Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ATAD3C	219293	broad.mit.edu	37	1	1392509	1392509	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1392509C>T	uc001aft.2	+	8	1685	c.690C>T	c.(688-690)GGC>GGT	p.G230G		NM_001039211	NP_001034300	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	230							ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCGTCCACAGCCTCCTGCTCT	0.642																0.522727	200.864598	200.923315	69	63	KEEP	---	---	---	---	37	40	35	31	-1	capture	Silent	SNP	1392509	1392509	ATAD3C	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	1066	112
KAZ	23254	broad.mit.edu	37	1	15441012	15441012	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15441012G>A	uc001avm.3	+	15	2490	c.2209G>A	c.(2209-2211)GAT>AAT	p.D737N	C1orf126_uc001avv.3_RNA|C1orf126_uc009voh.2_RNA|KAZ_uc001avs.3_Missense_Mutation_p.D184N	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	737					keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						CAAAGATCCCGATTTCCATGA	0.493																0.785714	69.662765	71.775185	22	6	KEEP	---	---	---	---	8	19	5	1	-1	capture	Missense_Mutation	SNP	15441012	15441012	KAZ	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7911	112
HP1BP3	50809	broad.mit.edu	37	1	21106349	21106349	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21106349G>A	uc001bdw.1	-	3	292	c.152C>T	c.(151-153)ACT>ATT	p.T51I	HP1BP3_uc001bdv.1_Missense_Mutation_p.T13I|HP1BP3_uc010odh.1_Missense_Mutation_p.T13I|HP1BP3_uc001bdy.1_Missense_Mutation_p.T51I|HP1BP3_uc001bdz.2_RNA|HP1BP3_uc001bea.2_Missense_Mutation_p.T50I|HP1BP3_uc001beb.2_Missense_Mutation_p.T51I	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74	51					nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TTTGGGAGGAGTTTCCCGGGT	0.403																0.681818	99.563747	100.85603	30	14	KEEP	---	---	---	---	16	20	10	5	-1	capture	Missense_Mutation	SNP	21106349	21106349	HP1BP3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	7253	112
PEX11B	8799	broad.mit.edu	37	1	145517332	145517332	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145517332C>T	uc001eny.1	+	2	134	c.116C>T	c.(115-117)CCT>CTT	p.P39L	NBPF10_uc001emp.3_Intron|GNRHR2_uc009wiv.1_5'Flank|GNRHR2_uc010oyt.1_5'Flank|GNRHR2_uc001enx.2_5'Flank|PEX11B_uc010oyu.1_Missense_Mutation_p.P25L	NM_003846	NP_003837	O96011	PX11B_HUMAN	peroxisomal biogenesis factor 11 beta	39					peroxisome fission|signal transduction	integral to peroxisomal membrane	protein binding				0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGAGCCAGTCCTGAGTTACAG	0.537																0.038835	-14.888509	8.766327	4	99	KEEP	---	---	---	---	3	2	65	56	-1	capture	Missense_Mutation	SNP	145517332	145517332	PEX11B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	11641	112
IQGAP3	128239	broad.mit.edu	37	1	156524129	156524129	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156524129A>G	uc001fpf.2	-	13	1421	c.1346T>C	c.(1345-1347)CTG>CCG	p.L449P	IQGAP3_uc009wsb.1_Missense_Mutation_p.L406P	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	449					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCGGTTAATCAGGACCACAGC	0.622																0.027273	-20.774381	6.357129	3	107	KEEP	---	---	---	---	4	0	63	59	-1	capture	Missense_Mutation	SNP	156524129	156524129	IQGAP3	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	7739	112
C1orf125	126859	broad.mit.edu	37	1	179460808	179460808	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179460808C>G	uc001gmo.2	+	19	2354	c.2227C>G	c.(2227-2229)CGA>GGA	p.R743G	C1orf125_uc009wxg.2_RNA|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.R743G|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	743											0						AGGAGTTGCGCGATTGGAGCT	0.413																0.776699	303.254569	310.504576	80	23	KEEP	---	---	---	---	43	48	13	16	-1	capture	Missense_Mutation	SNP	179460808	179460808	C1orf125	1	C	G	G	G	1	0	0	0	0	1	0	0	0	347	27	4	4	1975	112
F13B	2165	broad.mit.edu	37	1	197021962	197021962	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197021962G>A	uc001gtt.1	-	9	1401	c.1357C>T	c.(1357-1359)CCA>TCA	p.P453S		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	453	Sushi 8.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ACAGTACATGGTTCTGTAAAA	0.259																0.028571	-27.729514	6.53453	4	136	KEEP	---	---	---	---	0	5	65	80	-1	capture	Missense_Mutation	SNP	197021962	197021962	F13B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	5295	112
