Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GLIS1	148979	broad.mit.edu	37	1	54060499	54060499	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:54060499A>G	uc001cvr.1	-	3	644	c.77T>C	c.(76-78)CTC>CCC	p.L26P		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	26					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						TCGGCCCGGGAGGTCCAGGTC	0.706																0.25	5.846363	6.300656	2	6	KEEP	---	---	---	---	4	2	5	5	-1	capture	Missense_Mutation	SNP	54060499	54060499	GLIS1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	6381	90
TRIM46	80128	broad.mit.edu	37	1	155150608	155150608	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155150608G>A	uc001fhs.1	+	6	1123	c.1040G>A	c.(1039-1041)AGC>AAC	p.S347N	RAG1AP1_uc010pey.1_Intron|TRIM46_uc009wpe.1_RNA|TRIM46_uc001fhq.2_RNA|TRIM46_uc001fhr.2_Missense_Mutation_p.S347N|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.S221N|TRIM46_uc001fhu.1_Missense_Mutation_p.S324N|TRIM46_uc009wpg.1_Missense_Mutation_p.S334N|TRIM46_uc001fhv.3_Missense_Mutation_p.S334N|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	347	Potential.					intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCCCGTCTCAGCGCCCAGATC	0.622																0.384615	83.120856	84.034532	30	48	KEEP	---	---	---	---	18	16	18	42	-1	capture	Missense_Mutation	SNP	155150608	155150608	TRIM46	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	16404	90
IGSF8	93185	broad.mit.edu	37	1	160063842	160063842	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160063842C>T	uc001fva.2	-	3	607	c.562G>A	c.(562-564)GCG>ACG	p.A188T	IGSF8_uc001fuz.2_Missense_Mutation_p.A188T|IGSF8_uc009wtf.2_Missense_Mutation_p.A188T	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	188	Extracellular (Potential).|Ig-like C2-type 2.				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CTTGTCCTCGCCAGGCAGCCC	0.677																0.303279	98.125194	102.341366	37	85	KEEP	---	---	---	---	23	16	46	50	-1	capture	Missense_Mutation	SNP	160063842	160063842	IGSF8	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7528	90
OBSCN	84033	broad.mit.edu	37	1	228511139	228511139	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228511139G>A	uc009xez.1	+	56	15528	c.15484G>A	c.(15484-15486)GAT>AAT	p.D5162N	OBSCN_uc001hsn.2_Missense_Mutation_p.D5162N	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5162	Ig-like 49.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CTGGTTCAAGGATGGGAAGTT	0.537					4006											0.083333	0.960955	9.431397	4	44	KEEP	---	---	---	---	1	3	25	22	-1	capture	Missense_Mutation	SNP	228511139	228511139	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10717	90
OBSCN	84033	broad.mit.edu	37	1	228511261	228511261	+	Silent	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228511261G>A	uc009xez.1	+	56	15650	c.15606G>A	c.(15604-15606)GAG>GAA	p.E5202E	OBSCN_uc001hsn.2_Silent_p.E5202E	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5202	Ig-like 49.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCCTGGCCGAGAACAGCATGG	0.577					4006											0.085714	1.605407	7.687031	3	32	KEEP	---	---	---	---	4	0	20	18	-1	capture	Silent	SNP	228511261	228511261	OBSCN	1	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	10717	90
