Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FLG2	388698	broad.mit.edu	37	1	152326384	152326384	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152326384T>C	uc001ezw.3	-	3	3951	c.3878A>G	c.(3877-3879)CAC>CGC	p.H1293R	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1293							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTTGTGTGTGAATGTGTTC	0.473																0.360092	469.539794	477.058089	157	279	KEEP	---	---	---	---	93	92	155	162	-1	capture	Missense_Mutation	SNP	152326384	152326384	FLG2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	5868	140
HHIPL2	79802	broad.mit.edu	37	1	222717002	222717002	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222717002C>T	uc001hnh.1	-	2	909	c.851G>A	c.(850-852)CGC>CAC	p.R284H		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	284					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		GCGATTGTGGCGGAATTTGGG	0.483																0.385965	294.799096	298.040136	110	175	KEEP	---	---	---	---	57	63	97	96	-1	capture	Missense_Mutation	SNP	222717002	222717002	HHIPL2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7019	140
FEZ1	9638	broad.mit.edu	37	11	125359436	125359436	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125359436T>G	uc001qbx.2	-	2	390	c.238A>C	c.(238-240)AAG>CAG	p.K80Q	FEZ1_uc010sbc.1_Missense_Mutation_p.K80Q|FEZ1_uc001qby.1_Missense_Mutation_p.K80Q	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1	80					axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		TTCTCGGTCTTGGCGTTGTAG	0.463	Melanoma(180;509 2033 10762 15939 24711)															0.284615	114.826591	120.23681	37	93	KEEP	---	---	---	---	17	24	60	50	-1	capture	Missense_Mutation	SNP	125359436	125359436	FEZ1	11	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	5769	140
VWF	7450	broad.mit.edu	37	12	6128780	6128780	+	Silent	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6128780G>A	uc001qnn.1	-	28	4054	c.3804C>T	c.(3802-3804)CAC>CAT	p.H1268H	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1268			H -> D (in VWD2).		blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	AGTAGAAATCGTGCAACGGCG	0.617																0.385417	97.732991	98.843698	37	59	KEEP	---	---	---	---	17	22	30	36	-1	capture	Silent	SNP	6128780	6128780	VWF	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17128	140
MON2	23041	broad.mit.edu	37	12	62954286	62954286	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:62954286C>T	uc001sre.2	+	26	3816	c.3425C>T	c.(3424-3426)GCT>GTT	p.A1142V	MON2_uc009zqj.2_Missense_Mutation_p.A1142V|MON2_uc010ssl.1_Missense_Mutation_p.A1070V|MON2_uc010ssm.1_Missense_Mutation_p.A1119V|MON2_uc010ssn.1_Missense_Mutation_p.A1142V|MON2_uc001srf.2_Missense_Mutation_p.A905V|MON2_uc001srg.2_Missense_Mutation_p.A17V	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	1143					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTTTCAAGAGCTTGGGATGTT	0.338																0.238095	31.659166	35.64826	15	48	KEEP	---	---	---	---	8	8	27	35	-1	capture	Missense_Mutation	SNP	62954286	62954286	MON2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9612	140
WSCD2	9671	broad.mit.edu	37	12	108589646	108589646	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108589646C>T	uc001tms.2	+	2	781	c.37C>T	c.(37-39)CGC>TGC	p.R13C	WSCD2_uc001tmt.2_Missense_Mutation_p.R13C	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	13						integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						GCGGTACTTCCGCCGGAAACC	0.587																0.318841	124.049401	128.075406	44	94	KEEP	---	---	---	---	20	27	43	64	-1	capture	Missense_Mutation	SNP	108589646	108589646	WSCD2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17288	140
TCHP	84260	broad.mit.edu	37	12	110352296	110352296	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110352296G>A	uc001tpn.2	+	11	1337	c.1184G>A	c.(1183-1185)CGA>CAA	p.R395Q	TCHP_uc001tpo.1_RNA|TCHP_uc001tpp.2_Missense_Mutation_p.R395Q	NM_001143852	NP_001137324	Q9BT92	TCHP_HUMAN	trichoplein	395	Trichohyalin/plectin homology domain.|Glu-rich.|Potential.|Interaction with keratin proteins.				apoptosis|negative regulation of cell growth	apical cortex|centrosome|keratin filament|mitochondrion|plasma membrane	protein binding			skin(1)	1						GAGCAGAACCGACGGGCACAA	0.483																0.344444	78.459366	80.400353	31	59	KEEP	---	---	---	---	13	21	35	38	-1	capture	Missense_Mutation	SNP	110352296	110352296	TCHP	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15587	140
