Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CASZ1	54897	broad.mit.edu	37	1	10713867	10713867	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10713867C>T	uc001aro.2	-	11	2567	c.2247G>A	c.(2245-2247)GCG>GCA	p.A749A	CASZ1_uc001arp.1_Silent_p.A749A|CASZ1_uc009vmx.2_Silent_p.A773A	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	749					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CAGCCAGGGACGCAGAGGACT	0.667																0.1	4.771534	25.607469	13	117	KEEP	---	---	---	---	7	11	75	62	-1	capture	Silent	SNP	10713867	10713867	CASZ1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2661	95
GLIS1	148979	broad.mit.edu	37	1	54059816	54059816	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:54059816G>A	uc001cvr.1	-	3	1327	c.760C>T	c.(760-762)CGA>TGA	p.R254*		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	254	C2H2-type 2; atypical.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GAGTGCACTCGCATGTGGATG	0.652																0.136364	9.520856	15.153644	6	38	KEEP	---	---	---	---	2	6	21	19	-1	capture	Nonsense_Mutation	SNP	54059816	54059816	GLIS1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	6381	95
ITGA10	8515	broad.mit.edu	37	1	145532131	145532131	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145532131C>T	uc001eoa.2	+	8	851	c.775C>T	c.(775-777)CAG>TAG	p.Q259*	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Nonsense_Mutation_p.Q128*|ITGA10_uc009wiw.2_Nonsense_Mutation_p.Q116*|ITGA10_uc010oyw.1_Nonsense_Mutation_p.Q204*	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	259	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGGGTTCAGTCAGTCCCATGG	0.443					450											0.151351	46.484644	68.021363	28	157	KEEP	---	---	---	---	20	12	93	98	-1	capture	Nonsense_Mutation	SNP	145532131	145532131	ITGA10	1	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	7796	95
CRTC2	200186	broad.mit.edu	37	1	153923904	153923904	+	Silent	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153923904G>A	uc010ped.1	-	11	1306	c.1236C>T	c.(1234-1236)GGC>GGT	p.G412G	CRTC2_uc001fde.3_RNA|CRTC2_uc001fdf.3_Intron	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	412					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGAGGGGGCGCCCAAAACAG	0.592																0.190476	8.410657	10.274091	4	17	KEEP	---	---	---	---	3	2	9	8	-1	capture	Silent	SNP	153923904	153923904	CRTC2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3865	95
C1orf69	200205	broad.mit.edu	37	1	228362896	228362896	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228362896C>T	uc001hsl.3	+	3	842	c.753C>T	c.(751-753)AAC>AAT	p.N251N	C1orf69_uc010pvw.1_Silent_p.N58N	NM_001010867	NP_001010867	Q5T440	CAF17_HUMAN	hypothetical protein LOC200205 precursor	251					glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity				0		Prostate(94;0.0405)				CCTTCATGAACGGCGTGAGCT	0.647																0.057143	-17.094929	18.960673	10	165	KEEP	---	---	---	---	5	7	73	113	-1	capture	Silent	SNP	228362896	228362896	C1orf69	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2039	95
ZNF496	84838	broad.mit.edu	37	1	247464120	247464120	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247464120C>T	uc001ico.2	-	9	1930	c.1465G>A	c.(1465-1467)GAC>AAC	p.D489N	ZNF496_uc009xgv.2_Missense_Mutation_p.D525N|ZNF496_uc001icp.2_Missense_Mutation_p.D489N	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	489					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			TGGAGTCTGTCCGGCTGCAGG	0.642																0.067308	-8.780832	11.508542	7	97	KEEP	---	---	---	---	4	4	46	62	-1	capture	Missense_Mutation	SNP	247464120	247464120	ZNF496	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17824	95
OR2G6	391211	broad.mit.edu	37	1	248685052	248685052	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248685052C>T	uc001ien.1	+	1	105	c.105C>T	c.(103-105)TAC>TAT	p.Y35Y		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	35	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTACTTCTACGTCTTGAGCC	0.463																0.135135	30.836993	49.90027	20	128	KEEP	---	---	---	---	15	8	60	85	-1	capture	Silent	SNP	248685052	248685052	OR2G6	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10904	95
MUC5B	727897	broad.mit.edu	37	11	1283520	1283520	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1283520A>C	uc009ycr.1	+	72	18404	c.18278A>C	c.(18277-18279)GAC>GCC	p.D6093A		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	Error:Variant_position_missing_in_Q9HC84_after_alignment					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCAGTCCAGGACCCCCAGCAG	0.657																0.117647	-8.236015	7.118334	12	90	KEEP	---	---	---	---	18	27	44	57	-1	capture	Missense_Mutation	SNP	1283520	1283520	MUC5B	11	A	C	C	C	1	0	0	0	0	1	0	0	0	118	10	4	4	9889	95
LRRC32	2615	broad.mit.edu	37	11	76371805	76371805	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76371805G>A	uc001oxq.3	-	3	1075	c.832C>T	c.(832-834)CGG>TGG	p.R278W	LRRC32_uc001oxr.3_Missense_Mutation_p.R278W|LRRC32_uc010rsf.1_Missense_Mutation_p.R278W	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	278	LRR 10.|Extracellular (Potential).					integral to plasma membrane					0						GTGGGGAGCCGGATGAGGTTG	0.652																0.122807	18.478805	34.345434	14	100	KEEP	---	---	---	---	5	9	62	53	-1	capture	Missense_Mutation	SNP	76371805	76371805	LRRC32	11	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8903	95
GRAMD1B	57476	broad.mit.edu	37	11	123485469	123485469	+	Silent	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123485469G>A	uc001pyx.2	+	16	2144	c.1815G>A	c.(1813-1815)CGG>CGA	p.R605R	GRAMD1B_uc001pyw.2_Silent_p.R612R|GRAMD1B_uc010rzw.1_Silent_p.R565R|GRAMD1B_uc010rzx.1_Silent_p.R565R|GRAMD1B_uc001pyy.2_Silent_p.R296R	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	605						integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CACAGACGCGGCATATCCCGG	0.537					1503											0.066667	-2.408882	6.348009	3	42	KEEP	---	---	---	---	1	3	27	23	-1	capture	Silent	SNP	123485469	123485469	GRAMD1B	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	6681	95
