Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MPL	4352	broad.mit.edu	37	1	43804269	43804269	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43804269G>A	uc001ciw.2	+	3	314	c.269G>A	c.(268-270)CGA>CAA	p.R90Q	MPL_uc001civ.2_Missense_Mutation_p.R90Q|MPL_uc009vwr.2_Missense_Mutation_p.R83Q	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	90	Extracellular (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTTGGAACCCGATACGTGTGC	0.572	NSCLC(52;534 1204 10016 41452 44427)				169	Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia						0.049505	-12.383639	9.353135	5	96	KEEP	---	---	---	---	4	2	58	51	-1	capture	Missense_Mutation	SNP	43804269	43804269	MPL	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9642	143
C1orf104	284618	broad.mit.edu	37	1	155291139	155291139	+	Silent	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155291139G>A	uc001fki.2	-	2	418	c.141C>T	c.(139-141)TAC>TAT	p.Y47Y	RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_RNA|RUSC1_uc001fkj.2_Intron|RUSC1_uc001fkk.2_Intron|RUSC1_uc009wqn.1_5'Flank|RUSC1_uc009wqo.1_5'Flank|RUSC1_uc001fkl.2_5'Flank	NM_001039517	NP_001034606	Q66K80	RUAS1_HUMAN	hypothetical protein LOC284618	47											0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.32e-10)|all cancers(21;3.51e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TCCTCTGGGAGTAAGGGGTAG	0.647																0.333333	19.416822	19.934024	7	14	KEEP	---	---	---	---	5	5	9	6	-1	capture	Silent	SNP	155291139	155291139	C1orf104	1	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	1960	143
SPTA1	6708	broad.mit.edu	37	1	158617395	158617395	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158617395C>T	uc001fst.1	-	27	4029	c.3830G>A	c.(3829-3831)CGT>CAT	p.R1277H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1277	Spectrin 12.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ATCCTTTGTACGCCCCTGCAG	0.557																0.229358	56.522256	63.84135	25	84	KEEP	---	---	---	---	14	16	49	41	-1	capture	Missense_Mutation	SNP	158617395	158617395	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15008	143
CEP350	9857	broad.mit.edu	37	1	179989186	179989186	+	Silent	SNP	C	G	G			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179989186C>G	uc001gnt.2	+	12	2660	c.2277C>G	c.(2275-2277)CTC>CTG	p.L759L	CEP350_uc009wxl.2_Silent_p.L758L|CEP350_uc001gnu.2_Silent_p.L593L	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	759						centrosome|nucleus|spindle				ovary(4)	4						GAAGTTTACTCTCCCATCTCT	0.403																0.251656	109.978508	118.440404	38	113	KEEP	---	---	---	---	22	19	58	66	-1	capture	Silent	SNP	179989186	179989186	CEP350	1	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	3222	143
OR5F1	338674	broad.mit.edu	37	11	55761884	55761884	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55761884T>G	uc010riv.1	-	1	218	c.218A>C	c.(217-219)AAC>ACC	p.N73T		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					GGTAGTTGAGTTACAAACGTC	0.443																0.211268	41.48874	46.95929	15	56	KEEP	---	---	---	---	6	9	31	27	-1	capture	Missense_Mutation	SNP	55761884	55761884	OR5F1	11	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	11062	143
RFX4	5992	broad.mit.edu	37	12	107048021	107048021	+	Nonsense_Mutation	SNP	T	G	G			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107048021T>G	uc001tlr.2	+	4	273	c.207T>G	c.(205-207)TAT>TAG	p.Y69*	RFX4_uc010swv.1_RNA|RFX4_uc001tls.2_Nonsense_Mutation_p.Y78*|RFX4_uc001tlt.2_Nonsense_Mutation_p.Y78*	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	69	|RFX-type winged-helix.				transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						AGGAGAACTATGAGATTGCAG	0.468																0.235955	59.934315	65.604006	21	68	KEEP	---	---	---	---	15	9	33	45	-1	capture	Nonsense_Mutation	SNP	107048021	107048021	RFX4	12	T	G	G	G	1	0	0	0	0	0	1	0	0	660	51	5	4	13160	143
