Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HFM1	164045	broad.mit.edu	37	1	91843657	91843657	+	Silent	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91843657C>T	uc001doa.3	-	11	1420	c.1320G>A	c.(1318-1320)CAG>CAA	p.Q440Q	HFM1_uc010osu.1_Silent_p.Q119Q|HFM1_uc010osv.1_Silent_p.Q124Q|HFM1_uc001doc.1_Silent_p.Q440Q	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	440	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTTTTAAAGTCTGAGAAACAG	0.368																0.545455	123.505699	123.624196	36	30	KEEP	---	---	---	---	23	17	9	21	-1	capture	Silent	SNP	91843657	91843657	HFM1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	7008	161
LINGO4	339398	broad.mit.edu	37	1	151774511	151774511	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151774511G>A	uc001ezf.1	-	2	860	c.670C>T	c.(670-672)CTG>TTG	p.L224L		NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	224	Extracellular (Potential).|LRR 7.					integral to membrane				large_intestine(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGCCCCCGCAGGGCCCCAGCT	0.642																0.577273	429.141663	430.284642	127	93	KEEP	---	---	---	---	73	74	58	56	-1	capture	Silent	SNP	151774511	151774511	LINGO4	1	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	8737	161
UBQLN4	56893	broad.mit.edu	37	1	156011962	156011962	+	Silent	SNP	G	C	C			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156011962G>C	uc001fna.2	-	8	1356	c.1332C>G	c.(1330-1332)CTC>CTG	p.L444L	UBQLN4_uc010pgx.1_Silent_p.L424L	NM_020131	NP_064516	Q9NRR5	UBQL4_HUMAN	ataxin-1 ubiquitin-like interacting protein	444						cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding			pancreas(1)|skin(1)	2	Hepatocellular(266;0.133)|all_neural(408;0.195)					GGAAGACTGGGAGCTGCAGGC	0.617																0.133047	65.064745	95.514796	31	202	KEEP	---	---	---	---	25	26	138	139	-1	capture	Silent	SNP	156011962	156011962	UBQLN4	1	G	C	C	C	1	0	0	0	0	0	0	0	1	522	41	4	4	16781	161
UBQLN4	56893	broad.mit.edu	37	1	156021545	156021545	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156021545C>G	uc001fna.2	-	2	236	c.212G>C	c.(211-213)GGA>GCA	p.G71A	UBQLN4_uc010pgx.1_Missense_Mutation_p.G71A|ROBLD3_uc001fnb.3_5'Flank|ROBLD3_uc010pgy.1_5'Flank	NM_020131	NP_064516	Q9NRR5	UBQL4_HUMAN	ataxin-1 ubiquitin-like interacting protein	71	Ubiquitin-like.					cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding			pancreas(1)|skin(1)	2	Hepatocellular(266;0.133)|all_neural(408;0.195)					GTCCTTGATTCCGTGCTGGTT	0.537																0.460526	384.25671	384.565954	105	123	KEEP	---	---	---	---	63	56	84	58	-1	capture	Missense_Mutation	SNP	156021545	156021545	UBQLN4	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	16781	161
IQGAP3	128239	broad.mit.edu	37	1	156501015	156501015	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156501015G>C	uc001fpf.2	-	33	4203	c.4128C>G	c.(4126-4128)ATC>ATG	p.I1376M		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1376					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGAACTGTATGATATCGGCCA	0.587																0.105691	75.926076	151.928889	52	440	KEEP	---	---	---	---	34	23	233	254	-1	capture	Missense_Mutation	SNP	156501015	156501015	IQGAP3	1	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	7739	161
NTRK1	4914	broad.mit.edu	37	1	156834161	156834161	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156834161G>A	uc001fqh.1	+	2	284	c.228G>A	c.(226-228)CAG>CAA	p.Q76Q	NTRK1_uc001fqf.1_Silent_p.Q46Q|NTRK1_uc009wsi.1_5'UTR|NTRK1_uc001fqi.1_Silent_p.Q76Q|NTRK1_uc009wsk.1_Silent_p.Q76Q	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	76	Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	TCGAGAACCAGCAGCATCTGC	0.587					290	T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			0.734104	427.088083	435.648928	127	46	KEEP	---	---	---	---	69	84	40	22	-1	capture	Silent	SNP	156834161	156834161	NTRK1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	10613	161
ARHGEF11	9826	broad.mit.edu	37	1	156917714	156917714	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156917714C>T	uc001fqo.2	-	24	3108	c.2068G>A	c.(2068-2070)GAT>AAT	p.D690N	ARHGEF11_uc010phu.1_Missense_Mutation_p.D106N|ARHGEF11_uc001fqn.2_Missense_Mutation_p.D730N	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	690					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGGAGGGTATCTGTGCAGAAC	0.562																0.090909	7.693383	35.536208	15	150	KEEP	---	---	---	---	8	7	92	72	-1	capture	Missense_Mutation	SNP	156917714	156917714	ARHGEF11	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	889	161
F5	2153	broad.mit.edu	37	1	169489788	169489788	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169489788G>A	uc001ggg.1	-	22	6308	c.6163C>T	c.(6163-6165)CGA>TGA	p.R2055*		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	2055	F5/8 type C 1.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	AGTTCCAATCGAAGGGTAGGT	0.403																0.461538	171.643016	171.793195	54	63	KEEP	---	---	---	---	39	21	39	36	-1	capture	Nonsense_Mutation	SNP	169489788	169489788	F5	1	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	5302	161
LGR6	59352	broad.mit.edu	37	1	202287759	202287759	+	Silent	SNP	C	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202287759C>A	uc001gxu.2	+	18	2328	c.2328C>A	c.(2326-2328)GCC>GCA	p.A776A	LGR6_uc001gxv.2_Silent_p.A724A|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Silent_p.A637A	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	776	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						GGCACGTGGCCTGGCTCATCT	0.637																0.8	158.654629	163.760762	48	12	KEEP	---	---	---	---	26	24	6	7	0.48	capture	Silent	SNP	202287759	202287759	LGR6	1	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	8678	161
