Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FBLIM1	54751	broad.mit.edu	37	1	16093947	16093947	+	Silent	SNP	G	A	A	rs138682032		TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16093947G>A	uc001axd.1	+	5	770	c.327G>A	c.(325-327)CCG>CCA	p.P109P	FBLIM1_uc001axe.1_Silent_p.P109P|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axg.1_Silent_p.P109P|FBLIM1_uc001axh.1_Intron|FBLIM1_uc001axi.1_Intron	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a	109	Pro-rich.				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		CCCCTCCACCGCCCCCTCCAG	0.657																0.535714	39.715701	39.74599	15	13	KEEP	---	---	---	---	5	13	10	4	-1	capture	Silent	SNP	16093947	16093947	FBLIM1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5643	85
AKR7A3	22977	broad.mit.edu	37	1	19615062	19615062	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19615062C>G	uc001bbv.1	-	1	219	c.142G>C	c.(142-144)GTG>CTG	p.V48L		NM_012067	NP_036199	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3	48					cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCGCTGTACACGAAGGCCGTG	0.711																0.12	5.312191	8.848747	3	22	KEEP	---	---	---	---	3	1	12	12	-1	capture	Missense_Mutation	SNP	19615062	19615062	AKR7A3	1	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	476	85
C1orf103	55791	broad.mit.edu	37	1	111494470	111494470	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111494470G>A	uc001eaa.2	-	2	1292	c.1036C>T	c.(1036-1038)CGA>TGA	p.R346*	C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	346					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		TTTTTGGATCGCGTCCCACTA	0.353																0.348276	283.075571	288.972802	101	189	KEEP	---	---	---	---	38	71	90	117	-1	capture	Nonsense_Mutation	SNP	111494470	111494470	C1orf103	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	1959	85
HIPK1	204851	broad.mit.edu	37	1	114508833	114508833	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114508833G>T	uc001eem.2	+	11	2481	c.2320G>T	c.(2320-2322)GTC>TTC	p.V774F	HIPK1_uc001eel.2_Missense_Mutation_p.V774F|HIPK1_uc001een.2_Missense_Mutation_p.V774F|HIPK1_uc001eeo.2_Missense_Mutation_p.V400F|HIPK1_uc001eep.2_Missense_Mutation_p.V380F|HIPK1_uc001eeq.2_Missense_Mutation_p.V66F	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	774					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACACAACTCTGTCCAGCCCAC	0.542					365											0.35	126.911922	129.295076	42	78	KEEP	---	---	---	---	23	21	38	45	0.522727272727	capture	Missense_Mutation	SNP	114508833	114508833	HIPK1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	7041	85
HIPK1	204851	broad.mit.edu	37	1	114508840	114508840	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114508840C>A	uc001eem.2	+	11	2488	c.2327C>A	c.(2326-2328)CCC>CAC	p.P776H	HIPK1_uc001eel.2_Missense_Mutation_p.P776H|HIPK1_uc001een.2_Missense_Mutation_p.P776H|HIPK1_uc001eeo.2_Missense_Mutation_p.P402H|HIPK1_uc001eep.2_Missense_Mutation_p.P382H|HIPK1_uc001eeq.2_Missense_Mutation_p.P68H	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	776					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTGTCCAGCCCACAGCAATG	0.552					365											0.375	128.463304	130.102158	45	75	KEEP	---	---	---	---	25	22	37	43	0.468085106383	capture	Missense_Mutation	SNP	114508840	114508840	HIPK1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	7041	85
SMG5	23381	broad.mit.edu	37	1	156235769	156235769	+	Missense_Mutation	SNP	T	C	C	rs151295845	byFrequency	TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156235769T>C	uc001foc.3	-	12	1807	c.1658A>G	c.(1657-1659)AAT>AGT	p.N553S	SMG5_uc009wrv.2_Missense_Mutation_p.N38S	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	553					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					CAGTGGGCCATTGAGGGAATC	0.607																0.281818	93.184199	97.885589	31	79	KEEP	---	---	---	---	14	19	52	35	-1	capture	Missense_Mutation	SNP	156235769	156235769	SMG5	1	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14688	85
CADM3	57863	broad.mit.edu	37	1	159162382	159162382	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159162382C>T	uc001ftl.2	+	3	386	c.244C>T	c.(244-246)CGA>TGA	p.R82*	CADM3_uc009wsx.1_Nonsense_Mutation_p.R116*|CADM3_uc009wsy.1_Nonsense_Mutation_p.R82*|CADM3_uc001ftk.2_Nonsense_Mutation_p.R116*	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	82	Ig-like V-type.|Extracellular (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					TCGAGATAATCGAATTCAGCT	0.512																0.039062	-18.638609	10.721347	5	123	KEEP	---	---	---	---	4	2	62	76	-1	capture	Nonsense_Mutation	SNP	159162382	159162382	CADM3	1	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	2544	85
PVRL4	81607	broad.mit.edu	37	1	161049728	161049728	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161049728C>T	uc001fxo.2	-	2	390	c.91G>A	c.(91-93)GCG>ACG	p.A31T		NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	31					adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			AGCTCACCCGCGGGGCACCGG	0.627	NSCLC(76;1160 1387 14476 16172 29359)															0.4	87.735862	88.391306	30	45	KEEP	---	---	---	---	15	17	32	25	-1	capture	Missense_Mutation	SNP	161049728	161049728	PVRL4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12737	85
XCL1	6375	broad.mit.edu	37	1	168550427	168550427	+	Missense_Mutation	SNP	C	T	T	rs141027416		TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168550427C>T	uc001gfo.1	+	3	334	c.314C>T	c.(313-315)TCG>TTG	p.S105L		NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	105					CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					ACCCAGCAATCGACCAATACA	0.522																0.280488	61.896289	65.444496	23	59	KEEP	---	---	---	---	8	21	44	38	-1	capture	Missense_Mutation	SNP	168550427	168550427	XCL1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17304	85
SELE	6401	broad.mit.edu	37	1	169697312	169697312	+	Missense_Mutation	SNP	C	T	T	rs139137736		TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169697312C>T	uc001ggm.3	-	8	1323	c.1166G>A	c.(1165-1167)CGT>CAT	p.R389H	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	389	Sushi 4.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					GGACCCATAACGGAAACTGCC	0.522																0.369792	211.086269	213.942358	71	121	KEEP	---	---	---	---	30	45	64	79	-1	capture	Missense_Mutation	SNP	169697312	169697312	SELE	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13906	85
OR2M3	127062	broad.mit.edu	37	1	248367150	248367150	+	Missense_Mutation	SNP	C	T	T	rs147728074	byFrequency	TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248367150C>T	uc010pzg.1	+	1	781	c.781C>T	c.(781-783)CGG>TGG	p.R261W		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CATGTACATACGGCCCACATC	0.502																0.379147	484.327365	489.723936	160	262	KEEP	---	---	---	---	87	90	122	171	-1	capture	Missense_Mutation	SNP	248367150	248367150	OR2M3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	10915	85
