_uc010xup.1_Silent_p.G385G|SARS2_uc002okb.2_Silent_p.G383G|SARS2_uc010xuq.1_Silent_p.G383G|SARS2_uc010xur.1_RNA	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	383					seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGAAGTGCAAGCCCAGCTCTG	0.627																0.317829	111.283988	115.115913	41	88	KEEP	---	---	---	---	18	27	42	60	-1	capture	Silent	SNP	39408375	39408375	SARS2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	431	34	2	2	13737	58
IL4I1	259307	broad.mit.edu	37	19	50397588	50397588	+	Silent	SNP	G	A	A	rs145616852	byFrequency	TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50397588G>A	uc002pqt.1	-	5	582	c.504C>T	c.(502-504)TAC>TAT	p.Y168Y	IL4I1_uc002pqv.1_Silent_p.Y177Y|IL4I1_uc010eno.1_Silent_p.Y176Y|IL4I1_uc002pqw.1_Silent_p.Y176Y|IL4I1_uc002pqu.1_Silent_p.Y190Y	NM_152899	NP_690863	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1 isoform 1 precursor	168						lysosome	L-amino-acid oxidase activity			lung(1)|ovary(1)|prostate(1)	3		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)		GACGCAAGGCGTAGCCCAGCT	0.602																0.329114	72.826793	74.870062	26	53	KEEP	---	---	---	---	18	11	32	24	-1	capture	Silent	SNP	50397588	50397588	IL4I1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7620	58
ZNF667	63934	broad.mit.edu	37	19	56953533	56953533	+	Silent	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56953533T>C	uc002qnd.2	-	5	993	c.831A>G	c.(829-831)GGA>GGG	p.G277G	ZNF667_uc010etl.2_Silent_p.G59G|ZNF667_uc002qne.2_Silent_p.G277G|ZNF667_uc010etm.2_Silent_p.G220G	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667	277					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GTGTTTTCTTTCCATTGTGAA	0.348																0.02439	-32.145402	9.045485	4	160	KEEP	---	---	---	---	1	3	73	100	-1	capture	Silent	SNP	56953533	56953533	ZNF667	19	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	17952	58
ZNF134	7693	broad.mit.edu	37	19	58131796	58131796	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58131796G>A	uc002qpn.2	+	3	408	c.309G>A	c.(307-309)GAG>GAA	p.E103E	ZNF134_uc002qpo.2_5'UTR|ZNF211_uc010yhb.1_5'UTR	NM_003435	NP_003426	P52741	ZN134_HUMAN	zinc finger protein 134	103						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACAGTATAGAGCAACCCTTAA	0.458																0.034483	-20.107543	7.260808	4	112	KEEP	---	---	---	---	2	2	58	64	-1	capture	Silent	SNP	58131796	58131796	ZNF134	19	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	17604	58
GKN1	56287	broad.mit.edu	37	2	69207121	69207121	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69207121T>A	uc002sfc.2	+	5	497	c.434T>A	c.(433-435)CTG>CAG	p.L145Q		NM_019617	NP_062563	Q9NS71	GKN1_HUMAN	18 kDa antrum mucosa protein precursor	145	BRICHOS.				digestion|positive regulation of cell division	extracellular region				breast(1)	1						GTCGATGACCTGAGCAAGTTC	0.502																0.316456	148.4958	153.22791	50	108	KEEP	---	---	---	---	26	26	56	63	-1	capture	Missense_Mutation	SNP	69207121	69207121	GKN1	2	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	6360	58
FAM123C	205147	broad.mit.edu	37	2	131520943	131520943	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131520943C>A	uc002trw.2	+	2	1488	c.1298C>A	c.(1297-1299)CCT>CAT	p.P433H	FAM123C_uc010fmv.2_Missense_Mutation_p.P433H|FAM123C_uc010fms.1_Missense_Mutation_p.P433H|FAM123C_uc010fmt.1_Missense_Mutation_p.P433H|FAM123C_uc010fmu.1_Missense_Mutation_p.P433H	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	433										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		AGCGAGGGTCCTCTTGGCCCC	0.657																0.31	81.784356	85.002483	31	69	KEEP	---	---	---	---	18	19	32	43	0.513513513514	capture	Missense_Mutation	SNP	131520943	131520943	FAM123C	2	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	5378	58