RASSF5	83593	broad.mit.edu	37	1	206711530	206711530	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:206711530C>T	uc001hed.2	+	2	544	c.487C>T	c.(487-489)CGC>TGC	p.R163C	RASSF5_uc001hec.1_Missense_Mutation_p.R163C|RASSF5_uc001hee.2_Missense_Mutation_p.R163C	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5	163	Phorbol-ester/DAG-type.				apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CCCAGAATGCCGCAGCCTGAT	0.532	GBM(162;656 1984 11916 22872 31529)															0.204724	194.165258	224.960555	78	303	KEEP	---	---	---	---	42	43	172	156	-1	capture	Missense_Mutation	SNP	206711530	206711530	RASSF5	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12984	161
MAPKAPK2	9261	broad.mit.edu	37	1	206902080	206902080	+	Missense_Mutation	SNP	G	A	A	rs151079567		TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:206902080G>A	uc001hem.1	+	2	591	c.305G>A	c.(304-306)CGC>CAC	p.R102H	MAPKAPK2_uc001hel.1_Missense_Mutation_p.R102H	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated	102	Protein kinase.				activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			CCCAAGGCCCGCAGGGAGGTG	0.622					114											0.166667	24.15495	31.739489	12	60	KEEP	---	---	---	---	9	11	54	38	-1	capture	Missense_Mutation	SNP	206902080	206902080	MAPKAPK2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9202	161
ESRRG	2104	broad.mit.edu	37	1	216737723	216737723	+	Splice_Site	SNP	C	G	G			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216737723C>G	uc001hkw.1	-	5	867	c.701_splice	c.e5-1	p.Y234_splice	ESRRG_uc001hky.1_Splice_Site_p.Y211_splice|ESRRG_uc009xdp.1_Splice_Site_p.Y211_splice|ESRRG_uc001hkz.1_Splice_Site_p.Y172_splice|ESRRG_uc010puc.1_Splice_Site_p.Y211_splice|ESRRG_uc001hla.1_Splice_Site_p.Y211_splice|ESRRG_uc001hlb.1_Splice_Site_p.Y211_splice|ESRRG_uc010pud.1_Splice_Site_p.Y42_splice|ESRRG_uc001hlc.1_Splice_Site_p.Y211_splice|ESRRG_uc001hld.1_Splice_Site_p.Y211_splice|ESRRG_uc001hkx.1_Missense_Mutation_p.D246H|ESRRG_uc009xdo.1_Splice_Site_p.Y211_splice|ESRRG_uc001hle.1_Splice_Site_p.Y211_splice	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ATCTTGTTATCTGCAGGATCA	0.433																0.336364	125.240072	127.846252	37	73	KEEP	---	---	---	---	27	16	40	44	-1	capture	Splice_Site	SNP	216737723	216737723	ESRRG	1	C	G	G	G	1	0	0	0	0	0	0	1	0	416	32	5	4	5217	161
AKR1E2	83592	broad.mit.edu	37	10	4873008	4873008	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:4873008C>T	uc001ihi.2	+	2	296	c.181C>T	c.(181-183)CGG>TGG	p.R61W	AKR1E2_uc001ihl.1_RNA|AKR1E2_uc010qam.1_Missense_Mutation_p.R61W|AKR1E2_uc001ihh.1_Missense_Mutation_p.R61W|AKR1E2_uc009xhw.2_Missense_Mutation_p.R61W|AKR1E2_uc001ihj.2_RNA|AKR1E2_uc001ihk.2_Missense_Mutation_p.R61W	NM_001040177	NP_001035267	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	61						cytoplasm	1,5-anhydro-D-fructose reductase activity				0						CGCTGTAAGACGGGAGGATCT	0.507	NSCLC(43;343 1097 20371 28813 45509)															0.347826	90.056328	91.943709	32	60	KEEP	---	---	---	---	15	23	35	31	-1	capture	Missense_Mutation	SNP	4873008	4873008	AKR1E2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	474	161
ITIH2	3698	broad.mit.edu	37	10	7762869	7762869	+	Silent	SNP	C	T	T	rs144114794		TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7762869C>T	uc001ijs.2	+	7	843	c.681C>T	c.(679-681)CCC>CCT	p.P227P		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	227					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						TTCATGTTCCCGACACATTTG	0.453																0.293706	127.301398	132.743371	42	101	KEEP	---	---	---	---	28	22	59	55	-1	capture	Silent	SNP	7762869	7762869	ITIH2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7827	161
C10orf68	79741	broad.mit.edu	37	10	33000595	33000595	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:33000595T>C	uc001iwn.3	+	7	900	c.427T>C	c.(427-429)TCA>CCA	p.S143P	C10orf68_uc001iwl.1_Missense_Mutation_p.S151P|C10orf68_uc001iwm.1_Missense_Mutation_p.S119P|C10orf68_uc010qei.1_Missense_Mutation_p.S70P	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68	143										skin(2)|ovary(1)	3						ACATCAAGATTCAGTGTCAAA	0.308																0.755556	134.575182	137.254663	34	11	KEEP	---	---	---	---	22	20	8	5	-1	capture	Missense_Mutation	SNP	33000595	33000595	C10orf68	10	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	1601	161
NAV3	89795	broad.mit.edu	37	12	78591133	78591133	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:78591133C>G	uc001syp.2	+	35	6571	c.6398C>G	c.(6397-6399)TCT>TGT	p.S2133C	NAV3_uc001syo.2_Missense_Mutation_p.S2111C|NAV3_uc010sub.1_Missense_Mutation_p.S1590C|NAV3_uc009zsf.2_Missense_Mutation_p.S942C	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2133						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CATGTGGGCTCTCTGAGTGAT	0.328					1091								HNSCC(70;0.22)			0.340426	55.485943	56.543676	16	31	KEEP	---	---	---	---	7	9	14	22	-1	capture	Missense_Mutation	SNP	78591133	78591133	NAV3	12	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10092	161
PAWR	5074	broad.mit.edu	37	12	80014954	80014954	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:80014954G>A	uc001syx.2	-	3	836	c.550C>T	c.(550-552)CAG>TAG	p.Q184*		NM_002583	NP_002574	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	184	Selective for apoptosis induction in cancer cells (SAC).				actin filament bundle assembly|apoptosis|induction of apoptosis|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	actin binding|enzyme binding|leucine zipper domain binding|transcription corepressor activity				0						CGCTCTTTCTGCCCTGCTTCA	0.363					121											0.371747	277.319624	281.247839	100	169	KEEP	---	---	---	---	58	50	112	76	-1	capture	Nonsense_Mutation	SNP	80014954	80014954	PAWR	12	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	11380	161
