Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARHGEF16	27237	broad.mit.edu	37	1	3394457	3394457	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3394457G>A	uc001akg.3	+	11	1740	c.1492G>A	c.(1492-1494)GCC>ACC	p.A498T	ARHGEF16_uc001aki.2_Missense_Mutation_p.A210T|ARHGEF16_uc001akj.2_Missense_Mutation_p.A210T|ARHGEF16_uc010nzh.1_Missense_Mutation_p.A202T	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	498					activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		ACTGATCTCTGCCTCCCGGTG	0.622																0.493333	105.948057	105.951231	37	38	KEEP	---	---	---	---	20	24	21	22	-1	capture	Missense_Mutation	SNP	3394457	3394457	ARHGEF16	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	892	127
ADCY10	55811	broad.mit.edu	37	1	167814945	167814945	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167814945G>A	uc001ger.2	-	21	3161	c.2863C>T	c.(2863-2865)CGC>TGC	p.R955C	ADCY10_uc009wvk.2_Missense_Mutation_p.R863C|ADCY10_uc010plj.1_Missense_Mutation_p.R802C|ADCY10_uc009wvl.2_Missense_Mutation_p.R954C	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	955					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						TCTAAAAAGCGGGCACATTTC	0.488																0.423729	161.866348	162.456108	50	68	KEEP	---	---	---	---	29	25	39	37	-1	capture	Missense_Mutation	SNP	167814945	167814945	ADCY10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	293	127
KIAA1614	57710	broad.mit.edu	37	1	180904433	180904433	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180904433G>A	uc001gok.2	+	5	1455	c.1388G>A	c.(1387-1389)CGT>CAT	p.R463H	KIAA1614_uc001gol.1_Missense_Mutation_p.R84H|KIAA1614_uc001gom.1_Intron	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710	463										ovary(3)|skin(1)	4						GCCGAGTTCCGTCACCTGGAG	0.731																0.5	15.775067	15.775067	5	5	KEEP	---	---	---	---	5	5	2	6	-1	capture	Missense_Mutation	SNP	180904433	180904433	KIAA1614	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8170	127
GLUL	2752	broad.mit.edu	37	1	182356407	182356407	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:182356407C>T	uc001gpa.1	-	3	399	c.187G>A	c.(187-189)GAT>AAT	p.D63N	GLUL_uc010pnt.1_5'Flank|GLUL_uc001gpb.1_Missense_Mutation_p.D63N|GLUL_uc001gpc.1_Missense_Mutation_p.D63N|GLUL_uc001gpd.1_Missense_Mutation_p.D63N	NM_001033056	NP_001028228	P15104	GLNA_HUMAN	glutamine synthetase	63					cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding				0					Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)	CTAGAGCCATCGAAATTCCAC	0.473																0.455285	176.389693	176.603424	56	67	KEEP	---	---	---	---	27	34	44	31	-1	capture	Missense_Mutation	SNP	182356407	182356407	GLUL	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6414	127
RAB3GAP2	25782	broad.mit.edu	37	1	220359030	220359030	+	Silent	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:220359030G>A	uc010puk.1	-	18	1997	c.1833C>T	c.(1831-1833)AAC>AAT	p.N611N	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Silent_p.N191N	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	611					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		TCTGAGTGATGTTTCTAAGGC	0.333																0.053333	-7.667118	8.131431	4	71	KEEP	---	---	---	---	2	3	44	45	-1	capture	Silent	SNP	220359030	220359030	RAB3GAP2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	12831	127
HLX	3142	broad.mit.edu	37	1	221057616	221057616	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:221057616A>G	uc001hmv.3	+	4	1494	c.1037A>G	c.(1036-1038)GAG>GGG	p.E346G		NM_021958	NP_068777	Q14774	HLX_HUMAN	H2.0-like homeobox	346					cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				GBM - Glioblastoma multiforme(131;0.00914)		AAGGACAAGGAGGCTGGCGAG	0.667																0.482759	47.749646	47.757081	14	15	KEEP	---	---	---	---	8	6	9	6	-1	capture	Missense_Mutation	SNP	221057616	221057616	HLX	1	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	7141	127
HHIPL2	79802	broad.mit.edu	37	1	222705452	222705452	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222705452G>A	uc001hnh.1	-	6	1637	c.1579C>T	c.(1579-1581)CGA>TGA	p.R527*		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	527					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		GCCATAAGTCGACTAGACAAA	0.438																0.477273	63.969894	63.989778	21	23	KEEP	---	---	---	---	10	12	11	13	-1	capture	Nonsense_Mutation	SNP	222705452	222705452	HHIPL2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	7019	127
RYR2	6262	broad.mit.edu	37	1	237947552	237947552	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237947552C>T	uc001hyl.1	+	90	12660	c.12540C>T	c.(12538-12540)GGC>GGT	p.G4180G	RYR2_uc010pya.1_Silent_p.G595G	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4180					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCAACGAAGGCGGAGAGAAAG	0.502																0.385714	156.84525	158.437686	54	86	KEEP	---	---	---	---	36	19	48	42	-1	capture	Silent	SNP	237947552	237947552	RYR2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13661	127
LRRC55	219527	broad.mit.edu	37	11	56949854	56949854	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56949854C>T	uc001njl.1	+	1	634	c.487C>T	c.(487-489)CTG>TTG	p.L163L		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	133	LRR 3.					integral to membrane					0						ACACTTGGACCTGAGCTACAA	0.582																0.317073	40.361699	41.580801	13	28	KEEP	---	---	---	---	7	6	13	15	-1	capture	Silent	SNP	56949854	56949854	LRRC55	11	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8926	127
OR5AN1	390195	broad.mit.edu	37	11	59132440	59132440	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59132440G>T	uc010rks.1	+	1	509	c.509G>T	c.(508-510)TGT>TTT	p.C170F		NM_001004729	NP_001004729	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN,	170	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CTCCACTTCTGTGGGTCTAAT	0.443																0.422053	355.063193	356.46129	111	152	KEEP	---	---	---	---	68	53	86	75	0.561983471074	capture	Missense_Mutation	SNP	59132440	59132440	OR5AN1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	11047	127