DDX11	1663	broad.mit.edu	37	12	31236988	31236988	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31236988G>T	uc001rjt.1	+	3	637	c.386G>T	c.(385-387)CGA>CTA	p.R129L	DDX11_uc010sjw.1_Missense_Mutation_p.R129L|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Missense_Mutation_p.R129L|DDX11_uc001rjs.1_Missense_Mutation_p.R129L|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Missense_Mutation_p.R129L|DDX11_uc001rjw.1_Missense_Mutation_p.R103L	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	129	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CTGGTGGACCGACTAAAGGTG	0.587													Multiple Myeloma(12;0.14)			0.092391	4.773881	35.521051	17	167	KEEP	---	---	---	---	8	11	87	115	0.421052631579	capture	Missense_Mutation	SNP	31236988	31236988	DDX11	12	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	4301	95
PTPN11	5781	broad.mit.edu	37	12	112926909	112926909	+	Missense_Mutation	SNP	A	T	T	rs121918470		TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112926909A>T	uc001ttx.2	+	13	1909	c.1529A>T	c.(1528-1530)CAG>CTG	p.Q510L		NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	514	Tyrosine-protein phosphatase.		Q -> P (in LEOPARD1).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.Q510K(2)|p.Q510H(1)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						ACAGAAGCACAGTACCGATTT	0.498					372	Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				0.105023	24.359457	58.327061	23	196	KEEP	---	---	---	---	17	11	109	122	-1	capture	Missense_Mutation	SNP	112926909	112926909	PTPN11	12	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	12675	95
DIAPH3	81624	broad.mit.edu	37	13	60686198	60686198	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:60686198G>T	uc001vht.2	-	3	555	c.336C>A	c.(334-336)AAC>AAA	p.N112K	DIAPH3_uc001vhw.1_Missense_Mutation_p.N101K|DIAPH3_uc010aed.1_Missense_Mutation_p.N101K|DIAPH3_uc010aee.1_Intron	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	112					actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		GCTTTGGAAAGTTCTCCATCA	0.403																0.156977	48.622387	67.92634	27	145	KEEP	---	---	---	---	16	12	61	100	0.571428571429	capture	Missense_Mutation	SNP	60686198	60686198	DIAPH3	13	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	4478	95
MAP3K9	4293	broad.mit.edu	37	14	71205013	71205013	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:71205013G>A	uc001xmm.2	-	8	1793	c.1793C>T	c.(1792-1794)ACG>ATG	p.T598M	MAP3K9_uc010ttk.1_Missense_Mutation_p.T335M|MAP3K9_uc001xmk.2_Missense_Mutation_p.T340M|MAP3K9_uc001xml.2_Missense_Mutation_p.T598M	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase	598					activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		TGGCCCCCACGTCCGTCCCTT	0.488	GBM(114;411 1587 13539 28235 50070)				190											0.12844	15.059924	29.772921	14	95	KEEP	---	---	---	---	9	7	49	58	-1	capture	Missense_Mutation	SNP	71205013	71205013	MAP3K9	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9171	95
AHSA1	10598	broad.mit.edu	37	14	77930956	77930956	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:77930956T>A	uc001xtw.2	+	5	648	c.488T>A	c.(487-489)ATG>AAG	p.M163K	AHSA1_uc010tvk.1_Missense_Mutation_p.M163K	NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase	163					protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ACCCAGGGCATGATCTTACCT	0.468																0.14	13.093109	19.347976	7	43	KEEP	---	---	---	---	3	6	22	32	-1	capture	Missense_Mutation	SNP	77930956	77930956	AHSA1	14	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	418	95
AHSA1	10598	broad.mit.edu	37	14	77930997	77930997	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:77930997G>A	uc001xtw.2	+	5	689	c.529G>A	c.(529-531)GGG>AGG	p.G177R	AHSA1_uc010tvk.1_Missense_Mutation_p.G177R	NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase	177					protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		AGACCCAGTGGGGCAGCCAGC	0.473																0.102041	4.836997	12.574646	5	44	KEEP	---	---	---	---	2	3	25	30	-1	capture	Missense_Mutation	SNP	77930997	77930997	AHSA1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	418	95
RPS6KA5	9252	broad.mit.edu	37	14	91372576	91372576	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:91372576G>A	uc001xys.2	-	8	1089	c.874C>T	c.(874-876)CGT>TGT	p.R292C	RPS6KA5_uc010twi.1_Missense_Mutation_p.R213C|RPS6KA5_uc001xyt.2_Missense_Mutation_p.R292C|RPS6KA5_uc010att.1_RNA	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5	292	Protein kinase 1.				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		ATCAAAAGACGCTGAATTAGG	0.383					302											0.186813	35.13586	43.486397	17	74	KEEP	---	---	---	---	9	9	41	39	-1	capture	Missense_Mutation	SNP	91372576	91372576	RPS6KA5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13546	95
RHBDL1	9028	broad.mit.edu	37	16	726867	726867	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:726867G>A	uc002cis.1	+	2	619	c.592G>A	c.(592-594)GTG>ATG	p.V198M	RHBDL1_uc002cir.1_Missense_Mutation_p.V133M|RHBDL1_uc010uun.1_Missense_Mutation_p.V133M	NM_003961	NP_003952	O75783	RHBL1_HUMAN	rhomboid protease 1	198	Helical; (Potential).				proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.0218)				CCCACCCCCCGTGTTCATGGC	0.667																0.07438	-3.717976	18.788053	9	112	KEEP	---	---	---	---	5	4	72	62	-1	capture	Missense_Mutation	SNP	726867	726867	RHBDL1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13213	95
NOD2	64127	broad.mit.edu	37	16	50733737	50733737	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50733737C>G	uc002egm.1	+	2	517	c.412C>G	c.(412-414)CGG>GGG	p.R138G	NOD2_uc010cbj.1_Missense_Mutation_p.R111G|NOD2_uc010cbk.1_Missense_Mutation_p.R111G|NOD2_uc002egl.1_5'UTR	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	138	CARD 2.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				GCAGAGTCACCGGCCAGCCAT	0.632																0.069307	-3.401921	15.9045	7	94	KEEP	---	---	---	---	5	4	44	65	-1	capture	Missense_Mutation	SNP	50733737	50733737	NOD2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	295	23	4	4	10424	95