C20orf71	128861	broad.mit.edu	37	20	31814297	31814297	+	Splice_Site	SNP	G	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31814297G>T	uc002wyr.2	+	5	829	c.621_splice	c.e5+1	p.Q207_splice	C20orf71_uc002wys.2_Splice_Site_p.Q171_splice	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium							extracellular region	lipid binding			ovary(1)|skin(1)	2						AGAAAGTCAGGTAAGTTTAGA	0.348																0.271845	80.05217	84.887505	28	75	KEEP	---	---	---	---	12	19	43	40	0.387096774194	capture	Splice_Site	SNP	31814297	31814297	C20orf71	20	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	2098	58
PTPRT	11122	broad.mit.edu	37	20	41306674	41306674	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:41306674T>C	uc002xkg.2	-	7	1169	c.985A>G	c.(985-987)ACC>GCC	p.T329A	PTPRT_uc010ggj.2_Missense_Mutation_p.T329A	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	329	Extracellular (Potential).|Fibronectin type-III 1.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CCTGTGGTGGTGCGATATTCC	0.557					646											0.264368	112.3714	121.106533	46	128	KEEP	---	---	---	---	18	31	63	77	-1	capture	Missense_Mutation	SNP	41306674	41306674	PTPRT	20	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	12707	58
OLIG2	10215	broad.mit.edu	37	21	34399532	34399532	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34399532T>A	uc002yqx.1	+	2	520	c.362T>A	c.(361-363)ATG>AAG	p.M121K		NM_005806	NP_005797	Q13516	OLIG2_HUMAN	oligodendrocyte lineage transcription factor 2	121	Helix-loop-helix motif.					cytoplasm|nucleus|plasma membrane	DNA binding			central_nervous_system(2)	2						CGCAAGCGCATGCACGACCTC	0.622					15	T	TRA@	T-ALL								0.294118	14.669115	15.313484	5	12	KEEP	---	---	---	---	2	4	8	7	-1	capture	Missense_Mutation	SNP	34399532	34399532	OLIG2	21	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	10765	58
COL6A2	1292	broad.mit.edu	37	21	47544566	47544566	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47544566C>T	uc002zia.1	+	22	1755	c.1673C>T	c.(1672-1674)GCG>GTG	p.A558V	COL6A2_uc002zhy.1_Missense_Mutation_p.A558V|COL6A2_uc002zhz.1_Missense_Mutation_p.A558V|COL6A2_uc002zib.1_5'UTR|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	558	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	p.A558V(1)		central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCTTCTCAGGCGGATCCTGGT	0.672																0.2	43.342614	51.714009	20	80	KEEP	---	---	---	---	7	16	48	45	-1	capture	Missense_Mutation	SNP	47544566	47544566	COL6A2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3665	58
LRIG1	26018	broad.mit.edu	37	3	66449417	66449417	+	Silent	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:66449417C>T	uc003dmx.2	-	10	1223	c.1209G>A	c.(1207-1209)TCG>TCA	p.S403S	LRIG1_uc011bfu.1_Silent_p.S23S|LRIG1_uc003dmw.2_Silent_p.S69S|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Silent_p.S427S	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	403	Extracellular (Potential).|LRR 14.					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CTTCCAGCCCCGAGAATGCTC	0.522																0.275862	42.899034	45.507597	16	42	KEEP	---	---	---	---	10	12	25	29	-1	capture	Silent	SNP	66449417	66449417	LRIG1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8860	58
DRD5	1816	broad.mit.edu	37	4	9784011	9784011	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784011G>A	uc003gmb.3	+	1	754	c.358G>A	c.(358-360)GAC>AAC	p.D120N		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	120	Helical; Name=3; (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GGTGGCCTTCGACATCATGTG	0.617																0.308824	55.149482	57.364464	21	47	KEEP	---	---	---	---	11	10	25	25	-1	capture	Missense_Mutation	SNP	9784011	9784011	DRD5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4715	58