MMP13	4322	broad.mit.edu	37	11	102822878	102822878	+	Missense_Mutation	SNP	G	A	A	rs147544761		TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102822878G>A	uc001phl.2	-	5	690	c.662C>T	c.(661-663)GCG>GTG	p.A221V		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	221					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		GAACTCATGCGCAGCAACAAG	0.423																0.411458	219.888622	221.202121	79	113	KEEP	---	---	---	---	46	38	52	74	-1	capture	Missense_Mutation	SNP	102822878	102822878	MMP13	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9564	127
GRIN2B	2904	broad.mit.edu	37	12	13724856	13724856	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13724856T>C	uc001rbt.2	-	10	2232	c.2053A>G	c.(2053-2055)ACC>GCC	p.T685A		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	685	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTGGGCACGGTCCCAAAGCGG	0.353				p.T685A(OC316-Tumor)	371											0.035714	-12.12346	7.513132	3	81	KEEP	---	---	---	---	3	0	58	28	-1	capture	Missense_Mutation	SNP	13724856	13724856	GRIN2B	12	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6713	127
NR4A1	3164	broad.mit.edu	37	12	52448556	52448556	+	Silent	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52448556G>T	uc001rzs.2	+	3	758	c.444G>T	c.(442-444)CCG>CCT	p.P148P	NR4A1_uc010sno.1_Silent_p.P161P|NR4A1_uc001rzr.2_Silent_p.P148P|NR4A1_uc009zmb.1_Silent_p.P148P|NR4A1_uc001rzt.2_Silent_p.P148P|NR4A1_uc009zmc.2_5'Flank	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	148					nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GCTTCCAGCCGCCCCAGCTCT	0.677																0.519231	89.143126	89.161123	27	25	KEEP	---	---	---	---	14	17	12	15	0.451612903226	capture	Silent	SNP	52448556	52448556	NR4A1	12	G	T	T	T	1	0	0	0	0	0	0	0	1	483	38	4	4	10539	127
ESYT1	23344	broad.mit.edu	37	12	56536179	56536179	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56536179G>T	uc001sjq.2	+	25	2753	c.2703G>T	c.(2701-2703)CAG>CAT	p.Q901H	ESYT1_uc001sjr.2_Missense_Mutation_p.Q911H	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	901						integral to membrane				ovary(4)|skin(1)	5						GCAGTGGTCAGGGGCAGGTGC	0.622																0.444444	124.587947	124.830103	40	50	KEEP	---	---	---	---	23	19	27	24	0.547619047619	capture	Missense_Mutation	SNP	56536179	56536179	ESYT1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	5219	127
RNFT2	84900	broad.mit.edu	37	12	117217036	117217036	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117217036C>T	uc009zwn.2	+	7	998	c.765C>T	c.(763-765)GAC>GAT	p.D255D	RNFT2_uc001twb.3_Silent_p.D255D|RNFT2_uc001twa.3_Silent_p.D165D|RNFT2_uc001twc.3_Silent_p.D3D	NM_001109903	NP_001103373	Q96EX2	RNFT2_HUMAN	transmembrane protein 118 isoform 1	255	Extracellular (Potential).					integral to membrane	zinc ion binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		AGATGCTGGACTTCTTTGACC	0.547																0.444915	334.614572	335.242334	105	131	KEEP	---	---	---	---	54	60	80	78	-1	capture	Silent	SNP	117217036	117217036	RNFT2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	13394	127
VSIG10	54621	broad.mit.edu	37	12	118517207	118517207	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118517207C>A	uc001tws.2	-	4	1203	c.869G>T	c.(868-870)TGT>TTT	p.C290F		NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	290	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane					0						GCTTGTAACACACTTGAACTT	0.542																0.536232	119.398644	119.480525	37	32	KEEP	---	---	---	---	27	12	17	18	0.307692307692	capture	Missense_Mutation	SNP	118517207	118517207	VSIG10	12	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	17105	127
CCDC60	160777	broad.mit.edu	37	12	119942953	119942953	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119942953G>A	uc001txe.2	+	7	1193	c.728G>A	c.(727-729)CGG>CAG	p.R243Q	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	243										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AGTCTGAGTCGGGCCAGTGGG	0.557																0.448133	340.169441	340.733368	108	133	KEEP	---	---	---	---	52	68	66	79	-1	capture	Missense_Mutation	SNP	119942953	119942953	CCDC60	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2805	127
RNF17	56163	broad.mit.edu	37	13	25425654	25425654	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25425654C>T	uc001upr.2	+	24	3306	c.3265C>T	c.(3265-3267)CGT>TGT	p.R1089C	RNF17_uc010tdd.1_Missense_Mutation_p.R948C|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.R1085C|RNF17_uc001ups.2_Missense_Mutation_p.R1028C|RNF17_uc010aac.2_Missense_Mutation_p.R287C|RNF17_uc010aad.2_Missense_Mutation_p.R141C	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1089					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AAAAGGAGAGCGTGTTGATGT	0.333																0.756757	93.817127	96.040106	28	9	KEEP	---	---	---	---	22	11	4	5	-1	capture	Missense_Mutation	SNP	25425654	25425654	RNF17	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13353	127
PCDH9	5101	broad.mit.edu	37	13	67205380	67205380	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:67205380T>C	uc001vik.2	-	4	3994	c.3302A>G	c.(3301-3303)AAG>AGG	p.K1101R	PCDH9_uc010aei.2_RNA|PCDH9_uc001vil.2_Missense_Mutation_p.K1067R|PCDH9_uc010thl.1_Missense_Mutation_p.K1059R	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	1101	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TTCAGTCCTCTTGTCCGGAGA	0.512																0.417808	225.255056	226.115097	61	85	KEEP	---	---	---	---	43	27	51	41	-1	capture	Missense_Mutation	SNP	67205380	67205380	PCDH9	13	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11421	127
KLF12	11278	broad.mit.edu	37	13	74387376	74387376	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:74387376C>T	uc001vjf.2	-	5	941	c.719G>A	c.(718-720)AGT>AAT	p.S240N	KLF12_uc010aeq.2_Missense_Mutation_p.S240N|KLF12_uc001vjg.3_Missense_Mutation_p.S240N	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	240					negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		ATCATCATCACTGTCACTTTT	0.423																0.267123	101.352589	108.509086	39	107	KEEP	---	---	---	---	22	20	64	51	-1	capture	Missense_Mutation	SNP	74387376	74387376	KLF12	13	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	8261	127