RBP3	5949	broad.mit.edu	37	10	48389610	48389610	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48389610T>A	uc001jez.2	-	1	1382	c.1268A>T	c.(1267-1269)CAA>CTA	p.Q423L		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	423	4 X approximate tandem repeats.|2.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	CACCAGTGCTTGCCGGATAGC	0.627																0.172414	17.816728	23.696629	10	48	KEEP	---	---	---	---	4	6	23	34	-1	capture	Missense_Mutation	SNP	48389610	48389610	RBP3	10	T	A	A	A	1	0	0	0	0	1	0	0	0	819	63	4	4	13052	112
OR51F1	256892	broad.mit.edu	37	11	4790374	4790374	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4790374C>T	uc010qyl.1	-	1	774	c.774G>A	c.(772-774)CTG>CTA	p.L258L		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	258						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		AGGACAGGCTCAGCATGTGGA	0.522																0.134615	9.287295	16.021574	7	45	KEEP	---	---	---	---	4	5	19	27	-1	capture	Silent	SNP	4790374	4790374	OR51F1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	11000	112
SLC22A25	387601	broad.mit.edu	37	11	62985164	62985164	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62985164C>T	uc001nwr.1	-	3	550	c.550G>A	c.(550-552)GCC>ACC	p.A184T	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_Intron|SLC22A25_uc001nwt.1_Missense_Mutation_p.A184T	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	184	Helical; Name=3; (Potential).				transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						CCTACAATGGCGAGCTGGAGG	0.488																0.703125	138.403039	140.77822	45	19	KEEP	---	---	---	---	28	27	9	15	-1	capture	Missense_Mutation	SNP	62985164	62985164	SLC22A25	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14346	112
NLRX1	79671	broad.mit.edu	37	11	119052983	119052983	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119052983C>T	uc001pvu.2	+	9	2750	c.2535C>T	c.(2533-2535)AAC>AAT	p.N845N	NLRX1_uc001pvv.2_Silent_p.N845N|NLRX1_uc001pvw.2_Silent_p.N845N|NLRX1_uc001pvx.2_Silent_p.N845N	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	845	LRR 6.|Required for the repression of MAVS- induced interferon signaling.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TGGCGTACAACGGTGCTGGTG	0.677																0.04	-15.875477	6.925854	4	96	KEEP	---	---	---	---	2	4	56	55	-1	capture	Silent	SNP	119052983	119052983	NLRX1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10392	112
ARHGEF12	23365	broad.mit.edu	37	11	120352059	120352059	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120352059C>T	uc001pxl.1	+	39	4335	c.4328C>T	c.(4327-4329)ACA>ATA	p.T1443I	ARHGEF12_uc009zau.1_Missense_Mutation_p.T1340I	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1443					apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CAGCCCATGACAGGCATCCCT	0.512					1000	T	MLL	AML								0.090909	0.86182	13.861439	7	70	KEEP	---	---	---	---	2	7	33	43	-1	capture	Missense_Mutation	SNP	120352059	120352059	ARHGEF12	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	890	112
C1QL4	338761	broad.mit.edu	37	12	49726939	49726939	+	Silent	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49726939G>A	uc001rtz.1	-	2	1326	c.615C>T	c.(613-615)GAC>GAT	p.D205D		NM_001008223	NP_001008224	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	205	C1q.					collagen					0						CGTCGCCCACGTCCAGGTGCA	0.597																0.576923	87.544645	87.812749	30	22	KEEP	---	---	---	---	16	22	10	13	-1	capture	Silent	SNP	49726939	49726939	C1QL4	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1943	112
NHLRC3	387921	broad.mit.edu	37	13	39613426	39613426	+	Splice_Site	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:39613426G>A	uc001uxc.2	+	2	559	c.237_splice	c.e2+1	p.Q79_splice	C13orf23_uc001uwy.2_5'Flank|C13orf23_uc001uwz.2_5'Flank|NHLRC3_uc001uxa.1_Splice_Site_p.Q79_splice|NHLRC3_uc001uxb.1_Splice_Site_p.Q79_splice|NHLRC3_uc001uxd.2_Splice_Site_p.Q79_splice|NHLRC3_uc001uxe.2_Splice_Site	NM_001012754	NP_001012772	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3 isoform a							extracellular region				skin(1)	1		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		CATAGGTCAAGTAAGTAAATA	0.388																0.137255	8.586575	15.087493	7	44	KEEP	---	---	---	---	3	5	21	28	-1	capture	Splice_Site	SNP	39613426	39613426	NHLRC3	13	G	A	A	A	1	0	0	0	0	0	0	1	0	468	36	5	2	10314	112