LHPP	64077	broad.mit.edu	37	10	126172716	126172716	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:126172716G>A	uc001lhs.1	+	2	154	c.134G>A	c.(133-135)CGT>CAT	p.R45H	LHPP_uc001lht.1_Missense_Mutation_p.R45H|LHPP_uc009yai.1_Missense_Mutation_p.R45H	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic	45					protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		AGACTGAAGCGTTCCCGGCTG	0.617	GBM(165;1980 2715 15999 18454)															0.2	17.481399	20.826694	8	32	KEEP	---	---	---	---	3	5	18	19	-1	capture	Missense_Mutation	SNP	126172716	126172716	LHPP	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8689	90
RAG1	5896	broad.mit.edu	37	11	36596029	36596029	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36596029G>T	uc001mwu.3	+	2	1299	c.1175G>T	c.(1174-1176)GGG>GTG	p.G392V	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	392	NBD.				histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				ATTAATAAAGGGGGCCGGCCC	0.478	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)				117							Familial_Hemophagocytic_Lymphohistiocytosis				0.447619	133.711366	133.961793	47	58	KEEP	---	---	---	---	21	28	31	36	0.428571428571	capture	Missense_Mutation	SNP	36596029	36596029	RAG1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12898	90
SPRYD5	84767	broad.mit.edu	37	11	55652963	55652963	+	Missense_Mutation	SNP	A	G	G	rs2063276	by1000genomes	TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55652963A>G	uc010rip.1	+	2	151	c.59A>G	c.(58-60)AAC>AGC	p.N20S	SPRYD5_uc010riq.1_5'Flank	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	20	RING-type.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				ATCTGCATGAACTACTTCCTA	0.502																0.050633	-6.157073	10.735737	4	75	KEEP	---	---	---	---	3	1	43	37	-1	capture	Missense_Mutation	SNP	55652963	55652963	SPRYD5	11	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	15003	90
MAP6	4135	broad.mit.edu	37	11	75316902	75316902	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75316902C>T	uc001owu.2	-	3	1332	c.1267G>A	c.(1267-1269)GAC>AAC	p.D423N	MAP6_uc001owv.2_Missense_Mutation_p.D423N	NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1	423						Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)					TGCTCCTTGTCGTCTGGCTTG	0.542	Esophageal Squamous(181;1115 2007 8647 17065 22697)															0.444444	302.377484	302.956157	96	120	KEEP	---	---	---	---	61	53	76	80	-1	capture	Missense_Mutation	SNP	75316902	75316902	MAP6	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9178	90
TMBIM4	51643	broad.mit.edu	37	12	66547227	66547227	+	Silent	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66547227G>A	uc001stc.2	-	2	175	c.99C>T	c.(97-99)GCC>GCT	p.A33A	LLPH_uc010ssx.1_RNA|TMBIM4_uc001std.2_Intron|TMBIM4_uc009zqr.2_Silent_p.T80T|TMBIM4_uc001ste.2_RNA|TMBIM4_uc001stf.2_Silent_p.A33A|TMBIM4_uc009zqs.2_Silent_p.A33A	NM_016056	NP_057140	Q9HC24	TMBI4_HUMAN	transmembrane BAX inhibitor motif containing 4	33						integral to membrane	protein binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(28;0.0745)		TTCTCAGAAAGGCTAAAAGAG	0.289																0.6	301.327615	302.551363	84	56	KEEP	---	---	---	---	35	55	26	33	-1	capture	Silent	SNP	66547227	66547227	TMBIM4	12	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	15867	90
WDFY2	115825	broad.mit.edu	37	13	52234797	52234797	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:52234797C>G	uc001vfp.2	+	2	543	c.203C>G	c.(202-204)CCT>CGT	p.P68R	WDFY2_uc010ads.1_Missense_Mutation_p.P68R|WDFY2_uc010adt.1_RNA	NM_052950	NP_443182	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	68	WD 2.						metal ion binding				0		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		CATGCAATGCCTTGTAAGTAT	0.403																0.145985	34.128686	50.624086	20	117	KEEP	---	---	---	---	10	12	70	71	-1	capture	Missense_Mutation	SNP	52234797	52234797	WDFY2	13	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	17150	90