FRY	10129	broad.mit.edu	37	13	32735289	32735289	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32735289G>A	uc001utx.2	+	17	2289	c.1793G>A	c.(1792-1794)AGA>AAA	p.R598K	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	598					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AGGGGTGAGAGAAAGCCAAAA	0.299																0.468966	228.190329	228.311898	68	77	KEEP	---	---	---	---	43	31	43	42	-1	capture	Missense_Mutation	SNP	32735289	32735289	FRY	13	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	6006	161
FARP1	10160	broad.mit.edu	37	13	99042246	99042246	+	Silent	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99042246C>T	uc001vnj.2	+	10	1227	c.891C>T	c.(889-891)GCC>GCT	p.A297A	FARP1_uc001vnh.2_Silent_p.A297A	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	297	FERM.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TCCTGATGGCCAGTCGGGATT	0.443																0.454936	338.983353	339.39989	106	127	KEEP	---	---	---	---	66	54	79	62	-1	capture	Silent	SNP	99042246	99042246	FARP1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	5622	161
KIAA1409	57578	broad.mit.edu	37	14	94041533	94041533	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94041533G>C	uc001ybv.1	+	14	1752	c.1669G>C	c.(1669-1671)GCA>CCA	p.A557P	KIAA1409_uc001ybs.1_Missense_Mutation_p.A557P	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	734						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		AGGGAACCTTGCATCTCGAAG	0.373					1186											0.324324	75.174402	77.201303	24	50	KEEP	---	---	---	---	12	14	28	32	-1	capture	Missense_Mutation	SNP	94041533	94041533	KIAA1409	14	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	8152	161
UBFD1	56061	broad.mit.edu	37	16	23570883	23570883	+	Silent	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23570883C>T	uc002dlv.2	+	3	652	c.450C>T	c.(448-450)ATC>ATT	p.I150I	EARS2_uc002dls.3_5'Flank|EARS2_uc002dlt.3_5'Flank|EARS2_uc002dlu.2_5'Flank	NM_019116	NP_061989	O14562	UBFD1_HUMAN	ubiquitin-binding protein homolog	150	Ubiquitin-like.										0				GBM - Glioblastoma multiforme(48;0.0331)		GGGCCAAGATCATGGTGGTTG	0.502	Melanoma(22;290 1069 22358 48158)															0.364865	80.305131	81.493781	27	47	KEEP	---	---	---	---	18	13	24	23	-1	capture	Silent	SNP	23570883	23570883	UBFD1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	16766	161
RNMTL1	55178	broad.mit.edu	37	17	695048	695048	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:695048G>A	uc002frw.2	+	4	1108	c.1002G>A	c.(1000-1002)CTG>CTA	p.L334L		NM_018146	NP_060616	Q9HC36	RMTL1_HUMAN	RNA methyltransferase like 1	334					RNA processing		protein binding|RNA binding|RNA methyltransferase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		AAGATTGGCTGCCTCATGTTG	0.552																0.04717	-14.021844	9.145033	5	101	KEEP	---	---	---	---	3	2	71	51	-1	capture	Silent	SNP	695048	695048	RNMTL1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	13399	161
ALDH3A1	218	broad.mit.edu	37	17	19641725	19641725	+	Missense_Mutation	SNP	C	T	T	rs113168621		TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19641725C>T	uc010cqu.2	-	9	1588	c.1258G>A	c.(1258-1260)GAG>AAG	p.E420K	ALDH3A1_uc010vzd.1_Missense_Mutation_p.E420K|ALDH3A1_uc002gwj.2_Missense_Mutation_p.E420K|ALDH3A1_uc010cqv.2_Missense_Mutation_p.E419K|ALDH3A1_uc002gwk.2_Missense_Mutation_p.E537K|ALDH3A1_uc002gwl.1_Missense_Mutation_p.E347K	NM_001135168	NP_001128640	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3A1	420					cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(1)|pancreas(1)	2	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)	NADH(DB00157)	GAGAAAGTCTCGAAGCTCTTC	0.612																0.366337	112.353232	113.937914	37	64	KEEP	---	---	---	---	17	27	39	28	-1	capture	Missense_Mutation	SNP	19641725	19641725	ALDH3A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	497	161
GAS2L2	246176	broad.mit.edu	37	17	34072169	34072169	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34072169G>A	uc002hjv.1	-	6	2375	c.2347C>T	c.(2347-2349)CGG>TGG	p.R783W		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	783					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGGTCTCTCCGGGGCCGAATC	0.612																0.398374	310.384262	312.579095	98	148	KEEP	---	---	---	---	57	49	95	74	-1	capture	Missense_Mutation	SNP	34072169	34072169	GAS2L2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	6187	161
USH1G	124590	broad.mit.edu	37	17	72915620	72915620	+	Silent	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72915620C>T	uc002jme.1	-	2	1494	c.1311G>A	c.(1309-1311)AAG>AAA	p.K437K	USH1G_uc010wro.1_Silent_p.K334K	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	437	SAM.				equilibrioception|photoreceptor cell maintenance|sensory perception of sound	actin cytoskeleton				skin(2)	2	all_lung(278;0.172)|Lung NSC(278;0.207)					CCAAGATCTTCTTTCGGGGCC	0.682																0.257143	47.417541	51.159849	18	52	KEEP	---	---	---	---	15	7	23	32	-1	capture	Silent	SNP	72915620	72915620	USH1G	17	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	16917	161