CLIP1	6249	broad.mit.edu	37	12	122825886	122825886	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122825886A>T	uc001ucg.1	-	10	1971	c.1865T>A	c.(1864-1866)CTA>CAA	p.L622Q	CLIP1_uc001uch.1_Missense_Mutation_p.L611Q|CLIP1_uc001uci.1_Missense_Mutation_p.L576Q|CLIP1_uc001ucj.1_Missense_Mutation_p.L312Q|CLIP1_uc009zxo.1_Missense_Mutation_p.L178Q	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	622	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GGACTTCCATAGAGCTATCAC	0.488																0.384615	137.815893	139.334032	50	80	KEEP	---	---	---	---	33	23	48	41	-1	capture	Missense_Mutation	SNP	122825886	122825886	CLIP1	12	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	3497	140
OR11H12	440153	broad.mit.edu	37	14	19378054	19378054	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19378054A>C	uc010tkp.1	+	1	461	c.461A>C	c.(460-462)CAT>CCT	p.H154P		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	154	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATGACTGGGCATCTCTGTGCC	0.478																0.1	17.618253	46.403888	18	162	KEEP	---	---	---	---	9	16	114	112	-1	capture	Missense_Mutation	SNP	19378054	19378054	OR11H12	14	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	10831	140
TMCO5A	145942	broad.mit.edu	37	15	38228595	38228595	+	Missense_Mutation	SNP	C	T	T	rs138045481		TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:38228595C>T	uc001zjw.2	+	2	174	c.71C>T	c.(70-72)ACG>ATG	p.T24M	TMCO5A_uc001zjv.1_Missense_Mutation_p.T24M|TMCO5A_uc010bbc.1_Missense_Mutation_p.T24M	NM_152453	NP_689666	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	24	Potential.					integral to membrane				central_nervous_system(1)	1						GAAAGGGATACGCAGAGAATA	0.398																0.373494	83.401283	84.568705	31	52	KEEP	---	---	---	---	16	16	25	35	-1	capture	Missense_Mutation	SNP	38228595	38228595	TMCO5A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15884	140
USP8	9101	broad.mit.edu	37	15	50788098	50788098	+	Silent	SNP	T	C	C			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50788098T>C	uc001zym.3	+	18	3212	c.2712T>C	c.(2710-2712)TTT>TTC	p.F904F	USP8_uc001zyl.3_Silent_p.F904F|USP8_uc001zyn.3_Silent_p.F904F|USP8_uc010ufh.1_Silent_p.F798F|uc001zyo.1_5'Flank|USP8_uc001zyp.3_Silent_p.F71F	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	904					cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TCGATGACTTTAAAGCTGCAG	0.348																0.27027	32.536365	34.295864	10	27	KEEP	---	---	---	---	7	5	18	11	-1	capture	Silent	SNP	50788098	50788098	USP8	15	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	16971	140
ADCY9	115	broad.mit.edu	37	16	4016798	4016798	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4016798C>T	uc002cvx.2	-	11	3579	c.3040G>A	c.(3040-3042)GCG>ACG	p.A1014T		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	1014	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						TGAAGATCCGCTTCCACGTCT	0.567																0.076087	-3.40714	30.487932	14	170	KEEP	---	---	---	---	4	12	94	91	-1	capture	Missense_Mutation	SNP	4016798	4016798	ADCY9	16	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	301	140
CRYM	1428	broad.mit.edu	37	16	21273454	21273454	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21273454C>A	uc002dik.2	-	6	784	c.699G>T	c.(697-699)TGG>TGT	p.W233C	CRYM_uc010bwq.1_RNA|CRYM_uc002dil.2_Missense_Mutation_p.W191C|CRYM_uc002dim.2_Missense_Mutation_p.W233C	NM_001888	NP_001879	Q14894	CRYM_HUMAN	crystallin, mu isoform 1	233					negative regulation of transcription from RNA polymerase II promoter|sensory perception of sound|thyroid hormone transport	cytoplasm|nucleus|plasma membrane	NADP binding|protein homodimerization activity|thyroid hormone binding|transcription corepressor activity				0				GBM - Glioblastoma multiforme(48;0.0573)	Levothyroxine(DB00451)	CCAGTTCTCTCCAGTCAGGTC	0.532																0.28125	42.363457	45.092241	18	46	KEEP	---	---	---	---	10	11	18	34	0.52380952381	capture	Missense_Mutation	SNP	21273454	21273454	CRYM	16	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	3886	140