DICER1	23405	broad.mit.edu	37	14	95560476	95560476	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95560476C>G	uc001ydw.2	-	25	5295	c.5113G>C	c.(5113-5115)GAA>CAA	p.E1705Q	DICER1_uc010avh.1_Missense_Mutation_p.E603Q|DICER1_uc001ydv.2_Missense_Mutation_p.E1695Q|DICER1_uc001ydx.2_Missense_Mutation_p.E1705Q	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1705	RNase III 2.	Magnesium or manganese 2.			negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CCCAGGAATTCTAAGCGCTGG	0.527					741	Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				0.473214	191.161517	191.231891	53	59	KEEP	---	---	---	---	33	29	29	37	-1	capture	Missense_Mutation	SNP	95560476	95560476	DICER1	14	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4479	90
ITGAD	3681	broad.mit.edu	37	16	31422097	31422097	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31422097C>A	uc002ebv.1	+	12	1303	c.1254C>A	c.(1252-1254)AAC>AAA	p.N418K	ITGAD_uc010cap.1_Missense_Mutation_p.N418K	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	418	FG-GAP 4.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						GGGTACAGAACCTGGTCCTGG	0.647																0.861111	212.958816	222.016488	62	10	KEEP	---	---	---	---	36	32	7	4	0.470588235294	capture	Missense_Mutation	SNP	31422097	31422097	ITGAD	16	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	7807	90
EVI2B	2124	broad.mit.edu	37	17	29631684	29631684	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29631684C>G	uc002hgk.2	-	2	1099	c.944G>C	c.(943-945)GGT>GCT	p.G315A	NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2B_uc010csq.2_Missense_Mutation_p.G330A	NM_006495	NP_006486	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B precursor	315	Cytoplasmic (Potential).					cytoplasm|integral to plasma membrane				ovary(2)	2		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		TTCTGATGTACCATTTACTTG	0.388																0.444444	338.095912	338.6488	92	115	KEEP	---	---	---	---	57	39	49	75	-1	capture	Missense_Mutation	SNP	29631684	29631684	EVI2B	17	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	5243	90
GAS2L2	246176	broad.mit.edu	37	17	34073121	34073121	+	Silent	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34073121G>A	uc002hjv.1	-	6	1423	c.1395C>T	c.(1393-1395)GCC>GCT	p.A465A		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	465					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCAGGCACTCGGCTGGGCCAA	0.622																0.387324	174.307371	175.881807	55	87	KEEP	---	---	---	---	29	32	38	63	-1	capture	Silent	SNP	34073121	34073121	GAS2L2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6187	90
ACACA	31	broad.mit.edu	37	17	35444255	35444255	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35444255G>A	uc002hnm.2	-	56	7228	c.7037C>T	c.(7036-7038)ACG>ATG	p.T2346M	ACACA_uc002hnk.2_Missense_Mutation_p.T2268M|ACACA_uc002hnl.2_Missense_Mutation_p.T2288M|ACACA_uc002hnn.2_Missense_Mutation_p.T2346M|ACACA_uc002hno.2_Missense_Mutation_p.T2383M|ACACA_uc010cuy.2_Missense_Mutation_p.T991M|ACACA_uc010wdb.1_Missense_Mutation_p.T384M|ACACA_uc010wdc.1_Missense_Mutation_p.T472M	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	2346					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CTCTTCCTACGTGGAAGGGGA	0.517	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)				742											0.842105	155.615354	161.972352	48	9	KEEP	---	---	---	---	26	29	6	3	-1	capture	Missense_Mutation	SNP	35444255	35444255	ACACA	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	106	90