SLIT1	6585	broad.mit.edu	37	10	98808848	98808848	+	Silent	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98808848G>A	uc001kmw.2	-	14	1581	c.1329C>T	c.(1327-1329)TGC>TGT	p.C443C	SLIT1_uc009xvh.1_Silent_p.C453C	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	443	LRRCT 2.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GGTTACAGTCGCAAATGAAAG	0.617																0.666667	65.50805	66.245343	20	10	KEEP	---	---	---	---	13	23	7	15	-1	capture	Silent	SNP	98808848	98808848	SLIT1	10	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	14631	85
RBMXL2	27288	broad.mit.edu	37	11	7111073	7111073	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7111073G>A	uc001mfc.2	+	1	909	c.722G>A	c.(721-723)CGC>CAC	p.R241H		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	241	Arg/Gly/Pro-rich.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TACACCCACCGCGATTACGGC	0.662																0.357143	29.946117	30.447717	10	18	KEEP	---	---	---	---	7	13	11	21	-1	capture	Missense_Mutation	SNP	7111073	7111073	RBMXL2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13049	85
ABCC8	6833	broad.mit.edu	37	11	17419338	17419338	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:17419338T>C	uc001mnc.2	-	31	3886	c.3760A>G	c.(3760-3762)ATC>GTC	p.I1254V		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	1254	Helical; Name=16; (By similarity).|ABC transmembrane type-1 2.				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CATGCACCGATGTACTCCTGG	0.632																0.378788	69.552869	70.405652	25	41	KEEP	---	---	---	---	13	15	14	29	-1	capture	Missense_Mutation	SNP	17419338	17419338	ABCC8	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	58	85
MS4A14	84689	broad.mit.edu	37	11	60183620	60183620	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60183620C>T	uc001npj.2	+	5	1744	c.1179C>T	c.(1177-1179)CAC>CAT	p.H393H	MS4A14_uc001npi.2_Silent_p.H281H|MS4A14_uc001npn.2_Silent_p.H131H|MS4A14_uc001npk.2_Silent_p.H376H|MS4A14_uc001npl.2_Silent_p.H131H|MS4A14_uc001npm.2_Silent_p.H131H	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	393						integral to membrane	receptor activity			breast(1)	1						caccatcccacgccatgccac	0.075																0.413043	54.414791	54.71892	19	27	KEEP	---	---	---	---	4	16	9	18	-1	capture	Silent	SNP	60183620	60183620	MS4A14	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9768	85
LRP5	4041	broad.mit.edu	37	11	68177525	68177525	+	Silent	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68177525G>A	uc001ont.2	+	10	2310	c.2235G>A	c.(2233-2235)GCG>GCA	p.A745A	LRP5_uc009ysg.2_Silent_p.A155A	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	745	LDL-receptor class B 12.|Beta-propeller 3.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						TCGAAGTGGCGCGGCTGGACG	0.617																0.39759	94.954744	95.717053	33	50	KEEP	---	---	---	---	18	18	22	37	-1	capture	Silent	SNP	68177525	68177525	LRP5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8876	85
CBL	867	broad.mit.edu	37	11	119148932	119148932	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119148932T>G	uc001pwe.2	+	8	1290	c.1152T>G	c.(1150-1152)TGT>TGG	p.C384W		NM_005188	NP_005179	P22681	CBL_HUMAN	Cas-Br-M (murine) ecotropic retroviral	384	Asp/Glu-rich (acidic).|RING-type.				epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	p.E366_Q409del(13)|p.C384R(7)|p.C384Y(4)|p.E369_D390del(1)|p.E366_K477del(1)		haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		GTAAAATATGTGCTGAAAATG	0.353					309							CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome				0.019417	-43.98511	9.444068	4	202	KEEP	---	---	---	---	1	3	116	100	-1	capture	Missense_Mutation	SNP	119148932	119148932	CBL	11	T	G	G	G	1	0	0	0	0	1	0	0	0	764	59	4	4	2676	85
APOF	319	broad.mit.edu	37	12	56755294	56755294	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56755294C>A	uc001sle.1	-	2	750	c.696G>T	c.(694-696)ATG>ATT	p.M232I		NM_001638	NP_001629	Q13790	APOF_HUMAN	apolipoprotein F precursor	232					cholesterol metabolic process	high-density lipoprotein particle|low-density lipoprotein particle	cholesterol binding|lipid transporter activity|receptor binding				0						GCCCCCCTGACATCCCAGCCA	0.517																0.034188	-20.08468	7.545651	4	113	KEEP	---	---	---	---	2	2	57	69	0.5	capture	Missense_Mutation	SNP	56755294	56755294	APOF	12	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	796	85
CAPS2	84698	broad.mit.edu	37	12	75678781	75678781	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:75678781A>G	uc001sxk.3	-	16	1729	c.1532T>C	c.(1531-1533)ATT>ACT	p.I511T	CAPS2_uc001sxm.3_Missense_Mutation_p.I279T|CAPS2_uc009zsa.2_Missense_Mutation_p.I101T|CAPS2_uc001sxi.3_Missense_Mutation_p.I247T|CAPS2_uc001sxj.3_Missense_Mutation_p.I422T|CAPS2_uc001sxl.3_Missense_Mutation_p.I492T	NM_032606	NP_115995	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	511	EF-hand 2.						calcium ion binding			ovary(2)	2						CATTTCACCAATAATACCACG	0.313																0.4	96.739049	97.307101	26	39	KEEP	---	---	---	---	11	18	20	19	-1	capture	Missense_Mutation	SNP	75678781	75678781	CAPS2	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	2614	85
TDG	6996	broad.mit.edu	37	12	104378553	104378553	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104378553T>A	uc001tkg.2	+	8	1042	c.819T>A	c.(817-819)AGT>AGA	p.S273R	TDG_uc009zuk.2_Missense_Mutation_p.S269R|TDG_uc010swi.1_Missense_Mutation_p.S130R|TDG_uc010swj.1_Missense_Mutation_p.S61R	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	273					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		CATCATCCAGTGCAAGATGTG	0.338											BER_DNA_glycosylases					0.100775	11.877327	32.400738	13	116	KEEP	---	---	---	---	4	9	68	69	-1	capture	Missense_Mutation	SNP	104378553	104378553	TDG	12	T	A	A	A	1	0	0	0	0	1	0	0	0	764	59	4	4	15610	85
TMEM132D	121256	broad.mit.edu	37	12	129558525	129558525	+	Silent	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129558525G>A	uc009zyl.1	-	9	3523	c.3195C>T	c.(3193-3195)ATC>ATT	p.I1065I	TMEM132D_uc001uia.2_Silent_p.I603I	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	1065	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TACTCATCACGATGGAGTTCC	0.517																0.350482	323.2836	329.416408	109	202	KEEP	---	---	---	---	51	66	105	119	-1	capture	Silent	SNP	129558525	129558525	TMEM132D	12	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	15931	85
EFNB2	1948	broad.mit.edu	37	13	107187195	107187195	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:107187195A>C	uc001vqi.2	-	1	143	c.118T>G	c.(118-120)TCC>GCC	p.S40A		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	40	Extracellular (Potential).				cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					ACTTACTTGGAGTTCGAGGAA	0.433																0.333333	36.316174	37.126908	11	22	KEEP	---	---	---	---	5	7	8	15	-1	capture	Missense_Mutation	SNP	107187195	107187195	EFNB2	13	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	4911	85