GPR56	9289	broad.mit.edu	37	16	57688009	57688009	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57688009C>T	uc002emb.2	+	6	1024	c.732C>T	c.(730-732)GCC>GCT	p.A244A	GPR56_uc002elz.1_Silent_p.A74A|GPR56_uc002ema.1_Silent_p.A69A|GPR56_uc002emc.2_Silent_p.A244A|GPR56_uc002emf.2_Silent_p.A244A|GPR56_uc010vhs.1_Silent_p.A244A|GPR56_uc002emd.2_Silent_p.A244A|GPR56_uc002eme.2_Silent_p.A244A|GPR56_uc010vht.1_Silent_p.A249A|GPR56_uc002emg.3_Silent_p.A244A|GPR56_uc010vhu.1_Silent_p.A69A	NM_005682	NP_005673	Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56 isoform a	244	Extracellular (Potential).				brain development|cell adhesion|cell-cell signaling|neuropeptide signaling pathway	integral to plasma membrane	G-protein coupled receptor activity				0						AGCCCACAGCCGGCCTCCAGG	0.662																0.114583	11.418522	25.433205	11	85	KEEP	---	---	---	---	7	4	45	46	-1	capture	Silent	SNP	57688009	57688009	GPR56	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6633	95
KRT35	3886	broad.mit.edu	37	17	39637191	39637191	+	Silent	SNP	T	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39637191T>A	uc002hws.2	-	1	202	c.159A>T	c.(157-159)TCA>TCT	p.S53S		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	53	Head.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				CCAGACCCACTGAGCAGGCAG	0.632																0.162791	26.993442	36.290727	14	72	KEEP	---	---	---	---	5	10	30	48	-1	capture	Silent	SNP	39637191	39637191	KRT35	17	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	8392	95
PTPRM	5797	broad.mit.edu	37	18	8244151	8244151	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:8244151G>A	uc002knn.3	+	15	2899	c.2396G>A	c.(2395-2397)GGC>GAC	p.G799D	PTPRM_uc010dkv.2_Missense_Mutation_p.G799D|PTPRM_uc010wzl.1_Missense_Mutation_p.G586D	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	799	Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				GCTGAGCAGGGCACAAACTGC	0.483																0.037037	-17.740614	7.28955	4	104	KEEP	---	---	---	---	3	3	54	58	-1	capture	Missense_Mutation	SNP	8244151	8244151	PTPRM	18	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12701	95
PPP4R1	9989	broad.mit.edu	37	18	9570482	9570482	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:9570482G>A	uc002koe.1	-	11	1364	c.1246C>T	c.(1246-1248)CAG>TAG	p.Q416*	PPP4R1_uc002kof.2_5'UTR|PPP4R1_uc010wzo.1_Nonsense_Mutation_p.Q262*|PPP4R1_uc002kod.1_Nonsense_Mutation_p.Q399*|PPP4R1_uc010wzp.1_RNA	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	416					protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						GCTGCTTCCTGGTGAGATTCT	0.443	Melanoma(188;1232 2082 5061 11948 35994)															0.228916	47.781296	53.375404	19	64	KEEP	---	---	---	---	11	8	29	41	-1	capture	Nonsense_Mutation	SNP	9570482	9570482	PPP4R1	18	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	12304	95
NPC1	4864	broad.mit.edu	37	18	21120489	21120489	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21120489C>T	uc002kum.3	-	17	2801	c.2527G>A	c.(2527-2529)GTG>ATG	p.V843M	NPC1_uc010xaz.1_Missense_Mutation_p.V576M|NPC1_uc010xba.1_Missense_Mutation_p.V688M	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	843	Helical; (Potential).				autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGAACACCCACAAATATTGCT	0.363																0.12	5.910759	12.999143	6	44	KEEP	---	---	---	---	2	5	24	30	-1	capture	Missense_Mutation	SNP	21120489	21120489	NPC1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	10477	95
KIAA1012	22878	broad.mit.edu	37	18	29487454	29487454	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29487454T>G	uc002kxc.3	-	9	1722	c.1358A>C	c.(1357-1359)GAT>GCT	p.D453A	KIAA1012_uc002kxb.3_Missense_Mutation_p.D399A|KIAA1012_uc002kxd.3_RNA|KIAA1012_uc002kxe.2_Missense_Mutation_p.D453A	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	453					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						CATTGCTTGATCATTAAGAAA	0.338																0.140351	17.36216	24.477899	8	49	KEEP	---	---	---	---	3	5	27	25	-1	capture	Missense_Mutation	SNP	29487454	29487454	KIAA1012	18	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	8126	95
CREB3L3	84699	broad.mit.edu	37	19	4164609	4164609	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4164609C>T	uc002lzl.2	+	5	802	c.686C>T	c.(685-687)ACC>ATC	p.T229I	CREB3L3_uc002lzm.2_Missense_Mutation_p.T219I|CREB3L3_uc010xib.1_Missense_Mutation_p.T218I|CREB3L3_uc010xic.1_Missense_Mutation_p.T220I	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	229	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGGCATCACCCTGCCCACT	0.617																0.0625	-6.893917	9.080923	5	75	KEEP	---	---	---	---	3	3	26	54	-1	capture	Missense_Mutation	SNP	4164609	4164609	CREB3L3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	3823	95
DNAJB1	3337	broad.mit.edu	37	19	14627500	14627500	+	Silent	SNP	T	C	C	rs143985567	byFrequency	TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14627500T>C	uc002myz.1	-	2	610	c.570A>G	c.(568-570)CTA>CTG	p.L190L	DNAJB1_uc010xnr.1_Silent_p.L90L	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	190					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		CGTCGGGGTTTAGCCGCTTGT	0.483																0.015291	-77.511978	9.663727	5	322	KEEP	---	---	---	---	3	4	171	196	-1	capture	Silent	SNP	14627500	14627500	DNAJB1	19	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	4571	95
LILRB5	10990	broad.mit.edu	37	19	54760357	54760357	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54760357G>A	uc002qex.2	-	3	461	c.350C>T	c.(349-351)GCG>GTG	p.A117V	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.A117V|LILRB5_uc002qey.2_Missense_Mutation_p.A117V|LILRB5_uc002qez.2_Missense_Mutation_p.A117V|LILRB5_uc002qfa.1_Missense_Mutation_p.A107V|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	117	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTCACCTGTCGCCACCAGCTC	0.637																0.126829	35.26996	62.981577	26	179	KEEP	---	---	---	---	12	15	95	98	-1	capture	Missense_Mutation	SNP	54760357	54760357	LILRB5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8714	95