FADS6	283985	broad.mit.edu	37	17	72875610	72875610	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72875610G>C	uc002jmd.1	-	5	842	c.830C>G	c.(829-831)GCG>GGG	p.A277G	FADS6_uc010wrn.1_Missense_Mutation_p.A131G	NM_178128	NP_835229	Q8N9I5	FADS6_HUMAN	fatty acid desaturase domain family, member 6	283	Helical; (Potential).				fatty acid biosynthetic process	integral to membrane	oxidoreductase activity				0	all_lung(278;0.172)|Lung NSC(278;0.207)					GTGGCCGAACGCCCAGTCCAG	0.612																0.169811	22.15498	27.612405	9	44	KEEP	---	---	---	---	5	4	24	27	-1	capture	Missense_Mutation	SNP	72875610	72875610	FADS6	17	G	C	C	C	1	0	0	0	0	1	0	0	0	494	38	4	4	5322	90
KLK15	55554	broad.mit.edu	37	19	51330190	51330190	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51330190C>A	uc002ptl.2	-	3	456	c.425G>T	c.(424-426)GGC>GTC	p.G142V	KLK15_uc002ptm.2_Intron|KLK15_uc002ptn.2_Missense_Mutation_p.G142V|KLK15_uc002pto.2_Missense_Mutation_p.G141V|KLK15_uc010ych.1_Intron|KLK15_uc010yci.1_Missense_Mutation_p.G141V|KLK15_uc010eod.2_RNA	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	142	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CAGGCCCCAGCCAGACACCAC	0.692	Pancreas(140;10 2513 7143 9246)															0.24	27.875903	30.960711	12	38	KEEP	---	---	---	---	5	10	26	20	0.666666666667	capture	Missense_Mutation	SNP	51330190	51330190	KLK15	19	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	8323	90
CD93	22918	broad.mit.edu	37	20	23065723	23065723	+	Silent	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23065723G>A	uc002wsv.2	-	1	1255	c.1107C>T	c.(1105-1107)TGC>TGT	p.C369C		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	369	Extracellular (Potential).|EGF-like 3; calcium-binding (Potential).				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					AGCCAACCCAGCATTCGCAGC	0.642																0.089286	2.129739	11.672656	5	51	KEEP	---	---	---	---	3	2	35	35	-1	capture	Silent	SNP	23065723	23065723	CD93	20	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	3018	90
MANBAL	63905	broad.mit.edu	37	20	35944753	35944753	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35944753A>G	uc002xgu.2	+	4	405	c.193A>G	c.(193-195)AAG>GAG	p.K65E	MANBAL_uc002xgv.2_Missense_Mutation_p.K65E|MANBAL_uc002xgw.2_RNA|MANBAL_uc010gfx.2_RNA|MANBAL_uc010gfy.2_RNA	NM_022077	NP_071360	Q9NQG1	MANBL_HUMAN	mannosidase, beta A, lysosomal-like	65						integral to membrane					0		Myeloproliferative disorder(115;0.00878)				GGTGACGAGGAAGCCCAAGGC	0.552																0.247706	79.078269	85.38622	27	82	KEEP	---	---	---	---	13	21	48	48	-1	capture	Missense_Mutation	SNP	35944753	35944753	MANBAL	20	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	9134	90
TMPRSS7	344805	broad.mit.edu	37	3	111766626	111766626	+	Silent	SNP	T	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111766626T>G	uc010hqb.2	+	5	563	c.393T>G	c.(391-393)TCT>TCG	p.S131S	TMPRSS7_uc011bhr.1_5'UTR	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	257	Extracellular (Potential).|CUB 1.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						AGCATCTGTCTCTCCACTACC	0.448																0.87234	135.393144	141.738527	41	6	KEEP	---	---	---	---	21	26	3	4	-1	capture	Silent	SNP	111766626	111766626	TMPRSS7	3	T	G	G	G	1	0	0	0	0	0	0	0	1	691	54	4	4	16135	90
