Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KCNQ4	9132	broad.mit.edu	37	1	41289931	41289931	+	Splice_Site	SNP	G	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:41289931G>T	uc001cgh.1	+	9	1374	c.1292_splice	c.e9+1	p.S431_splice	KCNQ4_uc001cgi.1_Intron	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein						sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			CTGGGGAAAGGTAGGGGCCCC	0.667																0.407407	30.744812	30.939297	11	16	KEEP	---	---	---	---	6	6	9	12	0.5	capture	Splice_Site	SNP	41289931	41289931	KCNQ4	1	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	8007	151
ZNHIT6	54680	broad.mit.edu	37	1	86172017	86172017	+	Missense_Mutation	SNP	G	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86172017G>C	uc001dlh.2	-	3	878	c.744C>G	c.(742-744)CAC>CAG	p.H248Q	ZNHIT6_uc010osc.1_Missense_Mutation_p.H209Q	NM_017953	NP_060423	Q9NWK9	BCD1_HUMAN	zinc finger, HIT type 6	248	HIT-type.				box C/D snoRNP assembly|ribosome biogenesis	pre-snoRNP complex	identical protein binding|metal ion binding			large_intestine(1)	1						GTTCTGCTTTGTGTTTCTTTA	0.353																0.048387	-6.231312	7.217273	3	59	KEEP	---	---	---	---	0	3	21	39	-1	capture	Missense_Mutation	SNP	86172017	86172017	ZNHIT6	1	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	18085	151
GPR61	83873	broad.mit.edu	37	1	110086728	110086728	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110086728C>A	uc001dxy.2	+	2	1767	c.1084C>A	c.(1084-1086)CCA>ACA	p.P362T		NM_031936	NP_114142	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	362	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(2)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		CTTCTTCAAGCCAGCTCCAGA	0.557																0.033333	-21.288602	7.21326	4	116	KEEP	---	---	---	---	2	2	70	71	0.5	capture	Missense_Mutation	SNP	110086728	110086728	GPR61	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	6635	151
S100A7A	338324	broad.mit.edu	37	1	153391619	153391619	+	Splice_Site	SNP	A	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153391619A>T	uc001fbt.1	+	3	199	c.142_splice	c.e3-2	p.D48_splice		NM_176823	NP_789793	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7-like 1							cytoplasm	calcium ion binding			skin(1)	1	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCTCTTCACAGGACAAAAAG	0.408																0.03	-16.864329	7.381678	3	97	KEEP	---	---	---	---	1	2	51	53	-1	capture	Splice_Site	SNP	153391619	153391619	S100A7A	1	A	T	T	T	1	0	0	0	0	0	0	1	0	91	7	5	4	13676	151
OLFML2B	25903	broad.mit.edu	37	1	161967994	161967994	+	Silent	SNP	G	A	A	rs34123330	byFrequency	TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161967994G>A	uc001gbu.2	-	6	1519	c.1095C>T	c.(1093-1095)AAC>AAT	p.N365N	OLFML2B_uc010pkq.1_Silent_p.N366N	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	365										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CGGTCCGAGCGTTCAGGTCGC	0.612																0.126812	47.13099	84.632969	35	241	KEEP	---	---	---	---	17	22	105	167	-1	capture	Silent	SNP	161967994	161967994	OLFML2B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10763	151
CEP350	9857	broad.mit.edu	37	1	180053197	180053197	+	Missense_Mutation	SNP	C	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180053197C>G	uc001gnt.2	+	31	6552	c.6169C>G	c.(6169-6171)CTG>GTG	p.L2057V	CEP350_uc009wxl.2_Missense_Mutation_p.L2056V|CEP350_uc001gnv.2_Missense_Mutation_p.L192V|CEP350_uc001gnw.1_5'Flank	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	2057	Potential.					centrosome|nucleus|spindle				ovary(4)	4						GATCAGAGCTCTGAAGGATGA	0.358																0.083333	2.130073	6.364731	2	22	KEEP	---	---	---	---	0	2	17	9	-1	capture	Missense_Mutation	SNP	180053197	180053197	CEP350	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	3222	151
DSTYK	25778	broad.mit.edu	37	1	205138447	205138447	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205138447G>A	uc001hbw.2	-	3	1232	c.1168C>T	c.(1168-1170)CGT>TGT	p.R390C	DSTYK_uc001hbx.2_Missense_Mutation_p.R390C|DSTYK_uc001hby.1_Intron	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	390						cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						TATTCCAGACGTTTGGGAGTG	0.458				p.R390C(A2780-Tumor)	236											0.088608	4.325778	31.353664	14	144	KEEP	---	---	---	---	7	9	75	91	-1	capture	Missense_Mutation	SNP	205138447	205138447	DSTYK	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4740	151
USH2A	7399	broad.mit.edu	37	1	216138718	216138718	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216138718C>T	uc001hku.1	-	37	7448	c.7061G>A	c.(7060-7062)CGC>CAC	p.R2354H		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2354	Extracellular (Potential).|Fibronectin type-III 10.		R -> H (in USH2A).		maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATTAGGGCGAAAAGGTGC	0.403													HNSCC(13;0.011)			0.272727	176.858803	188.641516	69	184	KEEP	---	---	---	---	37	42	112	119	-1	capture	Missense_Mutation	SNP	216138718	216138718	USH2A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16918	151
SFTPD	6441	broad.mit.edu	37	10	81701253	81701253	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:81701253C>T	uc001kbh.2	-	6	611	c.568G>A	c.(568-570)GGT>AGT	p.G190S	MBL1P_uc001kbf.2_Intron	NM_003019	NP_003010	P35247	SFTPD_HUMAN	pulmonary surfactant-associated protein D	190	Collagen-like.				cell junction assembly|innate immune response|lung alveolus development|macrophage chemotaxis|negative regulation of interleukin-2 biosynthetic process|negative regulation of T cell proliferation|positive regulation of phagocytosis|reactive oxygen species metabolic process|receptor-mediated endocytosis|respiratory gaseous exchange|surfactant homeostasis	collagen|endocytic vesicle|extracellular space|lysosome	bacterial cell surface binding|protein binding|sugar binding			skin(1)	1	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			CCCTGGGGACCCATGGCTCCA	0.507																0.02381	-25.063158	6.680217	3	123	KEEP	---	---	---	---	5	0	57	88	-1	capture	Missense_Mutation	SNP	81701253	81701253	SFTPD	10	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	14086	151
MUC5B	727897	broad.mit.edu	37	11	1270908	1270908	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1270908G>A	uc009ycr.1	+	51	14343	c.14217G>A	c.(14215-14217)ACG>ACA	p.T4739T	MUC5B_uc001ltb.2_Silent_p.T4269T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	4266	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGGATCCACGGCCACCCCGT	0.647																0.108108	11.914571	28.864426	12	99	KEEP	---	---	---	---	8	17	81	97	-1	capture	Silent	SNP	1270908	1270908	MUC5B	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9889	151
OR52A1	23538	broad.mit.edu	37	11	5172692	5172692	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5172692C>T	uc010qyy.1	-	1	908	c.908G>A	c.(907-909)CGC>CAC	p.R303H		NM_012375	NP_036507	Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACATGAATGCGAATCTGTGT	0.358																0.239865	180.57854	198.860715	71	225	KEEP	---	---	---	---	42	41	136	132	-1	capture	Missense_Mutation	SNP	5172692	5172692	OR52A1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11012	151
PDE3B	5140	broad.mit.edu	37	11	14825558	14825558	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:14825558C>A	uc001mln.2	+	5	1837	c.1484C>A	c.(1483-1485)TCT>TAT	p.S495Y	PDE3B_uc010rcr.1_Missense_Mutation_p.S444Y	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	495					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						AGGTCATCTTCTGTATCACTG	0.358																0.037736	-17.296247	7.220897	4	102	KEEP	---	---	---	---	3	3	50	72	0.5	capture	Missense_Mutation	SNP	14825558	14825558	PDE3B	11	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	11541	151
OR4A47	403253	broad.mit.edu	37	11	48511019	48511019	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48511019C>A	uc010rhx.1	+	1	675	c.675C>A	c.(673-675)AAC>AAA	p.N225K		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CTTTAAAGAACCTTAGTCAGA	0.438																0.343849	320.874142	327.70377	109	208	KEEP	---	---	---	---	48	61	116	103	0.559633027523	capture	Missense_Mutation	SNP	48511019	48511019	OR4A47	11	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	10946	151
OR4A5	81318	broad.mit.edu	37	11	51412194	51412194	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:51412194C>A	uc001nhi.1	-	1	202	c.202G>T	c.(202-204)GAT>TAT	p.D68Y		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				TATGCAGCATCTATAAATGAC	0.438																0.381443	101.644531	102.842837	37	60	KEEP	---	---	---	---	19	20	31	34	0.512820512821	capture	Missense_Mutation	SNP	51412194	51412194	OR4A5	11	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	10947	151