PRSS36	146547	broad.mit.edu	37	16	31151619	31151619	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31151619C>A	uc002ebd.2	-	14	2344	c.2285G>T	c.(2284-2286)TGT>TTT	p.C762F	PRSS36_uc010vff.1_Missense_Mutation_p.C537F|PRSS36_uc010vfg.1_Missense_Mutation_p.C757F|PRSS36_uc010vfh.1_Intron	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor	762	Peptidase S1 3.				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						CTGTACCTCACACCTGTTCTC	0.527																0.051724	-5.624823	6.706348	3	55	KEEP	---	---	---	---	3	1	34	27	0.25	capture	Missense_Mutation	SNP	31151619	31151619	PRSS36	16	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12520	140
NTN1	9423	broad.mit.edu	37	17	9066306	9066306	+	Nonsense_Mutation	SNP	A	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9066306A>T	uc002glw.3	+	3	1302	c.1195A>T	c.(1195-1197)AAG>TAG	p.K399*		NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor	399	Laminin EGF-like 2.				apoptosis|axon guidance		protein binding				0						CACCCACCGGAAGGCCTGCAA	0.637																0.411765	18.921538	19.037142	7	10	KEEP	---	---	---	---	1	7	5	5	-1	capture	Nonsense_Mutation	SNP	9066306	9066306	NTN1	17	A	T	T	T	1	0	0	0	0	0	1	0	0	117	9	5	4	10607	140
HNF1B	6928	broad.mit.edu	37	17	36059152	36059152	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36059152A>G	uc002hok.3	-	8	1804	c.1583T>C	c.(1582-1584)TTT>TCT	p.F528S	HNF1B_uc010wdi.1_Missense_Mutation_p.F502S	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	528					endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			TGCAGATGGAAACCGGGAGGT	0.517	Colon(71;102 1179 9001 27917 43397)				411							Hereditary_Prostate_Cancer				0.45098	82.426924	82.532421	23	28	KEEP	---	---	---	---	12	14	21	12	-1	capture	Missense_Mutation	SNP	36059152	36059152	HNF1B	17	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	7177	140
TMC8	147138	broad.mit.edu	37	17	76128876	76128876	+	Silent	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76128876G>A	uc002jup.2	+	5	838	c.456G>A	c.(454-456)CAG>CAA	p.Q152Q	TMC6_uc002jul.1_5'Flank|TMC8_uc002juq.2_Translation_Start_Site|TMC8_uc010wtr.1_5'Flank	NM_152468	NP_689681	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	152	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			CAGCCCTCCAGTGCCCTGGTA	0.592												Epidermodysplasia_Verruciformis_Familial_Clustering_of				0.237705	69.817763	77.484682	29	93	KEEP	---	---	---	---	12	25	45	59	-1	capture	Silent	SNP	76128876	76128876	TMC8	17	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	15876	140
DSC1	1823	broad.mit.edu	37	18	28712602	28712602	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28712602A>T	uc002kwn.2	-	14	2429	c.2167T>A	c.(2167-2169)TGT>AGT	p.C723S	DSC1_uc002kwm.2_Missense_Mutation_p.C723S	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	723	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TCTGGAAAACATTTCTTGACT	0.328																0.285714	39.132771	41.149942	14	35	KEEP	---	---	---	---	4	10	17	22	-1	capture	Missense_Mutation	SNP	28712602	28712602	DSC1	18	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	4720	140
GNA11	2767	broad.mit.edu	37	19	3113330	3113330	+	Silent	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3113330C>T	uc002lxd.2	+	3	566	c.324C>T	c.(322-324)GCC>GCT	p.A108A		NM_002067	NP_002058	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein),	108					activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			eye(70)|skin(16)	86		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CCTCGCAGGCCAATGCGCTCC	0.662						Mis		uveal melanoma								0.043956	-12.881731	7.391014	4	87	KEEP	---	---	---	---	3	2	59	48	-1	capture	Silent	SNP	3113330	3113330	GNA11	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	6435	140
MCOLN1	57192	broad.mit.edu	37	19	7593590	7593590	+	Splice_Site	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7593590G>A	uc002mgo.2	+	8	1109	c.984_splice	c.e8+1	p.N328_splice	MCOLN1_uc002mgp.2_Splice_Site_p.N293_splice	NM_020533	NP_065394	Q9GZU1	MCLN1_HUMAN	mucolipin 1						calcium ion transport|cellular iron ion homeostasis|transferrin transport	integral to plasma membrane|late endosome membrane|lysosomal membrane	cation channel activity|iron ion transmembrane transporter activity			breast(1)	1						GCTGCAGAACGTGAGGCTTCT	0.637																0.264151	32.021192	34.690539	14	39	KEEP	---	---	---	---	6	10	25	20	-1	capture	Splice_Site	SNP	7593590	7593590	MCOLN1	19	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	9308	140