DPP10	57628	broad.mit.edu	37	2	116593818	116593818	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116593818A>T	uc002tla.1	+	22	2493	c.2036A>T	c.(2035-2037)GAC>GTC	p.D679V	DPP10_uc002tlb.1_Missense_Mutation_p.D629V|DPP10_uc002tlc.1_Missense_Mutation_p.D675V|DPP10_uc002tle.2_Missense_Mutation_p.D683V|DPP10_uc002tlf.1_Missense_Mutation_p.D672V	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	679	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						CCTATCACAGACTTGAAATTG	0.368																0.25	22.657981	24.703061	9	27	KEEP	---	---	---	---	7	5	14	17	-1	capture	Missense_Mutation	SNP	116593818	116593818	DPP10	2	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	4682	95
WDR33	55339	broad.mit.edu	37	2	128484320	128484320	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128484320C>T	uc002tpg.1	-	8	939	c.756G>A	c.(754-756)TGG>TGA	p.W252*		NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN	WD repeat domain 33 isoform 1	252	WD 4.				postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TGGTTGGATGCCAGTCTACAC	0.408																0.028369	-27.012365	7.516156	4	137	KEEP	---	---	---	---	1	4	65	88	-1	capture	Nonsense_Mutation	SNP	128484320	128484320	WDR33	2	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	17168	95
HOXD10	3236	broad.mit.edu	37	2	176981726	176981726	+	Silent	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:176981726G>A	uc002ukj.2	+	1	235	c.165G>A	c.(163-165)CCG>CCA	p.P55P		NM_002148	NP_002139	P28358	HXD10_HUMAN	homeobox D10	55						nucleus	sequence-specific DNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GACTGCTCCCGTCTCTGGCCA	0.488					294											0.078261	-2.201296	18.699154	9	106	KEEP	---	---	---	---	1	8	43	75	-1	capture	Silent	SNP	176981726	176981726	HOXD10	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7244	95
PLEKHM3	389072	broad.mit.edu	37	2	208841462	208841462	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208841462G>A	uc002vcl.2	-	3	1949	c.1459C>T	c.(1459-1461)CGC>TGC	p.R487C	PLEKHM3_uc002vcm.2_Missense_Mutation_p.R487C	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	487					intracellular signal transduction		metal ion binding			ovary(1)	1						ACAGATTGGCGTTTGTTCTTC	0.478																0.142857	14.434435	22.176817	9	54	KEEP	---	---	---	---	4	6	30	28	-1	capture	Missense_Mutation	SNP	208841462	208841462	PLEKHM3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11985	95
CCDC108	255101	broad.mit.edu	37	2	219874081	219874081	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219874081G>C	uc002vjl.1	-	28	4638	c.4554C>G	c.(4552-4554)GAC>GAG	p.D1518E		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1518						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCATACCAGGTCTGCACTGT	0.587																0.058333	-6.075892	18.454362	7	113	KEEP	---	---	---	---	5	3	53	75	-1	capture	Missense_Mutation	SNP	219874081	219874081	CCDC108	2	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	2717	95
RBM44	375316	broad.mit.edu	37	2	238738022	238738022	+	Silent	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238738022G>A	uc002vxi.3	+	13	2898	c.2766G>A	c.(2764-2766)TCG>TCA	p.S922S		NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	921							nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GAATTAGTTCGAATAATTTAG	0.388																0.217391	23.426872	26.813114	10	36	KEEP	---	---	---	---	6	4	21	19	-1	capture	Silent	SNP	238738022	238738022	RBM44	2	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	13033	95
NOP56	10528	broad.mit.edu	37	20	2633552	2633552	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2633552A>T	uc002wgh.2	+	2	121	c.68A>T	c.(67-69)GAG>GTG	p.E23V	NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_5'Flank|SNORD110_uc002wgj.2_5'Flank|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A	23					rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						AAGGAAGTGGAGGAGATCAGT	0.677																0.162791	11.387716	16.054563	7	36	KEEP	---	---	---	---	4	5	20	21	-1	capture	Missense_Mutation	SNP	2633552	2633552	NOP56	20	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	10446	95
LBP	3929	broad.mit.edu	37	20	36992652	36992652	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36992652G>A	uc002xic.1	+	7	711	c.676G>A	c.(676-678)GCC>ACC	p.A226T		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	226					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				TGACAGTTTCGCCGACATTGA	0.562																0.051282	-8.965485	7.665638	4	74	KEEP	---	---	---	---	3	2	46	41	-1	capture	Missense_Mutation	SNP	36992652	36992652	LBP	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8571	95
WFDC9	259240	broad.mit.edu	37	20	44237357	44237357	+	Missense_Mutation	SNP	G	A	A	rs139643257	byFrequency;by1000genomes	TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44237357G>A	uc002xoy.2	-	4	402	c.184C>T	c.(184-186)CGT>TGT	p.R62C		NM_147198	NP_671731	Q8NEX5	WFDC9_HUMAN	protease inhibitor WAP9 precursor	62						extracellular region					0		Myeloproliferative disorder(115;0.0122)				TGATTTGGACGTACACAAGTC	0.453																0.095238	2.682849	19.976621	10	95	KEEP	---	---	---	---	7	3	38	71	-1	capture	Missense_Mutation	SNP	44237357	44237357	WFDC9	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17238	95
TP53RK	112858	broad.mit.edu	37	20	45315631	45315631	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:45315631C>A	uc002xsk.2	-	2	746	c.523G>T	c.(523-525)GAA>TAA	p.E175*	SLC13A3_uc002xsg.1_5'Flank|SLC13A3_uc010gho.1_5'Flank|TP53RK_uc002xsj.2_3'UTR	NM_033550	NP_291028	Q96S44	PRPK_HUMAN	p53-related protein kinase	175	Protein kinase.				lipopolysaccharide biosynthetic process	membrane|nucleus	ATP binding|p53 binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0		Myeloproliferative disorder(115;0.0122)				TTCAGCTGTTCCAGGGGGGGT	0.498					20											0.128788	21.176443	38.901498	17	115	KEEP	---	---	---	---	8	11	58	66	0.578947368421	capture	Nonsense_Mutation	SNP	45315631	45315631	TP53RK	20	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	16273	95
SFRS15	57466	broad.mit.edu	37	21	33074598	33074598	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33074598C>T	uc002ypd.2	-	5	842	c.416G>A	c.(415-417)AGT>AAT	p.S139N	SFRS15_uc002ype.2_Missense_Mutation_p.S139N|SFRS15_uc010glu.2_Missense_Mutation_p.S124N|SFRS15_uc002ypf.1_5'Flank|SFRS15_uc002ypg.2_Missense_Mutation_p.S139N	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	139	CID.					nucleus	nucleotide binding|RNA binding				0						GGCTGCATTACTGGTTCCCGC	0.388																0.084034	4.061616	24.965702	10	109	KEEP	---	---	---	---	4	7	55	65	-1	capture	Missense_Mutation	SNP	33074598	33074598	SFRS15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	14064	95