KIT	3815	broad.mit.edu	37	4	55561758	55561758	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55561758G>A	uc010igr.2	+	2	235	c.148G>A	c.(148-150)GTG>ATG	p.V50M	KIT_uc010igs.2_Missense_Mutation_p.V50M	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	50	Extracellular (Potential).|Ig-like C2-type 1.				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	p.V50M(1)		soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATAGTCCGCGTGGGCGACGA	0.468			1		431	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				0.35514	105.422229	107.39956	38	69	KEEP	---	---	---	---	19	23	36	39	-1	capture	Missense_Mutation	SNP	55561758	55561758	KIT	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8250	58
SLC4A4	8671	broad.mit.edu	37	4	72338689	72338689	+	Splice_Site	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72338689T>C	uc003hfy.2	+	14	2020	c.1903_splice	c.e14+2	p.A635_splice	SLC4A4_uc010iic.2_Splice_Site_p.A635_splice|SLC4A4_uc010iib.2_Splice_Site_p.A635_splice|SLC4A4_uc003hfz.2_Splice_Site_p.A635_splice|SLC4A4_uc003hgc.3_Splice_Site_p.A591_splice|SLC4A4_uc010iid.2_Intron|SLC4A4_uc003hga.2_Silent_p.G513G|SLC4A4_uc003hgb.3_Silent_p.G591G	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CTGACCCAGGTGAGGGCATTA	0.463																0.042254	-29.807821	18.118437	9	204	KEEP	---	---	---	---	5	6	117	119	-1	capture	Splice_Site	SNP	72338689	72338689	SLC4A4	4	T	C	C	C	1	0	0	0	0	0	0	1	0	767	59	5	3	14548	58
NUDT9	53343	broad.mit.edu	37	4	88362984	88362984	+	Silent	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88362984T>C	uc003hqq.2	+	4	770	c.447T>C	c.(445-447)AAT>AAC	p.N149N	NUDT9_uc003hqr.2_Silent_p.N99N|NUDT9_uc010ikl.2_Silent_p.N117N	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a	149						mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TTTCCAGAAATCCTGCAGGAC	0.418																0.191489	23.05169	27.227397	9	38	KEEP	---	---	---	---	4	5	25	21	-1	capture	Silent	SNP	88362984	88362984	NUDT9	4	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	10653	58
PRDM9	56979	broad.mit.edu	37	5	23524499	23524499	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23524499A>T	uc003jgo.2	+	10	1189	c.1007A>T	c.(1006-1008)CAC>CTC	p.H336L		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	336	SET.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						TTCCAGTACCACAGGCAGATC	0.537													HNSCC(3;0.000094)			0.348485	67.407699	68.743663	23	43	KEEP	---	---	---	---	17	17	37	50	-1	capture	Missense_Mutation	SNP	23524499	23524499	PRDM9	5	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	12359	58
CDH9	1007	broad.mit.edu	37	5	26906907	26906907	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26906907G>A	uc003jgs.1	-	4	733	c.564C>T	c.(562-564)GAC>GAT	p.D188D	CDH9_uc010iug.2_Silent_p.D188D	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	188	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CATAGTTGGCGTCATCTGCAT	0.403	Melanoma(8;187 585 15745 40864 52829)															0.318841	59.926002	61.938327	22	47	KEEP	---	---	---	---	13	11	25	27	-1	capture	Silent	SNP	26906907	26906907	CDH9	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3088	58
FBN2	2201	broad.mit.edu	37	5	127712445	127712445	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127712445G>C	uc003kuu.2	-	14	2390	c.1951C>G	c.(1951-1953)CCA>GCA	p.P651A	FBN2_uc003kuv.2_Missense_Mutation_p.P618A	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	651	EGF-like 9; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGCCCATTTGGAGCCAAGACA	0.398					1552											0.290323	175.173709	182.501058	54	132	KEEP	---	---	---	---	32	27	81	79	-1	capture	Missense_Mutation	SNP	127712445	127712445	FBN2	5	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	5649	58
PCDHB11	56125	broad.mit.edu	37	5	140580521	140580521	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140580521G>A	uc003liy.2	+	1	1174	c.1174G>A	c.(1174-1176)GTG>ATG	p.V392M	PCDHB11_uc011daj.1_Missense_Mutation_p.V27M	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	392	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTCCCATTCGTGCTAAAATC	0.453																0.306306	183.51452	190.943181	68	154	KEEP	---	---	---	---	34	42	84	85	-1	capture	Missense_Mutation	SNP	140580521	140580521	PCDHB11	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11439	58