MUC16	94025	broad.mit.edu	37	19	9020077	9020077	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9020077C>T	uc002mkp.2	-	21	37622	c.37418G>A	c.(37417-37419)AGA>AAA	p.R12473K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12475	Extracellular (Potential).|SEA 3.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGCCGCTCTCTGTTGAGTCC	0.562																0.304183	225.203376	234.200086	80	183	KEEP	---	---	---	---	47	38	112	101	-1	capture	Missense_Mutation	SNP	9020077	9020077	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	9883	140
OR7G2	390882	broad.mit.edu	37	19	9213273	9213273	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9213273A>G	uc010xkk.1	-	1	710	c.710T>C	c.(709-711)TTG>TCG	p.L237S		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AGTGTAAGACAAAATGATTCC	0.448	Esophageal Squamous(67;143 1448 28637 40648)															0.342593	113.045354	115.408039	37	71	KEEP	---	---	---	---	21	19	39	41	-1	capture	Missense_Mutation	SNP	9213273	9213273	OR7G2	19	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	11127	140
AKAP8	10270	broad.mit.edu	37	19	15484623	15484623	+	Silent	SNP	A	G	G	rs117407939		TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15484623A>G	uc002nav.2	-	4	406	c.345T>C	c.(343-345)GGT>GGC	p.G115G	AKAP8_uc010dzy.2_5'Flank|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_Intron	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	115	Poly-Gly.				signal transduction	nuclear matrix				ovary(1)|breast(1)	2						TGCCCTCCCCACCGCCGCCGC	0.632	GBM(190;1671 2163 3274 27186 30476)															0.206897	11.340572	13.646115	6	23	KEEP	---	---	---	---	2	5	16	8	-1	capture	Silent	SNP	15484623	15484623	AKAP8	19	A	G	G	G	1	0	0	0	0	0	0	0	1	67	6	3	3	457	140
ZNF99	7652	broad.mit.edu	37	19	22941396	22941396	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22941396C>A	uc010xrh.1	-	5	1042	c.1042G>T	c.(1042-1044)GCC>TCC	p.A348S		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTTCTAAGGGCTGAGAAACGC	0.363																0.282051	25.189271	26.868785	11	28	KEEP	---	---	---	---	4	8	9	21	0.666666666667	capture	Missense_Mutation	SNP	22941396	22941396	ZNF99	19	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	18080	140
FCGBP	8857	broad.mit.edu	37	19	40363235	40363235	+	Silent	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40363235C>T	uc002omp.3	-	32	14843	c.14835G>A	c.(14833-14835)GTG>GTA	p.V4945V		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4945	VWFD 12.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCTCGGCGGTCACCCGCACGC	0.657																0.434783	22.333223	22.419949	10	13	KEEP	---	---	---	---	5	6	4	12	-1	capture	Silent	SNP	40363235	40363235	FCGBP	19	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	5724	140
PELI1	57162	broad.mit.edu	37	2	64323378	64323378	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:64323378T>C	uc002scs.3	-	5	4610	c.571A>G	c.(571-573)ATG>GTG	p.M191V	PELI1_uc002sct.3_Missense_Mutation_p.M191V|PELI1_uc002scr.3_Missense_Mutation_p.M12V	NM_020651	NP_065702	Q96FA3	PELI1_HUMAN	pellino protein	191					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol				ovary(1)	1						CGTGGATGCATCACAAGAACA	0.458																0.378641	127.997969	129.32954	39	64	KEEP	---	---	---	---	20	22	37	32	-1	capture	Missense_Mutation	SNP	64323378	64323378	PELI1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	11624	140
ARHGAP25	9938	broad.mit.edu	37	2	69053291	69053291	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69053291G>A	uc002seu.2	+	11	2267	c.1903G>A	c.(1903-1905)GTC>ATC	p.V635I	ARHGAP25_uc010fdg.2_Missense_Mutation_p.V636I|ARHGAP25_uc010yql.1_Missense_Mutation_p.V596I|ARHGAP25_uc002sew.2_Missense_Mutation_p.V628I|ARHGAP25_uc002sex.2_Missense_Mutation_p.V629I|ARHGAP25_uc002sey.2_Missense_Mutation_p.V362I	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	635	Potential.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						CAAGGAATTTGTCAAATCCAT	0.552																0.264706	83.428183	90.241965	36	100	KEEP	---	---	---	---	27	14	65	52	-1	capture	Missense_Mutation	SNP	69053291	69053291	ARHGAP25	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	867	140
