Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DNAJC16	23341	broad.mit.edu	37	1	15873341	15873341	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15873341C>T	uc001aws.2	+	6	959	c.839C>T	c.(838-840)ACG>ATG	p.T280M	DNAJC16_uc001awr.1_Missense_Mutation_p.T280M|DNAJC16_uc001awt.2_Translation_Start_Site	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	280	Cytoplasmic (Potential).				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		TTTGACCAAACGCCCATTGTG	0.308																0.043956	-24.351815	16.175689	8	174	KEEP	---	---	---	---	6	6	91	120	-1	capture	Missense_Mutation	SNP	15873341	15873341	DNAJC16	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4591	181
MACF1	23499	broad.mit.edu	37	1	39907987	39907987	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39907987C>T	uc010oiu.1	+	41	14403	c.14272C>T	c.(14272-14274)CGA>TGA	p.R4758*	MACF1_uc010ois.1_Nonsense_Mutation_p.R4256*	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	6323	Spectrin 12.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATTGCCCACCGACAGGTAAG	0.443																0.392857	134.876832	136.002189	44	68	KEEP	---	---	---	---	20	27	31	40	-1	capture	Nonsense_Mutation	SNP	39907987	39907987	MACF1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	9059	181
KCNQ4	9132	broad.mit.edu	37	1	41284177	41284177	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:41284177A>G	uc001cgh.1	+	4	615	c.533A>G	c.(532-534)GAC>GGC	p.D178G	KCNQ4_uc001cgi.1_Missense_Mutation_p.D178G	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	178	Helical; Name=Segment S3; (Potential).				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			GCCCCTGCAGACTTCATCGTG	0.701																0.383333	71.119516	71.831816	23	37	KEEP	---	---	---	---	10	16	23	21	-1	capture	Missense_Mutation	SNP	41284177	41284177	KCNQ4	1	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	8007	181
MYSM1	114803	broad.mit.edu	37	1	59141202	59141202	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:59141202C>T	uc009wab.1	-	10	1464	c.1441G>A	c.(1441-1443)GAC>AAC	p.D481N	MYSM1_uc001czc.2_RNA	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	481					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					TCTTTTCTGTCTCTGATTCGT	0.408																0.33871	61.653067	63.080621	21	41	KEEP	---	---	---	---	12	14	16	32	-1	capture	Missense_Mutation	SNP	59141202	59141202	MYSM1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	10011	181
GJA5	2702	broad.mit.edu	37	1	147230552	147230552	+	Silent	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147230552G>A	uc001eps.1	-	2	936	c.795C>T	c.(793-795)CCC>CCT	p.P265P	GJA5_uc001ept.1_Silent_p.P265P	NM_181703	NP_859054	P36382	CXA5_HUMAN	connexin 40	265	Cytoplasmic (Potential).				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane				ovary(1)	1	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			GATTAAAGTCGGGGGGTGGTG	0.532																0.370892	248.789807	251.901638	79	134	KEEP	---	---	---	---	39	43	75	67	-1	capture	Silent	SNP	147230552	147230552	GJA5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6341	181
PRPF3	9129	broad.mit.edu	37	1	150318611	150318611	+	Silent	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150318611G>A	uc001eum.3	+	13	1920	c.1758G>A	c.(1756-1758)GGG>GGA	p.G586G	PRPF3_uc009wlp.2_RNA|PRPF3_uc010pca.1_Silent_p.G545G|PRPF3_uc010pcb.1_Silent_p.G537G|PRPF3_uc009wlq.1_RNA	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog	586					nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TAGTGGAAGGGGGTGAGTCTG	0.488	Ovarian(168;1070 2670 5178 20729)															0.335616	441.328661	451.830652	147	291	KEEP	---	---	---	---	73	97	147	185	-1	capture	Silent	SNP	150318611	150318611	PRPF3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	12461	181
FAM5C	339479	broad.mit.edu	37	1	190234152	190234152	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:190234152C>T	uc001gse.1	-	4	693	c.461G>A	c.(460-462)CGG>CAG	p.R154Q	FAM5C_uc010pot.1_Missense_Mutation_p.R52Q	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	154						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					GCTCAACTTCCGCTTGTCCAC	0.388																0.392157	184.168521	185.726003	60	93	KEEP	---	---	---	---	29	36	42	65	-1	capture	Missense_Mutation	SNP	190234152	190234152	FAM5C	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5542	181
LYST	1130	broad.mit.edu	37	1	235922440	235922440	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235922440C>T	uc001hxj.2	-	23	6888	c.6713G>A	c.(6712-6714)CGA>CAA	p.R2238Q	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	2238					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GCTGTGGCTTCGCTGGAAGGA	0.527												Chediak-Higashi_syndrome				0.053435	-13.372194	14.187894	7	124	KEEP	---	---	---	---	4	4	78	71	-1	capture	Missense_Mutation	SNP	235922440	235922440	LYST	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9043	181