OR8I2	120586	broad.mit.edu	37	11	55861592	55861592	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55861592C>T	uc010rix.1	+	1	809	c.809C>T	c.(808-810)GCG>GTG	p.A270V		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	270	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					CTGACCCAGGCGCAGGTGGCA	0.453																0.314917	156.715947	162.228834	57	124	KEEP	---	---	---	---	24	36	56	80	-1	capture	Missense_Mutation	SNP	55861592	55861592	OR8I2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11144	151
FAT3	120114	broad.mit.edu	37	11	92532113	92532113	+	Silent	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92532113C>T	uc001pdj.3	+	9	5951	c.5934C>T	c.(5932-5934)AGC>AGT	p.S1978S		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1978	Cadherin 17.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCATGGACAGCGGCCTCCACT	0.433													TCGA Ovarian(4;0.039)			0.081761	-0.547118	56.045839	26	292	KEEP	---	---	---	---	16	13	170	181	-1	capture	Silent	SNP	92532113	92532113	FAT3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	5637	151
CLEC1A	51267	broad.mit.edu	37	12	10233990	10233990	+	Silent	SNP	G	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10233990G>T	uc001qxb.2	-	3	321	c.237C>A	c.(235-237)TCC>TCA	p.S79S	CLEC1A_uc009zhf.2_5'UTR|CLEC1A_uc001qxc.2_5'UTR|CLEC1A_uc001qxd.2_Silent_p.S36S|CLEC1A_uc010sgx.1_Intron	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	79	Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						GACCAGTATTGGAGAGCTGGT	0.378																0.375	115.992991	117.421988	39	65	KEEP	---	---	---	---	17	26	32	44	0.395348837209	capture	Silent	SNP	10233990	10233990	CLEC1A	12	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	3470	151
PRB1	5542	broad.mit.edu	37	12	11506753	11506753	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11506753C>A	uc001qzw.1	-	3	321	c.284G>T	c.(283-285)GGA>GTA	p.G95V	PRB1_uc001qzu.1_Missense_Mutation_p.G95V|PRB1_uc001qzv.1_Missense_Mutation_p.G95V	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	156	6.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).|Missing (in allele S).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			TTGTGGTTTTCCTGGAGGAGA	0.607																0.305949	533.703493	557.447289	216	490	KEEP	---	---	---	---	116	126	334	421	0.520661157025	capture	Missense_Mutation	SNP	11506753	11506753	PRB1	12	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	12338	151
ATP2B1	490	broad.mit.edu	37	12	90024361	90024361	+	Silent	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:90024361T>C	uc001tbh.2	-	5	1030	c.849A>G	c.(847-849)CAA>CAG	p.Q283Q	ATP2B1_uc001tbg.2_Silent_p.Q283Q	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	283	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						TAATTCCAGTTTGAGAATTTA	0.244																0.321739	124.439082	127.682076	37	78	KEEP	---	---	---	---	16	24	37	56	-1	capture	Silent	SNP	90024361	90024361	ATP2B1	12	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	1130	151
IGF1	3479	broad.mit.edu	37	12	102869429	102869429	+	Missense_Mutation	SNP	A	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:102869429A>C	uc001tjp.3	-	2	431	c.212T>G	c.(211-213)TTT>TGT	p.F71C	IGF1_uc001tjn.2_Missense_Mutation_p.F55C|IGF1_uc001tjm.2_Missense_Mutation_p.F71C|IGF1_uc001tjo.2_Missense_Mutation_p.F71C	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3	71	B.				anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						ACTGAAATAAAAGCCCCTGTC	0.537																0.030769	-21.315265	10.05286	4	126	KEEP	---	---	---	---	5	1	72	71	-1	capture	Missense_Mutation	SNP	102869429	102869429	IGF1	12	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	7495	151
ANAPC7	51434	broad.mit.edu	37	12	110825638	110825638	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110825638G>A	uc001tqo.2	-	5	683	c.682C>T	c.(682-684)CAA>TAA	p.Q228*	ANAPC7_uc001tqp.3_Nonsense_Mutation_p.Q228*	NM_016238	NP_057322	Q9UJX3	APC7_HUMAN	anaphase-promoting complex subunit 7 isoform a	228					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0						GGCACGGTTTGGATCACATTC	0.463																0.046875	-7.133787	6.880858	3	61	KEEP	---	---	---	---	1	2	33	33	-1	capture	Nonsense_Mutation	SNP	110825638	110825638	ANAPC7	12	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	603	151
PTPN11	5781	broad.mit.edu	37	12	112926900	112926900	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112926900C>A	uc001ttx.2	+	13	1900	c.1520C>A	c.(1519-1521)ACA>AAA	p.T507K		NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	511	Tyrosine-protein phosphatase.				axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.T507K(3)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						ATGGTCCAGACAGAAGCACAG	0.478					372	Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				0.032345	-64.436931	24.234802	12	359	KEEP	---	---	---	---	7	7	197	230	0.5	capture	Missense_Mutation	SNP	112926900	112926900	PTPN11	12	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12675	151
RBM19	9904	broad.mit.edu	37	12	114383718	114383718	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114383718C>A	uc009zwi.2	-	13	1685	c.1541G>T	c.(1540-1542)TGG>TTG	p.W514L	RBM19_uc001tvn.3_Missense_Mutation_p.W514L|RBM19_uc001tvm.2_Missense_Mutation_p.W514L	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	514					multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TAGTGTGTTCCAGTTGTGAGA	0.542																0.0625	-2.716844	6.859746	3	45	KEEP	---	---	---	---	2	1	22	33	0.333333333333	capture	Missense_Mutation	SNP	114383718	114383718	RBM19	12	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	13016	151
TCTN2	79867	broad.mit.edu	37	12	124175182	124175182	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124175182G>A	uc001ufp.2	+	8	1122	c.994G>A	c.(994-996)GGT>AGT	p.G332S	TCTN2_uc009zya.2_Missense_Mutation_p.G331S	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	332	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		AGAACGAGATGGTATTATCAA	0.388																0.285714	101.741035	106.937285	36	90	KEEP	---	---	---	---	26	19	63	40	-1	capture	Missense_Mutation	SNP	124175182	124175182	TCTN2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15608	151
HSPH1	10808	broad.mit.edu	37	13	31713139	31713139	+	Missense_Mutation	SNP	T	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:31713139T>A	uc001utj.2	-	15	2484	c.2086A>T	c.(2086-2088)ATG>TTG	p.M696L	HSPH1_uc001utk.2_Missense_Mutation_p.M652L|HSPH1_uc010aaw.2_Missense_Mutation_p.M655L|HSPH1_uc001utl.2_Missense_Mutation_p.M698L|HSPH1_uc010tds.1_Missense_Mutation_p.M620L	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD	696					positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		CGACCTACCATTAATTCTTCC	0.299																0.349112	183.380971	186.773159	59	110	KEEP	---	---	---	---	25	36	47	76	-1	capture	Missense_Mutation	SNP	31713139	31713139	HSPH1	13	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	7356	151
CCDC70	83446	broad.mit.edu	37	13	52439731	52439731	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:52439731C>T	uc001vfu.3	+	2	513	c.217C>T	c.(217-219)CGA>TGA	p.R73*	uc010tgr.1_RNA	NM_031290	NP_112580	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70 precursor	73						extracellular region|plasma membrane					0		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		GTGGACTTTCCGAGGCAAGAT	0.458																0.321053	181.489802	186.851799	61	129	KEEP	---	---	---	---	40	25	64	88	-1	capture	Nonsense_Mutation	SNP	52439731	52439731	CCDC70	13	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	2817	151
MUDENG	55745	broad.mit.edu	37	14	57741370	57741370	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:57741370C>A	uc001xcv.2	+	2	910	c.483C>A	c.(481-483)GAC>GAA	p.D161E	MUDENG_uc001xcu.3_Missense_Mutation_p.D161E|MUDENG_uc010tri.1_Intron|MUDENG_uc010trj.1_Missense_Mutation_p.D58E	NM_018229	NP_060699	Q9H0R1	MUDEN_HUMAN	Mu-2 related death-inducing protein	161					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex				ovary(1)	1						AGTTGCCTGACTTGCTTCTGC	0.368																0.024	-24.995372	6.489943	3	122	KEEP	---	---	---	---	3	1	64	82	0.25	capture	Missense_Mutation	SNP	57741370	57741370	MUDENG	14	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	9893	151