HEATR5A	25938	broad.mit.edu	37	14	31852888	31852888	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31852888C>T	uc001wrf.3	-	4	633	c.556G>A	c.(556-558)GCA>ACA	p.A186T	HEATR5A_uc010ami.2_Missense_Mutation_p.A84T|HEATR5A_uc001wrg.1_Missense_Mutation_p.A68T|HEATR5A_uc010tpk.1_Missense_Mutation_p.A479T	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	473							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GAGGGTAATGCCACGGCAATG	0.468																0.02139	-40.860845	7.021881	4	183	KEEP	---	---	---	---	3	3	86	112	-1	capture	Missense_Mutation	SNP	31852888	31852888	HEATR5A	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6958	127
RYR3	6263	broad.mit.edu	37	15	34049760	34049760	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34049760G>A	uc001zhi.2	+	60	8738	c.8668G>A	c.(8668-8670)GGA>AGA	p.G2890R	RYR3_uc010bar.2_Missense_Mutation_p.G2890R	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2890	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TAGCAGCAGCGGATATGCCTC	0.512																0.473684	30.374425	30.385831	9	10	KEEP	---	---	---	---	4	5	5	6	-1	capture	Missense_Mutation	SNP	34049760	34049760	RYR3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13662	127
SPTBN5	51332	broad.mit.edu	37	15	42162053	42162053	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42162053G>A	uc001zos.2	-	32	6067	c.5734C>T	c.(5734-5736)CGC>TGC	p.R1912C		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1947	Spectrin 16.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GTGCGGAAGCGGGCCAGGAGG	0.682																0.5	29.976146	29.976146	9	9	KEEP	---	---	---	---	6	8	5	4	-1	capture	Missense_Mutation	SNP	42162053	42162053	SPTBN5	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15014	127
GALK2	2585	broad.mit.edu	37	15	49620177	49620177	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49620177A>G	uc001zxj.1	+	10	1296	c.1198A>G	c.(1198-1200)ACT>GCT	p.T400A	GALK2_uc001zxi.1_Missense_Mutation_p.T389A|GALK2_uc010ufb.1_Missense_Mutation_p.T376A|GALK2_uc001zxk.2_RNA|GALK2_uc010ufc.1_Missense_Mutation_p.T376A	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1	400					galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		GTCACGACTTACTGGAGCAGG	0.438																0.382979	193.827793	195.51702	54	87	KEEP	---	---	---	---	35	27	61	45	-1	capture	Missense_Mutation	SNP	49620177	49620177	GALK2	15	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	6144	127
SLC24A1	9187	broad.mit.edu	37	15	65917215	65917215	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65917215C>A	uc010ujf.1	+	2	1084	c.797C>A	c.(796-798)GCA>GAA	p.A266E	SLC24A1_uc010ujd.1_Missense_Mutation_p.A266E|SLC24A1_uc010uje.1_Missense_Mutation_p.A266E|SLC24A1_uc010ujg.1_Missense_Mutation_p.A266E|SLC24A1_uc010ujh.1_Missense_Mutation_p.A266E	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24	266	Extracellular (Potential).				response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						GAGGTAGAAGCAAACGTCTTG	0.473																0.43609	179.09229	179.571862	58	75	KEEP	---	---	---	---	24	36	37	40	0.6	capture	Missense_Mutation	SNP	65917215	65917215	SLC24A1	15	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	14357	127
MYO15A	51168	broad.mit.edu	37	17	18052554	18052554	+	Silent	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18052554G>A	uc010vxh.1	+	33	7319	c.6981G>A	c.(6979-6981)TCG>TCA	p.S2327S		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2327	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GCTGGGACTCGGATGAGGACA	0.512																0.5	64.525387	64.525387	19	19	KEEP	---	---	---	---	10	11	12	11	-1	capture	Silent	SNP	18052554	18052554	MYO15A	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9973	127
MYO1D	4642	broad.mit.edu	37	17	31107790	31107790	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:31107790C>T	uc002hho.1	-	2	120	c.108G>A	c.(106-108)GGG>GGA	p.G36G	MYO1D_uc002hhp.1_Silent_p.G36G|MYO1D_uc010wcb.1_Silent_p.G36G	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	36	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TATAGATGCGCCCTTTTTCAA	0.413																0.478873	105.801337	105.824551	34	37	KEEP	---	---	---	---	22	12	19	22	-1	capture	Silent	SNP	31107790	31107790	MYO1D	17	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	9981	127
SLC4A1	6521	broad.mit.edu	37	17	42335421	42335421	+	Silent	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42335421G>A	uc002igf.3	-	11	1364	c.1215C>T	c.(1213-1215)GTC>GTT	p.V405V	SLC4A1_uc002igg.3_Silent_p.V405V	NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	405	Helical; (Potential).|Membrane (anion exchange).		Missing (in EL4).		bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CGGCAGCCAGGACCTGGGGGC	0.597																0.376068	123.413044	124.973657	44	73	KEEP	---	---	---	---	30	18	34	45	-1	capture	Silent	SNP	42335421	42335421	SLC4A1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	14542	127
RBBP8	5932	broad.mit.edu	37	18	20564928	20564928	+	Silent	SNP	T	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:20564928T>C	uc002ktw.2	+	8	1015	c.684T>C	c.(682-684)TAT>TAC	p.Y228Y	RBBP8_uc002kty.2_Silent_p.Y228Y|RBBP8_uc002ktz.2_Silent_p.Y228Y|RBBP8_uc002kua.2_Silent_p.Y228Y|RBBP8_uc002ktx.1_Silent_p.Y228Y	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a	228					cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			CTGACACTTATGACCAAAGTC	0.353				p.Y228Y(OCUM1-Tumor)	470						Direct_reversal_of_damage|Homologous_recombination					0.358491	110.920107	112.789407	38	68	KEEP	---	---	---	---	18	25	32	46	-1	capture	Silent	SNP	20564928	20564928	RBBP8	18	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	13000	127
C3	718	broad.mit.edu	37	19	6677900	6677900	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6677900G>T	uc002mfm.2	-	41	5047	c.4985C>A	c.(4984-4986)CCC>CAC	p.P1662H	C3_uc002mfl.2_Missense_Mutation_p.P398H	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1662					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		TGGTCAGTTGGGGCACCCAAA	0.557																0.330189	92.899209	95.603344	35	71	KEEP	---	---	---	---	26	11	49	30	0.702702702703	capture	Missense_Mutation	SNP	6677900	6677900	C3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	2184	127