NEIL1	79661	broad.mit.edu	37	15	75641495	75641495	+	Silent	SNP	C	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75641495C>T	uc002bad.2	+	2	755	c.249C>T	c.(247-249)GGC>GGT	p.G83G	NEIL1_uc002bae.2_Silent_p.G169G	NM_024608	NP_078884	Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1	83					base-excision repair|negative regulation of nuclease activity|nucleotide-excision repair|response to oxidative stress	cytoplasm|nucleus	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|protein C-terminus binding|zinc ion binding			ovary(1)	1						GCATGTCCGGCTCTTTTCAGC	0.687											BER_DNA_glycosylases					0.339286	50.765802	52.017453	19	37	KEEP	---	---	---	---	13	8	19	25	-1	capture	Silent	SNP	75641495	75641495	NEIL1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	10225	143
CAMKK1	84254	broad.mit.edu	37	17	3779538	3779538	+	Silent	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3779538G>A	uc002fwt.2	-	10	1069	c.975C>T	c.(973-975)TCC>TCT	p.S325S	CAMKK1_uc002fwu.2_Silent_p.S325S|CAMKK1_uc002fwv.2_Silent_p.S363S	NM_172206	NP_757343	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase 1	325	Protein kinase.				synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		AGCTCTGGCCGGAATCAGAAA	0.622					485											0.289474	28.71251	30.220354	11	27	KEEP	---	---	---	---	7	6	14	16	-1	capture	Silent	SNP	3779538	3779538	CAMKK1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2582	143
NF1	4763	broad.mit.edu	37	17	29661945	29661945	+	Nonsense_Mutation	SNP	C	T	T	rs137854552		TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29661945C>T	uc002hgg.2	+	40	6235	c.5902C>T	c.(5902-5904)CGA>TGA	p.R1968*	NF1_uc002hgh.2_Nonsense_Mutation_p.R1947*|NF1_uc010cso.2_Nonsense_Mutation_p.R156*|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1968					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.R1968*(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGATGCCAAACGACAAAGAGT	0.368					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.301587	48.096599	50.314218	19	44	KEEP	---	---	---	---	13	6	24	26	-1	capture	Nonsense_Mutation	SNP	29661945	29661945	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	6	1	10263	143
KRTAP4-11	653240	broad.mit.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	C	C	rs149439944	by1000genomes	TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274291T>C	uc002hvz.2	-	1	316	c.277A>G	c.(277-279)ATG>GTG	p.M93V		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	14.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.388																0.056338	-5.252114	9.427556	4	67	KEEP	---	---	---	---	1	6	32	37	-1	capture	Missense_Mutation	SNP	39274291	39274291	KRTAP4-11	17	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8469	143
ETV4	2118	broad.mit.edu	37	17	41610118	41610118	+	Silent	SNP	A	C	C			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41610118A>C	uc002idw.2	-	8	863	c.735T>G	c.(733-735)GGT>GGG	p.G245G	ETV4_uc002idv.2_5'Flank|ETV4_uc010wih.1_Silent_p.G191G|ETV4_uc010czh.2_Silent_p.G244G|ETV4_uc010wii.1_Silent_p.G206G|ETV4_uc002idx.2_Silent_p.G245G|ETV4_uc010wij.1_Silent_p.G206G	NM_001986	NP_001977	P43268	ETV4_HUMAN	ets variant gene 4 (E1A enhancer binding	245					positive regulation of transcription, DNA-dependent	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/ETV4(6)	bone(4)|soft_tissue(2)|ovary(1)	7		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		CATTGACCCCACCCTGGTCCA	0.617	Esophageal Squamous(116;1540 1611 12927 31103 34118)				106	T	EWSR1|TMPRSS2|DDX5|KLK2|CANT1	Ewing sarcoma|Prostate carcinoma								0.098765	-7.082398	6.528474	8	73	KEEP	---	---	---	---	10	7	42	41	-1	capture	Silent	SNP	41610118	41610118	ETV4	17	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	5236	143