BCL11B	64919	broad.mit.edu	37	14	99641920	99641920	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:99641920G>A	uc001yga.2	-	4	1520	c.1253C>T	c.(1252-1254)CCG>CTG	p.P418L	BCL11B_uc001ygb.2_Missense_Mutation_p.P347L	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	418						nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CTGCGGGGGCGGCGTGCCGCC	0.687					98	T	TLX3	T-ALL								0.125	4.239793	6.436725	2	14	KEEP	---	---	---	---	0	2	7	10	-1	capture	Missense_Mutation	SNP	99641920	99641920	BCL11B	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1353	151
GABRB3	2562	broad.mit.edu	37	15	26828530	26828530	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26828530G>A	uc001zaz.2	-	5	635	c.493C>T	c.(493-495)CTC>TTC	p.L165F	GABRB3_uc010uae.1_Missense_Mutation_p.L80F|GABRB3_uc001zba.2_Missense_Mutation_p.L165F|GABRB3_uc001zbb.2_Missense_Mutation_p.L221F	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	165	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TATCTCCTGAGGTCCATCATG	0.453																0.338983	127.562905	130.268301	40	78	KEEP	---	---	---	---	19	28	47	44	-1	capture	Missense_Mutation	SNP	26828530	26828530	GABRB3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6110	151
ZNF770	54989	broad.mit.edu	37	15	35274803	35274803	+	Missense_Mutation	SNP	G	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35274803G>C	uc001ziw.2	-	3	1144	c.833C>G	c.(832-834)TCT>TGT	p.S278C		NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	278					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		ATTCTCCTCAGATTCACCAAT	0.388																0.421053	87.291452	87.601418	24	33	KEEP	---	---	---	---	10	14	19	24	-1	capture	Missense_Mutation	SNP	35274803	35274803	ZNF770	15	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	18020	151
UACA	55075	broad.mit.edu	37	15	70957092	70957092	+	Missense_Mutation	SNP	A	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:70957092A>T	uc002asr.2	-	17	4126	c.4022T>A	c.(4021-4023)CTC>CAC	p.L1341H	UACA_uc010uke.1_Missense_Mutation_p.L1232H|UACA_uc002asq.2_Missense_Mutation_p.L1328H	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	1341	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						TGTGTAGGTGAGTTGGGAAAG	0.433																0.453488	120.324587	120.485012	39	47	KEEP	---	---	---	---	20	25	24	30	-1	capture	Missense_Mutation	SNP	70957092	70957092	UACA	15	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	16706	151
C16orf45	89927	broad.mit.edu	37	16	15609227	15609227	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15609227G>A	uc002ddo.2	+	2	358	c.172G>A	c.(172-174)GCA>ACA	p.A58T	C16orf45_uc002ddp.2_Missense_Mutation_p.A41T	NM_033201	NP_149978	Q96MC5	CP045_HUMAN	hypothetical protein LOC89927 isoform 1	58										ovary(1)	1						GCTGGAGATGGCAAAAATTCA	0.527																0.043011	-13.483647	7.351742	4	89	KEEP	---	---	---	---	2	2	46	53	-1	capture	Missense_Mutation	SNP	15609227	15609227	C16orf45	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1800	151
ATP2A1	487	broad.mit.edu	37	16	28913648	28913648	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28913648G>A	uc002dro.1	+	17	2649	c.2465G>A	c.(2464-2466)CGG>CAG	p.R822Q	uc010vct.1_Intron|ATP2A1_uc002drn.1_Missense_Mutation_p.R822Q|ATP2A1_uc002drp.1_Missense_Mutation_p.R697Q	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	822	Cytoplasmic (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CGCCCCCCCCGGAGCCCCAAG	0.657																0.405797	260.53761	262.118498	84	123	KEEP	---	---	---	---	42	52	70	87	-1	capture	Missense_Mutation	SNP	28913648	28913648	ATP2A1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1127	151
DHRS7C	201140	broad.mit.edu	37	17	9684903	9684903	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9684903G>A	uc010vvb.1	-	2	163	c.163C>T	c.(163-165)CGG>TGG	p.R55W	DHRS7C_uc010cof.2_Missense_Mutation_p.R55W	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	55	NAD or NADP (By similarity).					extracellular region	binding|oxidoreductase activity				0						TGGAACACCCGAGCACACTCT	0.547																0.093333	2.464434	14.943059	7	68	KEEP	---	---	---	---	6	3	45	40	-1	capture	Missense_Mutation	SNP	9684903	9684903	DHRS7C	17	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	4455	151
MAP2K3	5606	broad.mit.edu	37	17	21206533	21206533	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21206533G>A	uc002gys.2	+	7	820	c.555G>A	c.(553-555)TCG>TCA	p.S185S	MAP2K3_uc002gyt.2_Silent_p.S156S|MAP2K3_uc002gyu.2_Silent_p.S156S	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	185	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GCAAGCTGTCGGTGATCCACA	0.622				p.S185S(NALM6-Tumor)	346											0.15	15.738528	22.783759	9	51	KEEP	---	---	---	---	6	3	26	35	-1	capture	Silent	SNP	21206533	21206533	MAP2K3	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9152	151
MYO18A	399687	broad.mit.edu	37	17	27422043	27422043	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27422043C>A	uc002hdt.1	-	29	4578	c.4420G>T	c.(4420-4422)GCC>TCC	p.A1474S	MYO18A_uc010wbc.1_Missense_Mutation_p.A1016S|MYO18A_uc002hds.2_Missense_Mutation_p.A1016S|MYO18A_uc010csa.1_Missense_Mutation_p.A1474S|MYO18A_uc002hdu.1_Missense_Mutation_p.A1474S|MYO18A_uc010wbd.1_Missense_Mutation_p.A1143S	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1474	Potential.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TCCCGCTGGGCCTCCTCATGC	0.627	Esophageal Squamous(182;472 2015 7001 15270 22562)															0.4	7.048855	7.092633	2	3	KEEP	---	---	---	---	2	0	2	3	-1	capture	Missense_Mutation	SNP	27422043	27422043	MYO18A	17	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	9975	151
IKZF3	22806	broad.mit.edu	37	17	37922611	37922611	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37922611C>T	uc002hsu.2	-	8	1024	c.962G>A	c.(961-963)CGC>CAC	p.R321H	IKZF3_uc002htd.2_Missense_Mutation_p.R287H|IKZF3_uc010cwd.2_Missense_Mutation_p.R178H|IKZF3_uc002hsv.2_Missense_Mutation_p.R248H|IKZF3_uc010cwe.2_Missense_Mutation_p.R187H|IKZF3_uc010cwf.2_Missense_Mutation_p.R139H|IKZF3_uc010cwg.2_Missense_Mutation_p.R100H|IKZF3_uc002hsw.2_Missense_Mutation_p.R282H|IKZF3_uc002hsx.2_Missense_Mutation_p.R265H|IKZF3_uc002hsy.2_Missense_Mutation_p.R282H|IKZF3_uc002hsz.2_Missense_Mutation_p.R226H|IKZF3_uc002hta.2_Missense_Mutation_p.R243H|IKZF3_uc002htb.2_RNA|IKZF3_uc010cwh.2_Missense_Mutation_p.R234H|IKZF3_uc002htc.2_Missense_Mutation_p.R74H|IKZF3_uc010wel.1_Missense_Mutation_p.R74H	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1	321				R -> C (in Ref. 1; AAF13493 and 2; CAC80427/CAC80428/CAC80429/CAC80430/ CAC80431).	B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GACCAAGGGGCGCAGGGCTTC	0.547					312											0.36	118.932704	121.092432	45	80	KEEP	---	---	---	---	17	31	47	41	-1	capture	Missense_Mutation	SNP	37922611	37922611	IKZF3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7539	151
RPTOR	57521	broad.mit.edu	37	17	78727945	78727945	+	Missense_Mutation	SNP	A	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78727945A>C	uc002jyt.1	+	6	1595	c.790A>C	c.(790-792)ACC>CCC	p.T264P	RPTOR_uc002jys.2_Missense_Mutation_p.T264P|RPTOR_uc010wuf.1_Missense_Mutation_p.T79P|RPTOR_uc010wug.1_Missense_Mutation_p.T264P	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	264					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						TGACCTATTCACCTCCTGCCT	0.657					1368											0.026578	-66.509708	8.643331	8	293	KEEP	---	---	---	---	39	30	168	202	-1	capture	Missense_Mutation	SNP	78727945	78727945	RPTOR	17	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	13557	151
APCDD1	147495	broad.mit.edu	37	18	10471619	10471619	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:10471619G>A	uc002kom.3	+	3	689	c.335G>A	c.(334-336)AGC>AAC	p.S112N		NM_153000	NP_694545	Q8J025	APCD1_HUMAN	adenomatosis polyposis coli down-regulated 1	112	Extracellular (Potential).				hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding				0				READ - Rectum adenocarcinoma(15;0.08)		TATTATGGCAGCAACCGGTGC	0.532																0.030612	-16.166625	7.509369	3	95	KEEP	---	---	---	---	2	1	53	79	-1	capture	Missense_Mutation	SNP	10471619	10471619	APCDD1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	758	151
