Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SLC30A7	148867	broad.mit.edu	37	1	101379278	101379278	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:101379278G>T	uc001dtn.2	+	6	758	c.571G>T	c.(571-573)GAT>TAT	p.D191Y	SLC30A7_uc001dto.2_Missense_Mutation_p.D191Y	NM_001144884	NP_001138356	Q8NEW0	ZNT7_HUMAN	zinc transporter like 2	191	Cytoplasmic (Potential).|His-rich loop.				zinc ion transport	Golgi apparatus|integral to membrane	cation transmembrane transporter activity|protein binding				0		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)		Epithelial(280;0.0437)|all cancers(265;0.0498)|COAD - Colon adenocarcinoma(174;0.162)|Colorectal(144;0.19)|Lung(183;0.201)		TGGCCATGTCGATCATTGCCA	0.443	NSCLC(91;473 1491 3102 16827 21633)															0.294118	70.543011	73.766486	25	60	KEEP	---	---	---	---	13	16	34	33	0.448275862069	capture	Missense_Mutation	SNP	101379278	101379278	SLC30A7	1	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	14452	106
NPL	80896	broad.mit.edu	37	1	182787959	182787959	+	Missense_Mutation	SNP	T	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:182787959T>G	uc009wyb.2	+	10	758	c.618T>G	c.(616-618)AGT>AGG	p.S206R	NPL_uc010pnx.1_Intron|NPL_uc010pny.1_RNA|NPL_uc001gpo.1_Missense_Mutation_p.S187R|NPL_uc009wyc.2_Intron|NPL_uc001gpp.3_Missense_Mutation_p.S206R|NPL_uc001gpq.1_Missense_Mutation_p.S206R	NM_030769	NP_110396	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase	206					carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						AACTGTTGAGTGCTCTGGTGA	0.393																0.275229	95.606551	100.562706	30	79	KEEP	---	---	---	---	19	16	50	45	-1	capture	Missense_Mutation	SNP	182787959	182787959	NPL	1	T	G	G	G	1	0	0	0	0	1	0	0	0	764	59	4	4	10492	106
AHCTF1	25909	broad.mit.edu	37	1	247024397	247024397	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247024397G>A	uc001ibu.1	-	28	3943	c.3936C>T	c.(3934-3936)ATC>ATT	p.I1312I	AHCTF1_uc001ibv.1_Silent_p.I1321I|AHCTF1_uc009xgs.1_Silent_p.I173I|AHCTF1_uc001ibw.1_RNA	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	1312	Necessary for nuclear localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CATCGGATGTGATTGAAACAC	0.463	Colon(145;197 1800 4745 15099 26333)															0.259259	36.023171	38.858974	14	40	KEEP	---	---	---	---	8	6	22	25	-1	capture	Silent	SNP	247024397	247024397	AHCTF1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	577	45	2	2	408	106
NLRP3	114548	broad.mit.edu	37	1	247586553	247586553	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247586553C>T	uc001icr.2	+	4	443	c.305C>T	c.(304-306)TCG>TTG	p.S102L	NLRP3_uc001ics.2_Missense_Mutation_p.S102L|NLRP3_uc001icu.2_Missense_Mutation_p.S102L|NLRP3_uc001icw.2_Missense_Mutation_p.S102L|NLRP3_uc001icv.2_Missense_Mutation_p.S102L|NLRP3_uc010pyw.1_Missense_Mutation_p.S100L|NLRP3_uc001ict.1_Missense_Mutation_p.S100L	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	102					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	p.S102S(1)		lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GCACGTGTTTCGAATCCCACT	0.403					412											0.277457	129.789251	137.461113	48	125	KEEP	---	---	---	---	25	31	65	80	-1	capture	Missense_Mutation	SNP	247586553	247586553	NLRP3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10385	106
OR9I1	219954	broad.mit.edu	37	11	57886023	57886023	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57886023T>A	uc001nml.1	-	1	894	c.894A>T	c.(892-894)AAA>AAT	p.K298N	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	298	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				TGAAGGCGTCTTTTACATCTT	0.438																0.294118	136.85365	143.262494	50	120	KEEP	---	---	---	---	24	38	55	80	-1	capture	Missense_Mutation	SNP	57886023	57886023	OR9I1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	11157	106
KIRREL3	84623	broad.mit.edu	37	11	126299112	126299112	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:126299112G>A	uc001qea.2	-	15	2129	c.1768C>T	c.(1768-1770)CGG>TGG	p.R590W	KIRREL3_uc001qeb.2_Missense_Mutation_p.R578W|ST3GAL4_uc001qdx.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1	590	Cytoplasmic (Potential).				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TCACCCTCCCGACCAGAGGCT	0.488																0.111111	4.368365	11.075503	5	40	KEEP	---	---	---	---	1	4	27	25	-1	capture	Missense_Mutation	SNP	126299112	126299112	KIRREL3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	8248	106