PRSS16	10279	broad.mit.edu	37	6	27219612	27219612	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27219612G>A	uc003nja.2	+	8	813	c.801G>A	c.(799-801)ACG>ACA	p.T267T	PRSS16_uc011dkt.1_Intron|PRSS16_uc003njb.2_Intron|PRSS16_uc010jqq.1_Intron|PRSS16_uc010jqr.1_Intron|PRSS16_uc003njc.1_Intron|PRSS16_uc003njd.2_RNA	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	267					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						CATTGCGGACGGAGCTGAGCG	0.697	NSCLC(178;1118 2105 17078 23587 44429)															0.121212	9.65573	18.93625	8	58	KEEP	---	---	---	---	4	6	30	32	-1	capture	Silent	SNP	27219612	27219612	PRSS16	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	12511	58
KCNK5	8645	broad.mit.edu	37	6	39162433	39162433	+	Silent	SNP	G	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39162433G>T	uc003oon.2	-	3	766	c.402C>A	c.(400-402)GGC>GGA	p.G134G		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	134	Cytoplasmic (Potential).				excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						CGAAGAACTTGCCCAGGGCAC	0.597																0.032432	-32.515235	11.676183	6	179	KEEP	---	---	---	---	2	5	89	113	0.285714285714	capture	Silent	SNP	39162433	39162433	KCNK5	6	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	7991	58
HTR1E	3354	broad.mit.edu	37	6	87725488	87725488	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87725488G>A	uc003pli.2	+	2	1139	c.436G>A	c.(436-438)GTC>ATC	p.V146I		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	146	Helical; Name=4; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	GATCCTTACCGTCTGGACCAT	0.582																0.15	43.51045	64.65204	27	153	KEEP	---	---	---	---	17	11	79	90	-1	capture	Missense_Mutation	SNP	87725488	87725488	HTR1E	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7364	58
PTPRK	5796	broad.mit.edu	37	6	128319982	128319982	+	Silent	SNP	C	T	T	rs141454620	by1000genomes	TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:128319982C>T	uc003qbk.2	-	16	2926	c.2559G>A	c.(2557-2559)GGG>GGA	p.G853G	PTPRK_uc003qbj.2_Silent_p.G854G|PTPRK_uc010kfc.2_Silent_p.G854G|PTPRK_uc011ebu.1_Silent_p.G870G|PTPRK_uc010kfd.1_Silent_p.G79G	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	853	Cytoplasmic (Potential).				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GGGATTCCGTCCCCTCACAGA	0.478																0.336634	97.324013	99.705939	34	67	KEEP	---	---	---	---	12	22	34	41	-1	capture	Silent	SNP	128319982	128319982	PTPRK	6	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	12700	58
SKAP2	8935	broad.mit.edu	37	7	26766511	26766511	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:26766511C>T	uc003syc.2	-	7	877	c.584G>A	c.(583-585)CGT>CAT	p.R195H	SKAP2_uc011jzi.1_Missense_Mutation_p.R23H|SKAP2_uc011jzj.1_Missense_Mutation_p.R180H	NM_003930	NP_003921	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	195	PH.				B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1						CTGATATATACGTTTATCAGG	0.303																0.070588	-3.222365	12.948912	6	79	KEEP	---	---	---	---	6	1	48	42	-1	capture	Missense_Mutation	SNP	26766511	26766511	SKAP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14249	58
GRB10	2887	broad.mit.edu	37	7	50660761	50660761	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50660761T>C	uc003tpi.2	-	16	1704	c.1673A>G	c.(1672-1674)GAT>GGT	p.D558G	GRB10_uc003tph.3_Missense_Mutation_p.D500G|GRB10_uc003tpj.2_Missense_Mutation_p.D512G|GRB10_uc003tpk.2_Missense_Mutation_p.D558G|GRB10_uc010kzb.2_Missense_Mutation_p.D500G|GRB10_uc003tpl.2_Missense_Mutation_p.D552G|GRB10_uc003tpm.2_Missense_Mutation_p.D500G|GRB10_uc003tpn.2_Missense_Mutation_p.D500G	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	558	SH2.				insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					GTTCCCGTCATCTAGGCTGAA	0.547												Russell-Silver_syndrome				0.171946	96.12052	118.586822	38	183	KEEP	---	---	---	---	18	22	101	98	-1	capture	Missense_Mutation	SNP	50660761	50660761	GRB10	7	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	6689	58