COL4A2	1284	broad.mit.edu	37	13	111134945	111134945	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111134945C>T	uc001vqx.2	+	32	3130	c.2841C>T	c.(2839-2841)GGC>GGT	p.G947G		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	947	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGAGCAAAGGCGAGGCTGGAT	0.527																0.015924	-75.127662	8.16191	5	309	KEEP	---	---	---	---	6	0	133	192	-1	capture	Silent	SNP	111134945	111134945	COL4A2	13	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3655	85
KLHL28	54813	broad.mit.edu	37	14	45415013	45415013	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:45415013C>A	uc001wvq.2	-	2	365	c.119G>T	c.(118-120)CGA>CTA	p.R40L	KLHL28_uc001wvr.2_Missense_Mutation_p.R40L|KLHL28_uc001wvt.3_Missense_Mutation_p.R40L	NM_017658	NP_060128	Q9NXS3	KLH28_HUMAN	BTB (POZ) domain containing 5	40	BTB.									ovary(1)	1						ATCACCTACTCGAAGAATGAT	0.428																0.015789	-44.138518	6.337918	3	187	KEEP	---	---	---	---	2	1	99	103	0.333333333333	capture	Missense_Mutation	SNP	45415013	45415013	KLHL28	14	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	8302	85
DLGAP5	9787	broad.mit.edu	37	14	55650334	55650334	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:55650334C>G	uc001xbs.2	-	3	593	c.376G>C	c.(376-378)GAT>CAT	p.D126H	DLGAP5_uc001xbt.2_Missense_Mutation_p.D126H	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	126					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						CAAGGCATATCAGGTCTATAA	0.323																0.023622	-24.69069	7.365983	3	124	KEEP	---	---	---	---	1	2	73	71	-1	capture	Missense_Mutation	SNP	55650334	55650334	DLGAP5	14	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	4521	85
KCNK10	54207	broad.mit.edu	37	14	88654322	88654322	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88654322T>C	uc001xwo.2	-	6	1442	c.985A>G	c.(985-987)ACA>GCA	p.T329A	KCNK10_uc001xwm.2_Missense_Mutation_p.T334A|KCNK10_uc001xwn.2_Missense_Mutation_p.T334A	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	329	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						TCTTCTTTTGTCTTTTTGGAC	0.493																0.367965	277.675423	281.229325	85	146	KEEP	---	---	---	---	43	50	75	85	-1	capture	Missense_Mutation	SNP	88654322	88654322	KCNK10	14	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	7981	85
C15orf52	388115	broad.mit.edu	37	15	40629935	40629935	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40629935C>T	uc001zlh.3	-	6	821	c.805G>A	c.(805-807)GCC>ACC	p.A269T	C15orf52_uc001zli.1_Missense_Mutation_p.A201T|C15orf52_uc010ucn.1_Missense_Mutation_p.A59T	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115	269										large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GTGGACTTGGCCTTGTCCAGG	0.701																0.096774	1.800469	6.852997	3	28	KEEP	---	---	---	---	1	2	13	17	-1	capture	Missense_Mutation	SNP	40629935	40629935	C15orf52	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1786	85
CYP11A1	1583	broad.mit.edu	37	15	74636252	74636252	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74636252G>A	uc002axt.2	-	4	862	c.707C>T	c.(706-708)GCC>GTC	p.A236V	CYP11A1_uc002axs.2_Missense_Mutation_p.A78V|CYP11A1_uc010bjm.1_Missense_Mutation_p.A78V|CYP11A1_uc010bjn.1_Intron|CYP11A1_uc010bjo.1_Missense_Mutation_p.A236V|CYP11A1_uc010bjp.1_RNA|CYP11A1_uc010ulj.1_Missense_Mutation_p.A16V	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,	236					C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	CTGGTAGATGGCATCAATGAA	0.572	Esophageal Squamous(87;818 1337 4093 9268 37314)															0.021834	-51.673197	6.789451	5	224	KEEP	---	---	---	---	0	5	121	116	-1	capture	Missense_Mutation	SNP	74636252	74636252	CYP11A1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4104	85
HAPLN3	145864	broad.mit.edu	37	15	89421300	89421300	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89421300C>T	uc002bnc.2	-	5	1112	c.984G>A	c.(982-984)CCG>CCA	p.P328P	HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Silent_p.P390P	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	328	Link 2.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)					AGTTAGGATGCGGGTGAACCA	0.642																0.026455	-38.290945	8.474659	5	184	KEEP	---	---	---	---	2	3	123	113	-1	capture	Silent	SNP	89421300	89421300	HAPLN3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6883	85
CASKIN1	57524	broad.mit.edu	37	16	2231462	2231462	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2231462G>A	uc010bsg.1	-	18	1939	c.1907C>T	c.(1906-1908)CCG>CTG	p.P636L		NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	636					signal transduction	cytoplasm				skin(2)	2						GGGCTCAGGCGGGGGCGGCGA	0.657																0.25	13.665745	14.801655	5	15	KEEP	---	---	---	---	5	3	10	13	-1	capture	Missense_Mutation	SNP	2231462	2231462	CASKIN1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2642	85
DNAH3	55567	broad.mit.edu	37	16	21080807	21080807	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21080807C>T	uc010vbe.1	-	23	3310	c.3310G>A	c.(3310-3312)GCC>ACC	p.A1104T		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1104	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GGCATCTGGGCTATGATGTCC	0.428																0.340426	282.712573	289.060329	96	186	KEEP	---	---	---	---	49	56	97	106	-1	capture	Missense_Mutation	SNP	21080807	21080807	DNAH3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	4560	85
ITGAX	3687	broad.mit.edu	37	16	31382999	31382999	+	Missense_Mutation	SNP	G	A	A	rs146647978	byFrequency	TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31382999G>A	uc002ebu.1	+	17	2121	c.2054G>A	c.(2053-2055)CGC>CAC	p.R685H	ITGAX_uc002ebt.2_Missense_Mutation_p.R685H	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	685	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GACCCTGGCCGCCTGAGTCCC	0.607																0.370079	132.236535	134.10191	47	80	KEEP	---	---	---	---	22	33	36	53	-1	capture	Missense_Mutation	SNP	31382999	31382999	ITGAX	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7812	85
PDP2	57546	broad.mit.edu	37	16	66918530	66918530	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66918530G>A	uc002eqk.1	+	2	505	c.343G>A	c.(343-345)GCT>ACT	p.A115T		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	115					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		CAACCAGCTGGCTGCCAATTC	0.522																0.429577	180.922475	181.519303	61	81	KEEP	---	---	---	---	32	33	44	48	-1	capture	Missense_Mutation	SNP	66918530	66918530	PDP2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11589	85