TAS2R20	259295	broad.mit.edu	37	12	11150018	11150018	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11150018C>G	uc001qzm.2	-	1	457	c.457G>C	c.(457-459)GTG>CTG	p.V153L	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176889	NP_795370	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	153	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity				0						TCTGTCCACACATTTATATAC	0.398																0.132743	29.943031	44.742965	15	98	KEEP	---	---	---	---	9	7	42	61	-1	capture	Missense_Mutation	SNP	11150018	11150018	TAS2R20	12	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	15459	106
EPS8	2059	broad.mit.edu	37	12	15807133	15807133	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:15807133T>C	uc009zif.2	-	13	1290	c.1196A>G	c.(1195-1197)AAT>AGT	p.N399S	EPS8_uc001rdb.2_Missense_Mutation_p.N399S|EPS8_uc009zig.2_Missense_Mutation_p.N139S|EPS8_uc010shv.1_Missense_Mutation_p.N139S	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway	399	PH; second part.				cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		TTCATCACCATTGACAGTATA	0.418																0.025424	-22.883389	6.567007	3	115	KEEP	---	---	---	---	2	1	56	68	-1	capture	Missense_Mutation	SNP	15807133	15807133	EPS8	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5149	106
PA2G4	5036	broad.mit.edu	37	12	56501039	56501039	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56501039A>G	uc001sjm.2	+	4	811	c.392A>G	c.(391-393)CAG>CGG	p.Q131R	PA2G4_uc009zol.2_Missense_Mutation_p.Q131R|PA2G4_uc009zom.2_Missense_Mutation_p.Q131R	NM_006191	NP_006182	Q9UQ80	PA2G4_HUMAN	ErbB3-binding protein 1	131					cell cycle arrest|cell proliferation|negative regulation of transcription, DNA-dependent|regulation of translation|rRNA processing	cytoplasm|nucleolus|ribonucleoprotein complex	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding				0			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			GATGTAGCTCAGGTAGGTGGC	0.488																0.217647	96.74718	109.285514	37	133	KEEP	---	---	---	---	23	19	77	76	-1	capture	Missense_Mutation	SNP	56501039	56501039	PA2G4	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	11265	106
USP15	9958	broad.mit.edu	37	12	62778015	62778015	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:62778015C>G	uc001src.1	+	11	1414	c.1405C>G	c.(1405-1407)CCC>GCC	p.P469A	USP15_uc001srb.1_Missense_Mutation_p.P440A	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	469					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ACTTCCATTGCCCATGAAAAA	0.338	Melanoma(181;615 2041 39364 49691 50001)															0.507576	248.434192	248.440952	67	65	KEEP	---	---	---	---	40	35	32	39	-1	capture	Missense_Mutation	SNP	62778015	62778015	USP15	12	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	16928	106
NAV3	89795	broad.mit.edu	37	12	78415582	78415582	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:78415582C>G	uc001syp.2	+	9	2136	c.1963C>G	c.(1963-1965)CCT>GCT	p.P655A	NAV3_uc001syo.2_Missense_Mutation_p.P655A	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	655						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTGTACCAGTCCTACAAAGAT	0.413					1091								HNSCC(70;0.22)			0.120301	53.68892	91.373823	32	234	KEEP	---	---	---	---	25	16	127	152	-1	capture	Missense_Mutation	SNP	78415582	78415582	NAV3	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	10092	106
TPTE2	93492	broad.mit.edu	37	13	20039678	20039678	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20039678C>T	uc001umd.2	-	9	750	c.539G>A	c.(538-540)CGA>CAA	p.R180Q	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.R69Q|TPTE2_uc001ume.2_Missense_Mutation_p.R103Q|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	180						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AATAATAAGTCGTAGAAGTCG	0.303																0.282051	28.216125	29.876386	11	28	KEEP	---	---	---	---	5	6	17	14	-1	capture	Missense_Mutation	SNP	20039678	20039678	TPTE2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16314	106
SACS	26278	broad.mit.edu	37	13	23908157	23908157	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23908157A>C	uc001uon.2	-	10	10447	c.9858T>G	c.(9856-9858)TTT>TTG	p.F3286L	SACS_uc001uoo.2_Missense_Mutation_p.F3139L|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	3286					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTGAAACAGTAAACTTTGTTC	0.408					738											0.387755	134.138457	135.216681	38	60	KEEP	---	---	---	---	15	29	39	31	-1	capture	Missense_Mutation	SNP	23908157	23908157	SACS	13	A	C	C	C	1	0	0	0	0	1	0	0	0	167	13	4	4	13696	106