PCLO	27445	broad.mit.edu	37	7	82544904	82544904	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82544904C>T	uc003uhx.2	-	7	12687	c.12398G>A	c.(12397-12399)CGT>CAT	p.R4133H	PCLO_uc003uhv.2_Missense_Mutation_p.R4133H|PCLO_uc010lec.2_Missense_Mutation_p.R1098H	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4064					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGTCCCTCTACGAAATTCCTG	0.408																0.192308	95.941094	116.629837	45	189	KEEP	---	---	---	---	29	20	102	104	-1	capture	Missense_Mutation	SNP	82544904	82544904	PCLO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11486	58
ABCB4	5244	broad.mit.edu	37	7	87083895	87083895	+	Silent	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87083895C>T	uc003uiv.1	-	5	376	c.300G>A	c.(298-300)TTG>TTA	p.L100L	ABCB4_uc003uiw.1_Silent_p.L100L|ABCB4_uc003uix.1_Silent_p.L100L|ABCB4_uc003uiy.2_Silent_p.L100L	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	100	Extracellular (By similarity).|ABC transmembrane type-1 1.				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					TTAGCAGCGACAAGGAAAAGT	0.234																0.16	12.96379	18.472565	8	42	KEEP	---	---	---	---	3	5	22	28	-1	capture	Silent	SNP	87083895	87083895	ABCB4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	43	58
RELN	5649	broad.mit.edu	37	7	103137114	103137114	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103137114G>A	uc003vca.2	-	56	9212	c.9052C>T	c.(9052-9054)CGA>TGA	p.R3018*	RELN_uc010liz.2_Nonsense_Mutation_p.R3018*	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3018					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGCGAAGTCGAGTTGTGTTG	0.478	NSCLC(146;835 1944 15585 22231 52158)															0.216931	94.173999	108.140139	41	148	KEEP	---	---	---	---	20	22	83	77	-1	capture	Nonsense_Mutation	SNP	103137114	103137114	RELN	7	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	13115	58
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140453136A>T	uc003vwc.3	-	15	1860	c.1799T>A	c.(1798-1800)GTG>GAG	p.V600E		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	600	Protein kinase.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TCGAGATTTCACTGTAGCTAG	0.368	Colon(40;35 892 2973 5743 27438)	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61	p.V600E(G361-Tumor)|p.V600E(HT144-Tumor)|p.V600E(MDAMB361-Tumor)|p.V600E(COLO783-Tumor)|p.V600E(COLO201-Tumor)|p.V600E(8505C-Tumor)|p.V600E(COLO205-Tumor)|p.V600E(A673-Tumor)|p.V600E(WM88-Tumor)|p.V600E(LOXIMVI-Tumor)|p.V600D(WM2664-Tumor)|p.V600K(MDST8-Tumor)|p.V600E(HT29-Tumor)|p.V600E(CL34-Tumor)|p.V600E(COLO818-Tumor)|p.V600E(COLO741-Tumor)|p.V600E(LS411N-Tumor)|p.V600E(SKMEL28-Tumor)|p.V600E(NMCG1-Tumor)|p.V600E(MELHO-Tumor)|p.V600E(WM983B-Tumor)|p.V600E(OUMS23-Tumor)|p.V600E(NCIH854-Tumor)|p.V600E(IGR39-Tumor)|p.V600E(SKHEP1-Tumor)|p.V600E(COLO679-Tumor)|p.V600E(SKMEL5-Tumor)|p.V600E(UACC257-Tumor)|p.V600E(HS695T-Tumor)|p.V600E(A375-Tumor)|p.V600E(MALME3M-Tumor)|p.V600E(AM38-Tumor)|p.V600E(SIGM5-Tumor)|p.V600E(DBTRG05MG-Tumor)|p.V600E(8305C-Tumor)|p.V600E(SKMEL24-Tumor)|p.V600E(WM793-Tumor)|p.V600E(BCPAP-Tumor)|p.V600D(WM115-Tumor)|p.V600E(SNUC5-Tumor)|p.V600E(GCT-Tumor)|p.V600E(ES2-Tumor)|p.V600E(SW1417-Tumor)|p.V600E(MDAMB435S-Tumor)|p.V600E(HS294T-Tumor)|p.V600E(DU4475-Tumor)|p.V600E(C32-Tumor)|p.V600E(A101D-Tumor)|p.V600E(COLO829-Tumor)|p.V600E(SKMEL3-Tumor)|p.V600E(SKMEL1-Tumor)|p.V600E(WM1799-Tumor)|p.V600E(RKO-Tumor)|p.V600E(IGR37-Tumor)|p.V600E(K029AX-Tumor)|p.V600E(JHOM2B-Tumor)|p.V600E(SH4-Tumor)	451	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				0.165854	73.12409	94.832069	34	171	KEEP	---	---	---	---	20	19	91	101	-1	capture	Missense_Mutation	SNP	140453136	140453136	BRAF	7	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	1484	58