CAND2	23066	broad.mit.edu	37	3	12858462	12858462	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12858462C>T	uc003bxk.2	+	10	2080	c.2031C>T	c.(2029-2031)GAC>GAT	p.D677D	CAND2_uc003bxj.2_Silent_p.D584D	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	677	HEAT 14.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						CAGCCCTGGACGCCCTGGCCC	0.662	GBM(43;676 868 1633 6395 37496)															0.115385	8.829417	20.190737	9	69	KEEP	---	---	---	---	4	5	30	45	-1	capture	Silent	SNP	12858462	12858462	CAND2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2592	95
ZIC4	84107	broad.mit.edu	37	3	147113783	147113783	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:147113783C>G	uc003ewd.1	-	3	817	c.544G>C	c.(544-546)GGA>CGA	p.G182R	ZIC4_uc003ewc.1_Missense_Mutation_p.G112R|ZIC4_uc011bno.1_Missense_Mutation_p.G232R	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	182	C2H2-type 2; atypical.					nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						AAGGGCTTTCCCTGGCGCGGA	0.597																0.12892	54.464839	92.966446	37	250	KEEP	---	---	---	---	20	22	124	163	-1	capture	Missense_Mutation	SNP	147113783	147113783	ZIC4	3	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	17561	95
MECOM	2122	broad.mit.edu	37	3	168834185	168834185	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168834185G>A	uc003ffi.3	-	7	1180	c.911C>T	c.(910-912)CCT>CTT	p.P304L	MECOM_uc010hwk.1_Missense_Mutation_p.P327L|MECOM_uc003ffj.3_Missense_Mutation_p.P369L|MECOM_uc011bpi.1_Missense_Mutation_p.P305L|MECOM_uc003ffn.3_Missense_Mutation_p.P304L|MECOM_uc003ffk.2_Missense_Mutation_p.P304L|MECOM_uc003ffl.2_Missense_Mutation_p.P464L|MECOM_uc011bpj.1_Missense_Mutation_p.P492L|MECOM_uc011bpk.1_Missense_Mutation_p.P294L|MECOM_uc010hwn.2_Missense_Mutation_p.P492L	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	304					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						AAACAGACCAGGGAAGCTAAA	0.473					646											0.171875	24.782961	31.295964	11	53	KEEP	---	---	---	---	4	8	26	31	-1	capture	Missense_Mutation	SNP	168834185	168834185	MECOM	3	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9335	95
NAALADL2	254827	broad.mit.edu	37	3	174951839	174951839	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:174951839G>A	uc003fit.2	+	3	751	c.664G>A	c.(664-666)GAT>AAT	p.D222N	NAALADL2_uc003fiu.1_Missense_Mutation_p.D215N|NAALADL2_uc010hwy.1_Missense_Mutation_p.D44N	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	222	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TGTGCTGCTTGATCTGCCAGG	0.443																0.121622	10.81869	21.202676	9	65	KEEP	---	---	---	---	4	8	45	34	-1	capture	Missense_Mutation	SNP	174951839	174951839	NAALADL2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	10040	95
GNRHR	2798	broad.mit.edu	37	4	68606377	68606377	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68606377C>T	uc003hdn.2	-	3	2559	c.808G>A	c.(808-810)GTT>ATT	p.V270I	LOC550112_uc003hdl.3_Intron|GNRHR_uc003hdm.2_Missense_Mutation_p.G227D|uc003hdo.1_5'Flank	NM_000406	NP_000397	P30968	GNRHR_HUMAN	gonadotropin-releasing hormone receptor isoform	270	Cytoplasmic (Potential).				multicellular organismal development	integral to plasma membrane	gonadotropin-releasing hormone receptor activity			ovary(1)	1					Abarelix(DB00106)|Cetrorelix(DB00050)|Danazol(DB01406)|Gonadorelin(DB00644)|Leuprolide(DB00007)|Nafarelin(DB00666)	GCAAATGCAACCGTCATTTTT	0.408																0.151659	53.760456	78.28137	32	179	KEEP	---	---	---	---	14	24	90	120	-1	capture	Missense_Mutation	SNP	68606377	68606377	GNRHR	4	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	6485	95
PITX2	5308	broad.mit.edu	37	4	111539460	111539460	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111539460T>C	uc003iad.2	-	5	1357	c.775A>G	c.(775-777)ACG>GCG	p.T259A	PITX2_uc003iac.2_Missense_Mutation_p.T266A|PITX2_uc003iae.2_Missense_Mutation_p.T213A|PITX2_uc010iml.2_Missense_Mutation_p.T130A|PITX2_uc003iaf.2_Missense_Mutation_p.T259A	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	259					determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		CAGGCAGGCGTCGGCACCGCG	0.592																0.148148	22.868605	32.475799	12	69	KEEP	---	---	---	---	8	6	30	46	-1	capture	Missense_Mutation	SNP	111539460	111539460	PITX2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	11858	95
PCDHGB1	56104	broad.mit.edu	37	5	140730012	140730012	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140730012G>A	uc003ljo.1	+	1	185	c.185G>A	c.(184-186)CGA>CAA	p.R62Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Missense_Mutation_p.R62Q	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	62	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGCCAACTCGAAAACTGCGG	0.522														OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.095238	3.707785	14.0621	6	57	KEEP	---	---	---	---	2	4	21	38	-1	capture	Missense_Mutation	SNP	140730012	140730012	PCDHGB1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11465	95
MFAP3	4238	broad.mit.edu	37	5	153432941	153432941	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:153432941G>A	uc003lvf.2	+	3	1273	c.757G>A	c.(757-759)GAG>AAG	p.E253K	MFAP3_uc010jib.2_Missense_Mutation_p.E253K|MFAP3_uc011ddb.1_Missense_Mutation_p.E107K	NM_001135037	NP_001128509	P55082	MFAP3_HUMAN	microfibrillar-associated protein 3 isoform 2	253	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)		AGCCTTTGTTGAGGAGATGTT	0.453																0.081633	-0.239754	8.495405	4	45	KEEP	---	---	---	---	0	5	30	17	-1	capture	Missense_Mutation	SNP	153432941	153432941	MFAP3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9427	95