FKBP8	23770	broad.mit.edu	37	19	18649190	18649190	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18649190G>A	uc002njk.1	-	5	718	c.605C>T	c.(604-606)ACG>ATG	p.T202M	FKBP8_uc002nji.1_Missense_Mutation_p.T40M|FKBP8_uc010xqi.1_Missense_Mutation_p.T231M|FKBP8_uc002njj.1_Missense_Mutation_p.T203M|FKBP8_uc002njl.1_Missense_Mutation_p.T203M|FKBP8_uc002njm.1_Missense_Mutation_p.T202M|FKBP8_uc010ebr.1_Missense_Mutation_p.T41M|FKBP8_uc002njn.2_RNA	NM_012181	NP_036313	Q14318	FKBP8_HUMAN	FK506-binding protein 8	202	PPIase FKBP-type.				apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1						GTCCACAGCCGTCTTCAGGGT	0.697																0.305556	59.02346	61.451348	22	50	KEEP	---	---	---	---	15	10	27	27	-1	capture	Missense_Mutation	SNP	18649190	18649190	FKBP8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5859	127
ZNF181	339318	broad.mit.edu	37	19	35232200	35232200	+	Missense_Mutation	SNP	T	G	G	rs143797666		TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35232200T>G	uc002nvu.3	+	4	1377	c.914T>G	c.(913-915)GTC>GGC	p.V305G	ZNF181_uc010xsa.1_Missense_Mutation_p.V304G|ZNF181_uc010xsb.1_Missense_Mutation_p.V304G|ZNF181_uc010xsc.1_Missense_Mutation_p.V240G	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	305	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTAGCCATGTCTCATCACTT	0.413																0.015228	-45.653043	6.889013	3	194	KEEP	---	---	---	---	2	1	100	104	-1	capture	Missense_Mutation	SNP	35232200	35232200	ZNF181	19	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	17629	127
TMEM147	10430	broad.mit.edu	37	19	36037641	36037641	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36037641C>T	uc002oaj.1	+	4	372	c.275C>T	c.(274-276)GCC>GTC	p.A92V	uc010eec.1_5'Flank|uc002oag.2_5'Flank|TMEM147_uc002oai.1_Missense_Mutation_p.A43V|TMEM147_uc002oak.1_Missense_Mutation_p.P2S	NM_032635	NP_116024	Q9BVK8	TM147_HUMAN	transmembrane protein 147	92						endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TCCCGGAATGCCGGCAAGGGA	0.572																0.028169	-27.811541	7.007485	4	138	KEEP	---	---	---	---	2	3	74	70	-1	capture	Missense_Mutation	SNP	36037641	36037641	TMEM147	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15945	127
NPHS1	4868	broad.mit.edu	37	19	36339161	36339161	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36339161C>T	uc002oby.2	-	10	1309	c.1309G>A	c.(1309-1311)GTA>ATA	p.V437I		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	437	Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCACATTTTACGTTCAGGATG	0.582																0.256881	142.505358	154.18226	56	162	KEEP	---	---	---	---	38	24	96	90	-1	capture	Missense_Mutation	SNP	36339161	36339161	NPHS1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10489	127
TTYH1	57348	broad.mit.edu	37	19	54930375	54930375	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54930375T>C	uc002qfq.2	+	2	292	c.200T>C	c.(199-201)ATC>ACC	p.I67T	TTYH1_uc010yey.1_Missense_Mutation_p.I116T|TTYH1_uc002qfr.2_Missense_Mutation_p.I67T|TTYH1_uc002qft.2_Missense_Mutation_p.I67T|TTYH1_uc002qfu.1_5'UTR	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	67	Cytoplasmic (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GTCTACCTCATCCGCTTCTGC	0.682																0.263158	104.724565	112.457824	40	112	KEEP	---	---	---	---	24	25	62	67	-1	capture	Missense_Mutation	SNP	54930375	54930375	TTYH1	19	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	16621	127
ZNF418	147686	broad.mit.edu	37	19	58441862	58441862	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58441862T>A	uc002qqs.1	-	3	359	c.67A>T	c.(67-69)AGT>TGT	p.S23C	ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Intron	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	23	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TGAACCTCACTAAGGAGACTC	0.483																0.084656	3.759647	36.842101	16	173	KEEP	---	---	---	---	10	7	78	100	-1	capture	Missense_Mutation	SNP	58441862	58441862	ZNF418	19	T	A	A	A	1	0	0	0	0	1	0	0	0	689	53	4	4	17775	127
ALMS1	7840	broad.mit.edu	37	2	73677648	73677648	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73677648A>G	uc002sje.1	+	10	4108	c.3997A>G	c.(3997-3999)ACT>GCT	p.T1333A	ALMS1_uc002sjf.1_Missense_Mutation_p.T1289A|ALMS1_uc002sjg.2_Missense_Mutation_p.T719A|ALMS1_uc002sjh.1_Missense_Mutation_p.T719A	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1331	17.|34 X 47 AA approximate tandem repeat.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TTTACCCTCTACTTTCTACTC	0.453																0.392593	377.315672	380.035141	106	164	KEEP	---	---	---	---	59	56	86	93	-1	capture	Missense_Mutation	SNP	73677648	73677648	ALMS1	2	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	535	127
INPP1	3628	broad.mit.edu	37	2	191236128	191236128	+	Nonstop_Mutation	SNP	G	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:191236128G>C	uc002ury.3	+	7	1900	c.1200G>C	c.(1198-1200)TAG>TAC	p.*400Y	INPP1_uc010fsb.2_Nonstop_Mutation_p.*400Y|INPP1_uc002urx.3_Nonstop_Mutation_p.*400Y	NM_001128928	NP_001122400	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	400					signal transduction		inositol-1,4-bisphosphate 1-phosphatase activity|metal ion binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)		Lithium(DB01356)	CGCATACCTAGAGGAACTCTA	0.493	Melanoma(130;184 1743 2185 19805 38428)															0.47541	107.772665	107.804728	29	32	KEEP	---	---	---	---	15	15	18	16	-1	capture	Nonstop_Mutation	SNP	191236128	191236128	INPP1	2	G	C	C	C	1	0	0	0	0	0	0	0	0	425	33	5	4	7674	127
PROKR2	128674	broad.mit.edu	37	20	5283335	5283335	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5283335G>A	uc010zqw.1	-	2	506	c.506C>T	c.(505-507)ACG>ATG	p.T169M	PROKR2_uc010zqx.1_Missense_Mutation_p.T169M|PROKR2_uc010zqy.1_Missense_Mutation_p.T169M	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	169	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GAAGGAGGCCGTTTGATAATT	0.488													HNSCC(71;0.22)			0.3	218.261931	227.916128	81	189	KEEP	---	---	---	---	44	53	97	107	-1	capture	Missense_Mutation	SNP	5283335	5283335	PROKR2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12449	127