WDR86	349136	broad.mit.edu	37	7	151093239	151093239	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151093239G>A	uc003wkb.2	-	3	798	c.349C>T	c.(349-351)CGG>TGG	p.R117W	WDR86_uc003wka.2_Missense_Mutation_p.R75W|WDR86_uc011kvk.1_Missense_Mutation_p.R117W|WDR86_uc003wkc.2_5'UTR	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	WD repeat domain 86	117	WD 3.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGAGCTGTCCGGTCATAGGAG	0.627																0.194631	65.990728	78.9487	29	120	KEEP	---	---	---	---	13	21	66	76	-1	capture	Missense_Mutation	SNP	151093239	151093239	WDR86	7	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	17215	58
RIMS2	9699	broad.mit.edu	37	8	104709403	104709403	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104709403C>T	uc003ylp.2	+	2	405	c.266C>T	c.(265-267)GCG>GTG	p.A89V		NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	120	FYVE-type.|RabBD.				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AAGGGTGATGCGCCAACCTGT	0.438					728								HNSCC(12;0.0054)			0.254717	59.596656	65.372092	27	79	KEEP	---	---	---	---	13	14	48	38	-1	capture	Missense_Mutation	SNP	104709403	104709403	RIMS2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13260	58
PRSS3	5646	broad.mit.edu	37	9	33798043	33798043	+	Silent	SNP	C	T	T			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33798043C>T	uc003ztj.3	+	3	588	c.588C>T	c.(586-588)TGC>TGT	p.C196C	uc003ztk.1_Intron|PRSS3_uc003zti.3_Silent_p.C153C|PRSS3_uc003ztl.3_Silent_p.C139C	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein	196	Peptidase S1.				digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			GCACTGAGTGCCTCATCTCCG	0.567																0.025907	-40.079879	7.937153	5	188	KEEP	---	---	---	---	9	2	127	120	-1	capture	Silent	SNP	33798043	33798043	PRSS3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	12517	58
WNK2	65268	broad.mit.edu	37	9	96080166	96080166	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96080166G>A	uc004ati.1	+	30	6751	c.6751G>A	c.(6751-6753)GGA>AGA	p.G2251R	WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_3'UTR	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2251					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						TGGCGCCCTCGGAACCGCCCG	0.687					1420											0.25	20.485589	22.30294	8	24	KEEP	---	---	---	---	3	6	15	12	-1	capture	Missense_Mutation	SNP	96080166	96080166	WNK2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	495	39	1	1	17259	58
SLC46A2	57864	broad.mit.edu	37	9	115652489	115652489	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115652489G>A	uc004bgk.2	-	1	705	c.473C>T	c.(472-474)GCG>GTG	p.A158V		NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	158	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	symporter activity			central_nervous_system(1)	1						CGATCCCAGCGCCATGACCCC	0.682																0.40625	34.968623	35.214166	13	19	KEEP	---	---	---	---	8	5	9	10	-1	capture	Missense_Mutation	SNP	115652489	115652489	SLC46A2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14537	58
OR1N2	138882	broad.mit.edu	37	9	125316158	125316158	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125316158G>A	uc011lyx.1	+	1	710	c.710G>A	c.(709-711)CGC>CAC	p.R237H		NM_001004457	NP_001004457	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4						TCCTATGTCCGCATTTTCTGG	0.517																0.289231	238.804005	251.75469	94	231	KEEP	---	---	---	---	65	45	128	126	-1	capture	Missense_Mutation	SNP	125316158	125316158	OR1N2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10874	58
COL5A1	1289	broad.mit.edu	37	9	137622156	137622156	+	Silent	SNP	C	T	T	rs138702819	byFrequency	TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137622156C>T	uc004cfe.2	+	7	1381	c.999C>T	c.(997-999)GTC>GTT	p.V333V		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	333	Nonhelical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AAGAGGACGTCGGCATCGGGG	0.622																0.324627	233.837571	241.149813	87	181	KEEP	---	---	---	---	52	43	93	123	-1	capture	Silent	SNP	137622156	137622156	COL5A1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	3661	58