RB1	5925	broad.mit.edu	37	13	48916734	48916734	+	Splice_Site	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48916734G>A	uc001vcb.2	+	3	431	c.265_splice	c.e3-1	p.G89_splice	RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(2)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTGTTCCCAGGGAGGTTATA	0.318			6	(NCIH2029-Tumor)|(CORL95-Tumor)	568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.136752	26.414483	41.362659	16	101	KEEP	---	---	---	---	8	11	59	55	-1	capture	Splice_Site	SNP	48916734	48916734	RB1	13	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	6	2	12993	112
MTA1	9112	broad.mit.edu	37	14	105936268	105936268	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105936268C>T	uc001yqx.2	+	20	2123	c.1936C>T	c.(1936-1938)CGG>TGG	p.R646W	MTA1_uc001yqy.2_RNA|MTA1_uc001yrb.2_Missense_Mutation_p.R411W	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein	646					signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		AGTCAAGCGGCGGCGGATGAA	0.677																0.277778	11.768687	12.567797	5	13	KEEP	---	---	---	---	0	5	9	5	-1	capture	Missense_Mutation	SNP	105936268	105936268	MTA1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	9818	112
TSC2	7249	broad.mit.edu	37	16	2134716	2134716	+	Missense_Mutation	SNP	G	A	A	rs137854879		TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2134716G>A	uc002con.2	+	34	4599	c.4493G>A	c.(4492-4494)AGT>AAT	p.S1498N	TSC2_uc010bsd.2_Missense_Mutation_p.S1475N|TSC2_uc002coo.2_Missense_Mutation_p.S1431N|TSC2_uc010uvv.1_Missense_Mutation_p.S1395N|TSC2_uc010uvw.1_Missense_Mutation_p.S1383N|TSC2_uc002cop.2_Missense_Mutation_p.S1254N|TSC2_uc002coq.2_Missense_Mutation_p.S273N|TSC2_uc002cor.2_Missense_Mutation_p.S199N	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	1498			S -> N (in TSC2).		cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				ATCAACCCCAGGTGGGCCTCT	0.662					1098	D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				0.117647	8.017543	15.34275	6	45	KEEP	---	---	---	---	1	6	17	36	-1	capture	Missense_Mutation	SNP	2134716	2134716	TSC2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16489	112
GRIN2A	2903	broad.mit.edu	37	16	9862916	9862916	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9862916A>T	uc002czo.3	-	12	2935	c.2387T>A	c.(2386-2388)CTC>CAC	p.L796H	GRIN2A_uc010uym.1_Missense_Mutation_p.L796H|GRIN2A_uc010uyn.1_Missense_Mutation_p.L639H|GRIN2A_uc002czr.3_Missense_Mutation_p.L796H	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	796	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GATCCCAGTGAGCCACAGGGT	0.478					324											0.615385	169.789935	170.846414	56	35	KEEP	---	---	---	---	31	33	29	13	-1	capture	Missense_Mutation	SNP	9862916	9862916	GRIN2A	16	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	6712	112
IL4R	3566	broad.mit.edu	37	16	27373977	27373977	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27373977C>G	uc002don.2	+	11	1546	c.1304C>G	c.(1303-1305)CCT>CGT	p.P435R	IL4R_uc002dop.3_Missense_Mutation_p.P420R|IL4R_uc010bxy.2_Missense_Mutation_p.P435R|IL4R_uc002doo.2_Missense_Mutation_p.P275R	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	435	Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CTTCTTCCACCTTCGGGAAGT	0.612																0.736111	179.702862	183.329557	53	19	KEEP	---	---	---	---	40	18	10	11	-1	capture	Missense_Mutation	SNP	27373977	27373977	IL4R	16	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	7621	112
CDH8	1006	broad.mit.edu	37	16	61689535	61689535	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:61689535C>A	uc002eog.1	-	11	1997	c.1745G>T	c.(1744-1746)GGA>GTA	p.G582V		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	582	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGGAGGATTTCCACTATCACT	0.438																0.781818	130.14315	134.165086	43	12	KEEP	---	---	---	---	13	33	12	4	0.717391304348	capture	Missense_Mutation	SNP	61689535	61689535	CDH8	16	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	3087	112