EBF1	1879	broad.mit.edu	37	5	158140123	158140123	+	Silent	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:158140123G>A	uc010jip.2	-	13	1526	c.1224C>T	c.(1222-1224)GCC>GCT	p.A408A	EBF1_uc011ddw.1_Silent_p.A276A|EBF1_uc011ddx.1_Silent_p.A409A|EBF1_uc003lxl.3_Silent_p.A377A	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	408					multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAGGGCCTCGGCAATGTCGG	0.522						T	HMGA2	lipoma								0.196721	28.870242	34.093093	12	49	KEEP	---	---	---	---	4	9	18	35	-1	capture	Silent	SNP	158140123	158140123	EBF1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4835	95
BTNL3	10917	broad.mit.edu	37	5	180432547	180432547	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180432547G>A	uc003mmr.2	+	8	1204	c.1076G>A	c.(1075-1077)CGG>CAG	p.R359Q	BTNL3_uc010jlp.2_Missense_Mutation_p.R144Q	NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	359	B30.2/SPRY.|Cytoplasmic (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			GGAGTGTGTCGGGATGACGTA	0.478																0.147826	30.411491	44.096348	17	98	KEEP	---	---	---	---	9	8	64	47	-1	capture	Missense_Mutation	SNP	180432547	180432547	BTNL3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1554	95
ROS1	6098	broad.mit.edu	37	6	117679033	117679033	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117679033G>T	uc003pxp.1	-	24	3987	c.3788C>A	c.(3787-3789)CCC>CAC	p.P1263H	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1263	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CACCTCTCTGGGATATTTCAC	0.318					1038	T	GOPC|ROS1	glioblastoma|NSCLC								0.2	15.305671	18.235038	7	28	KEEP	---	---	---	---	2	6	15	16	0.25	capture	Missense_Mutation	SNP	117679033	117679033	ROS1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	13423	95
CRHR2	1395	broad.mit.edu	37	7	30693212	30693212	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30693212C>T	uc003tbn.2	-	12	1344	c.1100G>A	c.(1099-1101)CGC>CAC	p.R367H	CRHR2_uc010kvw.1_3'UTR|CRHR2_uc010kvx.1_Missense_Mutation_p.R366H|CRHR2_uc010kvy.1_Missense_Mutation_p.R203H|CRHR2_uc003tbo.2_Missense_Mutation_p.R353H|CRHR2_uc003tbp.2_Missense_Mutation_p.R394H	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	367	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						CACGGCTGAGCGCACCTGTGG	0.642																0.116788	18.423173	38.197578	16	121	KEEP	---	---	---	---	6	11	70	58	-1	capture	Missense_Mutation	SNP	30693212	30693212	CRHR2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3837	95
DDX56	54606	broad.mit.edu	37	7	44611162	44611162	+	Silent	SNP	C	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44611162C>A	uc003tlg.2	-	6	1462	c.819G>T	c.(817-819)CGG>CGT	p.R273R	DDX56_uc003tle.2_RNA|DDX56_uc003tlf.2_Silent_p.R209R|DDX56_uc003tlh.2_RNA|DDX56_uc010kyg.2_Silent_p.R273R|DDX56_uc010kyh.1_RNA	NM_019082	NP_061955	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 56	273	Helicase C-terminal.				rRNA processing	nucleolus	ATP binding|ATP-dependent RNA helicase activity|identical protein binding|RNA binding			upper_aerodigestive_tract(1)	1						ACAGGCGTAGCCGGTAACTCC	0.522																0.11194	13.8335	33.766713	15	119	KEEP	---	---	---	---	8	7	58	68	0.466666666667	capture	Silent	SNP	44611162	44611162	DDX56	7	C	A	A	A	1	0	0	0	0	0	0	0	1	327	26	4	4	4332	95
GTF2IRD2	84163	broad.mit.edu	37	7	74212399	74212399	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:74212399C>T	uc003ubd.1	-	16	1636	c.1452G>A	c.(1450-1452)GAG>GAA	p.E484E	GTF2IRD2_uc010lbt.1_Silent_p.E31E	NM_173537	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	484					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						cgtgaagcttctcgtcacgca	0.000	NSCLC(40;560 1096 7501 40315 49546)															0.130909	50.717336	87.144831	36	239	KEEP	---	---	---	---	16	22	124	132	-1	capture	Silent	SNP	74212399	74212399	GTF2IRD2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	6798	95
CCL24	6369	broad.mit.edu	37	7	75442664	75442664	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75442664G>C	uc011kga.1	-	2	151	c.151C>G	c.(151-153)CAG>GAG	p.Q51E		NM_002991	NP_002982	O00175	CCL24_HUMAN	small inducible cytokine A24 precursor	51					cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						CTGGACAGCTGGTAGCTGACC	0.562																0.095238	9.666979	26.934162	10	95	KEEP	---	---	---	---	3	7	41	62	-1	capture	Missense_Mutation	SNP	75442664	75442664	CCL24	7	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	2869	95
CDHR3	222256	broad.mit.edu	37	7	105660961	105660961	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:105660961C>T	uc003vdl.3	+	13	1904	c.1796C>T	c.(1795-1797)CCC>CTC	p.P599L	CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Missense_Mutation_p.P586L|CDHR3_uc011klt.1_Missense_Mutation_p.P511L|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	599	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GATTCCAGCCCCAGATCTTTC	0.488																0.102362	12.197536	32.195991	13	114	KEEP	---	---	---	---	9	4	61	77	-1	capture	Missense_Mutation	SNP	105660961	105660961	CDHR3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3091	95
KEL	3792	broad.mit.edu	37	7	142643377	142643377	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142643377C>T	uc003wcb.2	-	11	1441	c.1231G>A	c.(1231-1233)GTG>ATG	p.V411M		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	411	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GTCTCCTCCACGCACTTCATC	0.567																0.130435	8.923648	15.030103	6	40	KEEP	---	---	---	---	6	1	18	31	-1	capture	Missense_Mutation	SNP	142643377	142643377	KEL	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8064	95
SOX7	83595	broad.mit.edu	37	8	10583649	10583649	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10583649G>A	uc003wtf.2	-	2	845	c.766C>T	c.(766-768)CCC>TCC	p.P256S	SOX7_uc011kwz.1_Missense_Mutation_p.P308S	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	256					endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)		GAGCCCAGGGGGTGGCTACAG	0.692																0.102041	8.173583	23.650638	10	88	KEEP	---	---	---	---	4	7	34	65	-1	capture	Missense_Mutation	SNP	10583649	10583649	SOX7	8	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14848	95