SEMG2	6407	broad.mit.edu	37	20	43851266	43851266	+	Silent	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43851266A>G	uc010ggz.2	+	2	1050	c.993A>G	c.(991-993)ACA>ACG	p.T331T	SEMG2_uc002xnk.2_Silent_p.T331T|SEMG2_uc002xnl.2_Silent_p.T331T	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	331	Repeat-rich region.|4 X 60 AA tandem repeats, type I.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				ACCAGGTAACAATTCATAGTC	0.373																0.275168	117.700586	124.491468	41	108	KEEP	---	---	---	---	21	22	46	67	-1	capture	Silent	SNP	43851266	43851266	SEMG2	20	A	G	G	G	1	0	0	0	0	0	0	0	1	54	5	3	3	13938	127
WFDC8	90199	broad.mit.edu	37	20	44180784	44180784	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44180784G>A	uc002xow.2	-	6	686	c.607C>T	c.(607-609)CGC>TGC	p.R203C	WFDC8_uc002xox.2_Missense_Mutation_p.R203C	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor	203	WAP 3.					extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				AAGGGCTTGCGTGGGCAGAAA	0.423																0.319149	249.343376	257.543655	90	192	KEEP	---	---	---	---	57	40	105	108	-1	capture	Missense_Mutation	SNP	44180784	44180784	WFDC8	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17237	127
MOCS3	27304	broad.mit.edu	37	20	49575846	49575846	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49575846C>T	uc002xvy.1	+	1	484	c.467C>T	c.(466-468)CCG>CTG	p.P156L	DPM1_uc002xvw.1_5'Flank|DPM1_uc002xvx.1_5'Flank	NM_014484	NP_055299	O95396	MOCS3_HUMAN	molybdenum cofactor synthesis 3	156					enzyme active site formation via L-cysteine persulfide|Mo-molybdopterin cofactor biosynthetic process|tRNA thio-modification|tRNA wobble uridine modification|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|nucleotidyltransferase activity|protein binding|thiosulfate sulfurtransferase activity|URM1 activating enzyme activity			skin(2)|ovary(1)	3						GAATGCGTGCCGTACACTCAG	0.657																0.026667	-30.627439	6.573679	4	146	KEEP	---	---	---	---	3	1	84	81	-1	capture	Missense_Mutation	SNP	49575846	49575846	MOCS3	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9604	127
UMODL1	89766	broad.mit.edu	37	21	43496188	43496188	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43496188G>C	uc002zaf.1	+	2	151	c.151G>C	c.(151-153)GTG>CTG	p.V51L	UMODL1_uc002zad.1_5'UTR|UMODL1_uc002zae.1_5'UTR|UMODL1_uc002zag.1_Missense_Mutation_p.V51L|uc002zah.1_RNA	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	51	Extracellular (Potential).|EMI.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						GGTGGAGGCCGTGCAGACGTC	0.587	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)															0.412844	317.518827	318.96303	90	128	KEEP	---	---	---	---	57	42	73	67	-1	capture	Missense_Mutation	SNP	43496188	43496188	UMODL1	21	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	16862	127
CAV3	859	broad.mit.edu	37	3	8787341	8787341	+	Missense_Mutation	SNP	G	A	A	rs112626848		TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:8787341G>A	uc003bra.2	+	2	311	c.244G>A	c.(244-246)GTC>ATC	p.V82I	C3orf32_uc003bqz.2_5'Flank|CAV3_uc003brb.2_Missense_Mutation_p.V82I	NM_001234	NP_001225	P56539	CAV3_HUMAN	caveolin 3	82	Cytoplasmic (Potential).|Required for interaction with DAG1.				cell growth|elevation of cytosolic calcium ion concentration|muscle organ development|negative regulation of cardiac muscle hypertrophy|negative regulation of cell size|negative regulation of MAP kinase activity|negative regulation of sarcomere organization|positive regulation of microtubule polymerization|regulation of skeletal muscle contraction|regulation of ventricular cardiomyocyte membrane repolarization|T-tubule organization	caveola|dystrophin-associated glycoprotein complex|Golgi membrane|neuromuscular junction|T-tubule	protein C-terminus binding|protein complex binding|protein complex scaffold|sodium channel regulator activity			lung(1)|breast(1)	2						GCTGCTGGGCGTCCCACTGGC	0.587																0.475	57.928442	57.949581	19	21	KEEP	---	---	---	---	8	12	16	6	-1	capture	Missense_Mutation	SNP	8787341	8787341	CAV3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2671	127
RPL32	6161	broad.mit.edu	37	3	12880946	12880946	+	Silent	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12880946A>G	uc003bxl.2	-	2	393	c.180T>C	c.(178-180)TAT>TAC	p.Y60Y	RPL32_uc003bxm.2_Silent_p.Y60Y|RPL32_uc003bxn.2_Silent_p.Y60Y	NM_001007074	NP_001007075	P62910	RL32_HUMAN	ribosomal protein L32	60					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome			ovary(1)	1						TGTTGCTTCCATAACCAATGT	0.483																0.390698	501.887784	506.391738	168	262	KEEP	---	---	---	---	104	82	156	148	-1	capture	Silent	SNP	12880946	12880946	RPL32	3	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	13474	127
IQSEC1	9922	broad.mit.edu	37	3	12977752	12977752	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12977752G>A	uc003bxt.2	-	3	815	c.806C>T	c.(805-807)CCG>CTG	p.P269L	IQSEC1_uc003bxu.3_Missense_Mutation_p.P147L|IQSEC1_uc011auw.1_Missense_Mutation_p.P255L	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	269					regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						ATCCAGGGCCGGTGCCTCCTC	0.642																0.529915	197.657619	197.749166	62	55	KEEP	---	---	---	---	39	25	42	22	-1	capture	Missense_Mutation	SNP	12977752	12977752	IQSEC1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7740	127
ZNF385D	79750	broad.mit.edu	37	3	21606168	21606168	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:21606168C>T	uc003cce.2	-	3	582	c.174G>A	c.(172-174)CCG>CCA	p.P58P	ZNF385D_uc010hfb.1_RNA	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	58						nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						CTTTCTGAATCGGGTCCATCT	0.358																0.338583	125.993156	128.915657	43	84	KEEP	---	---	---	---	29	16	44	49	-1	capture	Silent	SNP	21606168	21606168	ZNF385D	3	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	17758	127