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGGGGGCAGCGCCTCACAAC	0.652	Pancreas(47;798 1329 9957 10801)	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	p.R175L(LS123-Tumor)|p.R175L(VMRCLCD-Tumor)|p.R175L(DETROIT562-Tumor)|p.R175L(KMS26-Tumor)|p.R175L(KLE-Tumor)|p.R175L(SNU245-Tumor)|p.R175L(SKBR3-Tumor)|p.R175L(RKN-Tumor)|p.R174fs(THP1-Tumor)|p.R175L(HCC1395-Tumor)|p.R175L(VMCUB1-Tumor)|p.R175L(RT11284-Tumor)|p.R175L(AU565-Tumor)|p.R175L(SKUT1-Tumor)|p.R175L(HS571.T-Tumor)|p.R175L(HUCCT1-Tumor)|p.R175L(TYKNU-Tumor)|p.R175L(LMSU-Tumor)|p.R175L(CAL33-Tumor)|p.R175L(SNU1197-Tumor)|p.R175L(NCIH196-Tumor)|p.R175H(HCC44-Tumor)|p.R175L(OPM2-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.76	173.695949	178.322057	57	18	KEEP	---	---	---	---	31	31	13	8	-1	capture	Missense_Mutation	SNP	7578406	7578406	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	112
KCNJ12	3768	broad.mit.edu	37	17	21318689	21318689	+	Missense_Mutation	SNP	T	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21318689T>G	uc002gyv.1	+	3	740	c.35T>G	c.(34-36)ATC>AGC	p.I12S		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	12	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CCCTACAGCATCGTGTCATCG	0.711													Prostate(3;0.18)			0.113636	6.744822	13.22239	5	39	KEEP	---	---	---	---	4	1	19	24	-1	capture	Missense_Mutation	SNP	21318689	21318689	KCNJ12	17	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	7968	112
NF1	4763	broad.mit.edu	37	17	29661898	29661898	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29661898G>A	uc002hgg.2	+	40	6188	c.5855G>A	c.(5854-5856)TGG>TAG	p.W1952*	NF1_uc002hgh.2_Nonsense_Mutation_p.W1931*|NF1_uc010cso.2_Nonsense_Mutation_p.W140*|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1952			W -> R (in NF1).		actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATGACTCCATGGCTGTCAAAT	0.343					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.653333	160.292878	161.847815	49	26	KEEP	---	---	---	---	30	28	17	15	-1	capture	Nonsense_Mutation	SNP	29661898	29661898	NF1	17	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	10263	112
KRTAP4-8	728224	broad.mit.edu	37	17	39253949	39253949	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39253949T>A	uc010wfo.1	-	1	427	c.388A>T	c.(388-390)AGC>TGC	p.S130C		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	130	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].					keratin filament					0						ctggagatgctgcagctgggg	0.124																0.1875	5.616047	7.079229	3	13	KEEP	---	---	---	---	7	8	10	14	-1	capture	Missense_Mutation	SNP	39253949	39253949	KRTAP4-8	17	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	8476	112
EFTUD2	9343	broad.mit.edu	37	17	42942379	42942379	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42942379G>A	uc002ihn.2	-	14	1465	c.1204C>T	c.(1204-1206)CAC>TAC	p.H402Y	EFTUD2_uc010wje.1_Missense_Mutation_p.H367Y|EFTUD2_uc010wjf.1_Missense_Mutation_p.H392Y	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	402						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				TTCGTCAGGTGGATGCCAAGC	0.557	Ovarian(10;65 485 10258 29980 30707)													OREG0024466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.837838	303.924651	315.96159	93	18	KEEP	---	---	---	---	54	52	10	10	-1	capture	Missense_Mutation	SNP	42942379	42942379	EFTUD2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	4916	112
LPO	4025	broad.mit.edu	37	17	56344837	56344837	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56344837C>T	uc002ivt.2	+	12	2137	c.1821C>T	c.(1819-1821)ATC>ATT	p.I607I	LPO_uc010wns.1_Silent_p.I548I|LPO_uc010dcp.2_Silent_p.I524I|LPO_uc010dcq.2_Silent_p.I278I|LPO_uc010dcr.2_Silent_p.I170I	NM_006151	NP_006142	P22079	PERL_HUMAN	lactoperoxidase isoform 1 preproprotein	607					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2						CTGACAACATCGACATCTGGA	0.587																0.545455	126.546832	126.684537	42	35	KEEP	---	---	---	---	19	30	18	18	-1	capture	Silent	SNP	56344837	56344837	LPO	17	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	8838	112