HGSNAT	138050	broad.mit.edu	37	8	43048945	43048945	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:43048945G>C	uc003xpx.3	+	14	1471	c.1423G>C	c.(1423-1425)GGC>CGC	p.G475R		NM_152419	NP_689632	Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	503	Helical; (Potential).				lysosomal transport|protein oligomerization	integral to membrane|lysosomal membrane	heparan-alpha-glucosaminide N-acetyltransferase activity				0	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GGGCATCCTGGGCACCATCAA	0.428																0.061538	-10.311574	15.799943	8	122	KEEP	---	---	---	---	2	6	61	86	-1	capture	Missense_Mutation	SNP	43048945	43048945	HGSNAT	8	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	7013	95
ENPP2	5168	broad.mit.edu	37	8	120628516	120628516	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120628516C>T	uc003yot.1	-	8	852	c.766G>A	c.(766-768)GGA>AGA	p.G256R	ENPP2_uc003yos.1_Missense_Mutation_p.G256R|ENPP2_uc010mdd.1_Missense_Mutation_p.G256R	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	256					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GGTTGACCTCCCCACCATCTA	0.378	Melanoma(20;305 879 2501 4818 31020)															0.126582	13.592859	24.344728	10	69	KEEP	---	---	---	---	5	6	42	40	-1	capture	Missense_Mutation	SNP	120628516	120628516	ENPP2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5085	95
HAS2	3037	broad.mit.edu	37	8	122626452	122626452	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:122626452T>C	uc003yph.2	-	4	2094	c.1556A>G	c.(1555-1557)TAT>TGT	p.Y519C		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	519	Helical; Name=7; (Potential).					integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			ATAGCATGCATAGAGCAACGT	0.418																0.13245	40.603494	60.404458	20	131	KEEP	---	---	---	---	5	15	66	75	-1	capture	Missense_Mutation	SNP	122626452	122626452	HAS2	8	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	6889	95
FAM49B	51571	broad.mit.edu	37	8	130866513	130866513	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:130866513G>A	uc003yss.2	-	10	1064	c.515C>T	c.(514-516)CCG>CTG	p.P172L	FAM49B_uc003yst.2_Missense_Mutation_p.P172L|FAM49B_uc003ysu.2_Missense_Mutation_p.P172L|FAM49B_uc003ysv.2_Missense_Mutation_p.P26L|FAM49B_uc003ysw.2_Missense_Mutation_p.P172L|FAM49B_uc003ysx.2_Missense_Mutation_p.P172L|FAM49B_uc003ysy.1_Missense_Mutation_p.P172L	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571	172											0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			TTAACTTACCGGTACATTGTT	0.348																0.171875	23.286713	29.797278	11	53	KEEP	---	---	---	---	4	10	30	29	-1	capture	Missense_Mutation	SNP	130866513	130866513	FAM49B	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5524	95
GSN	2934	broad.mit.edu	37	9	124062285	124062285	+	Splice_Site	SNP	T	G	G			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124062285T>G	uc004blf.1	+	1	205	c.144_splice	c.e1+2	p.R48_splice	GSN_uc004bld.1_Intron|GSN_uc010mvq.1_Intron|GSN_uc010mvr.1_Intron|GSN_uc010mvu.1_Intron|GSN_uc010mvt.1_Intron|GSN_uc010mvs.1_Intron|GSN_uc004ble.1_Intron|GSN_uc010mvv.1_Intron|GSN_uc011lyh.1_Intron|GSN_uc011lyi.1_Intron|GSN_uc011lyj.1_5'Flank	NM_000177	NP_000168	P06396	GELS_HUMAN	gelsolin isoform a precursor						actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3						gaggcgcgggtgagtgcccgg	0.348																0.296296	5.313474	6.439973	8	19	KEEP	---	---	---	---	5	10	8	11	-1	capture	Splice_Site	SNP	124062285	124062285	GSN	9	T	G	G	G	1	0	0	0	0	0	0	1	0	767	59	5	4	6757	95
ABL1	25	broad.mit.edu	37	9	133760582	133760582	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133760582G>A	uc004bzw.2	+	11	2908	c.2905G>A	c.(2905-2907)GCC>ACC	p.A969T	ABL1_uc004bzv.2_Missense_Mutation_p.A988T	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	969	F-actin-binding.|Pro-rich.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	GCCACAGTCCGCCAAGCCGTC	0.667					381	T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								0.032258	-22.855005	6.752019	4	120	KEEP	---	---	---	---	4	1	59	73	-1	capture	Missense_Mutation	SNP	133760582	133760582	ABL1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	92	95
RXRA	6256	broad.mit.edu	37	9	137300840	137300840	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137300840C>T	uc004cfb.2	+	4	647	c.485C>T	c.(484-486)ACG>ATG	p.T162M	RXRA_uc004cfc.1_Missense_Mutation_p.T65M	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha	162	Nuclear receptor.				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)	TTCAAGCGGACGGTGCGCAAG	0.647				p.T162M(ISHIKAWAHERAKLIO02ER-Tumor)	303											0.103139	13.796827	48.7254	23	200	KEEP	---	---	---	---	16	10	106	117	-1	capture	Missense_Mutation	SNP	137300840	137300840	RXRA	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13655	95
VCX3B	425054	broad.mit.edu	37	X	8433593	8433593	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:8433593G>C	uc010ndo.2	+	2	409	c.102G>C	c.(100-102)AAG>AAC	p.K34N	VCX3B_uc011mht.1_Missense_Mutation_p.K34N|VCX3B_uc004csd.1_Missense_Mutation_p.K34N	NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	34						nucleolus					0						CGAAGAAGAAGGTGAGTGACC	0.632																0.1	6.461379	32.08435	16	144	KEEP	---	---	---	---	8	10	157	169	-1	capture	Missense_Mutation	SNP	8433593	8433593	VCX3B	23	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	17027	95
USP9X	8239	broad.mit.edu	37	X	41075424	41075424	+	Silent	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41075424G>A	uc004dfb.2	+	35	6237	c.5604G>A	c.(5602-5604)GTG>GTA	p.V1868V	USP9X_uc004dfc.2_Silent_p.V1868V	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	1868					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						TTGTGGGTGTGCTCGTACACA	0.448	Ovarian(172;1807 2695 35459 49286)															0.074074	-4.830473	20.304409	10	125	KEEP	---	---	---	---	4	8	59	82	-1	capture	Silent	SNP	41075424	41075424	USP9X	23	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	16972	95
TEX11	56159	broad.mit.edu	37	X	69902635	69902635	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69902635G>A	uc004dyl.2	-	15	1252	c.1090C>T	c.(1090-1092)CGT>TGT	p.R364C	TEX11_uc004dyk.2_Missense_Mutation_p.R39C|TEX11_uc004dym.2_Missense_Mutation_p.R349C	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	364							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					GACTTAAAACGTTCATGAATA	0.358																0.2	17.479023	20.826976	8	32	KEEP	---	---	---	---	7	3	20	17	-1	capture	Missense_Mutation	SNP	69902635	69902635	TEX11	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15659	95