SPATA13	221178	broad.mit.edu	37	13	24871773	24871773	+	Silent	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:24871773C>T	uc001upg.1	+	10	2015	c.1608C>T	c.(1606-1608)GAC>GAT	p.D536D	SPATA13_uc001upd.1_Silent_p.D1161D|C1QTNF9_uc001upe.2_RNA|SPATA13_uc010tcy.1_Silent_p.D482D|SPATA13_uc010tcz.1_Silent_p.D420D|SPATA13_uc010tda.1_Silent_p.D480D|SPATA13_uc001uph.2_Silent_p.D458D|SPATA13_uc010tdb.1_Silent_p.D396D|SPATA13_uc009zzz.1_Intron|SPATA13_uc001upi.1_Silent_p.D42D	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	536	PH.				cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		GGACCACAGACGAGGTTTATT	0.532																0.276316	56.360768	59.772699	21	55	KEEP	---	---	---	---	10	13	26	36	-1	capture	Silent	SNP	24871773	24871773	SPATA13	13	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14892	106
SLC46A3	283537	broad.mit.edu	37	13	29287613	29287613	+	Silent	SNP	T	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29287613T>A	uc001usi.2	-	2	1234	c.264A>T	c.(262-264)ACA>ACT	p.T88T	SLC46A3_uc001usg.2_Silent_p.T13T|SLC46A3_uc001usj.2_Silent_p.T88T|SLC46A3_uc001ush.2_Silent_p.T88T|SLC46A3_uc001usk.2_Silent_p.T13T	NM_181785	NP_861450	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3 isoform a	88	Helical; (Potential).				transmembrane transport	integral to membrane				central_nervous_system(1)|skin(1)	2		Lung SC(185;0.0367)		all cancers(112;0.159)		AAAGTATGAATGTAGACACTA	0.378																0.192308	26.420086	31.016633	10	42	KEEP	---	---	---	---	5	6	26	22	-1	capture	Silent	SNP	29287613	29287613	SLC46A3	13	T	A	A	A	1	0	0	0	0	0	0	0	1	652	51	4	4	14538	106
VPS18	57617	broad.mit.edu	37	15	41191638	41191638	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41191638C>T	uc001zne.2	+	4	961	c.622C>T	c.(622-624)CTT>TTT	p.L208F		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	208					endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TGTGTGCTCCCTTGAGGCCGA	0.617																0.24	134.607876	146.94112	48	152	KEEP	---	---	---	---	36	18	77	92	-1	capture	Missense_Mutation	SNP	41191638	41191638	VPS18	15	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	17076	106
UBR1	197131	broad.mit.edu	37	15	43317593	43317593	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43317593T>C	uc001zqq.2	-	24	2636	c.2570A>G	c.(2569-2571)GAA>GGA	p.E857G	UBR1_uc010udk.1_Missense_Mutation_p.E857G	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	857					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATCTTTGTTTTCTTGTTTTCT	0.299																0.375	43.500663	43.936316	12	20	KEEP	---	---	---	---	0	14	7	15	-1	capture	Missense_Mutation	SNP	43317593	43317593	UBR1	15	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	16783	106
GABPB1	2553	broad.mit.edu	37	15	50593079	50593079	+	Missense_Mutation	SNP	C	T	T	rs147105901	byFrequency	TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50593079C>T	uc001zyb.2	-	6	1064	c.640G>A	c.(640-642)GTT>ATT	p.V214I	GABPB1_uc001zya.2_Missense_Mutation_p.V202I|GABPB1_uc010ufg.1_Missense_Mutation_p.V138I|GABPB1_uc001zyc.2_Missense_Mutation_p.V202I|GABPB1_uc001zyd.2_Missense_Mutation_p.V202I|GABPB1_uc001zye.2_Missense_Mutation_p.V214I|GABPB1_uc001zyf.2_Missense_Mutation_p.V202I	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta	214					positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1						CCAAACTGAACAGCAGATACA	0.348																0.182609	41.371143	52.303976	21	94	KEEP	---	---	---	---	7	14	40	67	-1	capture	Missense_Mutation	SNP	50593079	50593079	GABPB1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6100	106
MEFV	4210	broad.mit.edu	37	16	3299649	3299649	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3299649G>A	uc002cun.1	-	3	1082	c.1042C>T	c.(1042-1044)CGC>TGC	p.R348C		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	348					inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding	p.R348H(1)		central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	CCAGGTGAGCGGCTGCCTGAG	0.657																0.297297	30.010859	31.369987	11	26	KEEP	---	---	---	---	4	7	16	14	-1	capture	Missense_Mutation	SNP	3299649	3299649	MEFV	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9372	106