INO80C	125476	broad.mit.edu	37	18	33060423	33060423	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:33060423G>A	uc002kyy.3	-	2	378	c.261C>T	c.(259-261)AAC>AAT	p.N87N	INO80C_uc002kyw.1_Silent_p.N87N|INO80C_uc002kyx.3_Silent_p.N32N|INO80C_uc010dmt.2_Silent_p.N123N	NM_194281	NP_919257	Q6PI98	IN80C_HUMAN	Ies6-similar protein isoform 2	87					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|MLL1 complex					0						TTACCACAAAGTTGGGATCCT	0.483																0.196429	54.200864	63.805969	22	90	KEEP	---	---	---	---	9	17	54	45	-1	capture	Silent	SNP	33060423	33060423	INO80C	18	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	7671	161
SERPINB4	6318	broad.mit.edu	37	18	61310407	61310407	+	Silent	SNP	A	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61310407A>T	uc002ljf.2	-	3	296	c.210T>A	c.(208-210)GCT>GCA	p.A70A	SERPINB4_uc002lje.2_Silent_p.A70A|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	70					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						GATATGTTGCAGCTTTTTCTG	0.403					163											0.242857	48.240381	52.459393	17	53	KEEP	---	---	---	---	12	10	32	33	-1	capture	Silent	SNP	61310407	61310407	SERPINB4	18	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	13996	161
CNDP1	84735	broad.mit.edu	37	18	72223637	72223637	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72223637C>T	uc002llq.2	+	2	300	c.89C>T	c.(88-90)CCG>CTG	p.P30L		NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	30					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		TCACCCTCCCCGCCCCCGGCG	0.537	Melanoma(32;1029 1042 25286 38395 44237)															0.666667	153.868518	155.565984	46	23	KEEP	---	---	---	---	31	18	20	5	-1	capture	Missense_Mutation	SNP	72223637	72223637	CNDP1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3558	161
SAFB2	9667	broad.mit.edu	37	19	5587916	5587916	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5587916G>A	uc002mcd.2	-	19	2813	c.2601C>T	c.(2599-2601)GAC>GAT	p.D867D		NM_014649	NP_055464	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	867	Interacts with SAFB1.|Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CCGCGCCTGCGTCCATGGCAC	0.672	Ovarian(127;888 1728 23957 44128 52668)															0.5	35.00477	35.00477	12	12	KEEP	---	---	---	---	7	8	7	6	-1	capture	Silent	SNP	5587916	5587916	SAFB2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13699	161
FBN3	84467	broad.mit.edu	37	19	8190851	8190851	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8190851C>T	uc002mjf.2	-	21	2677	c.2656G>A	c.(2656-2658)GTC>ATC	p.V886I		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	886	EGF-like 11; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCAGTGTTGACGCAACGCCCG	0.637																0.390625	76.06179	76.73201	25	39	KEEP	---	---	---	---	18	10	19	21	-1	capture	Missense_Mutation	SNP	8190851	8190851	FBN3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5650	161
KIAA0892	23383	broad.mit.edu	37	19	19459728	19459728	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19459728G>A	uc002nmk.3	+	14	1378	c.1339G>A	c.(1339-1341)GAC>AAC	p.D447N	KIAA0892_uc002nml.3_Missense_Mutation_p.D52N|KIAA0892_uc010ecd.2_Missense_Mutation_p.D52N|KIAA0892_uc010ece.2_Missense_Mutation_p.D23N	NM_015329	NP_056144	Q9Y6X3	SCC4_HUMAN	hypothetical protein LOC23383 precursor	447					cell division|maintenance of mitotic sister chromatid cohesion	chromatin|nucleoplasm|SMC loading complex	protein N-terminus binding				0						GATCAACCCGGACCACAGCTT	0.617																0.24	59.267887	65.426249	24	76	KEEP	---	---	---	---	15	14	34	51	-1	capture	Missense_Mutation	SNP	19459728	19459728	KIAA0892	19	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	8118	161
MYH14	79784	broad.mit.edu	37	19	50792885	50792885	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50792885C>T	uc002prr.1	+	33	4869	c.4822C>T	c.(4822-4824)CGG>TGG	p.R1608W	MYH14_uc010enu.1_Missense_Mutation_p.R1649W|MYH14_uc002prq.1_Missense_Mutation_p.R1616W|MYH14_uc010ycb.1_5'UTR|MYH14_uc002prs.1_5'UTR	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	1608	Potential.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGAAGAGAGGCGGAGGCAGCT	0.612																0.454545	12.361804	12.382765	5	6	KEEP	---	---	---	---	4	2	3	4	-1	capture	Missense_Mutation	SNP	50792885	50792885	MYH14	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	9943	161
TSSC1	7260	broad.mit.edu	37	2	3193249	3193249	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3193249G>A	uc002qxj.2	-	9	1213	c.1020C>T	c.(1018-1020)ATC>ATT	p.I340I	TSSC1_uc002qxi.2_RNA	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	340							protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		CGTAGGTGGCGATCACGTTGT	0.657	Colon(140;1261 1762 4183 34270 49743)															0.4	12.198094	12.285524	4	6	KEEP	---	---	---	---	2	3	2	4	-1	capture	Silent	SNP	3193249	3193249	TSSC1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	16548	161
MAP4K4	9448	broad.mit.edu	37	2	102486218	102486218	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102486218G>A	uc002tbg.2	+	20	2410	c.2355G>A	c.(2353-2355)GGG>GGA	p.G785G	MAP4K4_uc002tbc.2_Silent_p.G866G|MAP4K4_uc002tbd.2_Silent_p.G758G|MAP4K4_uc002tbe.2_Silent_p.G704G|MAP4K4_uc002tbf.2_Silent_p.G755G|MAP4K4_uc010yvy.1_Silent_p.G781G|MAP4K4_uc002tbh.2_Silent_p.G703G|MAP4K4_uc002tbi.2_Silent_p.G588G|MAP4K4_uc010yvz.1_Silent_p.G761G|MAP4K4_uc002tbk.2_Silent_p.G240G|MAP4K4_uc002tbl.2_5'UTR	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	785					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						AGCAGGAAGGGGCTGACGAGT	0.572					483											0.666667	20.755786	20.979964	6	3	KEEP	---	---	---	---	3	4	2	1	-1	capture	Silent	SNP	102486218	102486218	MAP4K4	2	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9176	161