KRTAP4-7	100132476	broad.mit.edu	37	17	39240729	39240729	+	Missense_Mutation	SNP	A	G	G	rs148949542	by1000genomes	TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240729A>G	uc010wfn.1	+	1	271	c.271A>G	c.(271-273)ATG>GTG	p.M91V		NM_033061	NP_149050			keratin associated protein 4-7												0						cagctgctgtatgtccagctg	0.189																0.166667	9.190742	11.71412	4	20	KEEP	---	---	---	---	6	4	23	15	-1	capture	Missense_Mutation	SNP	39240729	39240729	KRTAP4-7	17	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	8475	85
KRTAP4-11	653240	broad.mit.edu	37	17	39274150	39274150	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274150T>A	uc002hvz.2	-	1	457	c.418A>T	c.(418-420)AGC>TGC	p.S140C		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	140	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ctggagatgctgcagctgggg	0.129																0.2	6.816366	8.071979	3	12	KEEP	---	---	---	---	6	3	14	23	-1	capture	Missense_Mutation	SNP	39274150	39274150	KRTAP4-11	17	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	8469	85
RNF43	54894	broad.mit.edu	37	17	56435337	56435337	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56435337T>G	uc002iwf.2	-	8	3756	c.1800A>C	c.(1798-1800)AGA>AGC	p.R600S	RNF43_uc010wnv.1_Missense_Mutation_p.R559S|RNF43_uc002iwh.3_Missense_Mutation_p.R600S|RNF43_uc002iwg.3_Missense_Mutation_p.R600S|RNF43_uc010dcw.2_Missense_Mutation_p.R473S	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	600	Pro-rich.|Cytoplasmic (Potential).			R -> G (in Ref. 1; BAD51435 and 2; BAA91085).		endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGAGTTGGATCTGGTGACTT	0.657																0.333333	239.824114	245.200606	73	146	KEEP	---	---	---	---	42	40	80	84	-1	capture	Missense_Mutation	SNP	56435337	56435337	RNF43	17	T	G	G	G	1	0	0	0	0	1	0	0	0	647	50	4	4	13387	85
RGS9	8787	broad.mit.edu	37	17	63173876	63173876	+	Silent	SNP	C	T	T	rs61739619		TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:63173876C>T	uc002jfe.2	+	9	719	c.609C>T	c.(607-609)TAC>TAT	p.Y203Y	RGS9_uc010dem.2_Silent_p.Y203Y|RGS9_uc002jfd.2_Silent_p.Y203Y|RGS9_uc002jff.2_RNA	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	203					intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						TGCTGGACTACGGCCTGGACC	0.488																0.276596	176.774915	187.331166	65	170	KEEP	---	---	---	---	27	48	110	95	-1	capture	Silent	SNP	63173876	63173876	RGS9	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13205	85
CDH7	1005	broad.mit.edu	37	18	63489429	63489429	+	Silent	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:63489429A>G	uc002ljz.2	+	5	1063	c.738A>G	c.(736-738)ACA>ACG	p.T246T	CDH7_uc002lka.2_Silent_p.T246T|CDH7_uc002lkb.2_Silent_p.T246T	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	246	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				CAGGAACTACATCAGTCACTG	0.433																0.373333	81.982779	83.038728	28	47	KEEP	---	---	---	---	21	13	25	26	-1	capture	Silent	SNP	63489429	63489429	CDH7	18	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	3086	85
ZNF407	55628	broad.mit.edu	37	18	72775604	72775604	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72775604C>T	uc002llw.2	+	8	5984	c.5927C>T	c.(5926-5928)TCG>TTG	p.S1976L		NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1976					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TTAAACCTCTCGGAGGCTGGA	0.617																0.285714	9.993183	10.570772	4	10	KEEP	---	---	---	---	2	4	4	10	-1	capture	Missense_Mutation	SNP	72775604	72775604	ZNF407	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17767	85
ZNF77	58492	broad.mit.edu	37	19	2933851	2933851	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2933851A>G	uc002lws.3	-	4	1405	c.1274T>C	c.(1273-1275)ATC>ACC	p.I425T		NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77	425	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCACGTGGATTCGAAGGGA	0.502																0.017857	-37.418747	6.599082	3	165	KEEP	---	---	---	---	1	2	82	98	-1	capture	Missense_Mutation	SNP	2933851	2933851	ZNF77	19	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	18019	85
MAG	4099	broad.mit.edu	37	19	35804318	35804318	+	Silent	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35804318G>A	uc002nyy.1	+	11	1991	c.1842G>A	c.(1840-1842)ACG>ACA	p.T614T	MAG_uc002nyx.1_3'UTR|MAG_uc010eds.1_Silent_p.T589T|MAG_uc002nyz.1_Silent_p.T614T	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	614	Cytoplasmic (Potential).			T -> S (in Ref. 2).	blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ACACGCTGACGGAGGAGCTAG	0.657																0.317073	78.781115	81.189097	26	56	KEEP	---	---	---	---	16	13	30	35	-1	capture	Silent	SNP	35804318	35804318	MAG	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9076	85
IL4I1	259307	broad.mit.edu	37	19	50392981	50392981	+	Silent	SNP	T	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50392981T>G	uc002pqt.1	-	8	1728	c.1650A>C	c.(1648-1650)CCA>CCC	p.P550P	IL4I1_uc002pqv.1_Silent_p.P559P|IL4I1_uc010eno.1_Silent_p.P558P|IL4I1_uc002pqw.1_Silent_p.P558P|IL4I1_uc002pqu.1_Silent_p.P572P	NM_152899	NP_690863	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1 isoform 1 precursor	550						lysosome	L-amino-acid oxidase activity			lung(1)|ovary(1)|prostate(1)	3		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)		GGCCTTGGACTGGAGGGTGGC	0.602																0.291667	96.268562	101.012844	35	85	KEEP	---	---	---	---	19	25	54	58	-1	capture	Silent	SNP	50392981	50392981	IL4I1	19	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	7620	85
ADD2	119	broad.mit.edu	37	2	70901894	70901894	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70901894C>T	uc002sgz.2	-	14	2122	c.1657G>A	c.(1657-1659)GTG>ATG	p.V553M	ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Missense_Mutation_p.V553M|ADD2_uc002sha.2_Missense_Mutation_p.V247M|ADD2_uc002sgx.2_Missense_Mutation_p.V553M|ADD2_uc010fdt.1_Missense_Mutation_p.V553M	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	553					actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						GGGTTGGGCACCGTCTCCTCT	0.507																0.32243	189.452714	195.417796	69	145	KEEP	---	---	---	---	45	31	74	87	-1	capture	Missense_Mutation	SNP	70901894	70901894	ADD2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	305	85
TTN	7273	broad.mit.edu	37	2	179446906	179446906	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179446906T>C	uc010zfg.1	-	264	58710	c.58486A>G	c.(58486-58488)ATT>GTT	p.I19496V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I13191V|TTN_uc010zfi.1_Missense_Mutation_p.I13124V|TTN_uc010zfj.1_Missense_Mutation_p.I12999V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20423							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTTGCTAATAACAGGAGGA	0.418				p.I19496F(BXPC3-Tumor)	8722											0.390805	245.874694	247.68758	68	106	KEEP	---	---	---	---	43	26	49	67	-1	capture	Missense_Mutation	SNP	179446906	179446906	TTN	2	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	16617	85