PRR23A	729627	broad.mit.edu	37	3	138724917	138724917	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138724917G>A	uc011bms.1	-	1	194	c.194C>T	c.(193-195)GCG>GTG	p.A65V		NM_001134659	NP_001128131	A6NEV1	PR23A_HUMAN	proline rich 23A	65											0						GGCACAGCCCGCGGCCAGGAC	0.721																0.769231	30.052583	30.914889	10	3	KEEP	---	---	---	---	3	9	2	1	-1	capture	Missense_Mutation	SNP	138724917	138724917	PRR23A	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12489	127
MUC4	4585	broad.mit.edu	37	3	195515160	195515160	+	Silent	SNP	T	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195515160T>C	uc011bto.1	-	2	3751	c.3291A>G	c.(3289-3291)GCA>GCG	p.A1097A	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACCTGTGGATGCTGAGGAAG	0.572																0.5	6.850062	6.850062	2	2	KEEP	---	---	---	---	2	0	3	1	-1	capture	Silent	SNP	195515160	195515160	MUC4	3	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	9888	127
MAN2B2	23324	broad.mit.edu	37	4	6578364	6578364	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:6578364C>T	uc003gjf.1	+	2	234	c.198C>T	c.(196-198)CGC>CGT	p.R66R	MAN2B2_uc003gje.1_Silent_p.R66R|MAN2B2_uc011bwf.1_Silent_p.R66R	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	66					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						AGCTGGCCCGCGGCCAGCAGC	0.627																0.401575	138.487678	139.566125	51	76	KEEP	---	---	---	---	31	30	42	48	-1	capture	Silent	SNP	6578364	6578364	MAN2B2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9131	127
PCDH7	5099	broad.mit.edu	37	4	30726111	30726111	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:30726111G>T	uc003gsk.1	+	1	4075	c.3067G>T	c.(3067-3069)GAT>TAT	p.D1023Y	PCDH7_uc011bxw.1_Missense_Mutation_p.D976Y|PCDH7_uc011bxx.1_Missense_Mutation_p.D1023Y	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	1023	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						GGCCGTACAAGATCTACCACC	0.468																0.487805	114.958137	114.969783	40	42	KEEP	---	---	---	---	18	26	22	21	0.409090909091	capture	Missense_Mutation	SNP	30726111	30726111	PCDH7	4	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	11419	127
KLB	152831	broad.mit.edu	37	4	39435838	39435838	+	Silent	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39435838G>A	uc003gua.2	+	2	931	c.834G>A	c.(832-834)TCG>TCA	p.S278S	KLB_uc011byj.1_Silent_p.S278S	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	278	Extracellular (Potential).|Glycosyl hydrolase-1 1.				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						AGGCTCACTCGAAAGTTTGGC	0.413																0.452174	163.287796	163.516786	52	63	KEEP	---	---	---	---	36	24	31	38	-1	capture	Silent	SNP	39435838	39435838	KLB	4	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	8253	127
NPFFR2	10886	broad.mit.edu	37	4	73012972	73012972	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:73012972G>T	uc003hgg.2	+	4	1110	c.1012G>T	c.(1012-1014)GTC>TTC	p.V338F	NPFFR2_uc010iig.1_Missense_Mutation_p.V120F|NPFFR2_uc003hgi.2_Missense_Mutation_p.V239F|NPFFR2_uc003hgh.2_Missense_Mutation_p.V236F|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	338	Helical; Name=5; (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			CTCCCTCATTGTCATCATGTA	0.517																0.4	119.830249	120.661448	38	57	KEEP	---	---	---	---	20	21	30	33	0.487804878049	capture	Missense_Mutation	SNP	73012972	73012972	NPFFR2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10485	127
TMSL3	7117	broad.mit.edu	37	4	91760137	91760137	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:91760137G>C	uc003hsy.2	-	1	133	c.52C>G	c.(52-54)CTG>GTG	p.L18V	FAM190A_uc003hsv.3_Intron|FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsx.2_Intron	NM_183049	NP_898870			thymosin-like 3												0		all_cancers(2;6.48e-24)|all_epithelial(2;3.86e-25)|Colorectal(2;8.52e-12)|all_lung(2;3.73e-07)|Lung NSC(2;7.99e-07)|Renal(2;0.0243)|Hepatocellular(203;0.0411)		Epithelial(2;5.28e-11)|OV - Ovarian serous cystadenocarcinoma(123;8.9e-10)|all cancers(2;3.21e-09)|STAD - Stomach adenocarcinoma(1;0.0201)		GTCTTCTTCAGTTTCGGCTTA	0.522																0.374449	284.417066	287.559321	85	142	KEEP	---	---	---	---	41	51	93	72	-1	capture	Missense_Mutation	SNP	91760137	91760137	TMSL3	4	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	16142	127
CFI	3426	broad.mit.edu	37	4	110663746	110663746	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110663746C>T	uc003hzr.3	-	12	1643	c.1435G>A	c.(1435-1437)GAA>AAA	p.E479K	CFI_uc003hzq.2_Missense_Mutation_p.E276K|CFI_uc011cft.1_Missense_Mutation_p.E487K|CFI_uc003hzs.3_Missense_Mutation_p.E472K	NM_000204	NP_000195	P05156	CFAI_HUMAN	complement factor I preproprotein	479	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		AAGACTCTTTCGTTATCTAAA	0.338				p.E472K(HT115-Tumor)	317											0.440367	149.98712	150.32458	48	61	KEEP	---	---	---	---	24	28	32	37	-1	capture	Missense_Mutation	SNP	110663746	110663746	CFI	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3255	127
FAT1	2195	broad.mit.edu	37	4	187541102	187541102	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187541102T>A	uc003izf.2	-	10	6826	c.6638A>T	c.(6637-6639)AAA>ATA	p.K2213I		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2213	Extracellular (Potential).|Cadherin 20.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GTAGAACACTTTCAGGCCTTC	0.498	Colon(197;1040 2055 4143 4984 49344)												HNSCC(5;0.00058)			0.433594	325.680373	326.665536	111	145	KEEP	---	---	---	---	81	49	82	80	-1	capture	Missense_Mutation	SNP	187541102	187541102	FAT1	4	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	5635	127
CDH9	1007	broad.mit.edu	37	5	26902769	26902769	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26902769G>A	uc003jgs.1	-	7	1238	c.1069C>T	c.(1069-1071)CGA>TGA	p.R357*		NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	357	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						TGTAAGAATCGTGGATCAGGG	0.358	Melanoma(8;187 585 15745 40864 52829)															0.742857	167.847119	171.62346	52	18	KEEP	---	---	---	---	27	28	8	12	-1	capture	Nonsense_Mutation	SNP	26902769	26902769	CDH9	5	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	3088	127