MUC20	200958	broad.mit.edu	37	3	195456549	195456549	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195456549T>C	uc010hzo.2	+	4	1613	c.1487T>C	c.(1486-1488)CTG>CCG	p.L496P	MUC20_uc010hzp.2_Missense_Mutation_p.L461P	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	667	Interaction with MET.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTCCTGCGGCTGAGTGTGGCT	0.453																0.538462	24.626391	24.643162	7	6	KEEP	---	---	---	---	4	5	6	5	-1	capture	Missense_Mutation	SNP	195456549	195456549	MUC20	3	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9886	90
ATP5I	521	broad.mit.edu	37	4	666298	666298	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:666298T>C	uc003gas.2	-	4	287	c.201A>G	c.(199-201)ATA>ATG	p.I67M	ATP5I_uc003gar.2_RNA|MYL5_uc003gat.2_5'Flank|MYL5_uc003gau.2_5'Flank	NM_007100	NP_009031	P56385	ATP5I_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	67					ATP catabolic process|respiratory electron transport chain		hydrogen ion transmembrane transporter activity				0						CTCACTTTAATATGCTGTCAT	0.448																0.381579	104.969117	105.899451	29	47	KEEP	---	---	---	---	17	20	34	26	-1	capture	Missense_Mutation	SNP	666298	666298	ATP5I	4	T	C	C	C	1	0	0	0	0	1	0	0	0	628	49	3	3	1148	90
ATP10D	57205	broad.mit.edu	37	4	47538903	47538903	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47538903G>T	uc003gxk.1	+	9	1508	c.1344G>T	c.(1342-1344)ATG>ATT	p.M448I	ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Missense_Mutation_p.M433I	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	448	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						AGAATAAGATGGTTTTTCGAA	0.433																0.175	27.194028	35.174848	14	66	KEEP	---	---	---	---	9	9	42	37	0.5	capture	Missense_Mutation	SNP	47538903	47538903	ATP10D	4	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	1109	90
CCDC99	54908	broad.mit.edu	37	5	169031191	169031191	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169031191A>G	uc003mae.3	+	12	2077	c.1798A>G	c.(1798-1800)ACC>GCC	p.T600A	CCDC99_uc011deq.1_Missense_Mutation_p.T417A|CCDC99_uc010jjk.2_Missense_Mutation_p.T326A	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99	600					cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACTCCAGAGACCCAGTGCCC	0.358																0.217391	70.134612	78.702027	25	90	KEEP	---	---	---	---	16	12	47	64	-1	capture	Missense_Mutation	SNP	169031191	169031191	CCDC99	5	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	2849	90
COL19A1	1310	broad.mit.edu	37	6	70916651	70916651	+	Silent	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70916651G>A	uc003pfc.1	+	50	3387	c.3270G>A	c.(3268-3270)CTG>CTA	p.L1090L		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	1090	Triple-helical region 6 (COL6).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						GAATTGGGCTGCCAGGGAGTC	0.458																0.042857	-19.876519	11.516251	6	134	KEEP	---	---	---	---	6	3	90	75	-1	capture	Silent	SNP	70916651	70916651	COL19A1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	3641	90
SDK1	221935	broad.mit.edu	37	7	4153059	4153059	+	Silent	SNP	G	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4153059G>T	uc003smx.2	+	24	3712	c.3573G>T	c.(3571-3573)CGG>CGT	p.R1191R	SDK1_uc010kso.2_Silent_p.R467R	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1191	Fibronectin type-III 6.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCAGCCTGCGGCTTCGCTGGG	0.637																0.049689	-18.238461	16.416519	8	153	KEEP	---	---	---	---	7	8	110	123	0.466666666667	capture	Silent	SNP	4153059	4153059	SDK1	7	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	13861	90