SSTR4	6754	broad.mit.edu	37	20	23016341	23016341	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23016341G>A	uc002wsr.2	+	1	285	c.221G>A	c.(220-222)CGC>CAC	p.R74H		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	74	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GTGATCCTTCGCTACGCCAAG	0.557	Esophageal Squamous(15;850 1104 16640)															0.232558	166.321792	186.021017	70	231	KEEP	---	---	---	---	33	47	113	144	-1	capture	Missense_Mutation	SNP	23016341	23016341	SSTR4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15092	85
EIF2S2	8894	broad.mit.edu	37	20	32677582	32677582	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:32677582T>C	uc002xaf.2	-	9	1125	c.956A>G	c.(955-957)CAG>CGG	p.Q319R	EIF2S2_uc002xag.2_Missense_Mutation_p.Q316R|EIF2S2_uc010ges.2_Missense_Mutation_p.Q259R	NM_003908	NP_003899	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2 beta	319						cytosol|eukaryotic translation initiation factor 2 complex	metal ion binding|protein binding|translation initiation factor activity			large_intestine(1)	1						CGTGACAGCCTGGAAGCCGGT	0.483																0.0125	-58.801116	6.43093	3	237	KEEP	---	---	---	---	1	2	136	134	-1	capture	Missense_Mutation	SNP	32677582	32677582	EIF2S2	20	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4965	85
SLC12A5	57468	broad.mit.edu	37	20	44673744	44673744	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44673744G>A	uc010zxl.1	+	12	1679	c.1603G>A	c.(1603-1605)GCC>ACC	p.A535T	SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Missense_Mutation_p.A512T	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	535					potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCTGCTGCAGGCCATCTCGAG	0.632																0.323077	216.231946	223.44627	84	176	KEEP	---	---	---	---	51	42	91	112	-1	capture	Missense_Mutation	SNP	44673744	44673744	SLC12A5	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14279	85
TUBB1	81027	broad.mit.edu	37	20	57599544	57599544	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57599544C>T	uc002yak.2	+	4	1331	c.1062C>T	c.(1060-1062)TGC>TGT	p.C354C		NM_030773	NP_110400	Q9H4B7	TBB1_HUMAN	beta tubulin 1, class VI	354					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity			ovary(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)		Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	TGGCTGTCTGCGACATCCCGC	0.567																0.28125	70.22691	74.331088	27	69	KEEP	---	---	---	---	13	18	33	45	-1	capture	Silent	SNP	57599544	57599544	TUBB1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	16635	85
DGCR8	54487	broad.mit.edu	37	22	20074008	20074008	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20074008A>G	uc002zri.2	+	2	872	c.522A>G	c.(520-522)ATA>ATG	p.I174M	DGCR8_uc010grz.2_Missense_Mutation_p.I174M|DGCR8_uc002zrj.2_5'Flank	NM_022720	NP_073557	Q8WYQ5	DGCR8_HUMAN	DiGeorge syndrome critical region gene 8	174	Necessary for nuclear localization and retention.|Necessary for interaction with NCL.				primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)					GGGTAGGCATAGGGGGTGAGA	0.552																0.017964	-37.176434	6.50885	3	164	KEEP	---	---	---	---	1	2	80	96	-1	capture	Missense_Mutation	SNP	20074008	20074008	DGCR8	22	A	G	G	G	1	0	0	0	0	1	0	0	0	189	15	3	3	4422	85
LZTR1	8216	broad.mit.edu	37	22	21340179	21340179	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21340179T>C	uc002zto.2	+	3	416	c.313T>C	c.(313-315)TGG>CGG	p.W105R	LZTR1_uc002ztn.2_Missense_Mutation_p.W64R|LZTR1_uc011ahy.1_Intron|LZTR1_uc010gsr.1_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	105	Kelch 1.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity	p.W105L(1)		ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGACTGCTCCTGGTGCAGGTG	0.582					1299											0.529412	87.215241	87.252928	27	24	KEEP	---	---	---	---	22	11	13	19	-1	capture	Missense_Mutation	SNP	21340179	21340179	LZTR1	22	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9052	85
OR5H2	79310	broad.mit.edu	37	3	98002586	98002586	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98002586C>T	uc003dsj.1	+	1	855	c.855C>T	c.(853-855)ATC>ATT	p.I285I		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						TTTATACAATCATAATTCCTT	0.328																0.363636	84.477999	85.738254	28	49	KEEP	---	---	---	---	17	15	21	32	-1	capture	Silent	SNP	98002586	98002586	OR5H2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	11066	85
HCLS1	3059	broad.mit.edu	37	3	121350755	121350755	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121350755G>A	uc003eeh.3	-	14	1524	c.1399C>T	c.(1399-1401)CGG>TGG	p.R467W	HCLS1_uc011bjj.1_Missense_Mutation_p.R430W	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	467	SH3.				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		CAACGTCCCCGCCACCAGCCC	0.507																0.415094	196.213889	197.215765	66	93	KEEP	---	---	---	---	33	40	41	67	-1	capture	Missense_Mutation	SNP	121350755	121350755	HCLS1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	6921	85
GOLGB1	2804	broad.mit.edu	37	3	121413146	121413146	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121413146C>T	uc003eei.3	-	13	6335	c.6209G>A	c.(6208-6210)CGC>CAC	p.R2070H	GOLGB1_uc010hrc.2_Missense_Mutation_p.R2075H|GOLGB1_uc003eej.3_Missense_Mutation_p.R2036H|GOLGB1_uc011bjm.1_Missense_Mutation_p.R1956H|GOLGB1_uc010hrd.1_Missense_Mutation_p.R2034H	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2070	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TGCCTTTTTGCGGTGTTCAAC	0.403																0.017699	-79.940116	9.003606	6	333	KEEP	---	---	---	---	3	3	166	185	-1	capture	Missense_Mutation	SNP	121413146	121413146	GOLGB1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6499	85
ABTB1	80325	broad.mit.edu	37	3	127396603	127396603	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:127396603G>T	uc003ejt.2	+	10	1034	c.946G>T	c.(946-948)GGC>TGC	p.G316C	ABTB1_uc003ejr.2_Missense_Mutation_p.G174C|ABTB1_uc003ejs.2_Missense_Mutation_p.G291C|ABTB1_uc003eju.2_Missense_Mutation_p.G174C|ABTB1_uc010hsm.2_Missense_Mutation_p.G43C	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1	316	BTB 2.					cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0						GACCTCAGGGGGCCCCCCAGC	0.642																0.322581	24.540774	25.406431	10	21	KEEP	---	---	---	---	6	5	13	12	0.545454545455	capture	Missense_Mutation	SNP	127396603	127396603	ABTB1	3	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	102	85
EPHB1	2047	broad.mit.edu	37	3	134967277	134967277	+	Silent	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134967277G>A	uc003eqt.2	+	14	2836	c.2616G>A	c.(2614-2616)GCG>GCA	p.A872A	EPHB1_uc003equ.2_Silent_p.A433A	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	872	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						CCCGGTTTGCGGAGATTGTCA	0.582					376											0.348485	72.141037	73.461893	23	43	KEEP	---	---	---	---	10	18	29	29	-1	capture	Silent	SNP	134967277	134967277	EPHB1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5129	85