IL21R	50615	broad.mit.edu	37	16	27460197	27460197	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27460197C>A	uc002doq.1	+	9	1443	c.1210C>A	c.(1210-1212)CTG>ATG	p.L404M	IL21R_uc002dor.1_Missense_Mutation_p.L404M|IL21R_uc002dos.1_Missense_Mutation_p.L404M|uc002dot.2_RNA	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	404	Cytoplasmic (Potential).				natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						AGCCCTGGACCTGGATGCTGG	0.632					423	T	BCL6	NHL								0.234783	67.262979	74.664905	27	88	KEEP	---	---	---	---	16	14	41	58	0.466666666667	capture	Missense_Mutation	SNP	27460197	27460197	IL21R	16	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	7594	106
CLEC10A	10462	broad.mit.edu	37	17	6978469	6978469	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6978469G>A	uc002gek.2	-	9	1158	c.855C>T	c.(853-855)TTC>TTT	p.F285F	CLEC10A_uc002gej.2_Silent_p.F261F|CLEC10A_uc002gel.2_Silent_p.F258F|CLEC10A_uc010clv.1_3'UTR	NM_182906	NP_878910	Q8IUN9	CLC10_HUMAN	C-type lectin, superfamily member 14 isoform 1	285	C-type lectin.|Extracellular (Potential).				endocytosis|innate immune response	integral to membrane|plasma membrane	sugar binding				0						CGTCTGGATGGAAGTGAGCAC	0.627																0.266055	78.625575	84.015214	29	80	KEEP	---	---	---	---	10	21	40	45	-1	capture	Silent	SNP	6978469	6978469	CLEC10A	17	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	3460	106
DNAH2	146754	broad.mit.edu	37	17	7721011	7721011	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7721011G>A	uc002giu.1	+	65	10167	c.10153G>A	c.(10153-10155)GTC>ATC	p.V3385I	DNAH2_uc010cnm.1_Missense_Mutation_p.V323I	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3385	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGCATCATCGTCACCCGAGG	0.597																0.348624	107.216942	109.421227	38	71	KEEP	---	---	---	---	21	20	35	42	-1	capture	Missense_Mutation	SNP	7721011	7721011	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4559	106
MYO15A	51168	broad.mit.edu	37	17	18058720	18058720	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18058720G>A	uc010vxh.1	+	46	8771	c.8433G>A	c.(8431-8433)GGG>GGA	p.G2811G	MYO15A_uc010vxi.1_Silent_p.G75G|MYO15A_uc010vxj.1_Silent_p.G10G|MYO15A_uc010vxk.1_Intron|MYO15A_uc010vxl.1_5'Flank|MYO15A_uc002gsl.2_5'Flank	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2811	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					AGGCCGGCGGGCAGCTGCGGG	0.637																0.323741	125.739615	129.566152	45	94	KEEP	---	---	---	---	21	35	55	54	-1	capture	Silent	SNP	18058720	18058720	MYO15A	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	9973	106
C18orf55	29090	broad.mit.edu	37	18	71825425	71825425	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:71825425G>C	uc010dqr.1	+	5	854	c.556G>C	c.(556-558)GAT>CAT	p.D186H		NM_014177	NP_054896	Q9BVV7	TI21L_HUMAN	hypothetical protein LOC29090 precursor	186					protein transport|transmembrane transport	integral to membrane|mitochondrial membrane					0		Esophageal squamous(42;0.0746)|Prostate(75;0.157)|Melanoma(33;0.211)				ATATGTAAAAGATGGGCTGAA	0.448																0.290909	50.791858	52.937629	16	39	KEEP	---	---	---	---	10	10	22	18	-1	capture	Missense_Mutation	SNP	71825425	71825425	C18orf55	18	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	1889	106
POLRMT	5442	broad.mit.edu	37	19	629657	629657	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:629657G>A	uc002lpf.1	-	3	761	c.705C>T	c.(703-705)CTC>CTT	p.L235L		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	235					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGTCAGTGAGCAGGCAGC	0.662																0.087719	1.627735	11.43097	5	52	KEEP	---	---	---	---	1	5	28	30	-1	capture	Silent	SNP	629657	629657	POLRMT	19	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	12140	106
MUC16	94025	broad.mit.edu	37	19	9056794	9056794	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9056794A>G	uc002mkp.2	-	3	30856	c.30652T>C	c.(30652-30654)TCA>CCA	p.S10218P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10220	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTATACTGTGAGGCTGGAGGC	0.463																0.028571	-18.525733	7.118736	3	102	KEEP	---	---	---	---	2	1	51	65	-1	capture	Missense_Mutation	SNP	9056794	9056794	MUC16	19	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	9883	106