LOC402644	402644	broad.mit.edu	37	7	28319007	28319007	+	Silent	SNP	T	A	A	rs177483	by1000genomes	TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:28319007T>A	uc010kuz.1	-	1	312	c.312A>T	c.(310-312)GGA>GGT	p.G104G		NM_001126493	NP_001119965			hypothetical protein LOC402644												0						TTGTGTTGGGTCCAGAATTTG	0.463																0.09589	4.571365	16.526921	7	66	KEEP	---	---	---	---	3	5	38	32	-1	capture	Silent	SNP	28319007	28319007	LOC402644	7	T	A	A	A	1	0	0	0	0	0	0	0	1	743	58	4	4	8796	90
KBTBD2	25948	broad.mit.edu	37	7	32909138	32909138	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:32909138C>T	uc003tdb.2	-	4	2350	c.1691G>A	c.(1690-1692)CGG>CAG	p.R564Q	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	564	Kelch 5.										0			GBM - Glioblastoma multiforme(11;0.0499)			TATATGCTGCCGCAGAGACCA	0.463																0.162921	61.192315	80.390117	29	149	KEEP	---	---	---	---	15	18	80	95	-1	capture	Missense_Mutation	SNP	32909138	32909138	KBTBD2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7915	90
ELN	2006	broad.mit.edu	37	7	73474491	73474491	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73474491A>G	uc003tzw.2	+	24	1707	c.1616A>G	c.(1615-1617)AAG>AGG	p.K539R	RFC2_uc011kfa.1_Intron|ELN_uc003tzn.2_Missense_Mutation_p.K533R|ELN_uc003tzz.2_Missense_Mutation_p.K452R|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Missense_Mutation_p.K444R|ELN_uc003tzq.2_Missense_Mutation_p.K397R|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Missense_Mutation_p.K514R|ELN_uc003tzt.2_Missense_Mutation_p.K538R|ELN_uc003tzu.2_Missense_Mutation_p.K519R|ELN_uc003tzv.2_Missense_Mutation_p.K504R|ELN_uc003tzx.2_Missense_Mutation_p.K523R|ELN_uc011kff.1_Missense_Mutation_p.K533R|ELN_uc003tzy.2_Missense_Mutation_p.K509R	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	562	Ala-rich.				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding	p.Q539Q(1)		ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	TCCGCTGCCAAGGTGGCTGCC	0.637					434	T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						0.893204	350.464496	366.271139	92	11	KEEP	---	---	---	---	48	66	6	8	-1	capture	Missense_Mutation	SNP	73474491	73474491	ELN	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	5026	90
TRPV5	56302	broad.mit.edu	37	7	142625890	142625890	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142625890G>T	uc003wby.1	-	6	922	c.658C>A	c.(658-660)CTG>ATG	p.L220M	TRPV5_uc003wbz.2_Missense_Mutation_p.L220M	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	220	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TCGTAGGACAGCAGCAGGTTG	0.572																0.057971	-6.259916	7.881626	4	65	KEEP	---	---	---	---	1	4	35	36	0.2	capture	Missense_Mutation	SNP	142625890	142625890	TRPV5	7	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	16482	90
WNK2	65268	broad.mit.edu	37	9	96030181	96030181	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96030181G>T	uc004ati.1	+	16	3850	c.3850G>T	c.(3850-3852)GGC>TGC	p.G1284C	WNK2_uc011lud.1_Missense_Mutation_p.G1284C|WNK2_uc004atj.2_Missense_Mutation_p.G1284C|WNK2_uc004atk.2_Missense_Mutation_p.G921C	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1284					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						CAGCACCTGCGGCCTGGGCAC	0.657					1420											0.277778	14.470489	15.268224	5	13	KEEP	---	---	---	---	3	6	12	9	0.333333333333	capture	Missense_Mutation	SNP	96030181	96030181	WNK2	9	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	17259	90