ALS2CR8	79800	broad.mit.edu	37	2	203806678	203806678	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:203806678C>T	uc002uzo.2	+	3	333	c.53C>T	c.(52-54)TCA>TTA	p.S18L	ALS2CR8_uc002uzn.2_Intron|ALS2CR8_uc002uzm.2_Missense_Mutation_p.S18L|ALS2CR8_uc010zhy.1_Missense_Mutation_p.S18L|ALS2CR8_uc010zhz.1_Intron|ALS2CR8_uc010ftu.1_Intron|ALS2CR8_uc010zia.1_Missense_Mutation_p.S18L|ALS2CR8_uc010zib.1_Missense_Mutation_p.S18L|ALS2CR8_uc010zic.1_Intron|ALS2CR8_uc002uzp.2_Missense_Mutation_p.S18L	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	18										large_intestine(1)|ovary(1)	2						GGTGAAGAGTCAAAAACCAGT	0.363																0.402062	112.693337	113.510172	39	58	KEEP	---	---	---	---	19	30	33	35	-1	capture	Missense_Mutation	SNP	203806678	203806678	ALS2CR8	2	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	555	161
RASSF2	9770	broad.mit.edu	37	20	4776462	4776462	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:4776462C>T	uc002wld.2	-	4	340	c.286G>A	c.(286-288)GGA>AGA	p.G96R	RASSF2_uc002wlc.2_5'Flank|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.G96R	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2	96					cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						CTCACTCACCCCTGAGCCCCC	0.597	Melanoma(158;1891 3343 50738)															0.44	214.332646	214.80276	66	84	KEEP	---	---	---	---	41	32	45	57	-1	capture	Missense_Mutation	SNP	4776462	4776462	RASSF2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12981	161
TXNRD2	10587	broad.mit.edu	37	22	19865620	19865620	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19865620C>T	uc011ahc.1	-	16	1471	c.1438G>A	c.(1438-1440)GGG>AGG	p.G480R	TXNRD2_uc002zql.1_Missense_Mutation_p.G234R|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Missense_Mutation_p.G479R|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Missense_Mutation_p.G130R	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	480					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					TACTTGATCCCCAGAGCAAAT	0.597																0.454545	50.522637	50.581845	15	18	KEEP	---	---	---	---	5	11	12	8	-1	capture	Missense_Mutation	SNP	19865620	19865620	TXNRD2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16690	161
SMTN	6525	broad.mit.edu	37	22	31492853	31492853	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31492853G>A	uc003ajl.1	+	14	2214	c.1996G>A	c.(1996-1998)GTT>ATT	p.V666I	SMTN_uc003ajk.1_Missense_Mutation_p.V666I|SMTN_uc003ajm.1_Missense_Mutation_p.V666I|SMTN_uc011ale.1_Missense_Mutation_p.V751I|SMTN_uc011alf.1_Missense_Mutation_p.V722I|SMTN_uc003ajn.1_Missense_Mutation_p.V689I|SMTN_uc011alg.1_Missense_Mutation_p.V122I|SMTN_uc003ajo.1_Intron|SMTN_uc011alh.1_RNA|SMTN_uc010gwe.1_Intron	NM_006932	NP_008863	P53814	SMTN_HUMAN	smoothelin isoform c	666					muscle organ development|smooth muscle contraction	actin cytoskeleton|cytoplasm	actin binding|structural constituent of muscle			large_intestine(2)|pancreas(1)	3						TGTCAGCACTGTTACCAAGAC	0.682																0.292683	61.866389	65.022749	24	58	KEEP	---	---	---	---	20	11	45	34	-1	capture	Missense_Mutation	SNP	31492853	31492853	SMTN	22	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14706	161
MST1	4485	broad.mit.edu	37	3	49723522	49723522	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49723522G>A	uc003cxg.2	-	9	1192	c.1120C>T	c.(1120-1122)CGT>TGT	p.R374C	MST1_uc011bcs.1_Silent_p.G412G|MST1_uc010hkx.2_3'UTR|MST1_uc011bct.1_3'UTR	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	360	Kringle 3.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTGTACAACGCCGGATCTGG	0.697	GBM(110;181 1524 8005 22865 46297)															0.076923	-2.010495	7.493978	4	48	KEEP	---	---	---	---	2	5	29	27	-1	capture	Missense_Mutation	SNP	49723522	49723522	MST1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9800	161
ABI3BP	25890	broad.mit.edu	37	3	100568897	100568897	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:100568897G>A	uc003dun.2	-	15	1452	c.1367C>T	c.(1366-1368)ACG>ATG	p.T456M	ABI3BP_uc003duo.2_Missense_Mutation_p.T498M	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	456	Pro-rich.					extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						ACCAGGTGTCGTAGGCTGCAT	0.378																0.318182	20.620386	21.265128	7	15	KEEP	---	---	---	---	3	7	8	8	-1	capture	Missense_Mutation	SNP	100568897	100568897	ABI3BP	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	91	161
ZIC1	7545	broad.mit.edu	37	3	147128425	147128425	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:147128425G>A	uc003ewe.2	+	1	1245	c.526G>A	c.(526-528)GAG>AAG	p.E176K		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	176					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCCGCGACCGGAGCAGTACGG	0.682																0.413793	34.993707	35.182126	12	17	KEEP	---	---	---	---	7	7	9	12	-1	capture	Missense_Mutation	SNP	147128425	147128425	ZIC1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	17558	161
POU4F2	5458	broad.mit.edu	37	4	147561770	147561770	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:147561770G>A	uc003ikv.2	+	2	1288	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	347	Homeobox.				estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					GAGAAGAAGCGCAAGCGCACG	0.622																0.409091	245.910769	247.318848	81	117	KEEP	---	---	---	---	45	46	71	63	-1	capture	Missense_Mutation	SNP	147561770	147561770	POU4F2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12180	161