ALPK2	115701	broad.mit.edu	37	18	56203541	56203541	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56203541A>G	uc002lhj.3	-	5	4092	c.3878T>C	c.(3877-3879)ATA>ACA	p.I1293T	ALPK2_uc002lhk.1_Missense_Mutation_p.I624T	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1293							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CAATGCTGCTATTTCAGAGGG	0.507					343											0.404167	339.450371	341.370829	97	143	KEEP	---	---	---	---	45	62	69	85	-1	capture	Missense_Mutation	SNP	56203541	56203541	ALPK2	18	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	545	112
SERPINB7	8710	broad.mit.edu	37	18	61471670	61471670	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61471670G>A	uc002ljl.2	+	8	1040	c.944G>A	c.(943-945)CGT>CAT	p.R315H	SERPINB7_uc002ljm.2_Missense_Mutation_p.R315H|SERPINB7_uc010xet.1_Missense_Mutation_p.R298H|SERPINB7_uc010dqg.2_Missense_Mutation_p.R315H	NM_001040147	NP_001035237	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade	315					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	p.R315H(1)		lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)				TCGGGGGGTCGTCTGTATATA	0.428																0.383333	61.215285	61.929372	23	37	KEEP	---	---	---	---	11	15	18	21	-1	capture	Missense_Mutation	SNP	61471670	61471670	SERPINB7	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13999	112
KCNG2	26251	broad.mit.edu	37	18	77624159	77624159	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77624159C>T	uc010xfl.1	+	1	492	c.492C>T	c.(490-492)CGC>CGT	p.R164R		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	164	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		ggcgccTGCGCGACGTGGTGG	0.368																0.323529	26.505972	27.449833	11	23	KEEP	---	---	---	---	5	12	8	22	-1	capture	Silent	SNP	77624159	77624159	KCNG2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7950	112
CD209	30835	broad.mit.edu	37	19	7812212	7812212	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7812212C>T	uc002mht.2	-	2	153	c.86G>A	c.(85-87)CGA>CAA	p.R29Q	CD209_uc010xju.1_Missense_Mutation_p.R29Q|CD209_uc010dvp.2_Missense_Mutation_p.R29Q|CD209_uc002mhr.2_Missense_Mutation_p.R29Q|CD209_uc002mhs.2_Missense_Mutation_p.R29Q|CD209_uc002mhu.2_Missense_Mutation_p.R29Q|CD209_uc010dvq.2_Missense_Mutation_p.R29Q|CD209_uc002mhq.2_Missense_Mutation_p.R29Q|CD209_uc002mhv.2_Missense_Mutation_p.R29Q|CD209_uc002mhx.2_Intron|CD209_uc002mhw.2_Intron|CD209_uc010dvr.2_Missense_Mutation_p.R29Q	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	29	Cytoplasmic (Probable).				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						CTTGTATCCTCGAGTCTGTCG	0.378																0.041002	-66.175897	33.304257	18	421	KEEP	---	---	---	---	8	13	250	264	-1	capture	Missense_Mutation	SNP	7812212	7812212	CD209	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2955	112
IGFL1	374918	broad.mit.edu	37	19	46733408	46733408	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46733408C>T	uc002pee.2	+	2	92	c.69C>T	c.(67-69)CAC>CAT	p.H23H		NM_198541	NP_940943	Q6UW32	IGFL1_HUMAN	IGF-like family member 1 precursor	23						extracellular space	protein binding				0		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.00242)|all cancers(93;0.0132)|GBM - Glioblastoma multiforme(486;0.0294)|Epithelial(262;0.201)		TCTGCTCACACGGAGCCCCAG	0.597																0.060773	-15.32155	21.158769	11	170	KEEP	---	---	---	---	10	5	101	99	-1	capture	Silent	SNP	46733408	46733408	IGFL1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7511	112
KLK6	5653	broad.mit.edu	37	19	51462532	51462532	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51462532C>T	uc002pui.2	-	7	883	c.623G>A	c.(622-624)CGA>CAA	p.R208Q	KLK6_uc010eoj.2_Missense_Mutation_p.E80K|KLK6_uc002puh.2_Missense_Mutation_p.R217Q|KLK6_uc002puj.2_Missense_Mutation_p.R101Q|KLK6_uc010ycn.1_Missense_Mutation_p.R101Q|KLK6_uc002pul.2_Missense_Mutation_p.R208Q|KLK6_uc002pum.2_Missense_Mutation_p.R101Q	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A	208	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CACAAGGCCTCGGAGGTGGTC	0.393																0.024845	-33.871051	6.391627	4	157	KEEP	---	---	---	---	3	1	93	87	-1	capture	Missense_Mutation	SNP	51462532	51462532	KLK6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8328	112