EPS15L1	58513	broad.mit.edu	37	19	16528878	16528878	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16528878T>C	uc002ndz.1	-	11	994	c.988A>G	c.(988-990)AAA>GAA	p.K330E	EPS15L1_uc002ndx.2_Missense_Mutation_p.K330E|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpe.1_Missense_Mutation_p.K220E|EPS15L1_uc010xpf.1_Missense_Mutation_p.K233E|EPS15L1_uc002nea.1_Missense_Mutation_p.K330E|EPS15L1_uc010eah.1_Missense_Mutation_p.K330E|EPS15L1_uc002neb.1_Missense_Mutation_p.K176E|EPS15L1_uc002nec.1_Missense_Mutation_p.K330E	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	330	EH 3.				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						AATTGGTCTTTGCTTAACTTC	0.547														OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.142857	12.982392	21.634327	10	60	KEEP	---	---	---	---	5	6	37	34	-1	capture	Missense_Mutation	SNP	16528878	16528878	EPS15L1	19	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	5148	106
USHBP1	83878	broad.mit.edu	37	19	17362437	17362437	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17362437G>A	uc002nfs.1	-	12	1989	c.1876C>T	c.(1876-1878)CGG>TGG	p.R626W	USHBP1_uc002nfr.1_Missense_Mutation_p.R252W|USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.R562W	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	626	Potential.						PDZ domain binding			ovary(1)	1						CTCTGAGACCGTCTGGCTCGC	0.607																0.050562	-20.660833	17.437883	9	169	KEEP	---	---	---	---	3	7	91	100	-1	capture	Missense_Mutation	SNP	17362437	17362437	USHBP1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16919	106
MAG	4099	broad.mit.edu	37	19	35786610	35786610	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35786610G>A	uc002nyy.1	+	4	290	c.141G>A	c.(139-141)CCG>CCA	p.P47P	MAG_uc002nyx.1_Silent_p.P47P|MAG_uc010eds.1_Silent_p.P22P|MAG_uc002nyz.1_Silent_p.P47P	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	47	Ig-like V-type.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TTGACTTCCCGGATGAGCTGC	0.642																0.136364	22.158785	36.256672	15	95	KEEP	---	---	---	---	5	13	68	40	-1	capture	Silent	SNP	35786610	35786610	MAG	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9076	106
TTN	7273	broad.mit.edu	37	2	179596192	179596192	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179596192G>A	uc010zfg.1	-	56	13793	c.13569C>T	c.(13567-13569)AGC>AGT	p.S4523S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.S1184S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5450							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGATTTCATCGCTGTCTTTTA	0.483					8722											0.391892	83.555012	84.31346	29	45	KEEP	---	---	---	---	13	16	25	20	-1	capture	Silent	SNP	179596192	179596192	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	16617	106
PRDM15	63977	broad.mit.edu	37	21	43246405	43246405	+	Missense_Mutation	SNP	G	A	A	rs139958739	by1000genomes	TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43246405G>A	uc002yzq.1	-	20	2749	c.2638C>T	c.(2638-2640)CGG>TGG	p.R880W	PRDM15_uc002yzo.2_Missense_Mutation_p.R551W|PRDM15_uc002yzp.2_Missense_Mutation_p.R571W|PRDM15_uc002yzr.1_Missense_Mutation_p.R571W	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	880					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCACTCGCCGCACTCCTGAA	0.577																0.035714	-19.639878	6.534184	4	108	KEEP	---	---	---	---	3	1	59	59	-1	capture	Missense_Mutation	SNP	43246405	43246405	PRDM15	21	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	12352	106
PIWIL3	440822	broad.mit.edu	37	22	25155854	25155854	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:25155854C>T	uc003abd.1	-	3	622	c.205G>A	c.(205-207)GGA>AGA	p.G69R	PIWIL3_uc011ajx.1_5'UTR|PIWIL3_uc011ajy.1_5'UTR|PIWIL3_uc010gut.1_Missense_Mutation_p.G69R	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	69					cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						TGTGCTCCTCCTCCTGCTCCT	0.582																0.346154	543.820255	554.168795	171	323	KEEP	---	---	---	---	102	106	187	195	-1	capture	Missense_Mutation	SNP	25155854	25155854	PIWIL3	22	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	11862	106
QARS	5859	broad.mit.edu	37	3	49142151	49142151	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49142151A>G	uc003cvx.2	-	1	21	c.16T>C	c.(16-18)TCC>CCC	p.S6P	QARS_uc011bcd.1_5'Flank|QARS_uc003cvy.2_5'UTR|QARS_uc011bce.1_Missense_Mutation_p.S6P|QARS_uc011bcf.1_Missense_Mutation_p.S6P	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	6					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	AGCGACAGGGAGTCTAGAGCC	0.602																0.22619	51.31059	57.073196	19	65	KEEP	---	---	---	---	13	9	37	41	-1	capture	Missense_Mutation	SNP	49142151	49142151	QARS	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	12766	106