MXRA5	25878	broad.mit.edu	37	X	3229308	3229308	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3229308G>A	uc004crg.3	-	7	7093	c.6936C>T	c.(6934-6936)AAC>AAT	p.N2312N		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2312	Ig-like C2-type 7.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TCCCCACTTCGTTAAAGTAGA	0.547																0.734266	344.132196	351.220411	105	38	KEEP	---	---	---	---	59	55	18	28	-1	capture	Silent	SNP	3229308	3229308	MXRA5	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9913	58
TLR8	51311	broad.mit.edu	37	X	12939911	12939911	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12939911G>A	uc004cve.2	+	2	2820	c.2752G>A	c.(2752-2754)GAG>AAG	p.E918K	TLR8_uc004cvd.2_Missense_Mutation_p.E936K	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8 precursor	918	Cytoplasmic (Potential).|TIR.				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|lung(2)|large_intestine(1)	7						CCTTTGTCTAGAGGAGAGGGA	0.443																0.563025	220.13477	220.545571	67	52	KEEP	---	---	---	---	37	34	28	33	-1	capture	Missense_Mutation	SNP	12939911	12939911	TLR8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	15842	58
OTUD6A	139562	broad.mit.edu	37	X	69282717	69282717	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69282717G>C	uc004dxu.1	+	1	377	c.343G>C	c.(343-345)GCT>CCT	p.A115P		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	115										lung(1)|skin(1)	2						CATCTTCCAGGCTGAGATGTC	0.617																0.5	21.250266	21.250266	6	6	KEEP	---	---	---	---	2	4	4	2	-1	capture	Missense_Mutation	SNP	69282717	69282717	OTUD6A	23	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	11220	58
CXorf57	55086	broad.mit.edu	37	X	105855511	105855511	+	Silent	SNP	G	A	A			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105855511G>A	uc004emi.3	+	1	352	c.201G>A	c.(199-201)GTG>GTA	p.V67V	CXorf57_uc004emj.3_Silent_p.V67V|CXorf57_uc004emh.2_Silent_p.V67V	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	67										ovary(1)|lung(1)|breast(1)	3						CGGAGGTGGTGCCTGTAACTG	0.572																0.646154	246.853389	249.280737	84	46	KEEP	---	---	---	---	46	47	26	25	-1	capture	Silent	SNP	105855511	105855511	CXorf57	23	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	4073	58
PTEN	5728	broad.mit.edu	37	10	89711988	89711989	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711988_89711989delTA	uc001kfb.2	+	7	1637_1638	c.606_607delTA	c.(604-609)ACTATTfs	p.T202fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	202_203	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.T202I(1)|p.T202fs*19(1)|p.G165_K342del(1)|p.I203fs*39(1)|p.G165_*404del(1)|p.I203fs*18(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGTTTGAAACTATTCCAATGTT	0.371			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.43			106	142		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89711988	89711989	PTEN	10	TA	-	-	-	1	0	1	0	1	0	0	0	0	678	53	5	5	12633	58
CD3EAP	10849	broad.mit.edu	37	19	45911859	45911861	+	In_Frame_Del	DEL	GAA	-	-			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45911859_45911861delGAA	uc002pbq.1	+	3	1121_1123	c.633_635delGAA	c.(631-636)CGGAAG>CGG	p.K217del	PPP1R13L_uc002pbo.2_5'Flank|PPP1R13L_uc002pbp.2_5'Flank|CD3EAP_uc002pbr.1_In_Frame_Del_p.K219del	NM_012099	NP_036231	O15446	RPA34_HUMAN	CD3E antigen, epsilon polypeptide associated	217	Poly-Lys.				rRNA transcription|transmembrane receptor protein tyrosine kinase signaling pathway	chromosome|RNA polymerase I transcription factor complex	DNA-directed RNA polymerase activity			large_intestine(2)|ovary(2)	4		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TGGATGTGCGGAAGAAGAAGAAG	0.581																0.04			9	225		---	---	---	---						capture_indel	In_Frame_Del	DEL	45911859	45911861	CD3EAP	19	GAA	-	-	-	1	0	1	0	1	0	0	0	0	522	41	5	5	2983	58