MUC16	94025	broad.mit.edu	37	19	9084743	9084743	+	Silent	SNP	G	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9084743G>T	uc002mkp.2	-	1	7276	c.7072C>A	c.(7072-7074)CGG>AGG	p.R2358R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2358	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	p.R2358P(1)		lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTTGTTTTCCGTGCGTCAAGG	0.433																0.329545	89.347486	91.612668	29	59	KEEP	---	---	---	---	16	13	28	35	0.551724137931	capture	Silent	SNP	9084743	9084743	MUC16	19	G	T	T	T	1	0	0	0	0	0	0	0	1	519	40	4	4	9883	151
SMARCA4	6597	broad.mit.edu	37	19	11136160	11136160	+	Silent	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11136160C>T	uc002mqf.3	+	22	3428	c.3144C>T	c.(3142-3144)CAC>CAT	p.H1048H	SMARCA4_uc010dxp.2_Silent_p.H1048H|SMARCA4_uc010dxo.2_Silent_p.H1048H|SMARCA4_uc002mqg.1_Silent_p.H1048H|SMARCA4_uc010dxq.2_Silent_p.H1048H|SMARCA4_uc010dxr.2_Silent_p.H1048H|SMARCA4_uc002mqj.3_Silent_p.H1048H|SMARCA4_uc010dxs.2_Silent_p.H1048H|SMARCA4_uc010dxt.1_Silent_p.H268H|SMARCA4_uc002mqh.3_Silent_p.H171H|SMARCA4_uc002mqi.1_Silent_p.H251H	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	1048					chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TCTGCAACCACCCCTACATGT	0.617					582	F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				0.266055	69.605233	75.017351	29	80	KEEP	---	---	---	---	17	18	37	59	-1	capture	Silent	SNP	11136160	11136160	SMARCA4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	14662	151
CEACAM7	1087	broad.mit.edu	37	19	42191016	42191016	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42191016C>A	uc002ori.1	-	2	203	c.201G>T	c.(199-201)TGG>TGT	p.W67C	CEACAM7_uc010ehx.2_Missense_Mutation_p.W67C|CEACAM7_uc010ehy.1_Missense_Mutation_p.W67C	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion	67	Ig-like V-type.					anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		CCCCTTTGTACCAGTTGTAGC	0.458																0.165957	79.562188	104.46404	39	196	KEEP	---	---	---	---	24	20	100	119	0.454545454545	capture	Missense_Mutation	SNP	42191016	42191016	CEACAM7	19	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	3166	151
CCDC8	83987	broad.mit.edu	37	19	46915568	46915568	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46915568G>A	uc002pep.2	-	1	1352	c.500C>T	c.(499-501)CCG>CTG	p.P167L		NM_032040	NP_114429	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	167						plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GCGGGCAGGCGGCGCGCTGGG	0.647																0.352941	67.158503	68.464229	24	44	KEEP	---	---	---	---	7	24	23	28	-1	capture	Missense_Mutation	SNP	46915568	46915568	CCDC8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2827	151
PRKCG	5582	broad.mit.edu	37	19	54401216	54401216	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54401216G>A	uc002qcq.1	+	10	1225	c.943G>A	c.(943-945)GTG>ATG	p.V315M	PRKCG_uc010yef.1_Silent_p.G285G|PRKCG_uc010yeg.1_Missense_Mutation_p.V315M|PRKCG_uc010yeh.1_Missense_Mutation_p.V202M	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	315				RVRM -> VSRT (in Ref. 3; AAA60102).	activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		TCCACAGCGGGTGCGGATGGG	0.468					505											0.019169	-73.333114	8.02505	6	307	KEEP	---	---	---	---	2	4	140	188	-1	capture	Missense_Mutation	SNP	54401216	54401216	PRKCG	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	12408	151
KIR3DL1	3811	broad.mit.edu	37	19	55378070	55378070	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55378070C>A	uc002qhl.3	+	9	1315	c.1252C>A	c.(1252-1254)CCC>ACC	p.P418T	KIR3DL2_uc010esh.2_Missense_Mutation_p.P401T|KIR3DL2_uc002qho.3_Missense_Mutation_p.P418T			P43629	KI3L1_HUMAN	SubName: Full=KIR3DS1;	418	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		TTCTCAGAGGCCCAAGACACC	0.522																0.310078	317.750299	330.190011	120	267	KEEP	---	---	---	---	50	74	140	147	0.596774193548	capture	Missense_Mutation	SNP	55378070	55378070	KIR3DL1	19	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	8242	151
NLRP7	199713	broad.mit.edu	37	19	55451740	55451740	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55451740G>A	uc002qih.3	-	4	523	c.447C>T	c.(445-447)GAC>GAT	p.D149D	NLRP7_uc002qig.3_Silent_p.D149D|NLRP7_uc002qii.3_Silent_p.D149D|NLRP7_uc010esk.2_Silent_p.D149D|NLRP7_uc010esl.2_Silent_p.D177D	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	149							ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		TCAGAGTGACGTCGTCATGGA	0.498																0.025862	-163.218775	38.834785	21	791	KEEP	---	---	---	---	13	13	397	485	-1	capture	Silent	SNP	55451740	55451740	NLRP7	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10389	151
NLRP4	147945	broad.mit.edu	37	19	56382210	56382210	+	Missense_Mutation	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56382210T>C	uc002qmd.3	+	7	2794	c.2372T>C	c.(2371-2373)CTC>CCC	p.L791P	NLRP4_uc002qmf.2_Missense_Mutation_p.L716P|NLRP4_uc010etf.2_Missense_Mutation_p.L566P	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	791							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTCTGCCACCTCAGCGAGCAG	0.498																0.057692	-5.83357	15.503274	6	98	KEEP	---	---	---	---	4	4	50	62	-1	capture	Missense_Mutation	SNP	56382210	56382210	NLRP4	19	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10386	151
ASAP2	8853	broad.mit.edu	37	2	9347326	9347326	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:9347326G>A	uc002qzh.2	+	1	433	c.93G>A	c.(91-93)GCG>GCA	p.A31A	ASAP2_uc002qzi.2_Silent_p.A31A	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	31					regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						CCCGCACGGCGCAGTGCCGGA	0.731																0.125	3.506713	6.805777	3	21	KEEP	---	---	---	---	1	2	10	16	-1	capture	Silent	SNP	9347326	9347326	ASAP2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1002	151
EHD3	30845	broad.mit.edu	37	2	31484555	31484555	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31484555C>A	uc002rnu.2	+	5	1664	c.1056C>A	c.(1054-1056)GAC>GAA	p.D352E	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	352					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CACCTGGGGACTTCCCCAATC	0.592																0.09417	9.615851	46.513394	21	202	KEEP	---	---	---	---	12	12	107	120	0.5	capture	Missense_Mutation	SNP	31484555	31484555	EHD3	2	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	4934	151
BCL11A	53335	broad.mit.edu	37	2	60689292	60689292	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:60689292G>A	uc002sae.1	-	4	983	c.755C>T	c.(754-756)TCC>TTC	p.S252F	BCL11A_uc002sab.2_Missense_Mutation_p.S252F|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Missense_Mutation_p.S218F|BCL11A_uc002sad.1_Missense_Mutation_p.S100F|BCL11A_uc002saf.1_Missense_Mutation_p.S218F	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	252					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGCCAGGCCGGAAGCCTCTCT	0.567					131	T	IGH@	B-CLL								0.058824	-9.617198	7.964855	5	80	KEEP	---	---	---	---	15	8	47	65	-1	capture	Missense_Mutation	SNP	60689292	60689292	BCL11A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	1352	151
CKAP2L	150468	broad.mit.edu	37	2	113514622	113514622	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113514622G>A	uc002tie.2	-	4	405	c.326C>T	c.(325-327)TCT>TTT	p.S109F	CKAP2L_uc002tif.2_5'UTR|CKAP2L_uc010yxp.1_5'UTR|CKAP2L_uc010yxq.1_5'UTR	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	109						centrosome					0						TGGGTTAGAAGAAACACATTC	0.473																0.035477	-73.276158	32.434507	16	435	KEEP	---	---	---	---	9	8	250	262	-1	capture	Missense_Mutation	SNP	113514622	113514622	CKAP2L	2	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	3408	151
MARCO	8685	broad.mit.edu	37	2	119726837	119726837	+	Missense_Mutation	SNP	G	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:119726837G>T	uc002tln.1	+	2	331	c.199G>T	c.(199-201)GTT>TTT	p.V67F	MARCO_uc010yyf.1_5'UTR	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	67	Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GGTGGTCCAAGGTAAAGCAGG	0.612	GBM(8;18 374 7467 11269 32796)															0.327434	105.030577	108.017886	37	76	KEEP	---	---	---	---	15	26	35	47	0.365853658537	capture	Missense_Mutation	SNP	119726837	119726837	MARCO	2	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	9224	151
LRP1B	53353	broad.mit.edu	37	2	141143511	141143511	+	Silent	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141143511C>A	uc002tvj.1	-	67	11454	c.10482G>T	c.(10480-10482)CGG>CGT	p.R3494R		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3494	Extracellular (Potential).|LDL-receptor class A 25.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGCTATCACACCGCCAGTGAT	0.378	Colon(99;50 2074 2507 20106)				2546								TSP Lung(27;0.18)			0.073529	-3.6658	21.774249	10	126	KEEP	---	---	---	---	6	4	57	77	0.4	capture	Silent	SNP	141143511	141143511	LRP1B	2	C	A	A	A	1	0	0	0	0	0	0	0	1	223	18	4	4	8871	151