SMARCAL1	50485	broad.mit.edu	37	2	217285033	217285033	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:217285033C>T	uc002vgc.3	+	5	1204	c.874C>T	c.(874-876)CAG>TAG	p.Q292*	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Nonsense_Mutation_p.Q292*|SMARCAL1_uc010fvg.2_Nonsense_Mutation_p.Q292*	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	292	HARP 1.				chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GAAAGCAGCCCAGAGCCTCCC	0.557												Schimke_Immuno-Osseous_Dysplasia				0.857143	82.718072	86.158716	24	4	KEEP	---	---	---	---	8	18	4	2	-1	capture	Nonsense_Mutation	SNP	217285033	217285033	SMARCAL1	2	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	14665	112
TSHZ2	128553	broad.mit.edu	37	20	51870294	51870294	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870294C>T	uc002xwo.2	+	2	1253	c.297C>T	c.(295-297)TGC>TGT	p.C99C		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	99					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			AGAGTGTCTGCGGCAGAGATG	0.512																0.042017	-17.92092	8.890118	5	114	KEEP	---	---	---	---	3	2	68	59	-1	capture	Silent	SNP	51870294	51870294	TSHZ2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	16507	112
RRP1B	23076	broad.mit.edu	37	21	45092195	45092195	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45092195C>A	uc002zdk.2	+	3	334	c.220C>A	c.(220-222)CTC>ATC	p.L74I		NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	74					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		GCAGGAAGAGCTCGCCAACAC	0.552																0.805	522.742728	540.114201	161	39	KEEP	---	---	---	---	73	119	24	19	0.619791666667	capture	Missense_Mutation	SNP	45092195	45092195	RRP1B	21	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	13580	112
PIK3CB	5291	broad.mit.edu	37	3	138374298	138374298	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138374298A>C	uc011bmq.1	-	22	3146	c.3146T>G	c.(3145-3147)CTC>CGC	p.L1049R	PIK3CB_uc011bmn.1_Missense_Mutation_p.L561R|PIK3CB_uc011bmo.1_Missense_Mutation_p.L500R|PIK3CB_uc011bmp.1_Missense_Mutation_p.L636R|PIK3CB_uc003est.1_RNA	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	1049	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						GCTTTCCCTGAGCGCCTCATC	0.418					330											0.102941	5.572612	16.254706	7	61	KEEP	---	---	---	---	3	5	34	34	-1	capture	Missense_Mutation	SNP	138374298	138374298	PIK3CB	3	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	11817	112
RBM47	54502	broad.mit.edu	37	4	40440532	40440532	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440532C>T	uc003gvc.2	-	4	1089	c.379G>A	c.(379-381)GCA>ACA	p.A127T	RBM47_uc003gvd.2_Missense_Mutation_p.A127T|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.A89T|RBM47_uc003gvg.1_Missense_Mutation_p.A127T	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	127	RRM 1.					nucleus	nucleotide binding|RNA binding			breast(3)	3						TCACGCACTGCGCGCTTGGCC	0.642																0.65	118.338878	119.530704	39	21	KEEP	---	---	---	---	23	20	12	9	-1	capture	Missense_Mutation	SNP	40440532	40440532	RBM47	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13036	112
FYB	2533	broad.mit.edu	37	5	39202820	39202820	+	Silent	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:39202820C>T	uc003jls.2	-	1	310	c.243G>A	c.(241-243)CCG>CCA	p.P81P	FYB_uc003jlt.2_Silent_p.P81P|FYB_uc003jlu.2_Silent_p.P81P|FYB_uc011cpl.1_Silent_p.P91P	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	81					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			GCTTTAGAAACGGGGGCTTGG	0.552																0.723404	103.506043	105.598532	34	13	KEEP	---	---	---	---	17	19	7	8	-1	capture	Silent	SNP	39202820	39202820	FYB	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6066	112
NUDT12	83594	broad.mit.edu	37	5	102891710	102891710	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:102891710C>T	uc003koi.2	-	4	979	c.886G>A	c.(886-888)GGT>AGT	p.G296S	NUDT12_uc011cvb.1_Missense_Mutation_p.G278S	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12	296						nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		TTATAGCCACCTTCTTCAATT	0.393																0.096386	6.333704	19.890908	8	75	KEEP	---	---	---	---	3	6	37	48	-1	capture	Missense_Mutation	SNP	102891710	102891710	NUDT12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10635	112