MTX3	345778	broad.mit.edu	37	5	79284387	79284387	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79284387C>G	uc010jag.2	-	5	429	c.402G>C	c.(400-402)TTG>TTC	p.L134F	MTX3_uc010jah.2_Missense_Mutation_p.L134F|MTX3_uc003kge.3_Missense_Mutation_p.L73F|MTX3_uc003kgf.1_5'Flank	NM_001010891	NP_001010891	Q5HYI7	MTX3_HUMAN	metaxin 3	134					protein targeting to mitochondrion	mitochondrial outer membrane					0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		GGATCAAACTCAAAGGAAAAG	0.453																0.444444	57.396336	57.493085	16	20	KEEP	---	---	---	---	8	8	12	9	-1	capture	Missense_Mutation	SNP	79284387	79284387	MTX3	5	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	9879	127
GPR98	84059	broad.mit.edu	37	5	89943466	89943466	+	Silent	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89943466A>G	uc003kju.2	+	17	3270	c.3174A>G	c.(3172-3174)GGA>GGG	p.G1058G	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1058	Calx-beta 8.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGAAAAAGGAGAAACGCTCA	0.413																0.384615	226.8316	228.805389	65	104	KEEP	---	---	---	---	32	39	55	55	-1	capture	Silent	SNP	89943466	89943466	GPR98	5	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	6654	127
PCDHA12	56137	broad.mit.edu	37	5	140256668	140256668	+	Silent	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140256668G>A	uc003lic.2	+	1	1738	c.1611G>A	c.(1609-1611)GCG>GCA	p.A537A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.A537A	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	537	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGAGCGCGCGCGACGCCG	0.687	Pancreas(113;759 1672 13322 24104 50104)															0.390071	152.046976	153.518985	55	86	KEEP	---	---	---	---	31	32	48	56	-1	capture	Silent	SNP	140256668	140256668	PCDHA12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11425	127
SIM1	6492	broad.mit.edu	37	6	100838896	100838896	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100838896G>A	uc003pqj.3	-	11	1849	c.1642C>T	c.(1642-1644)CGA>TGA	p.R548*	SIM1_uc010kcu.2_Nonsense_Mutation_p.R548*	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	548	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GTACGATATCGGTCACCTGAT	0.428																0.435714	194.251715	194.756515	61	79	KEEP	---	---	---	---	27	40	36	51	-1	capture	Nonsense_Mutation	SNP	100838896	100838896	SIM1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14216	127
RFX6	222546	broad.mit.edu	37	6	117246619	117246619	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117246619C>T	uc003pxm.2	+	16	1745	c.1682C>T	c.(1681-1683)GCG>GTG	p.A561V		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	561					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TTTCCAGATGCGAGTAAAGCT	0.393																0.401961	238.001357	239.718125	82	122	KEEP	---	---	---	---	48	41	71	62	-1	capture	Missense_Mutation	SNP	117246619	117246619	RFX6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13162	127
SHPRH	257218	broad.mit.edu	37	6	146215353	146215353	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146215353A>G	uc003qlf.2	-	27	5027	c.4628T>C	c.(4627-4629)ATT>ACT	p.I1543T	SHPRH_uc003qld.2_Missense_Mutation_p.I1547T|SHPRH_uc003qle.2_Missense_Mutation_p.I1547T	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	1543	Helicase C-terminal.				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TTTTGAAATAATATCTAATAC	0.313																0.452055	115.66981	115.815614	33	40	KEEP	---	---	---	---	21	15	22	24	-1	capture	Missense_Mutation	SNP	146215353	146215353	SHPRH	6	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	14184	127
SMOC2	64094	broad.mit.edu	37	6	169064764	169064764	+	Silent	SNP	T	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:169064764T>C	uc003qws.1	+	12	1316	c.1296T>C	c.(1294-1296)GGT>GGC	p.G432G	SMOC2_uc003qwr.1_Silent_p.G443G|SMOC2_uc011egu.1_Silent_p.G109G	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	432					signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CCCCCAGAGGTCATGCTGAAA	0.299																0.044776	-7.931139	6.914888	3	64	KEEP	---	---	---	---	1	3	42	33	-1	capture	Silent	SNP	169064764	169064764	SMOC2	6	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	14694	127
NOD1	10392	broad.mit.edu	37	7	30492365	30492365	+	Missense_Mutation	SNP	C	T	T	rs139576372		TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30492365C>T	uc003tav.2	-	6	1191	c.668G>A	c.(667-669)CGG>CAG	p.R223Q	NOD1_uc010kvs.2_Intron	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	223	NACHT.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						TGCGTCTAGCCGGCCCGTGGC	0.577																0.354167	101.433935	103.228329	34	62	KEEP	---	---	---	---	17	20	38	32	-1	capture	Missense_Mutation	SNP	30492365	30492365	NOD1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10423	127
EGFR	1956	broad.mit.edu	37	7	55221711	55221711	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221711G>C	uc003tqk.2	+	7	1001	c.755G>C	c.(754-756)CGC>CCC	p.R252P	EGFR_uc003tqh.2_Missense_Mutation_p.R252P|EGFR_uc003tqi.2_Missense_Mutation_p.R252P|EGFR_uc003tqj.2_Missense_Mutation_p.R252P|EGFR_uc010kzg.1_Missense_Mutation_p.R207P|EGFR_uc011kco.1_Missense_Mutation_p.R199P|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	252	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R252C(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TAGGTCTGCCGCAAATTCCGA	0.587			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.105181	88.254724	186.958216	67	570	KEEP	---	---	---	---	39	37	321	342	-1	capture	Missense_Mutation	SNP	55221711	55221711	EGFR	7	G	C	C	C	1	0	0	0	0	1	0	0	0	494	38	4	4	4922	127
WNT2	7472	broad.mit.edu	37	7	116960680	116960680	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116960680C>T	uc003viz.2	-	2	551	c.251G>A	c.(250-252)CGC>CAC	p.R84H	WNT2_uc003vja.2_Silent_p.P9P	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	84					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GCAATTCCAGCGGTGCTGGCG	0.597																0.516129	49.999625	50.00658	16	15	KEEP	---	---	---	---	12	5	13	7	-1	capture	Missense_Mutation	SNP	116960680	116960680	WNT2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17267	127