ZDHHC11	79844	broad.mit.edu	37	5	825284	825284	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:825284C>T	uc011cma.1	-	8	1402	c.1018G>A	c.(1018-1020)GCA>ACA	p.A340T	ZDHHC11_uc010itc.2_5'Flank|ZDHHC11_uc003jbj.2_RNA|ZDHHC11_uc010itd.1_RNA	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	340						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CTTACCCGTGCCGTCGAATCC	0.542																0.068182	-2.012896	6.47758	3	41	KEEP	---	---	---	---	2	1	36	29	-1	capture	Missense_Mutation	SNP	825284	825284	ZDHHC11	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17481	161
HTR1A	3350	broad.mit.edu	37	5	63257205	63257205	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:63257205G>A	uc011cqt.1	-	1	342	c.342C>T	c.(340-342)GCC>GCT	p.A114A		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	114	Helical; Name=3; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	GCACGTCGAGGGCGATGAACA	0.607																0.377778	50.154656	50.747651	17	28	KEEP	---	---	---	---	8	9	17	12	-1	capture	Silent	SNP	63257205	63257205	HTR1A	5	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7361	161
PCDHA5	56143	broad.mit.edu	37	5	140203141	140203141	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140203141G>A	uc003lhl.2	+	1	1781	c.1781G>A	c.(1780-1782)CGC>CAC	p.R594H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.R594H|PCDHA5_uc003lhj.1_Missense_Mutation_p.R594H	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	594	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGAAGGTGCGCGCAGTGGAC	0.697																0.473214	156.865882	156.935684	53	59	KEEP	---	---	---	---	29	25	40	24	-1	capture	Missense_Mutation	SNP	140203141	140203141	PCDHA5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11430	161
RGS14	10636	broad.mit.edu	37	5	176794018	176794018	+	Silent	SNP	C	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176794018C>A	uc003mgf.2	+	5	648	c.466C>A	c.(466-468)CGG>AGG	p.R156R	RGS14_uc003mgg.1_Silent_p.R3R|RGS14_uc003mgh.2_Silent_p.R3R|RGS14_uc003mgi.2_5'Flank	NM_006480	NP_006471	O43566	RGS14_HUMAN	regulator of G-protein signalling 14	156	RGS.				chromosome segregation|long-term memory|long-term synaptic potentiation|negative regulation of ERK1 and ERK2 cascade|negative regulation of MAP kinase activity|negative regulation of synaptic plasticity|nucleocytoplasmic transport|platelet-derived growth factor receptor signaling pathway|positive regulation of neurogenesis|regulation of DNA-dependent transcription in response to stress|regulation of G-protein coupled receptor protein signaling pathway|response to oxidative stress|spindle organization|visual learning|zygote asymmetric cell division	cell junction|centrosome|dendritic spine|microtubule|PML body|postsynaptic density|postsynaptic membrane|spindle pole	GDP-dissociation inhibitor activity|GTPase activator activity|microtubule binding|receptor signaling complex scaffold activity|receptor signaling protein activity			lung(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACATGTTTCGGGCACAGCA	0.662	NSCLC(47;353 1896 28036)															0.5	71.520237	71.520237	23	23	KEEP	---	---	---	---	19	6	9	17	0.24	capture	Silent	SNP	176794018	176794018	RGS14	5	C	A	A	A	1	0	0	0	0	0	0	0	1	399	31	4	4	13189	161
PTK7	5754	broad.mit.edu	37	6	43109925	43109925	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43109925G>A	uc003oub.1	+	13	2133	c.1935G>A	c.(1933-1935)CAG>CAA	p.Q645Q	PTK7_uc003ouc.1_Intron|PTK7_uc003oud.1_Silent_p.Q605Q|PTK7_uc003oue.1_Silent_p.Q515Q|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Silent_p.Q653Q|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	645	Ig-like C2-type 7.|Extracellular (Potential).				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			ACATCTTCCAGAATGGCTCCC	0.642					398											0.102804	8.342218	25.167587	11	96	KEEP	---	---	---	---	5	6	48	60	-1	capture	Silent	SNP	43109925	43109925	PTK7	6	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	12660	161
SRF	6722	broad.mit.edu	37	6	43141721	43141721	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43141721C>T	uc003oui.2	+	2	1125	c.650C>T	c.(649-651)ACC>ATC	p.T217I	SRF_uc011dvf.1_Missense_Mutation_p.T13I	NM_003131	NP_003122	P11831	SRF_HUMAN	serum response factor (c-fos serum response	217	|Involved in dimerization.				angiogenesis involved in wound healing|cell migration involved in sprouting angiogenesis|cellular senescence|heart looping|muscle cell homeostasis|neuron development|positive regulation of cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of smooth muscle cell differentiation|response to cytokine stimulus|response to hormone stimulus|response to toxin|transcription from RNA polymerase II promoter|trophectodermal cell differentiation	endoplasmic reticulum	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			ovary(1)|breast(1)|central_nervous_system(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CTGATTCAGACCTGCCTCAAC	0.557					101											0.47619	85.991898	86.025836	30	33	KEEP	---	---	---	---	18	18	12	29	-1	capture	Missense_Mutation	SNP	43141721	43141721	SRF	6	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	15035	161
DST	667	broad.mit.edu	37	6	56566691	56566691	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56566691G>A	uc003pdf.2	-	7	878	c.850C>T	c.(850-852)CGC>TGC	p.R284C	DST_uc003pcz.3_Missense_Mutation_p.R106C|DST_uc011dxj.1_Missense_Mutation_p.R135C|DST_uc011dxk.1_Missense_Mutation_p.R146C|DST_uc011dxl.1_Missense_Mutation_p.R135C	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	106	CH 1.|Actin-binding.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATACCTGGCGTCTTTTCAAA	0.343					2498											0.295455	37.358604	39.004887	13	31	KEEP	---	---	---	---	12	2	22	14	-1	capture	Missense_Mutation	SNP	56566691	56566691	DST	6	G	A	A	A	1	0	0	0	0	1	0	0	0	508	40	1	1	4738	161