ANAPC2	29882	broad.mit.edu	37	9	140074735	140074735	+	Silent	SNP	C	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140074735C>A	uc004clr.1	-	10	1861	c.1788G>T	c.(1786-1788)CTG>CTT	p.L596L	ANAPC2_uc004clq.1_Silent_p.L452L	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2	596					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		ACTCACTGGACAGGATGACAG	0.607																0.327731	116.272344	119.410424	39	80	KEEP	---	---	---	---	24	21	62	49	0.466666666667	capture	Silent	SNP	140074735	140074735	ANAPC2	9	C	A	A	A	1	0	0	0	0	0	0	0	1	210	17	4	4	600	90
PCDH19	57526	broad.mit.edu	37	X	99663291	99663291	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99663291G>A	uc010nmz.2	-	1	1981	c.305C>T	c.(304-306)TCG>TTG	p.S102L	PCDH19_uc004efw.3_Missense_Mutation_p.S102L|PCDH19_uc004efx.3_Missense_Mutation_p.S102L	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	102	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GACCTCGAGCGAGATGATGCA	0.557																0.333333	146.402017	150.091102	50	100	KEEP	---	---	---	---	27	28	67	50	-1	capture	Missense_Mutation	SNP	99663291	99663291	PCDH19	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11417	90
CLEC4C	170482	broad.mit.edu	37	12	7882275	7882280	+	In_Frame_Del	DEL	AACGGA	-	-			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7882275_7882280delAACGGA	uc001qtg.1	-	6	728_733	c.554_559delTCCGTT	c.(553-561)TTCCGTTCT>TCT	p.FR185del	CLEC4C_uc001qth.1_In_Frame_Del_p.FR185del|CLEC4C_uc001qti.1_In_Frame_Del_p.FR154del	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	185_186	Extracellular (Potential).|C-type lectin.				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		TCTTCTGAAGAACGGAAATTTATTAT	0.398																0.07			15	199		---	---	---	---						capture_indel	In_Frame_Del	DEL	7882275	7882280	CLEC4C	12	AACGGA	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	3478	90
DICER1	23405	broad.mit.edu	37	14	95571502	95571519	+	In_Frame_Del	DEL	AAAGTATGCTGGGGAGAC	-	-			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95571502_95571519delAAAGTATGCTGGGGAGAC	uc001ydw.2	-	21	3340_3357	c.3158_3175delGTCTCCCCAGCATACTTT	c.(3157-3177)TGTCTCCCCAGCATACTTTAT>TAT	p.CLPSIL1053del	DICER1_uc010avh.1_5'UTR|DICER1_uc001ydv.2_In_Frame_Del_p.CLPSIL1043del|DICER1_uc001ydx.2_In_Frame_Del_p.CLPSIL1053del|DICER1_uc001ydy.1_5'Flank	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1053_1058					negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TGAAGGCGATAAAGTATGCTGGGGAGACAAACAGCTTT	0.468				p.S1056G(RKO-Tumor)	741	Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				0.18			62	285		---	---	---	---						capture_indel	In_Frame_Del	DEL	95571502	95571519	DICER1	14	AAAGTATGCTGGGGAGAC	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	4479	90
TP53	7157	broad.mit.edu	37	17	7578456	7578467	+	In_Frame_Del	DEL	GCGGACGCGGGT	-	-	rs139200646;rs121912654		TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578456_7578467delGCGGACGCGGGT	uc002gim.2	-	5	657_668	c.463_474delACCCGCGTCCGC	c.