FHL1	2273	broad.mit.edu	37	X	135291466	135291466	+	Silent	SNP	C	T	T			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135291466C>T	uc004ezo.2	+	6	853	c.753C>T	c.(751-753)CAC>CAT	p.H251H	FHL1_uc010nrz.2_Intron|FHL1_uc004ezm.2_Intron|FHL1_uc004ezl.2_Intron|FHL1_uc004ezq.2_Intron|FHL1_uc011mvy.1_Intron|FHL1_uc011mvz.1_Intron|FHL1_uc004ezn.2_Intron|FHL1_uc011mwa.1_Intron|FHL1_uc011mwb.1_Intron|FHL1_uc004ezp.2_Intron|FHL1_uc004ezr.2_Intron	NM_001159702	NP_001153174	Q13642	FHL1_HUMAN	four and a half LIM domains 1 isoform 1	251					cell differentiation|cell growth|muscle organ development|organ morphogenesis	cytosol|nucleus|plasma membrane	protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(192;0.000127)					CAGTGTGCCACGGGAAACGCT	0.552														OREG0019943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.068182	-4.598555	12.361193	6	82	KEEP	---	---	---	---	2	5	40	57	-1	capture	Silent	SNP	135291466	135291466	FHL1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5824	95
SLITRK2	84631	broad.mit.edu	37	X	144905002	144905002	+	Silent	SNP	T	C	C			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:144905002T>C	uc004fcd.2	+	5	2049	c.1059T>C	c.(1057-1059)AAT>AAC	p.N353N	SLITRK2_uc010nsp.2_Silent_p.N353N|SLITRK2_uc010nso.2_Silent_p.N353N|SLITRK2_uc011mwq.1_Silent_p.N353N|SLITRK2_uc011mwr.1_Silent_p.N353N|SLITRK2_uc011mws.1_Silent_p.N353N|SLITRK2_uc004fcg.2_Silent_p.N353N|SLITRK2_uc011mwt.1_Silent_p.N353N	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	353	Extracellular (Potential).|LRRNT.					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					GCTCAGACAATGGTCTGAATG	0.493																0.151163	23.118536	33.144906	13	73	KEEP	---	---	---	---	6	9	41	40	-1	capture	Silent	SNP	144905002	144905002	SLITRK2	23	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	14635	95
PLXNA3	55558	broad.mit.edu	37	X	153689599	153689599	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153689599C>A	uc004flm.2	+	3	928	c.755C>A	c.(754-756)ACA>AAA	p.T252K		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	252	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGTTGGACACAGCGGGCGAG	0.567																0.116022	25.237218	51.515663	21	160	KEEP	---	---	---	---	10	12	73	105	0.545454545455	capture	Missense_Mutation	SNP	153689599	153689599	PLXNA3	23	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12024	95
INADL	10207	broad.mit.edu	37	1	62228837	62228837	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62228837delC	uc001dab.2	+	3	289	c.175delC	c.(175-177)CAAfs	p.Q59fs	INADL_uc009waf.1_Frame_Shift_Del_p.Q59fs|INADL_uc001daa.2_Frame_Shift_Del_p.Q59fs	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	59	L27.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GTCCATCAAGCAACTGAAGGG	0.363																0.10			7	62		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	62228837	62228837	INADL	1	C	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	7654	95
PTEN	5728	broad.mit.edu	37	10	89720831	89720831	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720831delG	uc001kfb.2	+	9	2013	c.982delG	c.(982-984)GCAfs	p.A328fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	328	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.A328fs*15(1)|p.W274_F341del(1)|p.A328fs*1(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TCTTGACAAAGCAAATAAAGA	0.333			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.19			14	58		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89720831	89720831	PTEN	10	G	-	-	-	1	0	1	0	1	0	0	0	0	442	34	5	5	12633	95
SENP8	123228	broad.mit.edu	37	15	72432087	72432090	+	Frame_Shift_Del	DEL	CAGT	-	-			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72432087_72432090delCAGT	uc002atp.2	+	2	222_225	c.123_126delCAGT	c.(121-126)AACAGTfs	p.N41fs		NM_145204	NP_660205	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	41_42	Protease.				proteolysis		cysteine-type peptidase activity|protein binding			ovary(1)|skin(1)	2						ACTTTGCCAACAGTCAGTTTCATG	0.475																0.12			21	157		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	72432087	72432090	SENP8	15	CAGT	-	-	-	1	0	1	0	1	0	0	0	0	220	17	5	5	13945	95
NF1	4763	broad.mit.edu	37	17	29652976	29652979	+	Frame_Shift_Del	DEL	TCTC	-	-			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29652976_29652979delTCTC	uc002hgg.2	+	37	5307_5310	c.4974_4977delTCTC	c.(4972-4977)TTTCTCfs	p.F1658fs	NF1_uc002hgh.2_Frame_Shift_Del_p.F1637fs|NF1_uc002hgi.1_Frame_Shift_Del_p.F670fs|NF1_uc010cso.2_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1658_1659	CRAL-TRIO.				actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.S1660fs*37(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAACAGACTTTCTCTCTAAGTGGT	0.422					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.19			40	167		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	29652976	29652979	NF1	17	TCTC	-	-	-	1	0	1	0	1	0	0	0	0	803	62	5	5	10263	95
SLC22A4	6583	broad.mit.edu	37	5	131676327	131676327	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131676327delT	uc003kwq.2	+	9	1679	c.1514delT	c.(1513-1515)CTTfs	p.L505fs	uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	505	Helical; Name=12; (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	ATCCTCACCCTTTTTTTCCCT	0.418																0.04			10	241		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	131676327	131676327	SLC22A4	5	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	14348	95
SND1	27044	broad.mit.edu	37	7	127334947	127334948	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-5412-01	TCGA-06-5412-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127334947_127334948insA	uc003vmi.2	+	3	520_521	c.294_295insA	c.(292-297)ACGATAfs	p.T98fs		NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	98_99	TNase-like 1.				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TCTGTTTCACGATAGAAAACAA	0.465																0.09			12	127		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	127334947	127334948	SND1	7	-	A	A	A	1	0	1	1	0	0	0	0	0	470	37	5	5	14736	95