MGAM	8972	broad.mit.edu	37	7	141734061	141734061	+	Splice_Site	SNP	G	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141734061G>T	uc003vwy.2	+	15	1724	c.1670_splice	c.e15-1	p.R557_splice		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTTGTTTCAGGAATCCTGGA	0.478																0.388889	20.620376	20.815264	7	11	KEEP	---	---	---	---	2	5	5	8	0.285714285714	capture	Splice_Site	SNP	141734061	141734061	MGAM	7	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	9453	127
FAM135B	51059	broad.mit.edu	37	8	139164563	139164563	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139164563G>A	uc003yuy.2	-	13	2326	c.2155C>T	c.(2155-2157)CGA>TGA	p.R719*	FAM135B_uc003yux.2_Nonsense_Mutation_p.R620*|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Nonsense_Mutation_p.R281*|FAM135B_uc003yvb.2_Nonsense_Mutation_p.R281*	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	719										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCATGTCTTCGAACAAACGGG	0.567													HNSCC(54;0.14)			0.112676	9.248388	19.764049	8	63	KEEP	---	---	---	---	4	4	33	37	-1	capture	Nonsense_Mutation	SNP	139164563	139164563	FAM135B	8	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	5403	127
BNC2	54796	broad.mit.edu	37	9	16419622	16419622	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:16419622G>A	uc003zml.2	-	7	2805	c.2665C>T	c.(2665-2667)CGT>TGT	p.R889C	BNC2_uc011lmw.1_Missense_Mutation_p.R794C|BNC2_uc003zmm.2_3'UTR|BNC2_uc011lmv.1_3'UTR|BNC2_uc003zmj.2_3'UTR|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.R676C	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	889					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		AACAGTTTACGATGTAGGTTT	0.488																0.178947	33.207925	42.435867	17	78	KEEP	---	---	---	---	9	9	48	36	-1	capture	Missense_Mutation	SNP	16419622	16419622	BNC2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1463	127
LINGO2	158038	broad.mit.edu	37	9	27950347	27950347	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27950347C>T	uc003zqu.1	-	2	517	c.323G>A	c.(322-324)CGT>CAT	p.R108H	LINGO2_uc010mjf.1_Missense_Mutation_p.R108H|LINGO2_uc003zqv.1_Missense_Mutation_p.R108H	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	108	LRR 3.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GCGGAGGGAACGCAGGTTAAA	0.438																0.782609	411.742705	423.642381	126	35	KEEP	---	---	---	---	69	65	27	10	-1	capture	Missense_Mutation	SNP	27950347	27950347	LINGO2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8735	127
WNK2	65268	broad.mit.edu	37	9	96051416	96051416	+	Silent	SNP	A	G	G			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96051416A>G	uc004ati.1	+	20	4491	c.4491A>G	c.(4489-4491)CCA>CCG	p.P1497P	WNK2_uc011lud.1_Silent_p.P1460P|WNK2_uc004atj.2_Silent_p.P1460P|WNK2_uc004atk.2_Silent_p.P1097P|WNK2_uc004atl.1_Silent_p.P55P	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1497					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						CTCCAGCTCCAGAGGCTGCCT	0.692					1420											0.75	41.707076	42.615704	12	4	KEEP	---	---	---	---	5	7	2	6	-1	capture	Silent	SNP	96051416	96051416	WNK2	9	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	17259	127
MAGEB4	4115	broad.mit.edu	37	X	30260502	30260502	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30260502G>A	uc004dcb.2	+	1	334	c.250G>A	c.(250-252)GAC>AAC	p.D84N	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	84										ovary(1)	1						TGATAAAGGCGACGAGAGCCA	0.517																0.1875	6.315371	7.778642	3	13	KEEP	---	---	---	---	2	1	6	7	-1	capture	Missense_Mutation	SNP	30260502	30260502	MAGEB4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9092	127
AR	367	broad.mit.edu	37	X	66937441	66937441	+	Silent	SNP	C	T	T			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:66937441C>T	uc004dwu.1	+	5	3410	c.2295C>T	c.(2293-2295)TTC>TTT	p.F765F	AR_uc004dwv.1_Silent_p.F233F	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	764	Ligand-binding.|Interaction with MYST2.		F -> L (in AIS).		cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	TGCTCTACTTCGCCCCTGATC	0.542					177							Androgen_Insensitivity_Syndrome				0.103448	2.904024	7.443863	3	26	KEEP	---	---	---	---	1	2	15	12	-1	capture	Silent	SNP	66937441	66937441	AR	23	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	829	127
KDM5D	8284	broad.mit.edu	37	Y	21897252	21897252	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:21897252T>A	uc004fug.2	-	8	1207	c.919A>T	c.(919-921)AGC>TGC	p.S307C	KDM5D_uc011naz.1_Missense_Mutation_p.S307C|KDM5D_uc010nwy.2_Missense_Mutation_p.S250C|KDM5D_uc011nba.1_Missense_Mutation_p.S307C|KDM5D_uc004fuh.2_Missense_Mutation_p.S262C	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D isoform	307					chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)	TGGGCACTGCTGTGATTCTTT	0.398																0.893333	238.480562	249.997652	67	8	KEEP	---	---	---	---	37	38	5	5	-1	capture	Missense_Mutation	SNP	21897252	21897252	KDM5D	24	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	8058	127
RYR2	6262	broad.mit.edu	37	1	237787140	237787151	+	In_Frame_Del	DEL	GATTTCCATGAA	-	-			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237787140_237787151delGATTTCCATGAA	uc001hyl.1	+	39	6112_6123	c.5992_6003delGATTTCCATGAA	c.(5992-6003)GATTTCCATGAAdel	p.DFHE1998del		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1998_2001	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCAACTATTGGATTTCCATGAAGATTTGATGA	0.307																0.16			14	71		---	---	---	---						capture_indel	In_Frame_Del	DEL	237787140	237787151	RYR2	1	GATTTCCATGAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	13661	127
OR9G9	504191	broad.mit.edu	37	11	56467944	56467944	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-3652-01	TCGA-12-3652-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56467944delC	uc010rjn.1	+	1	81	c.81delC	c.(79-81)TTCfs	p.F27fs		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	27	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGGGCCTCTTCGTGGTGTTCC	0.502																0.21			32	120		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	56467944	56467944	OR9G9	11	C	-	-	-	1	0	1	0	1	0	0	0	0	402	31	5	5	11156	127