CSRNP3	80034	broad.mit.edu	37	2	166535947	166535947	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166535947C>T	uc002udf.2	+	7	1818	c.1442C>T	c.(1441-1443)GCC>GTC	p.A481V	CSRNP3_uc002udg.2_Missense_Mutation_p.A481V	NM_024969	NP_079245	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	481					apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5						GTTGACTATGCCCGACAAGCA	0.512																0.030928	-17.064437	6.326655	3	94	KEEP	---	---	---	---	2	1	41	59	-1	capture	Missense_Mutation	SNP	166535947	166535947	CSRNP3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3930	151
SP5	389058	broad.mit.edu	37	2	171573817	171573817	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:171573817G>A	uc002uge.2	+	2	1266	c.1100G>A	c.(1099-1101)CGC>CAC	p.R367H		NM_001003845	NP_001003845	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	367	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGCTTCATGCGCAGCGACCAC	0.647																0.1	2.307908	7.098118	3	27	KEEP	---	---	---	---	1	2	12	19	-1	capture	Missense_Mutation	SNP	171573817	171573817	SP5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14859	151
TTN	7273	broad.mit.edu	37	2	179613920	179613920	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179613920C>A	uc002unb.2	-	46	13431	c.13207G>T	c.(13207-13209)GGT>TGT	p.G4403C	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGATCTACCAAGTTTTCCA	0.328					8722											0.26087	77.391438	83.347984	30	85	KEEP	---	---	---	---	13	18	40	49	0.58064516129	capture	Missense_Mutation	SNP	179613920	179613920	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	16617	151
SF3B1	23451	broad.mit.edu	37	2	198267454	198267454	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198267454C>A	uc002uue.2	-	14	1951	c.1903G>T	c.(1903-1905)GTA>TTA	p.V635L		NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	635	HEAT 3.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCAGAGGCTACAACAGCAAAA	0.448																0.043103	-18.695014	7.349753	5	111	KEEP	---	---	---	---	3	2	46	71	0.4	capture	Missense_Mutation	SNP	198267454	198267454	SF3B1	2	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	14042	151
SGOL2	151246	broad.mit.edu	37	2	201437781	201437781	+	Missense_Mutation	SNP	T	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201437781T>G	uc002uvw.2	+	7	2825	c.2712T>G	c.(2710-2712)AAT>AAG	p.N904K	SGOL2_uc010zhd.1_Missense_Mutation_p.N904K|SGOL2_uc010zhe.1_Missense_Mutation_p.N904K	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	904					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						CAAAAATAAATAAGCTCAGGA	0.299																0.400966	301.099845	302.870607	83	124	KEEP	---	---	---	---	44	43	64	66	-1	capture	Missense_Mutation	SNP	201437781	201437781	SGOL2	2	T	G	G	G	1	0	0	0	0	1	0	0	0	634	49	4	4	14110	151
CPS1	1373	broad.mit.edu	37	2	211515146	211515146	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:211515146C>T	uc002vee.3	+	28	3596	c.3464C>T	c.(3463-3465)GCG>GTG	p.A1155V	CPS1_uc010fur.2_Missense_Mutation_p.A1161V|CPS1_uc010fus.2_Missense_Mutation_p.A704V	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	1155	ATP-grasp 2.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CTAGAAGAGGCGACTAGAGTT	0.368																0.350993	153.732327	156.688604	53	98	KEEP	---	---	---	---	19	36	48	66	-1	capture	Missense_Mutation	SNP	211515146	211515146	CPS1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3788	151
UGT1A9	54600	broad.mit.edu	37	2	234581022	234581022	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234581022G>A	uc002vus.2	+	1	479	c.442G>A	c.(442-444)GAT>AAT	p.D148N	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Missense_Mutation_p.D148N	NM_021027	NP_066307	O60656	UD19_HUMAN	UDP glycosyltransferase 1 family, polypeptide A9	148					drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(3)|breast(1)|skin(1)	5		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)	AGTGTTTCTCGATCCTTTTGA	0.373																0.022222	-48.90287	8.390246	5	220	KEEP	---	---	---	---	1	5	139	117	-1	capture	Missense_Mutation	SNP	234581022	234581022	UGT1A9	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16834	151
SLC7A4	6545	broad.mit.edu	37	22	21384419	21384419	+	Missense_Mutation	SNP	A	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21384419A>G	uc002zud.2	-	3	1272	c.1204T>C	c.(1204-1206)TAC>CAC	p.Y402H	SLC7A4_uc002zue.2_Missense_Mutation_p.Y402H	NM_004173	NP_004164	O43246	CTR4_HUMAN	solute carrier family 7 (cationic amino acid	402	Helical; (Potential).				cellular amino acid metabolic process	integral to membrane	basic amino acid transmembrane transporter activity			ovary(1)|lung(1)	2	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	ACGAATGTGTAGGCCAGGAGT	0.657																0.055556	-1.076358	6.40036	2	34	KEEP	---	---	---	---	0	2	13	22	-1	capture	Missense_Mutation	SNP	21384419	21384419	SLC7A4	22	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	14591	151
RRP7A	27341	broad.mit.edu	37	22	42910784	42910784	+	Silent	SNP	C	T	T	rs146741450	by1000genomes	TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42910784C>T	uc003bcq.2	-	5	478	c.462G>A	c.(460-462)AAG>AAA	p.K154K	SERHL_uc011apm.1_Intron|RRP7A_uc003bcp.2_Silent_p.K177K	NM_015703	NP_056518	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A	154							nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2						CACTGATCCACTCTGAGGAAA	0.602																0.066667	-2.314456	6.44785	3	42	KEEP	---	---	---	---	2	1	26	22	-1	capture	Silent	SNP	42910784	42910784	RRP7A	22	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	13581	151
MOV10L1	54456	broad.mit.edu	37	22	50596619	50596619	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50596619C>T	uc003bjj.2	+	23	3283	c.3200C>T	c.(3199-3201)ACG>ATG	p.T1067M	MOV10L1_uc003bjk.3_Missense_Mutation_p.T1067M|MOV10L1_uc011arp.1_Missense_Mutation_p.T1047M|MOV10L1_uc003bjl.2_Missense_Mutation_p.T194M|MOV10L1_uc003bjm.1_Missense_Mutation_p.T110M	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	1067					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GGCGTCATCACGCCCTACCGG	0.657																0.033333	-14.647074	6.722807	3	87	KEEP	---	---	---	---	0	3	48	50	-1	capture	Missense_Mutation	SNP	50596619	50596619	MOV10L1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9631	151
ITPR1	3708	broad.mit.edu	37	3	4699832	4699832	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:4699832C>T	uc003bqa.2	+	13	1369	c.1021C>T	c.(1021-1023)CGA>TGA	p.R341*	ITPR1_uc010hca.1_Nonsense_Mutation_p.R326*|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Nonsense_Mutation_p.R326*	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	341	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		GGACGCCTCTCGAAGTAGGTT	0.488					2114											0.031414	-35.219317	10.69906	6	185	KEEP	---	---	---	---	4	3	109	111	-1	capture	Nonsense_Mutation	SNP	4699832	4699832	ITPR1	3	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	7843	151
SLC6A6	6533	broad.mit.edu	37	3	14513770	14513770	+	Missense_Mutation	SNP	C	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14513770C>G	uc010heg.2	+	17	1445	c.1154C>G	c.(1153-1155)ACA>AGA	p.T385R	SLC6A6_uc003byq.2_Missense_Mutation_p.T385R|SLC6A6_uc003byr.2_RNA	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter	385	Helical; Name=8; (Potential).				cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						CCGCTGCCCACATTTTGGTCC	0.537																0.275641	141.660346	148.728	43	113	KEEP	---	---	---	---	22	28	65	67	-1	capture	Missense_Mutation	SNP	14513770	14513770	SLC6A6	3	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	14580	151
C3orf20	84077	broad.mit.edu	37	3	14799033	14799033	+	Missense_Mutation	SNP	G	A	A	rs151210868		TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14799033G>A	uc003byy.2	+	13	2500	c.2096G>A	c.(2095-2097)CGC>CAC	p.R699H	C3orf20_uc003byz.2_Missense_Mutation_p.R577H|C3orf20_uc003bza.2_Missense_Mutation_p.R577H|C3orf20_uc003bzb.1_Missense_Mutation_p.R200H|C3orf20_uc011avj.1_Missense_Mutation_p.R26H	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	699						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						GAGCTGGAGCGCTTCCTGTTG	0.627																0.475862	194.429299	194.504639	69	76	KEEP	---	---	---	---	45	30	42	46	-1	capture	Missense_Mutation	SNP	14799033	14799033	C3orf20	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2193	151