HSPA14	51182	broad.mit.edu	37	10	14891809	14891809	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:14891809G>A	uc001inf.2	+	6	607	c.466G>A	c.(466-468)GGA>AGA	p.G156R	HSPA14_uc010qbw.1_Missense_Mutation_p.G156R	NM_016299	NP_057383	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14 isoform 1	156					'de novo' cotranslational protein folding	cytosol	ATP binding|protein binding			ovary(2)|breast(2)|lung(1)	5						AAATGCTCTTGGGTAAGTATA	0.338																0.05	-6.429324	6.462074	3	57	KEEP	---	---	---	---	1	2	33	30	-1	capture	Missense_Mutation	SNP	14891809	14891809	HSPA14	10	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	7332	181
PTEN	5728	broad.mit.edu	37	10	89720650	89720650	+	Splice_Site	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720650G>A	uc001kfb.2	+	9	1833	c.802_splice	c.e9-1	p.D268_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.N212fs*1(2)|p.Y27fs*1(2)|p.M264fs*8(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		tttttttttAGGACAAAATGT	0.239			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.8	82.014863	84.524963	24	6	KEEP	---	---	---	---	13	16	2	6	-1	capture	Splice_Site	SNP	89720650	89720650	PTEN	10	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	12633	181
MUC2	4583	broad.mit.edu	37	11	1084747	1084747	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1084747C>T	uc001lsx.1	+	20	2569	c.2542C>T	c.(2542-2544)CGC>TGC	p.R848C		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	848						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CAAGAGAGGACGCTGGGTGTG	0.602																0.4	10.697092	10.784789	4	6	KEEP	---	---	---	---	3	2	2	4	-1	capture	Missense_Mutation	SNP	1084747	1084747	MUC2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9885	181
NELL1	4745	broad.mit.edu	37	11	21596532	21596532	+	Silent	SNP	T	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:21596532T>C	uc001mqe.2	+	20	2550	c.2397T>C	c.(2395-2397)TGT>TGC	p.C799C	NELL1_uc001mqf.2_Silent_p.C752C|NELL1_uc009yid.2_Silent_p.C827C|NELL1_uc010rdo.1_Silent_p.C742C|NELL1_uc010rdp.1_Silent_p.C512C|NELL1_uc001mqh.2_Silent_p.C344C	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	799	VWFC 5.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						GAAGAGTCTGTTGTTCTGTGG	0.353																0.375	186.220843	188.193776	54	90	KEEP	---	---	---	---	38	26	56	53	-1	capture	Silent	SNP	21596532	21596532	NELL1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	10240	181
OR5D18	219438	broad.mit.edu	37	11	55587476	55587476	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587476T>C	uc010rin.1	+	1	371	c.371T>C	c.(370-372)TTC>TCC	p.F124S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				TATGACCGCTTCGTGGCCATT	0.458																0.414868	603.809502	606.445923	173	244	KEEP	---	---	---	---	100	85	127	129	-1	capture	Missense_Mutation	SNP	55587476	55587476	OR5D18	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11061	181
PANX3	116337	broad.mit.edu	37	11	124489386	124489386	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124489386A>G	uc001qah.2	+	4	734	c.734A>G	c.(733-735)AAG>AGG	p.K245R		NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN	pannexin 3	245	Extracellular (Potential).				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		TGCTCCATCAAGACAGGGCTG	0.488																0.387387	149.401984	150.634905	43	68	KEEP	---	---	---	---	21	24	34	40	-1	capture	Missense_Mutation	SNP	124489386	124489386	PANX3	11	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11326	181
ABCC9	10060	broad.mit.edu	37	12	21995285	21995285	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21995285A>T	uc001rfi.1	-	27	3456	c.3436T>A	c.(3436-3438)TTT>ATT	p.F1146I	ABCC9_uc001rfh.2_Missense_Mutation_p.F1146I|ABCC9_uc001rfj.1_Missense_Mutation_p.F1110I	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1146	Helical; Name=14; (Potential).|ABC transmembrane type-1 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	ATAAAATAAAAGGCAACACCA	0.388																0.655738	127.714273	129.019815	40	21	KEEP	---	---	---	---	15	28	5	20	-1	capture	Missense_Mutation	SNP	21995285	21995285	ABCC9	12	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	59	181
ITPR2	3709	broad.mit.edu	37	12	26808744	26808744	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:26808744C>T	uc001rhg.2	-	20	2903	c.2486G>A	c.(2485-2487)AGG>AAG	p.R829K		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	829	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GGCAAATTTCCTCTTCATATC	0.313					1600											0.089172	7.309235	34.136167	14	143	KEEP	---	---	---	---	6	11	71	88	-1	capture	Missense_Mutation	SNP	26808744	26808744	ITPR2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	7844	181
ADAMTS20	80070	broad.mit.edu	37	12	43771195	43771195	+	Silent	SNP	G	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:43771195G>C	uc010skx.1	-	32	4968	c.4968C>G	c.(4966-4968)GCC>GCG	p.A1656A		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1656	TSP type-1 15.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTTTCCAAGTGGCCAAATGCA	0.403					2149											0.774194	91.117057	93.257229	24	7	KEEP	---	---	---	---	14	10	3	4	-1	capture	Silent	SNP	43771195	43771195	ADAMTS20	12	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	266	181