HOXB8	3218	broad.mit.edu	37	17	46692020	46692020	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46692020C>G	uc002inw.2	-	1	282	c.47G>C	c.(46-48)GGG>GCG	p.G16A		NM_024016	NP_076921	P17481	HXB8_HUMAN	homeobox B8	16						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CAGGGACTCCCCGGTTTTGTA	0.582																0.428571	19.047865	19.11014	6	8	KEEP	---	---	---	---	3	3	3	7	-1	capture	Missense_Mutation	SNP	46692020	46692020	HOXB8	17	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	7232	143
MUC16	94025	broad.mit.edu	37	19	9062384	9062384	+	Silent	SNP	G	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9062384G>T	uc002mkp.2	-	3	25266	c.25062C>A	c.(25060-25062)ACC>ACA	p.T8354T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8356	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCTCACGTTGGTCACTGCTG	0.488																0.20155	54.461995	65.158476	26	103	KEEP	---	---	---	---	15	14	62	49	0.51724137931	capture	Silent	SNP	9062384	9062384	MUC16	19	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	9883	143
ZNF653	115950	broad.mit.edu	37	19	11594572	11594572	+	Silent	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11594572G>A	uc002mrz.1	-	9	1826	c.1773C>T	c.(1771-1773)TGC>TGT	p.C591C	ELAVL3_uc002mrx.1_5'Flank|ELAVL3_uc002mry.1_5'Flank	NM_138783	NP_620138	Q96CK0	ZN653_HUMAN	zinc finger protein 653	591	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGCGCTTCCCGCAGCGATCGC	0.612	Pancreas(83;980 1446 4542 6441 43352)															0.333333	36.136222	37.169338	14	28	KEEP	---	---	---	---	8	8	20	11	-1	capture	Silent	SNP	11594572	11594572	ZNF653	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	17944	143
PCK1	5105	broad.mit.edu	37	20	56140691	56140691	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56140691A>C	uc002xyn.3	+	10	1863	c.1700A>C	c.(1699-1701)AAA>ACA	p.K567T	PCK1_uc010zzm.1_Missense_Mutation_p.K250T	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	567					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CTGAACCTGAAAGGCCTGGGG	0.532																0.695652	181.529208	183.887259	48	21	KEEP	---	---	---	---	26	28	9	14	-1	capture	Missense_Mutation	SNP	56140691	56140691	PCK1	20	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	11484	143
HUNK	30811	broad.mit.edu	37	21	33331245	33331245	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33331245C>A	uc002yph.2	+	5	1197	c.837C>A	c.(835-837)GAC>GAA	p.D279E		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	279	Protein kinase.				multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						AGATGGTAGACAAAGAAATGA	0.537					285											0.218182	54.261609	62.302193	24	86	KEEP	---	---	---	---	12	16	51	44	0.571428571429	capture	Missense_Mutation	SNP	33331245	33331245	HUNK	21	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	7383	143
CAMKV	79012	broad.mit.edu	37	3	49896857	49896857	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49896857G>T	uc003cxt.1	-	11	1593	c.1400C>A	c.(1399-1401)CCG>CAG	p.P467Q	TRAIP_uc003cxs.1_5'Flank|TRAIP_uc010hla.1_5'Flank|TRAIP_uc011bcx.1_5'Flank|CAMKV_uc011bcy.1_Missense_Mutation_p.P392Q|CAMKV_uc003cxv.1_Missense_Mutation_p.P439Q|CAMKV_uc003cxw.1_Missense_Mutation_p.P299Q|CAMKV_uc003cxx.1_Missense_Mutation_p.P299Q|CAMKV_uc003cxu.2_Missense_Mutation_p.P436Q|CAMKV_uc011bcz.1_Missense_Mutation_p.P399Q|CAMKV_uc011bda.1_Missense_Mutation_p.P393Q	NM_024046	NP_076951	Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	467	Ala-rich.					cytoplasmic vesicle membrane|plasma membrane	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|large_intestine(2)|central_nervous_system(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGTGCTGTCCGGCTGGGCCAT	0.652					82											0.292135	67.59785	71.053839	26	63	KEEP	---	---	---	---	15	16	42	27	0.483870967742	capture	Missense_Mutation	SNP	49896857	49896857	CAMKV	3	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	2584	143