TTC21A	199223	broad.mit.edu	37	3	39156148	39156148	+	Missense_Mutation	SNP	G	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39156148G>C	uc003cjc.2	+	6	808	c.631G>C	c.(631-633)GGG>CGG	p.G211R	TTC21A_uc003cja.2_Missense_Mutation_p.G211R|TTC21A_uc010hho.1_Missense_Mutation_p.G133R|TTC21A_uc003cjb.2_Missense_Mutation_p.R77T|TTC21A_uc003cje.2_Missense_Mutation_p.G211R|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.G170R	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	211	TPR 4.						binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGTGACTTCAGGGAGCTTCCT	0.552																0.057778	-19.3234	26.846634	13	212	KEEP	---	---	---	---	5	8	115	108	-1	capture	Missense_Mutation	SNP	39156148	39156148	TTC21A	3	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	16569	151
CACNA2D2	9254	broad.mit.edu	37	3	50416395	50416395	+	Silent	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50416395C>T	uc003daq.2	-	13	1328	c.1290G>A	c.(1288-1290)CAG>CAA	p.Q430Q	CACNA2D2_uc003dap.2_Silent_p.Q430Q	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	430	VWFA.|Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	CATAGTTATGCTGCCCCACGG	0.587																0.027027	-20.879086	6.545083	3	108	KEEP	---	---	---	---	1	2	68	68	-1	capture	Silent	SNP	50416395	50416395	CACNA2D2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	2525	151
ACOX2	8309	broad.mit.edu	37	3	58520774	58520774	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58520774G>A	uc003dkl.2	-	2	235	c.60C>T	c.(58-60)CCC>CCT	p.P20P		NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2	20					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		TCTCTATGTCGGGGTGCATTT	0.552																0.313916	573.037177	592.021298	194	424	KEEP	---	---	---	---	111	117	206	277	-1	capture	Silent	SNP	58520774	58520774	ACOX2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	159	151
KLF15	28999	broad.mit.edu	37	3	126071173	126071173	+	Missense_Mutation	SNP	C	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126071173C>G	uc011bkk.1	-	2	775	c.593G>C	c.(592-594)GGT>GCT	p.G198A		NM_014079	NP_054798	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	198						nucleus	DNA binding|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(114;0.147)		TGCACTGGCACCACCTGGTGG	0.662																0.05	-1.969974	6.606787	2	38	KEEP	---	---	---	---	0	2	14	27	-1	capture	Missense_Mutation	SNP	126071173	126071173	KLF15	3	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	8264	151
COL6A6	131873	broad.mit.edu	37	3	130325803	130325803	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:130325803G>A	uc010htl.2	+	20	4713	c.4682G>A	c.(4681-4683)GGC>GAC	p.G1561D	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1561	Triple-helical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GGACATACAGGCCCACAGGTA	0.353																0.36	50.840849	51.701555	18	32	KEEP	---	---	---	---	11	10	23	16	-1	capture	Missense_Mutation	SNP	130325803	130325803	COL6A6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3668	151
CPB1	1360	broad.mit.edu	37	3	148562321	148562321	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148562321C>A	uc003ewl.2	+	7	656	c.633C>A	c.(631-633)GAC>GAA	p.D211E		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	211					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			ACAAGTTAGACTTTTATGTCC	0.413																0.082474	-0.777248	16.433929	8	89	KEEP	---	---	---	---	5	4	40	64	0.444444444444	capture	Missense_Mutation	SNP	148562321	148562321	CPB1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	3761	151
SLC7A14	57709	broad.mit.edu	37	3	170198876	170198876	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:170198876C>A	uc003fgz.2	-	7	1511	c.1195G>T	c.(1195-1197)GCA>TCA	p.A399S	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	399	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			ACCAACAGTGCGAGGAGCGCT	0.592																0.034188	-19.197825	8.442629	4	113	KEEP	---	---	---	---	2	2	50	74	0.5	capture	Missense_Mutation	SNP	170198876	170198876	SLC7A14	3	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	14588	151
DRD5	1816	broad.mit.edu	37	4	9784478	9784478	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784478C>A	uc003gmb.3	+	1	1221	c.825C>A	c.(823-825)AGC>AGA	p.S275R		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	275	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GCCGGAGCAGCGCAGCCTGCG	0.637																0.098361	-3.157087	6.826295	6	55	KEEP	---	---	---	---	4	2	34	25	0.333333333333	capture	Missense_Mutation	SNP	9784478	9784478	DRD5	4	C	A	A	A	1	0	0	0	0	1	0	0	0	350	27	4	4	4715	151
BOD1L	259282	broad.mit.edu	37	4	13583896	13583896	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13583896C>T	uc003gmz.1	-	19	8674	c.8557G>A	c.(8557-8559)GAG>AAG	p.E2853K		NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	2853							DNA binding			ovary(5)|breast(1)	6						TCGTTCTGCTCTGGCTTTTCA	0.383																0.23913	56.400257	62.119177	22	70	KEEP	---	---	---	---	9	16	34	59	-1	capture	Missense_Mutation	SNP	13583896	13583896	BOD1L	4	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	1471	151
EGF	1950	broad.mit.edu	37	4	110915953	110915953	+	Silent	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110915953T>C	uc003hzy.3	+	20	3374	c.2922T>C	c.(2920-2922)TCT>TCC	p.S974S	EGF_uc011cfu.1_Silent_p.S932S|EGF_uc011cfv.1_Silent_p.S933S|EGF_uc010imk.2_Silent_p.S122S	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	974	EGF-like 9.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	ATAGTGACTCTGAATGTCCCC	0.438					724											0.062112	-8.686519	23.506679	10	151	KEEP	---	---	---	---	6	4	79	92	-1	capture	Silent	SNP	110915953	110915953	EGF	4	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	4917	151
PRDM9	56979	broad.mit.edu	37	5	23522495	23522495	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23522495G>A	uc003jgo.2	+	7	773	c.591G>A	c.(589-591)CCG>CCA	p.P197P		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	197					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						TCAGCGAGCCGCAGGATGATG	0.443													HNSCC(3;0.000094)			0.388889	206.236345	208.173412	70	110	KEEP	---	---	---	---	65	48	93	76	-1	capture	Silent	SNP	23522495	23522495	PRDM9	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12359	151
NDUFAF2	91942	broad.mit.edu	37	5	60368982	60368982	+	Missense_Mutation	SNP	A	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:60368982A>G	uc003jsp.3	+	2	285	c.158A>G	c.(157-159)GAA>GGA	p.E53G	NDUFAF2_uc003jso.3_Intron	NM_174889	NP_777549	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	53						membrane|mitochondrion	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				AGAATTGTAGAAGCAGCAAAT	0.323																0.155689	60.943606	79.845444	26	141	KEEP	---	---	---	---	14	16	96	76	-1	capture	Missense_Mutation	SNP	60368982	60368982	NDUFAF2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	10182	151
PCDHA5	56143	broad.mit.edu	37	5	140202989	140202989	+	Silent	SNP	T	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140202989T>A	uc003lhl.2	+	1	1629	c.1629T>A	c.(1627-1629)CCT>CCA	p.P543P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.P543P|PCDHA5_uc003lhj.1_Silent_p.P543P	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	543	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTGCCGCCTCTGGGCAGCA	0.701																0.282258	91.06647	96.353537	35	89	KEEP	---	---	---	---	32	27	76	84	-1	capture	Silent	SNP	140202989	140202989	PCDHA5	5	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	11430	151
PCDHGA12	26025	broad.mit.edu	37	5	140810930	140810930	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140810930C>T	uc003lkt.1	+	1	773	c.604C>T	c.(604-606)CGC>TGC	p.R202C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.R202C	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	202	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCCTGGACCGCGAAGAAAA	0.627																0.075829	-0.753314	38.143841	16	195	KEEP	---	---	---	---	7	11	96	123	-1	capture	Missense_Mutation	SNP	140810930	140810930	PCDHGA12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11456	151