PLG	5340	broad.mit.edu	37	6	161127557	161127557	+	Silent	SNP	C	T	T	rs144100362		TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161127557C>T	uc003qtm.3	+	2	231	c.168C>T	c.(166-168)GAC>GAT	p.D56D		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	56	PAN.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GTGAGGAGGACGAAGAATTCA	0.413																0.72093	195.950577	199.714612	62	24	KEEP	---	---	---	---	29	41	17	12	-1	capture	Silent	SNP	161127557	161127557	PLG	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11989	161
ZNF107	51427	broad.mit.edu	37	7	64168371	64168371	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:64168371G>A	uc003ttd.2	+	7	2475	c.1689G>A	c.(1687-1689)CAG>CAA	p.Q563Q	ZNF107_uc003tte.2_Silent_p.Q563Q	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	563	C2H2-type 18; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TTTTTAACCAGTCCTCAAACC	0.348																0.226891	69.658872	77.809028	27	92	KEEP	---	---	---	---	12	15	55	44	-1	capture	Silent	SNP	64168371	64168371	ZNF107	7	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	17595	161
PCLO	27445	broad.mit.edu	37	7	82581607	82581607	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82581607C>T	uc003uhx.2	-	5	8951	c.8662G>A	c.(8662-8664)GTA>ATA	p.V2888I	PCLO_uc003uhv.2_Missense_Mutation_p.V2888I|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2819					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CCCTGGGATACGGTGCTATCA	0.463																0.273256	255.351895	271.256816	94	250	KEEP	---	---	---	---	47	51	132	131	-1	capture	Missense_Mutation	SNP	82581607	82581607	PCLO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11486	161
COL1A2	1278	broad.mit.edu	37	7	94043012	94043012	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94043012G>T	uc003ung.1	+	27	2039	c.1568G>T	c.(1567-1569)GGT>GTT	p.G523V	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	523					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGTGCTCCAGGTCCTGATGGA	0.438													HNSCC(75;0.22)			0.317073	183.795948	189.89843	65	140	KEEP	---	---	---	---	38	38	84	81	0.5	capture	Missense_Mutation	SNP	94043012	94043012	COL1A2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3643	161
INTS10	55174	broad.mit.edu	37	8	19690804	19690804	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:19690804C>T	uc003wzj.2	+	12	1633	c.1502C>T	c.(1501-1503)ACG>ATG	p.T501M		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	501					snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		CAGCTGGCGACGTGCCACTTT	0.602																0.554054	133.189858	133.379986	41	33	KEEP	---	---	---	---	18	23	16	18	-1	capture	Missense_Mutation	SNP	19690804	19690804	INTS10	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7699	161
ENPP2	5168	broad.mit.edu	37	8	120598445	120598445	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120598445G>A	uc003yot.1	-	15	1434	c.1348C>T	c.(1348-1350)CGC>TGC	p.R450C	ENPP2_uc011lic.1_5'Flank|ENPP2_uc003yor.1_Missense_Mutation_p.R89C|ENPP2_uc003yos.1_Missense_Mutation_p.R502C|ENPP2_uc010mdd.1_Missense_Mutation_p.R450C	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	450					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGCCATCTGCGTTCCACCAAT	0.413	Melanoma(20;305 879 2501 4818 31020)															0.427586	190.621819	191.285856	62	83	KEEP	---	---	---	---	42	26	51	43	-1	capture	Missense_Mutation	SNP	120598445	120598445	ENPP2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5085	161
IFNB1	3456	broad.mit.edu	37	9	21077338	21077338	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21077338G>A	uc003zok.2	-	1	606	c.531C>T	c.(529-531)TTC>TTT	p.F177F		NM_002176	NP_002167	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast precursor	177					activation of caspase activity|B cell proliferation|blood coagulation|cellular response to exogenous dsRNA|defense response to virus|induction of apoptosis|natural killer cell activation|negative regulation of cell proliferation|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of viral genome replication|negative regulation of viral transcription|negative regulation of virion penetration into host cell|positive regulation of innate immune response|positive regulation of transcription from RNA polymerase II promoter|regulation of MHC class I biosynthetic process|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding|transcription corepressor activity			ovary(1)|breast(1)|kidney(1)	3				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)	Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)	GTCTGTTAATGAAGTAAAAGT	0.453					45											0.129032	5.576542	9.732857	4	27	KEEP	---	---	---	---	2	2	23	8	-1	capture	Silent	SNP	21077338	21077338	IFNB1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	7471	161
NHS	4810	broad.mit.edu	37	X	17745612	17745612	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17745612C>T	uc004cxx.2	+	6	3661	c.3323C>T	c.(3322-3324)CCG>CTG	p.P1108L	NHS_uc011mix.1_Missense_Mutation_p.P1129L|NHS_uc004cxy.2_Missense_Mutation_p.P952L|NHS_uc004cxz.2_Missense_Mutation_p.P931L|NHS_uc004cya.2_Missense_Mutation_p.P831L	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1108						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					AATCCTCCACCGTCCCTTGCA	0.408																0.40824	349.338204	351.298653	109	158	KEEP	---	---	---	---	54	60	97	70	-1	capture	Missense_Mutation	SNP	17745612	17745612	NHS	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10318	161