C3orf26	84319	broad.mit.edu	37	3	99891168	99891168	+	Silent	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:99891168G>A	uc003dtl.2	+	8	731	c.588G>A	c.(586-588)GCG>GCA	p.A196A		NM_032359	NP_115735	Q9BQ75	CC026_HUMAN	hypothetical protein LOC84319	196							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1						AGGTCCAGGCGCAGGTAAAGT	0.413																0.219512	38.103015	44.049419	18	64	KEEP	---	---	---	---	6	14	38	42	-1	capture	Silent	SNP	99891168	99891168	C3orf26	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2198	143
RICTOR	253260	broad.mit.edu	37	5	38950386	38950386	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:38950386A>C	uc003jlp.2	-	31	3588	c.3564T>G	c.(3562-3564)AAT>AAG	p.N1188K	RICTOR_uc003jlo.2_Missense_Mutation_p.N1188K|RICTOR_uc010ivf.2_Missense_Mutation_p.N903K	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1188					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CTGTACCAAAATTCTTGGTGA	0.358					698											0.257511	177.672789	190.114625	60	173	KEEP	---	---	---	---	33	33	89	94	-1	capture	Missense_Mutation	SNP	38950386	38950386	RICTOR	5	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	13250	143
SV2C	22987	broad.mit.edu	37	5	75427791	75427791	+	Silent	SNP	C	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:75427791C>T	uc003kei.1	+	2	350	c.216C>T	c.(214-216)GAC>GAT	p.D72D		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	72	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		CCAACGATGACGAAGGCTCAA	0.498																0.283019	37.836941	40.057975	15	38	KEEP	---	---	---	---	7	9	16	28	-1	capture	Silent	SNP	75427791	75427791	SV2C	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15307	143
ARRDC3	57561	broad.mit.edu	37	5	90671379	90671379	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90671379A>C	uc003kjz.2	-	4	802	c.562T>G	c.(562-564)TCA>GCA	p.S188A		NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	188					signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		ATTGGGCCTGAGGTACAGAAC	0.398																0.235294	108.440265	119.315837	40	130	KEEP	---	---	---	---	28	27	96	88	-1	capture	Missense_Mutation	SNP	90671379	90671379	ARRDC3	5	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	977	143
CDC23	8697	broad.mit.edu	37	5	137524677	137524677	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137524677A>G	uc003lcl.2	-	16	1815	c.1784T>C	c.(1783-1785)GTC>GCC	p.V595A		NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23	595					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTATGGCGTGACAGAAGACAA	0.493																0.203125	35.043508	40.277133	13	51	KEEP	---	---	---	---	9	8	28	30	-1	capture	Missense_Mutation	SNP	137524677	137524677	CDC23	5	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3032	143
JAKMIP2	9832	broad.mit.edu	37	5	147012259	147012259	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147012259C>T	uc003loq.1	-	13	2142	c.1760G>A	c.(1759-1761)CGA>CAA	p.R587Q	JAKMIP2_uc011dbx.1_Missense_Mutation_p.R545Q|JAKMIP2_uc003lor.1_Missense_Mutation_p.R566Q|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.R587Q	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	587	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTAGGTTTCGAAACTCCAG	0.289																0.257282	130.964113	141.978279	53	153	KEEP	---	---	---	---	35	27	84	96	-1	capture	Missense_Mutation	SNP	147012259	147012259	JAKMIP2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7864	143
COL12A1	1303	broad.mit.edu	37	6	75866132	75866132	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:75866132G>A	uc003phs.2	-	15	3257	c.3091C>T	c.(3091-3093)CGC>TGC	p.R1031C	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1031	Fibronectin type-III 7.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CCATGAGGGCGATAGACAACA	0.473																0.227273	45.06371	51.065159	20	68	KEEP	---	---	---	---	8	15	44	34	-1	capture	Missense_Mutation	SNP	75866132	75866132	COL12A1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3634	143