HAVCR1	26762	broad.mit.edu	37	5	156476070	156476070	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156476070G>A	uc010jij.1	-	5	945	c.760C>T	c.(760-762)CCA>TCA	p.P254S	HAVCR1_uc011ddl.1_Missense_Mutation_p.P85S|HAVCR1_uc003lwi.2_Missense_Mutation_p.P254S	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	249	Extracellular (Potential).				interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGTACAATGGTGAGCTGGTG	0.438																0.247748	141.927645	154.772788	55	167	KEEP	---	---	---	---	24	38	74	106	-1	capture	Missense_Mutation	SNP	156476070	156476070	HAVCR1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	6900	151
SLIT3	6586	broad.mit.edu	37	5	168100307	168100307	+	Missense_Mutation	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168100307T>C	uc003mab.2	-	33	4136	c.3716A>G	c.(3715-3717)CAC>CGC	p.H1239R	SLIT3_uc010jjg.2_Missense_Mutation_p.H1246R	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1239	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCCACACTGTGAAACTGCCC	0.567	Ovarian(29;311 847 10864 17279 24903)															0.023437	-24.779197	7.556659	3	125	KEEP	---	---	---	---	1	2	68	73	-1	capture	Missense_Mutation	SNP	168100307	168100307	SLIT3	5	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	14633	151
BTBD9	114781	broad.mit.edu	37	6	38256182	38256182	+	Silent	SNP	G	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38256182G>T	uc003ooa.3	-	9	1896	c.1320C>A	c.(1318-1320)GTC>GTA	p.V440V	BTBD9_uc003ony.3_Silent_p.V372V|BTBD9_uc010jwv.2_Silent_p.V401V|BTBD9_uc010jww.2_RNA|BTBD9_uc010jwx.2_Silent_p.V440V	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a	440					cell adhesion						0						GGCTCCGACTGACTCCTTCAA	0.463																0.072464	-4.667764	21.300912	10	128	KEEP	---	---	---	---	5	7	79	78	0.416666666667	capture	Silent	SNP	38256182	38256182	BTBD9	6	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	1536	151
SLC29A1	2030	broad.mit.edu	37	6	44198124	44198124	+	Silent	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44198124T>C	uc003owu.1	+	6	824	c.495T>C	c.(493-495)GCT>GCC	p.A165A	SLC29A1_uc011dvp.1_3'UTR|SLC29A1_uc003owv.1_Silent_p.A165A|SLC29A1_uc003oww.1_Silent_p.A244A|SLC29A1_uc011dvq.1_3'UTR|SLC29A1_uc003owx.1_Silent_p.A165A|SLC29A1_uc003owy.1_Silent_p.A165A|SLC29A1_uc003owz.1_Silent_p.A165A	NM_004955	NP_004946	Q99808	S29A1_HUMAN	equilibrative nucleoside transporter 1	165	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|basolateral plasma membrane|integral to plasma membrane|membrane fraction	nucleoside transmembrane transporter activity|protein binding			large_intestine(2)|skin(1)	3	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Troglitazone(DB00197)	TTGGTCTGGCTGGCCTTCTGC	0.627					184											0.037383	-17.685289	7.728745	4	103	KEEP	---	---	---	---	0	5	53	63	-1	capture	Silent	SNP	44198124	44198124	SLC29A1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	14426	151
IMPG1	3617	broad.mit.edu	37	6	76744406	76744406	+	Missense_Mutation	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76744406T>C	uc003pik.1	-	3	530	c.400A>G	c.(400-402)ACC>GCC	p.T134A		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	134					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AGGCAGAAGGTCTCCTGCTGG	0.498	Pancreas(37;839 1141 2599 26037)															0.37013	196.248689	198.525865	57	97	KEEP	---	---	---	---	26	37	51	51	-1	capture	Missense_Mutation	SNP	76744406	76744406	IMPG1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	7651	151
IL22RA2	116379	broad.mit.edu	37	6	137482860	137482860	+	Silent	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:137482860G>A	uc003qhl.2	-	2	328	c.27C>T	c.(25-27)GGC>GGT	p.G9G	IL22RA2_uc003qhm.2_Silent_p.G9G|IL22RA2_uc003qhn.2_Silent_p.G9G	NM_052962	NP_443194	Q969J5	I22R2_HUMAN	interleukin 22-binding protein isoform 1	9					regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	interleukin-22 receptor activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		TGATGAGGAAGCCTAGAAAGC	0.413																0.376812	76.329738	77.250042	26	43	KEEP	---	---	---	---	18	14	30	20	-1	capture	Silent	SNP	137482860	137482860	IL22RA2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	431	34	2	2	7597	151
EZR	7430	broad.mit.edu	37	6	159239121	159239121	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159239121G>A	uc003qrt.3	-	1	220	c.5C>T	c.(4-6)CCG>CTG	p.P2L	EZR_uc011efs.1_Missense_Mutation_p.P2L|EZR_uc003qru.3_Missense_Mutation_p.P2L	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin	2	FERM.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TACTGGTTTCGGCATTTTCGG	0.577																0.029126	-17.902029	7.048363	3	100	KEEP	---	---	---	---	0	3	55	63	-1	capture	Missense_Mutation	SNP	159239121	159239121	EZR	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5289	151
DNAH11	8701	broad.mit.edu	37	7	21657267	21657267	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21657267G>A	uc003svc.2	+	23	4172	c.4141G>A	c.(4141-4143)GTC>ATC	p.V1381I		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1381	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGAAGTCCGCGTCTGGGATGC	0.483												Kartagener_syndrome				0.147541	15.33365	22.612118	9	52	KEEP	---	---	---	---	7	4	34	24	-1	capture	Missense_Mutation	SNP	21657267	21657267	DNAH11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4557	151
CALN1	83698	broad.mit.edu	37	7	71275406	71275406	+	Silent	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71275406C>T	uc003twa.3	-	5	974	c.447G>A	c.(445-447)ACG>ACA	p.T149T	CALN1_uc003twb.3_Silent_p.T191T|CALN1_uc003twc.3_Silent_p.T149T	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	149	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TGTCCTTCATCGTTAGGTGGT	0.463																0.273038	217.422194	230.99279	80	213	KEEP	---	---	---	---	29	54	96	135	-1	capture	Silent	SNP	71275406	71275406	CALN1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	2567	151
PMPCB	9512	broad.mit.edu	37	7	102937947	102937947	+	Missense_Mutation	SNP	C	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102937947C>A	uc003vbl.2	+	1	75	c.41C>A	c.(40-42)GCG>GAG	p.A14E	PMPCB_uc010liu.1_Missense_Mutation_p.A14E|PMPCB_uc003vbk.1_Missense_Mutation_p.A14E|PMPCB_uc003vbm.2_5'UTR|PMPCB_uc010liv.2_5'UTR|PMPCB_uc010liw.2_5'UTR|PMPCB_uc011kll.1_5'UTR|PMPCB_uc011klm.1_5'Flank	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit	14					proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						TCATCCGCGGCGCGGCGGCGG	0.652														OREG0018240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.104167	8.905385	23.850505	10	86	KEEP	---	---	---	---	7	4	47	56	0.363636363636	capture	Missense_Mutation	SNP	102937947	102937947	PMPCB	7	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	12044	151
WEE2	494551	broad.mit.edu	37	7	141429401	141429401	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141429401G>A	uc003vwn.2	+	11	2012	c.1606G>A	c.(1606-1608)GGG>AGG	p.G536R	FLJ40852_uc011krh.1_Intron|FLJ40852_uc010lnm.2_Intron|FLJ40852_uc010lnn.2_Intron|FLJ40852_uc003vwm.3_Intron|FLJ40852_uc010lno.2_Intron	NM_001105558	NP_001099028	P0C1S8	WEE2_HUMAN	WEE1 homolog 2	536					egg activation|female meiosis|female pronucleus assembly|meiotic metaphase II|meiotic prophase I|mitosis|negative regulation of oocyte development|regulation of meiosis I	centrosome|nucleus	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2	Melanoma(164;0.0171)					TGGGGTCTCTGGGACCCACAC	0.522					241											0.026616	-52.211725	12.934313	7	256	KEEP	---	---	---	---	4	3	142	136	-1	capture	Missense_Mutation	SNP	141429401	141429401	WEE2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	17226	151
GIMAP8	155038	broad.mit.edu	37	7	150171495	150171495	+	Missense_Mutation	SNP	A	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150171495A>G	uc003whj.2	+	4	1408	c.1078A>G	c.(1078-1080)ATC>GTC	p.I360V		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	360						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TGAGTACATGATCATACTTCT	0.403																0.267157	336.778903	356.767217	109	299	KEEP	---	---	---	---	55	61	158	162	-1	capture	Missense_Mutation	SNP	150171495	150171495	GIMAP8	7	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	6324	151
GIMAP1	170575	broad.mit.edu	37	7	150417944	150417944	+	Silent	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150417944C>T	uc003whq.2	+	3	939	c.852C>T	c.(850-852)GGC>GGT	p.G284G	GIMAP1_uc003whp.2_Silent_p.G292G	NM_130759	NP_570115	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	284	Helical; Anchor for type IV membrane protein; (Potential).					endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCTGGGGGGCGCGCTCCTGT	0.687																0.310345	20.494316	21.407667	9	20	KEEP	---	---	---	---	7	8	21	20	-1	capture	Silent	SNP	150417944	150417944	GIMAP1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6318	151