YSK4	80122	broad.mit.edu	37	2	135738921	135738921	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135738921G>T	uc002tue.1	-	9	3421	c.3390C>A	c.(3388-3390)TGC>TGA	p.C1130*	YSK4_uc002tuf.1_Nonsense_Mutation_p.C312*|YSK4_uc010fnc.1_Nonsense_Mutation_p.C264*|YSK4_uc010fnd.1_Nonsense_Mutation_p.C1017*|YSK4_uc010zbg.1_Nonsense_Mutation_p.C262*|YSK4_uc002tuh.3_Nonsense_Mutation_p.C858*|YSK4_uc002tui.3_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	1130	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCTCTTGCAAGCATGTCCCCA	0.418					411											0.252336	65.644032	71.559188	27	80	KEEP	---	---	---	---	17	15	43	43	0.53125	capture	Nonsense_Mutation	SNP	135738921	135738921	YSK4	2	G	T	T	T	1	0	0	0	0	0	1	0	0	438	34	5	4	17376	140
SAG	6295	broad.mit.edu	37	2	234237130	234237130	+	Silent	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234237130C>T	uc002vuh.2	+	8	907	c.519C>T	c.(517-519)TCC>TCT	p.S173S	SAG_uc010zmq.1_Silent_p.S39S	NM_000541	NP_000532	P10523	ARRS_HUMAN	S-arrestin	173					rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity			ovary(1)	1		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		ACAGGAGCTCCGTGCGATTAC	0.592																0.279221	112.357878	119.109865	43	111	KEEP	---	---	---	---	19	31	80	62	-1	capture	Silent	SNP	234237130	234237130	SAG	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13700	140
KCNG1	3755	broad.mit.edu	37	20	49626630	49626630	+	Silent	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49626630G>A	uc002xwa.3	-	2	541	c.246C>T	c.(244-246)GAC>GAT	p.D82D	KCNG1_uc002xwb.2_Silent_p.D82D	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	82	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						GCGGGAACTCGTCCAGCGTGG	0.632																0.388889	53.740927	54.331269	21	33	KEEP	---	---	---	---	11	12	19	20	-1	capture	Silent	SNP	49626630	49626630	KCNG1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7949	140
MN1	4330	broad.mit.edu	37	22	28193444	28193444	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:28193444C>T	uc003adj.2	-	1	4043	c.3088G>A	c.(3088-3090)GGC>AGC	p.G1030S		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	1030							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						TTGGCCCCGCCGTCCAGGGAC	0.657					140	T	ETV6	AML|meningioma								0.481013	114.251413	114.275702	38	41	KEEP	---	---	---	---	22	26	24	24	-1	capture	Missense_Mutation	SNP	28193444	28193444	MN1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9585	140
PRKCD	5580	broad.mit.edu	37	3	53222823	53222823	+	Silent	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53222823G>A	uc003dgl.2	+	16	1856	c.1503G>A	c.(1501-1503)GGG>GGA	p.G501G	PRKCD_uc003dgm.2_Silent_p.G501G	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	501	Protein kinase.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		ACATATTCGGGGAGAGCCGGG	0.552					215											0.378378	81.2792	82.240721	28	46	KEEP	---	---	---	---	17	15	26	25	-1	capture	Silent	SNP	53222823	53222823	PRKCD	3	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	12405	140
HHLA2	11148	broad.mit.edu	37	3	108076824	108076824	+	Silent	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108076824C>T	uc003dwy.3	+	6	986	c.819C>T	c.(817-819)TAC>TAT	p.Y273Y	HHLA2_uc011bhl.1_Silent_p.Y209Y|HHLA2_uc010hpu.2_Silent_p.Y273Y|HHLA2_uc003dwz.2_Silent_p.Y273Y	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	273	Ig-like V-type 2.					integral to membrane				ovary(1)	1						TCCTGGCTTACTATCTGAGCT	0.383																0.323699	150.24196	155.014119	56	117	KEEP	---	---	---	---	26	34	60	73	-1	capture	Silent	SNP	108076824	108076824	HHLA2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	7020	140