CASP8AP2	9994	broad.mit.edu	37	6	90578080	90578080	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90578080G>A	uc003pnr.2	+	8	5267	c.5071G>A	c.(5071-5073)GTC>ATC	p.V1691I	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.V1691I|CASP8AP2_uc011dzz.1_Missense_Mutation_p.V1691I	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1691					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		GAAAGATCCAGTCACTGAAAC	0.388	Colon(187;1656 2025 17045 31481 39901)															0.181818	16.271136	20.458085	8	36	KEEP	---	---	---	---	6	2	18	22	-1	capture	Missense_Mutation	SNP	90578080	90578080	CASP8AP2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	2654	143
PEX1	5189	broad.mit.edu	37	7	92147239	92147239	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92147239T>C	uc003uly.2	-	5	686	c.590A>G	c.(589-591)AAA>AGA	p.K197R	PEX1_uc011khr.1_5'UTR|PEX1_uc010ley.2_Missense_Mutation_p.K197R|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_RNA	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	197					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ATGAAGTTTTTTATATTCAGC	0.388																0.2	47.730877	54.84111	17	68	KEEP	---	---	---	---	10	8	39	41	-1	capture	Missense_Mutation	SNP	92147239	92147239	PEX1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	11638	143
KIF12	113220	broad.mit.edu	37	9	116858751	116858751	+	Silent	SNP	G	A	A			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116858751G>A	uc004bif.2	-	5	478	c.240C>T	c.(238-240)AGC>AGT	p.S80S	KIF12_uc004big.2_RNA	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN	kinesin family member 12	213	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						TCCTTCGACGGCTGAGAcctg	0.318																0.214286	6.516582	7.572633	3	11	KEEP	---	---	---	---	1	2	4	9	-1	capture	Silent	SNP	116858751	116858751	KIF12	9	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	8195	143
FAM83D	81610	broad.mit.edu	37	20	37580810	37580811	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37580810_37580811insT	uc002xjg.2	+	4	1536_1537	c.1495_1496insT	c.(1495-1497)GTAfs	p.V499fs		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	469	Ser-rich.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				AAAAATGTCTGTATCGAGATCT	0.485																0.23			27	91		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	37580810	37580811	FAM83D	20	-	T	T	T	1	0	1	1	0	0	0	0	0	624	48	5	5	5582	143
FXR1	8087	broad.mit.edu	37	3	180651171	180651172	+	Frame_Shift_Del	DEL	AT	-	-			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:180651171_180651172delAT	uc003fkq.2	+	2	123_124	c.101_102delAT	c.(100-102)AATfs	p.N34fs	FXR1_uc003fkp.2_5'UTR|FXR1_uc003fkr.2_Frame_Shift_Del_p.N34fs|FXR1_uc011bqj.1_Intron|FXR1_uc003fks.2_5'UTR|FXR1_uc011bqk.1_Intron|FXR1_uc011bql.1_Frame_Shift_Del_p.N21fs	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1	34					apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			GTTTTTGAAAATAAGTAAGTTA	0.332																0.21			12	46		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	180651171	180651172	FXR1	3	AT	-	-	-	1	0	1	0	1	0	0	0	0	52	4	5	5	6057	143
HRCT1	646962	broad.mit.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	-	-			TCGA-14-1043-01	TCGA-14-1043-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35906348_35906350delCTG	uc003zyr.1	+	1	160_162	c.64_66delCTG	c.(64-66)CTGdel	p.L28del		NM_001039792	NP_001034881	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28	Helical; (Potential).					integral to membrane					0						TGTGGCGGTCctgctgctgctgc	0.601																0.19			9	39		---	---	---	---						capture_indel	In_Frame_Del	DEL	35906348	35906350	HRCT1	9	CTG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	7278	143