PTDSS1	9791	broad.mit.edu	37	8	97296348	97296348	+	Missense_Mutation	SNP	C	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:97296348C>G	uc003yht.1	+	3	385	c.283C>G	c.(283-285)CGA>GGA	p.R95G	PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	95					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	TCCGTTCACTCGACCTCATCC	0.353																0.352113	262.468754	266.574202	75	138	KEEP	---	---	---	---	43	38	85	87	-1	capture	Missense_Mutation	SNP	97296348	97296348	PTDSS1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	399	31	4	4	12631	151
HSD17B3	3293	broad.mit.edu	37	9	99064323	99064323	+	Missense_Mutation	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99064323C>T	uc004awa.1	-	1	112	c.64G>A	c.(64-66)GCG>ACG	p.A22T	HSD17B3_uc010msc.1_Missense_Mutation_p.A22T	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3	22					androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	ACGCACTTCGCCAGGCAGGCC	0.547																0.023622	-25.393157	6.669736	3	124	KEEP	---	---	---	---	0	3	62	74	-1	capture	Missense_Mutation	SNP	99064323	99064323	HSD17B3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7310	151
UCK1	83549	broad.mit.edu	37	9	134400596	134400596	+	Missense_Mutation	SNP	A	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:134400596A>G	uc004cay.2	-	7	766	c.665T>C	c.(664-666)CTG>CCG	p.L222P	UCK1_uc010mzk.2_Missense_Mutation_p.L213P|UCK1_uc004cba.2_Silent_p.P190P|UCK1_uc004caz.2_RNA	NM_031432	NP_113620	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1 isoform a	222					pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		CTGCACGATCAGGTTGATGGC	0.597	Melanoma(42;523 1129 28385 43975 48113)															0.033333	-14.956	6.426053	3	87	KEEP	---	---	---	---	1	3	44	55	-1	capture	Missense_Mutation	SNP	134400596	134400596	UCK1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	16805	151
SHROOM2	357	broad.mit.edu	37	X	9905429	9905429	+	Silent	SNP	C	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:9905429C>T	uc004csu.1	+	7	3933	c.3843C>T	c.(3841-3843)CCC>CCT	p.P1281P	SHROOM2_uc004csv.2_Silent_p.P116P|SHROOM2_uc011mic.1_Silent_p.P116P|SHROOM2_uc004csw.1_Silent_p.P116P	NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	1281					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				CGGCTGAGCCCCAGCCCCTGG	0.642																0.125	4.139074	6.336518	2	14	KEEP	---	---	---	---	2	0	12	4	-1	capture	Silent	SNP	9905429	9905429	SHROOM2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14187	151
SRPX	8406	broad.mit.edu	37	X	38009054	38009054	+	Silent	SNP	A	G	G			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:38009054A>G	uc004ddy.1	-	10	1391	c.1305T>C	c.(1303-1305)CCT>CCC	p.P435P	SRPX_uc004ddz.1_Silent_p.P415P|SRPX_uc011mkh.1_Silent_p.P376P|SRPX_uc011mki.1_3'UTR	NM_006307	NP_006298	P78539	SRPX_HUMAN	sushi-repeat-containing protein, X-linked	435					cell adhesion	cell surface|membrane					0						ACAGGGCCACAGGCATCACCA	0.502																0.05	-2.084807	6.506049	2	38	KEEP	---	---	---	---	0	2	17	22	-1	capture	Silent	SNP	38009054	38009054	SRPX	23	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	15056	151
WDR45	11152	broad.mit.edu	37	X	48935362	48935362	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48935362G>A	uc004dmk.1	-	4	347	c.175C>T	c.(175-177)CGC>TGC	p.R59C	PRAF2_uc011mmt.1_Intron|WDR45_uc004dmj.1_Missense_Mutation_p.R9C|WDR45_uc004dml.1_Missense_Mutation_p.R59C|WDR45_uc004dmm.1_Intron|WDR45_uc010nim.1_Missense_Mutation_p.R59C|WDR45_uc004dmn.1_5'UTR|WDR45_uc004dmo.1_Missense_Mutation_p.R81C|WDR45_uc004dmp.1_Missense_Mutation_p.R59C|WDR45_uc011mmu.1_Missense_Mutation_p.R59C	NM_001029896	NP_001025067	Q9Y484	WIPI4_HUMAN	WD repeat domain 45 isoform 2	59					autophagy|response to starvation	organelle membrane	phosphatidylinositol-3,5-bisphosphate binding			ovary(1)	1						AGGTTGGAGCGGTGCAGCATC	0.607																0.928571	47.921934	50.136139	13	1	KEEP	---	---	---	---	10	6	1	0	-1	capture	Missense_Mutation	SNP	48935362	48935362	WDR45	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17178	151
OPN1LW	5956	broad.mit.edu	37	X	153416186	153416186	+	Silent	SNP	T	C	C			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153416186T>C	uc004fjz.3	+	2	204	c.171T>C	c.(169-171)AGT>AGC	p.S57S		NM_020061	NP_064445	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	57	Helical; Name=1; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCTCACCAGTGTCTGGATGA	0.587																0.663265	233.303371	235.614443	65	33	KEEP	---	---	---	---	36	53	40	38	-1	capture	Silent	SNP	153416186	153416186	OPN1LW	23	T	C	C	C	1	0	0	0	0	0	0	0	1	764	59	3	3	10781	151
RPL10	6134	broad.mit.edu	37	X	153628824	153628824	+	Missense_Mutation	SNP	G	A	A			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153628824G>A	uc004fkm.2	+	6	537	c.349G>A	c.(349-351)GGT>AGT	p.G117S	uc010nuv.1_5'Flank|RPL10_uc004fko.2_Intron|RPL10_uc004fkn.1_Missense_Mutation_p.G117S|RPL10_uc004fkp.1_3'UTR|RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Missense_Mutation_p.G42S	NM_006013	NP_006004	P27635	RL10_HUMAN	ribosomal protein L10	117					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGCATGCGAGGTGCCTTTGG	0.527																0.021127	-30.005093	6.421191	3	139	KEEP	---	---	---	---	1	3	88	68	-1	capture	Missense_Mutation	SNP	153628824	153628824	RPL10	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	13446	151
VAMP7	6845	broad.mit.edu	37	X	155130194	155130194	+	Missense_Mutation	SNP	G	T	T			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:155130194G>T	uc004fnr.2	+	5	550	c.376G>T	c.(376-378)GTG>TTG	p.V126L	VAMP7_uc004fnt.2_Missense_Mutation_p.V85L|VAMP7_uc011naa.1_Missense_Mutation_p.V87L|VAMP7_uc011nab.1_Missense_Mutation_p.V25L|VAMP7_uc004fns.2_Missense_Mutation_p.V126L|VAMP7_uc011nac.1_Missense_Mutation_p.V59L	NM_005638	NP_005629	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7 isoform 1	126	v-SNARE coiled-coil homology.|Cytoplasmic (Potential).				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCTAGACAAAGTGATGGAGAC	0.358																0.375	34.090131	34.529835	12	20	KEEP	---	---	---	---	7	7	13	10	0.5	capture	Missense_Mutation	SNP	155130194	155130194	VAMP7	23	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	16999	151
LCE4A	199834	broad.mit.edu	37	1	152681693	152681698	+	In_Frame_Del	DEL	TGTGGT	-	-	rs113617356;rs11269814;rs74871420;rs79268808		TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152681693_152681698delTGTGGT	uc001fak.2	+	1	171_176	c.142_147delTGTGGT	c.(142-147)TGTGGTdel	p.CG48del		NM_178356	NP_848133	Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	48_49	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			CTCTGGGGGCTGTGGTTGCTGCAGCT	0.578																0.04			8	211		---	---	---	---						capture_indel	In_Frame_Del	DEL	152681693	152681698	LCE4A	1	TGTGGT	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	8594	151
TRIM21	6737	broad.mit.edu	37	11	4409705	4409705	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4409705delT	uc001lyy.1	-	4	673	c.560delA	c.(559-561)AACfs	p.N187fs		NM_003141	NP_003132	P19474	RO52_HUMAN	tripartite motif protein 21	187	Potential.				cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		AACCAGGAAGTTTTTTTGCTG	0.483																0.01			8	677		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	4409705	4409705	TRIM21	11	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	16378	151
NCOR2	9612	broad.mit.edu	37	12	124915195	124915195	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-3476-01	TCGA-14-3476-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124915195delG	uc010tba.1	-	9	1138	c.1021delC	c.(1021-1023)CGCfs	p.R341fs	NCOR2_uc010tay.1_Frame_Shift_Del_p.R341fs|NCOR2_uc010taz.1_Frame_Shift_Del_p.R341fs|NCOR2_uc010tbb.1_Frame_Shift_Del_p.R341fs|NCOR2_uc010tbc.1_Frame_Shift_Del_p.R341fs|NCOR2_uc001ugj.1_Frame_Shift_Del_p.R341fs|NCOR2_uc001ugk.1_Frame_Shift_Del_p.R341fs	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	341					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CGCTGCTTGCGGATCTCAGGG	0.672																0.27			59	159		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	124915195	124915195	NCOR2	12	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	10143	151