PKD2	5311	broad.mit.edu	37	4	88973174	88973174	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88973174A>G	uc003hre.2	+	7	1646	c.1580A>G	c.(1579-1581)TAC>TGC	p.Y527C	PKD2_uc011cdf.1_Translation_Start_Site|PKD2_uc011cdg.1_Translation_Start_Site|PKD2_uc011cdh.1_Translation_Start_Site	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2	527	Extracellular (Potential).					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		ATTAACATATACAGAACATCA	0.328																0.339286	58.159562	59.461594	19	37	KEEP	---	---	---	---	11	11	19	24	-1	capture	Missense_Mutation	SNP	88973174	88973174	PKD2	4	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	11869	140
POU4F2	5458	broad.mit.edu	37	4	147561831	147561831	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:147561831G>T	uc003ikv.2	+	2	1349	c.1101G>T	c.(1099-1101)CAG>CAT	p.Q367H		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	367	Homeobox.				estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					TTGCCATTCAGCCTCGGCCCT	0.582																0.336207	100.763867	103.530066	39	77	KEEP	---	---	---	---	18	26	39	44	0.409090909091	capture	Missense_Mutation	SNP	147561831	147561831	POU4F2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	12180	140
TLR2	7097	broad.mit.edu	37	4	154624496	154624496	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:154624496C>G	uc003inq.2	+	3	656	c.437C>G	c.(436-438)TCT>TGT	p.S146C	TLR2_uc003inr.2_Missense_Mutation_p.S146C|TLR2_uc003ins.2_Missense_Mutation_p.S146C	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	146	LRR 4.|Extracellular (Potential).				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				TCTCTTTTTTCTCATCTCACA	0.373																0.479167	79.493589	79.513052	23	25	KEEP	---	---	---	---	9	14	13	14	-1	capture	Missense_Mutation	SNP	154624496	154624496	TLR2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	15836	140
PIK3R1	5295	broad.mit.edu	37	5	67589149	67589149	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589149A>T	uc003jva.2	+	10	1697	c.1137A>T	c.(1135-1137)AAA>AAT	p.K379N	PIK3R1_uc003jvb.2_Missense_Mutation_p.K379N|PIK3R1_uc003jvc.2_Missense_Mutation_p.K79N|PIK3R1_uc003jvd.2_Missense_Mutation_p.K109N|PIK3R1_uc003jve.2_Missense_Mutation_p.K58N|PIK3R1_uc011crb.1_Missense_Mutation_p.K49N	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	379	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GAAATAACAAATTAATCAAAA	0.308				p.L380del(DAOY-Tumor)	370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.192308	10.260307	12.559055	5	21	KEEP	---	---	---	---	4	2	16	8	-1	capture	Missense_Mutation	SNP	67589149	67589149	PIK3R1	5	A	T	T	T	1	0	0	0	0	1	0	0	0	50	4	4	4	11821	140
CXXC5	51523	broad.mit.edu	37	5	139060958	139060958	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:139060958C>T	uc010jfg.1	+	2	1140	c.850C>T	c.(850-852)CGA>TGA	p.R284*	CXXC5_uc003let.2_Nonsense_Mutation_p.R284*	NM_016463	NP_057547	Q7LFL8	CXXC5_HUMAN	CXXC finger 5	284	CXXC-type.				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|nucleus	DNA binding|signal transducer activity|zinc ion binding			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGTAGGAATCGAAAGACTGG	0.562																0.311881	160.113951	166.501462	63	139	KEEP	---	---	---	---	37	32	80	77	-1	capture	Nonsense_Mutation	SNP	139060958	139060958	CXXC5	5	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4059	140
PCDHB12	56124	broad.mit.edu	37	5	140590067	140590067	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140590067C>T	uc003liz.2	+	1	1777	c.1588C>T	c.(1588-1590)CGC>TGC	p.R530C	PCDHB12_uc011dak.1_Missense_Mutation_p.R193C	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	530	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTCCAGTTCCGCGTGGGCGC	0.677																0.358974	118.837639	120.877729	42	75	KEEP	---	---	---	---	22	28	34	49	-1	capture	Missense_Mutation	SNP	140590067	140590067	PCDHB12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11440	140
PCDHGB6	56100	broad.mit.edu	37	5	140788951	140788951	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140788951T>G	uc003lkj.1	+	1	1182	c.1182T>G	c.(1180-1182)ATT>ATG	p.I394M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Missense_Mutation_p.I394M	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	394	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTCAAGATTTATTCTTCTT	0.453																0.41791	99.396451	99.788543	28	39	KEEP	---	---	---	---	12	18	23	16	-1	capture	Missense_Mutation	SNP	140788951	140788951	PCDHGB6	5	T	G	G	G	1	0	0	0	0	1	0	0	0	822	64	4	4	11470	140