(463-474)ACCCGCGTCCGCdel	p.TRVR155del	TP53_uc002gig.1_In_Frame_Del_p.TRVR155del|TP53_uc002gih.2_In_Frame_Del_p.TRVR155del|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_In_Frame_Del_p.TRVR23del|TP53_uc010cng.1_In_Frame_Del_p.TRVR23del|TP53_uc002gii.1_In_Frame_Del_p.TRVR23del|TP53_uc010cnh.1_In_Frame_Del_p.TRVR155del|TP53_uc010cni.1_In_Frame_Del_p.TRVR155del|TP53_uc002gij.2_In_Frame_Del_p.TRVR155del|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_In_Frame_Del_p.TRVR62del|TP53_uc002gio.2_In_Frame_Del_p.TRVR23del|TP53_uc010vug.1_In_Frame_Del_p.TRVR116del	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	155_158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V157F(139)|p.R158H(58)|p.R158L(55)|p.R156P(24)|p.T155N(19)|p.R158C(17)|p.T155P(14)|p.T155I(10)|p.V157I(10)|p.R156H(10)|p.R158G(10)|p.R158P(9)|p.V157D(8)|p.R156fs*14(8)|p.T155A(7)|p.V157G(7)|p.0?(7)|p.V157L(6)|p.R158R(6)|p.V157V(5)|p.T155T(5)|p.R158fs*12(5)|p.P152fs*14(4)|p.R158_A159insX(4)|p.V157fs*13(3)|p.R156R(3)|p.R156S(3)|p.R156fs*25(3)|p.R156L(3)|p.R156G(3)|p.T155S(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.G154fs*14(2)|p.R158fs*11(2)|p.R156C(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.A159fs*11(1)|p.R65L(1)|p.D148fs*23(1)|p.V157A(1)|p.A159fs*21(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.T155fs*25(1)|p.R156_A161del(1)|p.D148_T155delDSTPPPGT(1)|p.G154_R156delGTR(1)|p.V157_M160delVRAM(1)|p.R156fs*12(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.R158_A159insXX(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156del(1)|p.T155fs*15(1)|p.T155_R156delTR(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*25(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.R158fs*8(1)|p.T155fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGGCCATGGCGCGGACGCGGGTGCCGGGCGGG	0.623	Pancreas(47;798 1329 9957 10801)		111	p.V157F(NCIH1781-Tumor)|p.T155N(NCIH524-Tumor)|p.T155P(DMS153-Tumor)|p.R158H(MOLT16-Tumor)|p.R158L(NCIH747-Tumor)|p.R156P(HTK-Tumor)|p.V157F(DMS454-Tumor)|p.V157F(HS578T-Tumor)|p.R158P(NCIH2110-Tumor)|p.V157F(NCIH2196-Tumor)|p.R158L(NCIH661-Tumor)|p.R158G(SNU1105-Tumor)|p.R156P(HOS-Tumor)|p.R158L(NCIH441-Tumor)|p.V157F(VMRCLCP-Tumor)|p.P152fs(RH41-Tumor)|p.V157F(NCIH2066-Tumor)|p.V157F(NCIH2087-Tumor)|p.R158G(NCIH2170-Tumor)|p.R158H(ST486-Tumor)|p.V157F(CORL88-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.75			56	19		---	---	---	---						capture_indel	In_Frame_Del	DEL	7578456	7578467	TP53	17	GCGGACGCGGGT	-	-	-	1	0	1	0	1	0	0	0	0	483	38	5	5	16264	90
NF1	4763	broad.mit.edu	37	17	29653042	29653043	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29653042_29653043insA	uc002hgg.2	+	37	5373_5374	c.5040_5041insA	c.(5038-5043)TATAACfs	p.Y1680fs	NF1_uc002hgh.2_Frame_Shift_Ins_p.Y1659fs|NF1_uc002hgi.1_Frame_Shift_Ins_p.Y692fs|NF1_uc010cso.2_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1680_1681	CRAL-TRIO.				actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCTATATCTATAACTGTAACTC	0.460					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.85			161	29		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	29653042	29653043	NF1	17	-	A	A	A	1	0	1	1	0	0	0	0	0	634	49	5	5	10263	90
HOXD8	3234	broad.mit.edu	37	2	176996300	176996301	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-06-2569-01	TCGA-06-2569-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:176996300_176996301delAA	uc002uko.2	+	2	1451_1452	c.833_834delAA	c.(832-834)CAAfs	p.Q278fs	uc002ukm.1_5'Flank|HOXD8_uc002ukn.2_Frame_Shift_Del_p.Q94fs|HOXD8_uc002ukp.2_Frame_Shift_Del_p.Q277fs	NM_019558	NP_062458	P13378	HXD8_HUMAN	homeobox D8	278					anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		AAGGAAGCCCAAGAGCTGGAGG	0.426																0.34			25	49		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	176996300	176996301	HOXD8	2	AA	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	7250	90