ZIC4	84107	broad.mit.edu	37	3	147108751	147108751	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:147108751G>A	uc003ewd.1	-	4	1244	c.971C>T	c.(970-972)GCG>GTG	p.A324V	ZIC4_uc003ewc.1_Missense_Mutation_p.A254V|ZIC4_uc011bno.1_Missense_Mutation_p.A374V	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	324						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						CGCCGCCACCGCCGCCGAGGA	0.706																0.518519	42.349715	42.358018	14	13	KEEP	---	---	---	---	8	11	6	10	-1	capture	Missense_Mutation	SNP	147108751	147108751	ZIC4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17561	85
GAK	2580	broad.mit.edu	37	4	864620	864620	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:864620C>T	uc003gbm.3	-	19	2326	c.2127G>A	c.(2125-2127)GTG>GTA	p.V709V	GAK_uc003gbn.3_Silent_p.V630V|GAK_uc010ibk.1_Silent_p.V603V|GAK_uc010ibj.2_RNA|GAK_uc003gbl.3_Silent_p.V573V	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	709	C2 tensin-type.				cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		CCCTGGGCTCCACCTCCACTT	0.557					679											0.37037	112.572096	114.166523	40	68	KEEP	---	---	---	---	13	30	38	40	-1	capture	Silent	SNP	864620	864620	GAK	4	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	6135	85
ATP8A1	10396	broad.mit.edu	37	4	42505527	42505527	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:42505527G>C	uc003gwr.2	-	24	2323	c.2091C>G	c.(2089-2091)CAC>CAG	p.H697Q	ATP8A1_uc003gwq.2_5'UTR|ATP8A1_uc003gws.2_Missense_Mutation_p.H682Q	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	697	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	GTTTGCAGGAGTGTCCTGTAT	0.274																0.361446	102.626796	104.029471	30	53	KEEP	---	---	---	---	16	20	23	43	-1	capture	Missense_Mutation	SNP	42505527	42505527	ATP8A1	4	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	1183	85
SLC4A4	8671	broad.mit.edu	37	4	72316924	72316924	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72316924G>A	uc003hfy.2	+	11	1345	c.1228G>A	c.(1228-1230)GGA>AGA	p.G410R	SLC4A4_uc010iic.2_Missense_Mutation_p.G410R|SLC4A4_uc010iib.2_Missense_Mutation_p.G410R|SLC4A4_uc003hfz.2_Missense_Mutation_p.G410R|SLC4A4_uc003hgc.3_Missense_Mutation_p.G366R|SLC4A4_uc010iid.2_5'UTR|SLC4A4_uc003hga.2_Missense_Mutation_p.G288R|SLC4A4_uc003hgb.3_Missense_Mutation_p.G366R	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	410	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			GTACTCAGGTGGAGAGAATGT	0.443																0.318519	116.07076	120.026189	43	92	KEEP	---	---	---	---	22	24	43	52	-1	capture	Missense_Mutation	SNP	72316924	72316924	SLC4A4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	14548	85
PPEF2	5470	broad.mit.edu	37	4	76797562	76797562	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76797562G>A	uc003hix.2	-	11	1555	c.1198C>T	c.(1198-1200)CGG>TGG	p.R400W	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.R400W	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	400	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGCCGGCACCGCTCTAGCTCC	0.667	NSCLC(105;1359 1603 15961 44567 47947)															0.37037	109.464452	111.061508	40	68	KEEP	---	---	---	---	17	26	44	37	-1	capture	Missense_Mutation	SNP	76797562	76797562	PPEF2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	12209	85
SHROOM3	57619	broad.mit.edu	37	4	77661370	77661370	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77661370C>T	uc011cbx.1	+	5	2997	c.2044C>T	c.(2044-2046)CGG>TGG	p.R682W	SHROOM3_uc011cbz.1_Missense_Mutation_p.R506W|SHROOM3_uc003hkf.1_Missense_Mutation_p.R557W|SHROOM3_uc003hkg.2_Missense_Mutation_p.R460W	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	682					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			GGAGCTAGGCCGGGGAACCCA	0.607																0.029703	-38.689158	10.365281	6	196	KEEP	---	---	---	---	4	3	104	116	-1	capture	Missense_Mutation	SNP	77661370	77661370	SHROOM3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	14188	85
FAM190A	401145	broad.mit.edu	37	4	91321221	91321221	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:91321221A>G	uc003hsv.3	+	4	1884	c.1544A>G	c.(1543-1545)GAT>GGT	p.D515G	FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.D515G	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	515										large_intestine(1)|ovary(1)	2						TGTGAACTGGATGAAGATGAT	0.333																0.173913	10.385892	12.693743	4	19	KEEP	---	---	---	---	3	3	7	17	-1	capture	Missense_Mutation	SNP	91321221	91321221	FAM190A	4	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	5473	85
CTNND2	1501	broad.mit.edu	37	5	11565132	11565132	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:11565132C>T	uc003jfa.1	-	3	356	c.211G>A	c.(211-213)GCT>ACT	p.A71T	CTNND2_uc010itt.2_5'UTR|CTNND2_uc011cmy.1_5'UTR|CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	71	Potential.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TGCCGTTCAGCCTCCAGCTCT	0.502																0.298969	77.852315	81.348404	29	68	KEEP	---	---	---	---	17	14	34	43	-1	capture	Missense_Mutation	SNP	11565132	11565132	CTNND2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3983	85
PIK3R1	5295	broad.mit.edu	37	5	67591125	67591125	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591125T>C	uc003jva.2	+	13	2278	c.1718T>C	c.(1717-1719)CTG>CCG	p.L573P	PIK3R1_uc003jvb.2_Missense_Mutation_p.L573P|PIK3R1_uc003jvc.2_Missense_Mutation_p.L273P|PIK3R1_uc003jvd.2_Missense_Mutation_p.L303P|PIK3R1_uc003jve.2_Missense_Mutation_p.L252P|PIK3R1_uc011crb.1_Missense_Mutation_p.L243P	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	573					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.L570_D578del(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CTTATCCAGCTGAGAAAGACG	0.383					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.274725	147.410782	155.779332	50	132	KEEP	---	---	---	---	29	39	61	85	-1	capture	Missense_Mutation	SNP	67591125	67591125	PIK3R1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	11821	85
PRR16	51334	broad.mit.edu	37	5	120021968	120021968	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:120021968C>A	uc003ksq.2	+	2	642	c.479C>A	c.(478-480)CCA>CAA	p.P160Q	PRR16_uc003ksp.2_Missense_Mutation_p.P137Q|PRR16_uc003ksr.2_Missense_Mutation_p.P90Q	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	160	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		GGAGGCTTACCAGGTGGACCT	0.468																0.387097	181.261885	182.994065	60	95	KEEP	---	---	---	---	26	38	37	68	0.59375	capture	Missense_Mutation	SNP	120021968	120021968	PRR16	5	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	12485	85
SGCD	6444	broad.mit.edu	37	5	156186311	156186311	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156186311C>T	uc003lwd.3	+	8	1256	c.780C>T	c.(778-780)TTC>TTT	p.F260F	SGCD_uc003lwc.3_Silent_p.F261F	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	260	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGAAGGTCTTCGAGATCTGCG	0.488																0.34434	210.049121	214.568054	73	139	KEEP	---	---	---	---	44	38	85	70	-1	capture	Silent	SNP	156186311	156186311	SGCD	5	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	14094	85