UBA7	7318	broad.mit.edu	37	3	49847050	49847050	+	Silent	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49847050C>T	uc003cxr.2	-	16	2184	c.2013G>A	c.(2011-2013)GCG>GCA	p.A671A		NM_003335	NP_003326	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	671					ISG15-protein conjugation|negative regulation of type I interferon production	cytosol	ATP binding|ISG15 activating enzyme activity|ligase activity			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAAGAGCCCACGCCACACAGT	0.547																0.196721	77.690444	93.388316	36	147	KEEP	---	---	---	---	17	20	72	78	-1	capture	Silent	SNP	49847050	49847050	UBA7	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	16715	106
ABCC5	10057	broad.mit.edu	37	3	183677612	183677612	+	Silent	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183677612T>C	uc003fmg.2	-	17	2556	c.2391A>G	c.(2389-2391)AAA>AAG	p.K797K	ABCC5_uc011bqt.1_Silent_p.K325K|ABCC5_uc010hxl.2_Silent_p.K797K	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	797						integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TGGTTTCCTTTTTTGAATTGA	0.363																0.346667	89.531265	91.086221	26	49	KEEP	---	---	---	---	9	20	22	31	-1	capture	Silent	SNP	183677612	183677612	ABCC5	3	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	56	106
ZNF595	152687	broad.mit.edu	37	4	85691	85691	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:85691T>C	uc003fzv.1	+	4	452	c.296T>C	c.(295-297)ATA>ACA	p.I99T	ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_5'UTR	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	99					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CACAAACTTATACTGAAAAGA	0.353																0.25	70.584364	75.807951	23	69	KEEP	---	---	---	---	8	18	39	36	-1	capture	Missense_Mutation	SNP	85691	85691	ZNF595	4	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	17903	106
FAM193A	8603	broad.mit.edu	37	4	2733554	2733554	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2733554T>C	uc010icl.2	+	20	4108	c.3757T>C	c.(3757-3759)TCC>CCC	p.S1253P	FAM193A_uc010ick.2_Missense_Mutation_p.S1412P|FAM193A_uc003gfd.2_Missense_Mutation_p.S1212P|FAM193A_uc011bvm.1_Missense_Mutation_p.S1234P|FAM193A_uc011bvn.1_3'UTR|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	1253										ovary(3)	3						TATCAACTGGTCCAATTTTAG	0.517																0.018634	-35.314504	6.655054	3	158	KEEP	---	---	---	---	1	2	92	99	-1	capture	Missense_Mutation	SNP	2733554	2733554	FAM193A	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5476	106
PRKG2	5593	broad.mit.edu	37	4	82063966	82063966	+	Silent	SNP	C	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:82063966C>A	uc003hmh.2	-	10	1403	c.1389G>T	c.(1387-1389)GGG>GGT	p.G463G	PRKG2_uc011ccf.1_Silent_p.G43G|PRKG2_uc011ccg.1_Silent_p.G43G|PRKG2_uc011cch.1_Intron	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	463	Protein kinase.|ATP (By similarity).				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						CTCTTCCGAACCCACCAACGC	0.428					728											0.25	235.126097	255.127605	88	264	KEEP	---	---	---	---	48	62	148	162	0.563636363636	capture	Silent	SNP	82063966	82063966	PRKG2	4	C	A	A	A	1	0	0	0	0	0	0	0	1	223	18	4	4	12419	106
FAT1	2195	broad.mit.edu	37	4	187630082	187630082	+	Silent	SNP	G	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187630082G>T	uc003izf.2	-	2	1088	c.900C>A	c.(898-900)CTC>CTA	p.L300L	FAT1_uc010iso.1_Silent_p.L300L	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	300	Extracellular (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TAAACTGCTGGAGAAGGTCAC	0.493	Colon(197;1040 2055 4143 4984 49344)												HNSCC(5;0.00058)			0.453125	342.633656	343.127211	116	140	KEEP	---	---	---	---	66	61	60	89	0.51968503937	capture	Silent	SNP	187630082	187630082	FAT1	4	G	T	T	T	1	0	0	0	0	0	0	0	1	522	41	4	4	5635	106
GABRA6	2559	broad.mit.edu	37	5	161119060	161119060	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161119060G>A	uc003lyu.2	+	8	1278	c.940G>A	c.(940-942)GTC>ATC	p.V314I	GABRA6_uc003lyv.2_Missense_Mutation_p.V85I	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	314	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	p.V314I(1)		ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTTTGCATTCGTCTTCTCTGC	0.478													TCGA Ovarian(5;0.080)			0.234043	54.0097	60.089251	22	72	KEEP	---	---	---	---	10	14	38	39	-1	capture	Missense_Mutation	SNP	161119060	161119060	GABRA6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6107	106