PCDHGA1	56114	broad.mit.edu	37	5	140711002	140711002	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140711002G>A	uc003lji.1	+	1	751	c.751G>A	c.(751-753)GTC>ATC	p.V251I	PCDHGA1_uc011dan.1_Missense_Mutation_p.V251I	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	251	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCATATAAATGTCCCCGAAAA	0.493																0.746269	149.563024	153.244616	50	17	KEEP	---	---	---	---	24	30	9	9	-1	capture	Missense_Mutation	SNP	140711002	140711002	PCDHGA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11453	112
RUFY1	80230	broad.mit.edu	37	5	179036447	179036447	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179036447A>C	uc003mka.1	+	18	2054	c.2054A>C	c.(2053-2055)TAC>TCC	p.Y685S	RUFY1_uc003mkb.1_Missense_Mutation_p.Y577S|RUFY1_uc003mkc.1_Missense_Mutation_p.Y577S|RUFY1_uc003mkd.1_Missense_Mutation_p.Y287S	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	685	FYVE-type.				endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGCCCTCCTACCCCAAGCCG	0.647													HNSCC(44;0.11)			0.169492	0.98016	7.542632	10	49	KEEP	---	---	---	---	6	10	21	35	-1	capture	Missense_Mutation	SNP	179036447	179036447	RUFY1	5	A	C	C	C	1	0	0	0	0	1	0	0	0	182	14	4	4	13630	112
CARD11	84433	broad.mit.edu	37	7	2951813	2951813	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2951813G>A	uc003smv.2	-	23	3541	c.3137C>T	c.(3136-3138)GCC>GTC	p.A1046V		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1046	Guanylate kinase-like.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CACCTTGGCGGCCACAGCTTC	0.602					1492	Mis		DLBCL								0.388235	87.312948	88.255565	33	52	KEEP	---	---	---	---	21	15	45	21	-1	capture	Missense_Mutation	SNP	2951813	2951813	CARD11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2621	112
NXPH1	30010	broad.mit.edu	37	7	8791355	8791355	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:8791355G>A	uc003srv.2	+	3	1683	c.772G>A	c.(772-774)GAC>AAC	p.D258N	NXPH1_uc011jxh.1_Missense_Mutation_p.D141N	NM_152745	NP_689958	P58417	NXPH1_HUMAN	neurexophilin 1 precursor	258	V (Cys-rich).					extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		AGTGTGCCCTGACTACAACTA	0.443																0.119048	5.042367	11.030479	5	37	KEEP	---	---	---	---	4	2	24	16	-1	capture	Missense_Mutation	SNP	8791355	8791355	NXPH1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	10695	112
ZNF713	349075	broad.mit.edu	37	7	56007178	56007178	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56007178T>C	uc003trc.1	+	4	810	c.772T>C	c.(772-774)TCA>CCA	p.S258P	ZNF713_uc003tra.1_Missense_Mutation_p.S271P|MRPS17_uc003trb.2_Intron	NM_182633	NP_872439	Q8N859	ZN713_HUMAN	zinc finger protein 713	258					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CAGCCACACCTCATCTCTTAG	0.423																0.027778	-20.044539	6.481922	3	105	KEEP	---	---	---	---	2	1	55	59	-1	capture	Missense_Mutation	SNP	56007178	56007178	ZNF713	7	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17993	112
AHCYL2	23382	broad.mit.edu	37	7	129062691	129062691	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129062691G>T	uc011kov.1	+	13	1526	c.1472G>T	c.(1471-1473)CGG>CTG	p.R491L	AHCYL2_uc003vot.2_Missense_Mutation_p.R490L|AHCYL2_uc003vov.2_Missense_Mutation_p.R388L|AHCYL2_uc011kow.1_Missense_Mutation_p.R389L|AHCYL2_uc011kox.1_Missense_Mutation_p.R388L	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform	491					one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						GCGAGTCTGCGGACACCAGAA	0.507	Pancreas(160;1736 1964 29875 40941 45605)															0.025	-33.510689	6.501473	4	156	KEEP	---	---	---	---	1	3	90	95	0.25	capture	Missense_Mutation	SNP	129062691	129062691	AHCYL2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	411	112