ADAMTS2	9509	broad.mit.edu	37	5	178552111	178552111	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178552111G>A	uc003mjw.2	-	19	2821	c.2821C>T	c.(2821-2823)CGC>TGC	p.R941C		NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	941	TSP type-1 3.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGAATGCAGCGCACGGAGCGC	0.692					1974											0.349776	203.630973	208.00394	78	145	KEEP	---	---	---	---	37	55	65	102	-1	capture	Missense_Mutation	SNP	178552111	178552111	ADAMTS2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	265	85
GMDS	2762	broad.mit.edu	37	6	1930436	1930436	+	Silent	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:1930436G>A	uc003mtq.2	-	7	862	c.672C>T	c.(670-672)AGC>AGT	p.S224S		NM_001500	NP_001491	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	224					'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		CTACTGACCGGCTAATTTTTC	0.428																0.025157	-32.749029	7.008495	4	155	KEEP	---	---	---	---	1	4	62	103	-1	capture	Silent	SNP	1930436	1930436	GMDS	6	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	6422	85
ZSCAN23	222696	broad.mit.edu	37	6	28402496	28402496	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28402496G>C	uc003nli.3	-	4	1097	c.916C>G	c.(916-918)CAG>GAG	p.Q306E	ZSCAN23_uc003nlh.2_RNA|ZSCAN23_uc010jrf.1_RNA|ZSCAN23_uc011dli.1_3'UTR	NM_001012455	NP_001012458	Q3MJ62	ZSC23_HUMAN	zinc finger protein 390	306	C2H2-type 3.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACACTGCACTGGTAGCGCTTC	0.542																0.545455	22.051196	22.070966	6	5	KEEP	---	---	---	---	4	3	2	3	-1	capture	Missense_Mutation	SNP	28402496	28402496	ZSCAN23	6	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	18111	85
PPP1R10	5514	broad.mit.edu	37	6	30570090	30570090	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30570090C>T	uc003nqn.1	-	19	2888	c.2336G>A	c.(2335-2337)AGT>AAT	p.S779N	PPP1R10_uc010jsc.1_Missense_Mutation_p.S433N	NM_002714	NP_002705	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	779	Gly-rich.				protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding			ovary(2)|lung(1)|kidney(1)	4						GCGATGCCCACTTCCCATGCC	0.672																0.388715	365.4101	368.876451	124	195	KEEP	---	---	---	---	68	73	113	125	-1	capture	Missense_Mutation	SNP	30570090	30570090	PPP1R10	6	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12253	85
SFRS18	25957	broad.mit.edu	37	6	99856145	99856145	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:99856145C>T	uc003ppo.3	-	7	904	c.676G>A	c.(676-678)GCA>ACA	p.A226T	SFRS18_uc003ppp.3_Missense_Mutation_p.A226T|SFRS18_uc011eag.1_Missense_Mutation_p.A226T|SFRS18_uc003ppr.2_Missense_Mutation_p.A226T	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN	splicing factor, arginine/serine-rich 130	226						nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)		CGTTTTACTGCGTCTGTTTCA	0.358																0.309091	197.324437	204.465682	68	152	KEEP	---	---	---	---	33	37	78	92	-1	capture	Missense_Mutation	SNP	99856145	99856145	SFRS18	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14067	85
ATG5	9474	broad.mit.edu	37	6	106764059	106764059	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:106764059G>A	uc003prf.2	-	2	378	c.25C>T	c.(25-27)CGA>TGA	p.R9*	ATG5_uc010kdb.2_Nonsense_Mutation_p.R9*|ATG5_uc003prg.2_5'UTR|ATG5_uc010kdc.2_Nonsense_Mutation_p.R9*	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	APG5 autophagy 5-like	9					apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CACACATCTCGAAGCACATCT	0.368																0.306931	176.973639	183.687477	62	140	KEEP	---	---	---	---	28	41	81	83	-1	capture	Nonsense_Mutation	SNP	106764059	106764059	ATG5	6	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	1091	85
TXLNB	167838	broad.mit.edu	37	6	139564240	139564240	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139564240A>T	uc011eds.1	-	10	1643	c.1478T>A	c.(1477-1479)GTT>GAT	p.V493D		NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta	493						cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		GACACTATTAACCTCCTCTGC	0.478																0.025974	-64.67519	12.255603	8	300	KEEP	---	---	---	---	4	4	143	173	-1	capture	Missense_Mutation	SNP	139564240	139564240	TXLNB	6	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	16670	85
PRPS1L1	221823	broad.mit.edu	37	7	18066565	18066565	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:18066565T>C	uc003stz.2	-	1	922	c.841A>G	c.(841-843)ATG>GTG	p.M281V		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	281					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					CAATGCTTCATCTTCTCATCT	0.438																0.314961	518.812005	534.289408	160	348	KEEP	---	---	---	---	91	77	199	173	-1	capture	Missense_Mutation	SNP	18066565	18066565	PRPS1L1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	12475	85
PKD1L1	168507	broad.mit.edu	37	7	47867036	47867036	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47867036G>C	uc003tny.1	-	45	6766	c.6766C>G	c.(6766-6768)CTG>GTG	p.L2256V	C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_5'UTR	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2256	Cytoplasmic (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						GCCCAGCGCAGGTGGCGAGCT	0.667																0.14	12.616129	18.852288	7	43	KEEP	---	---	---	---	4	4	23	24	-1	capture	Missense_Mutation	SNP	47867036	47867036	PKD1L1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	11867	85
CALN1	83698	broad.mit.edu	37	7	71252855	71252855	+	Missense_Mutation	SNP	C	T	T	rs144352678	by1000genomes	TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71252855C>T	uc003twa.3	-	6	1092	c.565G>A	c.(565-567)GTC>ATC	p.V189I	CALN1_uc003twb.3_Missense_Mutation_p.V231I|CALN1_uc003twc.3_Missense_Mutation_p.V189I	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	189	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				CTCTTCCGGACGCAGGTCTGT	0.537																0.265432	109.388602	117.422872	43	119	KEEP	---	---	---	---	23	25	75	64	-1	capture	Missense_Mutation	SNP	71252855	71252855	CALN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2567	85
ZAN	7455	broad.mit.edu	37	7	100336230	100336230	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100336230C>T	uc003uwj.2	+	7	925	c.760C>T	c.(760-762)CCT>TCT	p.P254S	ZAN_uc003uwk.2_Missense_Mutation_p.P254S|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	254	MAM 2.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTTCTCTAGCCCTGGTAGTGA	0.577																0.222222	37.25013	42.375147	16	56	KEEP	---	---	---	---	8	11	40	30	-1	capture	Missense_Mutation	SNP	100336230	100336230	ZAN	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17394	85