TIMM17B	10245	broad.mit.edu	37	X	48751096	48751096	+	Silent	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48751096G>A	uc004dlc.1	-	7	584	c.435C>T	c.(433-435)CCC>CCT	p.P145P	TIMM17B_uc004dla.1_Silent_p.P195P|TIMM17B_uc004dlb.1_Silent_p.P165P	NM_005834	NP_005825	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17	145					protein targeting to mitochondrion	integral to membrane|microtubule cytoskeleton|mitochondrial inner membrane presequence translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1						CCAGGAATGGGGGCGCTGGAG	0.617																0.416667	30.343693	30.489658	10	14	KEEP	---	---	---	---	5	6	10	6	-1	capture	Silent	SNP	48751096	48751096	TIMM17B	23	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	15794	161
PCDH11X	27328	broad.mit.edu	37	X	91132985	91132985	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91132985C>A	uc004efk.1	+	2	2591	c.1746C>A	c.(1744-1746)AAC>AAA	p.N582K	PCDH11X_uc004efl.1_Missense_Mutation_p.N582K|PCDH11X_uc004efo.1_Missense_Mutation_p.N582K|PCDH11X_uc010nmv.1_Missense_Mutation_p.N582K|PCDH11X_uc004efm.1_Missense_Mutation_p.N582K|PCDH11X_uc004efn.1_Missense_Mutation_p.N582K|PCDH11X_uc004efh.1_Missense_Mutation_p.N582K|PCDH11X_uc004efj.1_Missense_Mutation_p.N582K	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	582	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TCCCAGAAAACCTTCCAAGGC	0.393	NSCLC(38;925 1092 2571 38200 45895)															0.396648	213.49944	215.165903	71	108	KEEP	---	---	---	---	50	37	67	72	0.425287356322	capture	Missense_Mutation	SNP	91132985	91132985	PCDH11X	23	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	11411	161
DOCK11	139818	broad.mit.edu	37	X	117722099	117722099	+	Splice_Site	SNP	G	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117722099G>T	uc004eqp.2	+	17	1859	c.1796_splice	c.e17-1	p.N599_splice	DOCK11_uc004eqq.2_Splice_Site_p.N365_splice	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						CCCTGCTATAGATTGTATTAC	0.318																0.416107	185.218338	186.135326	62	87	KEEP	---	---	---	---	45	23	44	53	0.661764705882	capture	Splice_Site	SNP	117722099	117722099	DOCK11	23	G	T	T	T	1	0	0	0	0	0	0	1	0	429	33	5	4	4642	161
RNF113A	7737	broad.mit.edu	37	X	119004909	119004909	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119004909C>T	uc004esb.2	-	1	883	c.668G>A	c.(667-669)CGT>CAT	p.R223H	NDUFA1_uc004esc.3_5'Flank	NM_006978	NP_008909	O15541	R113A_HUMAN	ring finger protein 113A	223	C3H1-type.						nucleic acid binding|zinc ion binding			breast(2)	2						GTAATCTGAACGGTCATGGAG	0.522																0.436019	275.656314	276.411109	92	119	KEEP	---	---	---	---	52	44	53	69	-1	capture	Missense_Mutation	SNP	119004909	119004909	RNF113A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13319	161
ARHGAP36	158763	broad.mit.edu	37	X	130220576	130220576	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:130220576C>T	uc004evz.2	+	11	1768	c.1423C>T	c.(1423-1425)CCA>TCA	p.P475S	ARHGAP36_uc004ewa.2_Missense_Mutation_p.P463S|ARHGAP36_uc004ewb.2_Missense_Mutation_p.P444S|ARHGAP36_uc004ewc.2_Missense_Mutation_p.P339S	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	475					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						ACTTTCTGATCCAGTGGAAAC	0.478																0.42233	271.197636	272.280367	87	119	KEEP	---	---	---	---	55	44	69	69	-1	capture	Missense_Mutation	SNP	130220576	130220576	ARHGAP36	23	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	876	161
CTAG2	30848	broad.mit.edu	37	X	153881755	153881755	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153881755G>A	uc004fmi.1	-	1	88	c.35C>T	c.(34-36)ACG>ATG	p.T12M	CTAG2_uc004fmh.1_Missense_Mutation_p.T12M	NM_020994	NP_066274	O75638	CTAG2_HUMAN	cancer/testis antigen 2 isoform LAGE-1b	12	Gly-rich.					centrosome				pancreas(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCATCGCCCGTCGAACCCCC	0.706																0.777778	23.430775	24.071953	7	2	KEEP	---	---	---	---	6	4	3	6	-1	capture	Missense_Mutation	SNP	153881755	153881755	CTAG2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3956	161
FLG2	388698	broad.mit.edu	37	1	152324558	152324559	+	Frame_Shift_Del	DEL	TG	-	-	rs140875805	byFrequency	TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152324558_152324559delTG	uc001ezw.3	-	3	5776_5777	c.5703_5704delCA	c.(5701-5706)CACAGCfs	p.H1901fs	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1901_1902							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGCTTGGCTGTGTGTGTGTC	0.515																0.01			11	938		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	152324558	152324559	FLG2	1	TG	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	5868	161
CHD2	1106	broad.mit.edu	37	15	93567832	93567834	+	In_Frame_Del	DEL	CTC	-	-			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:93567832_93567834delCTC	uc002bsp.2	+	39	5959_5961	c.5384_5386delCTC	c.(5383-5388)TCTCCT>TCT	p.P1796del		NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1796					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TCTCAGAAATCTCCTCACGATTC	0.468																0.40			48	72		---	---	---	---						capture_indel	In_Frame_Del	DEL	93567832	93567834	CHD2	15	CTC	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	3291	161
MYH15	22989	broad.mit.edu	37	3	108205332	108205332	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2619-01	TCGA-19-2619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108205332delA	uc003dxa.1	-	11	1030	c.973delT	c.(973-975)TGCfs	p.C325fs		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	325	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CCACAGGAGCAAAAGTGGAAG	0.438																0.46			25	29		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	108205332	108205332	MYH15	3	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	9944	161