TP53INP1	94241	broad.mit.edu	37	8	95952365	95952365	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95952365A>G	uc003yhg.2	-	3	580	c.196T>C	c.(196-198)TTT>CTT	p.F66L	C8orf38_uc003yhe.1_Intron|C8orf38_uc003yhf.2_Intron|TP53INP1_uc003yhh.2_Missense_Mutation_p.F66L	NM_033285	NP_150601	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	66					apoptosis	PML body					0	Breast(36;8.75e-07)					AAACAGGAAAAGACTGAAGGG	0.463																0.054795	-7.723735	7.865363	4	69	KEEP	---	---	---	---	2	2	36	38	-1	capture	Missense_Mutation	SNP	95952365	95952365	TP53INP1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	16271	112
CYP11B1	1584	broad.mit.edu	37	8	143956491	143956491	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143956491C>G	uc003yxi.2	-	8	1287	c.1280G>C	c.(1279-1281)CGC>CCC	p.R427P	CYP11B1_uc010mex.2_Missense_Mutation_p.R126P|CYP11B1_uc003yxh.2_Intron|CYP11B1_uc003yxj.2_Intron|CYP11B1_uc010mey.2_Missense_Mutation_p.R498P	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	427					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GTCTAGCCAGCGCTGGGGGTT	0.647												Familial_Hyperaldosteronism_type_I				0.115385	17.581123	32.683451	12	92	KEEP	---	---	---	---	3	10	56	50	-1	capture	Missense_Mutation	SNP	143956491	143956491	CYP11B1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	4105	112
C9orf64	84267	broad.mit.edu	37	9	86571236	86571236	+	Silent	SNP	G	A	A			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86571236G>A	uc004anb.2	-	1	428	c.180C>T	c.(178-180)GCC>GCT	p.A60A	C9orf64_uc004anc.2_Intron	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267	60											0						CGGCCTCGTCGGCCGCCCTGG	0.647																0.525641	127.813172	127.86146	41	37	KEEP	---	---	---	---	21	27	15	24	-1	capture	Silent	SNP	86571236	86571236	C9orf64	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2465	112
SEC16A	9919	broad.mit.edu	37	9	139369673	139369673	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139369673C>G	uc004chx.2	-	3	2704	c.2395G>C	c.(2395-2397)GAG>CAG	p.E799Q	SEC16A_uc004chv.3_Missense_Mutation_p.E426Q|SEC16A_uc004chw.2_Missense_Mutation_p.E799Q|SEC16A_uc010nbn.2_Missense_Mutation_p.E799Q|SEC16A_uc010nbo.1_Missense_Mutation_p.E799Q	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	621					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GCCTCCTCCTCTCCCATTTTG	0.572																0.761905	118.520549	121.151963	32	10	KEEP	---	---	---	---	18	17	5	7	-1	capture	Missense_Mutation	SNP	139369673	139369673	SEC16A	9	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	13879	112
MAGT1	84061	broad.mit.edu	37	X	77109426	77109426	+	Silent	SNP	T	C	C			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77109426T>C	uc004fof.2	-	7	956	c.894A>G	c.(892-894)GTA>GTG	p.V298V	MAGT1_uc004fog.3_Intron	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	266					protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				upper_aerodigestive_tract(1)	1						GTGTTTCAGCTACAAACTGGG	0.348																0.017647	-38.178624	6.384739	3	167	KEEP	---	---	---	---	4	0	88	119	-1	capture	Silent	SNP	77109426	77109426	MAGT1	23	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	9110	112
WDR67	93594	broad.mit.edu	37	8	124140520	124140521	+	Splice_Site	INS	-	T	T			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124140520_124140521insT	uc003ypp.1	+	14	1975	c.1885_splice	c.e14-1	p.F629_splice	WDR67_uc011lig.1_Splice_Site_p.F629_splice|WDR67_uc011lih.1_Splice_Site_p.F519_splice|WDR67_uc003ypq.1_Splice_Site|WDR67_uc003yps.1_Intron|WDR67_uc003ypt.1_Splice_Site_p.F86_splice|WDR67_uc003ypu.1_Splice_Site_p.F86_splice	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1							centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TTTTCTTACAGTTTTTTTTTCA	0.322																0.09			8	85		---	---	---	---						capture_indel	Splice_Site	INS	124140520	124140521	WDR67	8	-	T	T	T	1	0	1	1	0	0	0	1	0	468	36	5	5	17199	112
PASD1	139135	broad.mit.edu	37	X	150817142	150817144	+	In_Frame_Del	DEL	GCT	-	-			TCGA-06-6698-01	TCGA-06-6698-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150817142_150817144delGCT	uc004fev.3	+	9	1017_1019	c.685_687delGCT	c.(685-687)GCTdel	p.A236del		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	236	Poly-Ala.					nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTGAACCCgctgctgctgctg	0.355																0.04			7	191		---	---	---	---						capture_indel	In_Frame_Del	DEL	150817142	150817144	PASD1	23	GCT	-	-	-	1	0	1	0	1	0	0	0	0	494	38	5	5	11374	112