BMP5	653	broad.mit.edu	37	6	55739290	55739290	+	Missense_Mutation	SNP	C	T	T	rs148184427		TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55739290C>T	uc003pcq.2	-	1	1086	c.374G>A	c.(373-375)CGT>CAT	p.R125H	BMP5_uc011dxf.1_Missense_Mutation_p.R125H	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	125					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTGTATGCGACGAGGATACCC	0.522																0.363636	20.994278	21.354023	8	14	KEEP	---	---	---	---	4	4	8	8	-1	capture	Missense_Mutation	SNP	55739290	55739290	BMP5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1451	140
LAMA2	3908	broad.mit.edu	37	6	129687471	129687471	+	Silent	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129687471C>T	uc003qbn.2	+	33	4930	c.4825C>T	c.(4825-4827)CTG>TTG	p.L1609L	LAMA2_uc003qbo.2_Silent_p.L1609L	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1609	Domain II and I.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATATAAAATGCTGTATGGTCT	0.517																0.275862	39.938927	42.592342	16	42	KEEP	---	---	---	---	7	9	20	25	-1	capture	Silent	SNP	129687471	129687471	LAMA2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	8526	140
CNTNAP2	26047	broad.mit.edu	37	7	147914501	147914501	+	Silent	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147914501G>A	uc003weu.1	+	19	3648	c.3132G>A	c.(3130-3132)CCG>CCA	p.P1044P		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1044	Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACTCCCACCCGGACCTGGCAC	0.562													HNSCC(39;0.1)			0.514563	167.175829	167.194774	53	50	KEEP	---	---	---	---	30	30	27	27	-1	capture	Silent	SNP	147914501	147914501	CNTNAP2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3612	140
ARMC1	55156	broad.mit.edu	37	8	66534548	66534548	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:66534548C>G	uc003xvl.2	-	3	460	c.225G>C	c.(223-225)AAG>AAC	p.K75N	ARMC1_uc011leo.1_Missense_Mutation_p.D37H	NM_018120	NP_060590	Q9NVT9	ARMC1_HUMAN	armadillo repeat-containing protein	75	ARM.				metal ion transport		metal ion binding			skin(1)	1			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			CTCCTTTCATCTTTTCTCTGT	0.338																0.023392	-34.163402	9.071419	4	167	KEEP	---	---	---	---	4	2	83	114	-1	capture	Missense_Mutation	SNP	66534548	66534548	ARMC1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	942	140
OR1L1	26737	broad.mit.edu	37	9	125424624	125424624	+	Silent	SNP	G	A	A			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125424624G>A	uc011lza.1	+	1	780	c.780G>A	c.(778-780)CCG>CCA	p.P260P		NM_001005236	NP_001005236	Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L,	260	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						TAATGACCCCGTTTTCATGCA	0.413																0.355932	164.866604	168.106742	63	114	KEEP	---	---	---	---	29	38	62	59	-1	capture	Silent	SNP	125424624	125424624	OR1L1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10867	140
MID1	4281	broad.mit.edu	37	X	10535512	10535512	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:10535512C>T	uc004cte.3	-	2	267	c.76G>A	c.(76-78)GCA>ACA	p.A26T	MID1_uc004ctd.3_5'Flank|MID1_uc004ctg.3_Missense_Mutation_p.A26T|MID1_uc004cth.3_Missense_Mutation_p.A26T|MID1_uc004ctk.3_Missense_Mutation_p.A26T|MID1_uc004cti.3_Missense_Mutation_p.A26T|MID1_uc004ctj.3_Missense_Mutation_p.A26T|MID1_uc011mie.1_RNA|MID1_uc004ctm.1_Missense_Mutation_p.A26T|MID1_uc004ctn.1_Missense_Mutation_p.A26T|MID1_uc004cto.1_Missense_Mutation_p.A26T|MID1_uc010ndw.1_5'Flank|MID1_uc004cts.1_5'Flank|MID1_uc004ctt.2_Missense_Mutation_p.A26T|MID1_uc004ctu.2_Missense_Mutation_p.A26T|MID1_uc004ctv.2_Missense_Mutation_p.A26T|MID1_uc004ctw.2_Missense_Mutation_p.A26T|MID1_uc010ndy.1_Missense_Mutation_p.A26T|uc010ndz.1_5'Flank|MID1_uc004cty.2_Missense_Mutation_p.A26T|MID1_uc004ctz.1_5'Flank|MID1_uc004cua.1_RNA|MID1_uc004cub.1_Missense_Mutation_p.A26T|MID1_uc010nea.1_5'Flank|MID1_uc004cuc.1_Missense_Mutation_p.A26T|MID1_uc004cud.1_Missense_Mutation_p.A26T|MID1_uc004cue.1_Missense_Mutation_p.A26T|MID1_uc004cuf.1_Missense_Mutation_p.A26T|MID1_uc004cug.1_Missense_Mutation_p.A26T	NM_033290	NP_150632	O15344	TRI18_HUMAN	midline 1	26	RING-type.				microtubule cytoskeleton organization|pattern specification process|positive regulation of stress-activated MAPK cascade	cytoplasm|microtubule|microtubule associated complex|spindle	ligase activity|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|pancreas(1)	3						AGGCTGTGTGCGCAGGGCAGT	0.557																0.59434	183.815908	184.636837	63	43	KEEP	---	---	---	---	36	42	25	26	-1	capture	Missense_Mutation	SNP	10535512	10535512	MID1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9488	140