ZNF354C	30832	broad.mit.edu	37	5	178506220	178506220	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178506220C>G	uc003mju.2	+	5	902	c.787C>G	c.(787-789)CAG>GAG	p.Q263E		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	263	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TCTTTCTCATCAGAGAATTCA	0.388																0.048193	-7.067136	10.947288	4	79	KEEP	---	---	---	---	1	3	40	47	-1	capture	Missense_Mutation	SNP	178506220	178506220	ZNF354C	5	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17746	106
ZNF354C	30832	broad.mit.edu	37	5	178506472	178506472	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178506472C>G	uc003mju.2	+	5	1154	c.1039C>G	c.(1039-1041)CAA>GAA	p.Q347E		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	347	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TCACAGGCATCAAAGAATCCA	0.428																0.049645	-23.792415	36.902348	14	268	KEEP	---	---	---	---	11	6	135	159	-1	capture	Missense_Mutation	SNP	178506472	178506472	ZNF354C	5	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17746	106
ZNF354C	30832	broad.mit.edu	37	5	178506565	178506565	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178506565C>A	uc003mju.2	+	5	1247	c.1132C>A	c.(1132-1134)CAT>AAT	p.H378N		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	378	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TCAGAGGTTTCATACTGGAGA	0.428																0.053254	-18.567145	17.08961	9	160	KEEP	---	---	---	---	5	4	70	99	0.444444444444	capture	Missense_Mutation	SNP	178506565	178506565	ZNF354C	5	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	17746	106
FTSJD2	23070	broad.mit.edu	37	6	37446254	37446254	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:37446254G>A	uc003ons.2	+	22	2476	c.2223G>A	c.(2221-2223)CGG>CGA	p.R741R		NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2	741	Interaction with POLR2A.				mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GTGATGACCGGCACTTTGTAC	0.587																0.020513	-43.480114	6.750827	4	191	KEEP	---	---	---	---	3	1	99	108	-1	capture	Silent	SNP	37446254	37446254	FTSJD2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	6033	106
IGFBP1	3484	broad.mit.edu	37	7	45930223	45930223	+	Silent	SNP	C	T	T			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45930223C>T	uc003tnp.2	+	2	719	c.426C>T	c.(424-426)GCC>GCT	p.A142A	IGFBP1_uc003tno.3_Silent_p.A142A|IGFBP1_uc010kyn.2_Silent_p.A142A	NM_000596	NP_000587	P08833	IBP1_HUMAN	insulin-like growth factor binding protein 1	142						extracellular space	insulin-like growth factor binding			lung(1)	1						ATCTGATGGCCCCTTCTGAAG	0.517														OREG0018048	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.213115	97.58801	111.459458	39	144	KEEP	---	---	---	---	12	29	75	77	-1	capture	Silent	SNP	45930223	45930223	IGFBP1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7503	106
SEPT14	346288	broad.mit.edu	37	7	55910809	55910809	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55910809T>C	uc003tqz.2	-	5	501	c.384A>G	c.(382-384)ATA>ATG	p.I128M		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	128					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGTAGTCAACTATTGGTTGGT	0.358																0.103448	3.703444	8.243471	3	26	KEEP	---	---	---	---	1	2	12	21	-1	capture	Missense_Mutation	SNP	55910809	55910809	SEPT14	7	T	C	C	C	1	0	0	0	0	1	0	0	0	680	53	3	3	13956	106
KIAA1324L	222223	broad.mit.edu	37	7	86526910	86526910	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86526910T>C	uc011kha.1	-	19	2782	c.2597A>G	c.(2596-2598)TAT>TGT	p.Y866C	KIAA1324L_uc003uif.1_Missense_Mutation_p.Y626C|KIAA1324L_uc011kgz.1_Missense_Mutation_p.Y752C|KIAA1324L_uc003uie.2_Missense_Mutation_p.Y699C	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	866	Extracellular (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CCACAGGAAATAGAACGTACA	0.453																0.183486	54.067093	64.288678	20	89	KEEP	---	---	---	---	7	15	49	47	-1	capture	Missense_Mutation	SNP	86526910	86526910	KIAA1324L	7	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8146	106