PHC3	80012	broad.mit.edu	37	3	169896635	169896637	+	In_Frame_Del	DEL	TGG	-	-			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169896635_169896637delTGG	uc010hws.1	-	2	132_134	c.68_70delCCA	c.(67-72)ACCATC>ATC	p.T23del	PHC3_uc003fgl.2_In_Frame_Del_p.T35del|PHC3_uc011bpq.1_In_Frame_Del_p.T35del|PHC3_uc011bpr.1_In_Frame_Del_p.T35del|PHC3_uc003fgm.2_In_Frame_Del_p.T35del|PHC3_uc003fgo.1_In_Frame_Del_p.T23del|PHC3_uc003fgp.3_In_Frame_Del_p.T35del|PHC3_uc003fgq.3_In_Frame_Del_p.T35del|PHC3_uc003fgr.1_RNA	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	23	Poly-Thr.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GAAgtggtgatggtggtggtggt	0.424																0.01			7	494		---	---	---	---						capture_indel	In_Frame_Del	DEL	169896635	169896637	PHC3	3	TGG	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	11721	58
FGFR3	2261	broad.mit.edu	37	4	1808950	1808951	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1808950_1808951insC	uc003gdr.3	+	18	2638_2639	c.2382_2383insC	c.(2380-2385)CTGCCCfs	p.L794fs	FGFR3_uc003gdu.2_Frame_Shift_Ins_p.L796fs|FGFR3_uc003gds.3_Frame_Shift_Ins_p.L682fs|FGFR3_uc003gdq.3_Frame_Shift_Ins_p.A772fs	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	794_795	Cytoplasmic (Potential).				bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.P795fs*139(1)|p.L794fs*23(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	ACGACCTGCTGCCCCCGGCCCC	0.688			1		527	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				0.24			8	26		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	1808950	1808951	FGFR3	4	-	C	C	C	1	0	1	1	0	0	0	0	0	587	46	5	5	5813	58
PIM1	5292	broad.mit.edu	37	6	37138555	37138557	+	In_Frame_Del	DEL	AGA	-	-			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:37138555_37138557delAGA	uc003onk.2	+	2	519_521	c.89_91delAGA	c.(88-93)GAGAAG>GAG	p.K31del	PIM1_uc011dtw.1_5'Flank	NM_002648	NP_002639	P11309	PIM1_HUMAN	non-specific serine/threonine protein kinase	122					cell cycle|cell proliferation|multicellular organismal development|negative regulation of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|protein autophosphorylation	cytoplasm|nucleus|plasma membrane	ATP binding|manganese ion binding|protein binding|protein binding|protein serine/threonine kinase activity|transcription factor binding			large_intestine(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CTAGGCAAGGAGAAGGAGCCCCT	0.714					455	T	BCL6	NHL								0.30			13	31		---	---	---	---						capture_indel	In_Frame_Del	DEL	37138555	37138557	PIM1	6	AGA	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	11830	58
TXNDC3	51314	broad.mit.edu	37	7	37901681	37901682	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37901681_37901682insC	uc003tfn.2	+	7	694_695	c.322_323insC	c.(322-324)AAAfs	p.K108fs		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	108	Thioredoxin.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GCTTGTTAATAAAAAAGTTATT	0.376	Ovarian(108;903 1537 27096 29907 47400)											Kartagener_syndrome				0.05			7	131		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	37901681	37901682	TXNDC3	7	-	C	C	C	1	0	1	1	0	0	0	0	0	169	13	5	5	16680	58
PCDH11Y	83259	broad.mit.edu	37	Y	4967730	4967730	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0644-01	TCGA-06-0644-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:4967730delT	uc004fqo.2	+	2	2845	c.2111delT	c.(2110-2112)GTTfs	p.V704fs	PCDH11Y_uc010nwg.1_Frame_Shift_Del_p.V693fs|PCDH11Y_uc004fql.1_Frame_Shift_Del_p.V693fs|PCDH11Y_uc004fqm.1_Frame_Shift_Del_p.V693fs|PCDH11Y_uc004fqn.1_Frame_Shift_Del_p.V704fs|PCDH11Y_uc004fqp.1_Frame_Shift_Del_p.V475fs	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	704	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						AACAAACCAGTTTTCATTGTC	0.403																0.62			94	57		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	4967730	4967730	PCDH11Y	24	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	11412	58