OPN1SW	611	broad.mit.edu	37	7	128415497	128415497	+	Silent	SNP	T	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128415497T>A	uc003vnt.3	-	1	348	c.348A>T	c.(346-348)GTA>GTT	p.V116V		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	116	Helical; Name=3; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						CAGTACCTGCTACAGTGCCCA	0.547																0.134146	67.361605	109.966159	44	284	KEEP	---	---	---	---	24	21	145	172	-1	capture	Silent	SNP	128415497	128415497	OPN1SW	7	T	A	A	A	1	0	0	0	0	0	0	0	1	678	53	4	4	10784	85
TTC26	79989	broad.mit.edu	37	7	138854079	138854079	+	Silent	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138854079A>G	uc003vus.2	+	12	1164	c.1050A>G	c.(1048-1050)GGA>GGG	p.G350G	TTC26_uc011kqn.1_Silent_p.G350G|TTC26_uc011kqo.1_Silent_p.G319G|TTC26_uc011kqp.1_Silent_p.G245G|TTC26_uc003vut.2_Silent_p.G210G|TTC26_uc011kqq.1_Silent_p.G219G	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1	350							binding			ovary(1)	1						AGTTGGTGGGAGGATCAGCTA	0.368																0.261538	146.804554	156.866556	51	144	KEEP	---	---	---	---	36	26	102	74	-1	capture	Silent	SNP	138854079	138854079	TTC26	7	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	16576	85
GIMAP5	55340	broad.mit.edu	37	7	150439564	150439564	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150439564G>A	uc003whr.1	+	3	689	c.337G>A	c.(337-339)GTC>ATC	p.V113I	GIMAP5_uc010lpu.2_5'UTR	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	113	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGGCCCCACGTCCTGCTTCT	0.587																0.28	182.552734	193.428481	70	180	KEEP	---	---	---	---	37	42	88	108	-1	capture	Missense_Mutation	SNP	150439564	150439564	GIMAP5	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6321	85
PIP5K1B	8395	broad.mit.edu	37	9	71606125	71606125	+	Silent	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71606125C>T	uc004agu.2	+	15	1877	c.1572C>T	c.(1570-1572)AAC>AAT	p.N524N	PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_RNA	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	524						endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		CTGAGCCCAACACTCTGGAAG	0.428					223											0.305677	182.448417	190.170312	70	159	KEEP	---	---	---	---	39	35	75	95	-1	capture	Silent	SNP	71606125	71606125	PIP5K1B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	11843	85
PALM2-AKAP2	445815	broad.mit.edu	37	9	112694260	112694260	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112694260C>T	uc004bei.2	+	6	640	c.448C>T	c.(448-450)CGA>TGA	p.R150*	PALM2_uc004bef.2_Nonsense_Mutation_p.R152*|PALM2_uc004beg.2_Intron|PALM2_uc004beh.3_Nonsense_Mutation_p.R150*|PALM2-AKAP2_uc004bek.3_Nonsense_Mutation_p.R150*|PALM2-AKAP2_uc004bej.3_Nonsense_Mutation_p.R150*|PALM2-AKAP2_uc004bel.1_Intron	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	Error:Variant_position_missing_in_Q9Y2D5_after_alignment							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						CCTCTGTTCACGAACAGCAGA	0.542																0.550314	567.474174	568.180617	175	143	KEEP	---	---	---	---	128	156	110	132	-1	capture	Nonsense_Mutation	SNP	112694260	112694260	PALM2-AKAP2	9	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11314	85
SLC46A2	57864	broad.mit.edu	37	9	115652657	115652657	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115652657C>T	uc004bgk.2	-	1	537	c.305G>A	c.(304-306)CGC>CAC	p.R102H		NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	102	Cytoplasmic (Potential).					integral to membrane|plasma membrane	symporter activity			central_nervous_system(1)	1						TCGGTGGTAGCGGTCGCTGAG	0.607																0.230088	110.386983	125.483997	52	174	KEEP	---	---	---	---	29	32	92	109	-1	capture	Missense_Mutation	SNP	115652657	115652657	SLC46A2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14537	85
EDA	1896	broad.mit.edu	37	X	69253319	69253319	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69253319C>T	uc004dxs.2	+	7	1107	c.865C>T	c.(865-867)CGC>TGC	p.R289C	EDA_uc004dxr.2_Missense_Mutation_p.R289C|EDA_uc011mpj.1_Missense_Mutation_p.R286C	NM_001399	NP_001390	Q92838	EDA_HUMAN	ectodysplasin A isoform EDA-A1	289	Extracellular (Potential).				cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding			ovary(2)|large_intestine(1)	3						GCTACATCCCCGCAGCGGGGA	0.498														OREG0019847	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.804348	385.503547	397.420479	111	27	KEEP	---	---	---	---	53	70	13	16	-1	capture	Missense_Mutation	SNP	69253319	69253319	EDA	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4858	85
MCF2	4168	broad.mit.edu	37	X	138679647	138679647	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138679647A>G	uc004fau.2	-	18	2321	c.2027T>C	c.(2026-2028)ATG>ACG	p.M676T	MCF2_uc004fav.2_Missense_Mutation_p.M692T|MCF2_uc011mwl.1_Missense_Mutation_p.M653T|MCF2_uc010nsh.1_Missense_Mutation_p.M676T|MCF2_uc011mwm.1_Missense_Mutation_p.M637T|MCF2_uc011mwn.1_Missense_Mutation_p.M821T|MCF2_uc004faw.2_Missense_Mutation_p.M736T|MCF2_uc011mwo.1_Missense_Mutation_p.M752T	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	676					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	p.M676I(1)		lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					AATCTGATGCATAGAATCATT	0.259					693											0.745902	322.373178	329.065085	91	31	KEEP	---	---	---	---	35	58	12	21	-1	capture	Missense_Mutation	SNP	138679647	138679647	MCF2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	9291	85
NF1	4763	broad.mit.edu	37	17	29541476	29541476	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29541476delC	uc002hgg.2	+	13	1733	c.1400delC	c.(1399-1401)ACAfs	p.T467fs	NF1_uc002hge.1_Frame_Shift_Del_p.T467fs|NF1_uc002hgf.1_Frame_Shift_Del_p.T467fs|NF1_uc002hgh.2_Frame_Shift_Del_p.T467fs|NF1_uc010csn.1_Frame_Shift_Del_p.T327fs	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	467					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TAGAGTCTTACATTTAAAGAA	0.289					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.19			17	72		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	29541476	29541476	NF1	17	C	-	-	-	1	0	1	0	1	0	0	0	0	221	17	6	5	10263	85
PLCB1	23236	broad.mit.edu	37	20	8628555	8628559	+	Frame_Shift_Del	DEL	AACTT	-	-			TCGA-06-2562-01	TCGA-06-2562-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:8628555_8628559delAACTT	uc002wnb.2	+	6	476_480	c.473_477delAACTT	c.(472-477)AAACTTfs	p.K158fs	PLCB1_uc010zrb.1_Frame_Shift_Del_p.K57fs|PLCB1_uc010gbv.1_Frame_Shift_Del_p.K158fs|PLCB1_uc002wmz.1_Frame_Shift_Del_p.K158fs|PLCB1_uc002wna.2_Frame_Shift_Del_p.K158fs|PLCB1_uc002wnc.1_Frame_Shift_Del_p.K57fs	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	158_159					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AGCTATACTAAACTTAAGCTGCAAG	0.259																0.18			55	257		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	8628555	8628559	PLCB1	20	AACTT	-	-	-	1	0	1	0	1	0	0	0	0	13	1	5	5	11930	85