LY96	23643	broad.mit.edu	37	8	74941281	74941281	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:74941281T>C	uc003yad.2	+	5	566	c.475T>C	c.(475-477)TCA>CCA	p.S159P		NM_015364	NP_056179	Q9Y6Y9	LY96_HUMAN	MD-2 protein precursor	159					cellular defense response|detection of lipopolysaccharide|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	extracellular space|lipopolysaccharide receptor complex|plasma membrane	coreceptor activity|lipopolysaccharide receptor activity|protein binding				0	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			CCAACCTAATTCAAATTAGAA	0.234	GBM(131;1357 1748 34893 50149 52212)															0.2	25.754524	29.516634	9	36	KEEP	---	---	---	---	7	3	17	23	-1	capture	Missense_Mutation	SNP	74941281	74941281	LY96	8	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	9017	106
RUNX1T1	862	broad.mit.edu	37	8	93017373	93017373	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:93017373G>A	uc003yfd.2	-	5	795	c.711C>T	c.(709-711)AAC>AAT	p.N237N	RUNX1T1_uc003yfc.1_Silent_p.N210N|RUNX1T1_uc003yfe.1_Silent_p.N200N|RUNX1T1_uc010mao.2_Silent_p.N210N|RUNX1T1_uc011lgi.1_Silent_p.N248N|RUNX1T1_uc003yfb.1_Silent_p.N200N|RUNX1T1_uc003yff.1_Silent_p.N200N	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	237					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCCCGTTTTCGTTCACATCGA	0.537					213											0.041379	-20.46813	12.320488	6	139	KEEP	---	---	---	---	3	4	85	76	-1	capture	Silent	SNP	93017373	93017373	RUNX1T1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13639	106
DENND3	22898	broad.mit.edu	37	8	142186755	142186755	+	Silent	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142186755G>A	uc003yvy.2	+	15	2639	c.2361G>A	c.(2359-2361)GCG>GCA	p.A787A	DENND3_uc010mep.2_Silent_p.A748A	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	787										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TCAGAGTGGCGTCCAAGAAAG	0.483																0.073684	-2.442249	15.293055	7	88	KEEP	---	---	---	---	2	5	42	50	-1	capture	Silent	SNP	142186755	142186755	DENND3	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4390	106
EPPK1	83481	broad.mit.edu	37	8	144945189	144945189	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144945189G>A	uc003zaa.1	-	1	2246	c.2233C>T	c.(2233-2235)CGG>TGG	p.R745W		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	745	Plectin 14.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TAGCCGCGCCGGTAGGCCACG	0.652																0.24359	101.176139	110.520972	38	118	KEEP	---	---	---	---	21	24	65	78	-1	capture	Missense_Mutation	SNP	144945189	144945189	EPPK1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5145	106
SH3GL2	6456	broad.mit.edu	37	9	17791242	17791242	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:17791242G>A	uc003zna.2	+	7	926	c.638G>A	c.(637-639)AGC>AAC	p.S213N	SH3GL2_uc011lmy.1_Missense_Mutation_p.S166N	NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	213	BAR.|Potential.				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		GAACAAGTGAGCCAGCTCTCT	0.478																0.301724	108.001188	112.061353	35	81	KEEP	---	---	---	---	19	18	42	50	-1	capture	Missense_Mutation	SNP	17791242	17791242	SH3GL2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	14144	106
CYLC2	1539	broad.mit.edu	37	9	105767006	105767006	+	Silent	SNP	T	C	C			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:105767006T>C	uc004bbs.2	+	4	280	c.210T>C	c.(208-210)GAT>GAC	p.D70D		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	70	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				TAAGAGGAGATCGTAGACAAC	0.358																0.173913	26.840425	33.804131	12	57	KEEP	---	---	---	---	2	11	38	33	-1	capture	Silent	SNP	105767006	105767006	CYLC2	9	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	4102	106
OR10G8	219869	broad.mit.edu	37	11	123901241	123901243	+	In_Frame_Del	DEL	AGT	-	-			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123901241_123901243delAGT	uc001pzp.1	+	1	912_914	c.912_914delAGT	c.(910-915)AAAGTA>AAA	p.V305del		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGAAAGACAAAGTAGCACATTCT	0.291																0.25			22	67		---	---	---	---						capture_indel	In_Frame_Del	DEL	123901241	123901243	OR10G8	11	AGT	-	-	-	1	0	1	0	1	0	0	0	0	37	3	5	5	10807	106
RNF213	57674	broad.mit.edu	37	17	78349658	78349658	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-6390-01	TCGA-06-6390-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78349658delC	uc002jyh.1	+	26	7615	c.7392delC	c.(7390-7392)CACfs	p.H2464fs	uc002jyi.1_Intron|RNF213_uc010dhw.1_Frame_Shift_Del_p.H846fs	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CAAGCCTCCACCCCACGCCAG	0.473																0.34			29	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	78349658	78349658	RNF213	17	C	-	-	-	1	0	1	0	1	0	0	0	0	233	18	5	5	13369	106