DCAF12L2	340578	broad.mit.edu	37	X	125299277	125299277	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299277C>T	uc004euk.1	-	1	658	c.631G>A	c.(631-633)GGC>AGC	p.G211S		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	211	WD 2.									lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						TCGCGGGAGCCGCTCACAGCT	0.647																0.717391	106.390353	108.341802	33	13	KEEP	---	---	---	---	18	25	9	8	-1	capture	Missense_Mutation	SNP	125299277	125299277	DCAF12L2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4224	140
FRMD7	90167	broad.mit.edu	37	X	131212955	131212955	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131212955G>C	uc004ewn.2	-	12	1268	c.1090C>G	c.(1090-1092)CAA>GAA	p.Q364E	FRMD7_uc011muy.1_Missense_Mutation_p.Q349E	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	364					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TTCACATTTTGGTAGTAGCCA	0.294																0.106796	12.144462	27.954637	11	92	KEEP	---	---	---	---	6	6	50	63	-1	capture	Missense_Mutation	SNP	131212955	131212955	FRMD7	23	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	5998	140
CD2BP2	10421	broad.mit.edu	37	16	30365550	30365552	+	In_Frame_Del	DEL	CAT	-	-			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30365550_30365552delCAT	uc002dxr.2	-	2	423_425	c.170_172delATG	c.(169-174)GATGGG>GGG	p.D57del	CD2BP2_uc002dxs.2_In_Frame_Del_p.D57del	NM_006110	NP_006101	O95400	CD2B2_HUMAN	CD2 antigen (cytoplasmic tail) binding protein	57					assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding			ovary(1)	1						CTGGACCCCCCATCATCATCATC	0.532																0.02			7	426		---	---	---	---						capture_indel	In_Frame_Del	DEL	30365550	30365552	CD2BP2	16	CAT	-	-	-	1	0	1	0	1	0	0	0	0	273	21	5	5	2966	140
REXO1	57455	broad.mit.edu	37	19	1827919	1827924	+	In_Frame_Del	DEL	TCTGAG	-	-			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1827919_1827924delTCTGAG	uc002lua.3	-	2	959_964	c.864_869delCTCAGA	c.(862-870)GACTCAGAA>GAA	p.DS288del	REXO1_uc010dsr.1_In_Frame_Del_p.DS242del	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	288_289						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCTCATCTTCTGAGTCTGAGAACC	0.670																0.16			12	65		---	---	---	---						capture_indel	In_Frame_Del	DEL	1827919	1827924	REXO1	19	TCTGAG	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	13136	140
LZTR1	8216	broad.mit.edu	37	22	21349215	21349217	+	In_Frame_Del	DEL	GAA	-	-			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21349215_21349217delGAA	uc002zto.2	+	16	1945_1947	c.1842_1844delGAA	c.(1840-1845)ATGAAG>ATG	p.K615del	LZTR1_uc002ztn.2_In_Frame_Del_p.K574del|LZTR1_uc011ahy.1_In_Frame_Del_p.K596del|LZTR1_uc002ztp.2_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	615					anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGATCATGATGAAGGAGTTCGAG	0.601				p.M614I(NCIH650-Tumor)	1299											0.38			45	75		---	---	---	---						capture_indel	In_Frame_Del	DEL	21349215	21349217	LZTR1	22	GAA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	9052	140
NEK4	6787	broad.mit.edu	37	3	52780805	52780807	+	In_Frame_Del	DEL	CTC	-	-			TCGA-14-0862-01	TCGA-14-0862-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52780805_52780807delCTC	uc003dfq.3	-	9	1809_1811	c.1620_1622delGAG	c.(1618-1623)AGGAGA>AGA	p.540_541RR>R	NEK4_uc011bej.1_In_Frame_Del_p.451_452RR>R|NEK4_uc003dfr.2_In_Frame_Del_p.494_495RR>R	NM_003157	NP_003148	P51957	NEK4_HUMAN	NIMA-related kinase 4	540_541					cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		AGTCTGTTCTCTCCTCTTTTGCC	0.483					346											0.40			35	53		---	---	---	---						capture_indel	In_Frame_Del	DEL	52780805	52780807	NEK4	3	CTC	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	10233	140