SUDS3	64426	broad.mit.edu	37	12	118841310	118841310	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118841310A>G	uc001twz.2	+	10	930	c.791A>G	c.(790-792)TAT>TGT	p.Y264C		NM_022491	NP_071936	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3	264					chromatin modification|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	Sin3 complex	histone deacetylase binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAACTGTACTATGACAAAAGA	0.483																0.444444	56.696927	56.793486	16	20	KEEP	---	---	---	---	12	6	13	7	-1	capture	Missense_Mutation	SNP	118841310	118841310	SUDS3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	15257	181
RB1	5925	broad.mit.edu	37	13	48953730	48953730	+	Nonsense_Mutation	SNP	C	T	T	rs3092891		TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48953730C>T	uc001vcb.2	+	14	1499	c.1333C>T	c.(1333-1335)CGA>TGA	p.R445*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	445	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.R445*(2)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTGTTTGTAGCGATACAAACT	0.204			6	p.R445*(639V-Tumor)	568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.742857	85.863863	87.73378	26	9	KEEP	---	---	---	---	23	9	7	5	-1	capture	Nonsense_Mutation	SNP	48953730	48953730	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	12993	181
THBS1	7057	broad.mit.edu	37	15	39874516	39874516	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:39874516G>A	uc001zkh.2	+	3	369	c.190G>A	c.(190-192)GCC>ACC	p.A64T		NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	64	TSP N-terminal.|Heparin-binding.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	CATCGAGGATGCCAACCTGAT	0.612																0.333333	102.847292	105.805727	40	80	KEEP	---	---	---	---	11	34	37	51	-1	capture	Missense_Mutation	SNP	39874516	39874516	THBS1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	15738	181
CDAN1	146059	broad.mit.edu	37	15	43022940	43022940	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43022940C>T	uc001zql.2	-	14	2147	c.2030G>A	c.(2029-2031)CGG>CAG	p.R677Q	CDAN1_uc001zqj.2_RNA|CDAN1_uc001zqk.2_Missense_Mutation_p.G3R	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	677						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CAGCAGAGTCCGCACATCCAG	0.647																0.5	97.853015	97.853015	30	30	KEEP	---	---	---	---	17	17	16	14	-1	capture	Missense_Mutation	SNP	43022940	43022940	CDAN1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3025	181
ZCCHC14	23174	broad.mit.edu	37	16	87448889	87448889	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:87448889G>T	uc002fjz.1	-	9	1084	c.1057C>A	c.(1057-1059)CTG>ATG	p.L353M	ZCCHC14_uc002fka.1_RNA|ZCCHC14_uc002fkb.2_Missense_Mutation_p.L129M	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	353					cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		CACTTTTCCAGCTCCAGCTGG	0.423																0.432161	256.512545	257.312645	86	113	KEEP	---	---	---	---	51	47	54	76	0.520408163265	capture	Missense_Mutation	SNP	87448889	87448889	ZCCHC14	16	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	17463	181
PRPF8	10594	broad.mit.edu	37	17	1577829	1577829	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1577829T>C	uc002fte.2	-	21	3320	c.3206A>G	c.(3205-3207)AAT>AGT	p.N1069S		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1069						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding	p.N1069D(1)		lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GAGAAAGTCATTTGGCATCTG	0.507																0.419753	464.458403	466.275153	136	188	KEEP	---	---	---	---	73	77	104	99	-1	capture	Missense_Mutation	SNP	1577829	1577829	PRPF8	17	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	12471	181
ALDH3A1	218	broad.mit.edu	37	17	19644516	19644516	+	Missense_Mutation	SNP	C	T	T	rs140108064	byFrequency	TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19644516C>T	uc010cqu.2	-	5	1027	c.697G>A	c.(697-699)GCC>ACC	p.A233T	ALDH3A1_uc010vzd.1_Missense_Mutation_p.A233T|ALDH3A1_uc002gwj.2_Missense_Mutation_p.A233T|ALDH3A1_uc010cqv.2_Missense_Mutation_p.A233T|ALDH3A1_uc002gwk.2_Missense_Mutation_p.A350T|ALDH3A1_uc002gwl.1_Missense_Mutation_p.A160T	NM_001135168	NP_001128640	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3A1	233					cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(1)|pancreas(1)	2	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)	NADH(DB00157)	TTCCCCCAGGCGATGCGTCTG	0.537																0.481928	124.797207	124.820674	40	43	KEEP	---	---	---	---	15	34	30	16	-1	capture	Missense_Mutation	SNP	19644516	19644516	ALDH3A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	497	181
SEZ6	124925	broad.mit.edu	37	17	27287691	27287691	+	Splice_Site	SNP	T	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27287691T>A	uc002hdp.2	-	7	1604	c.1410_splice	c.e7-1	p.R470_splice	SEZ6_uc002hdm.2_Splice_Site|SEZ6_uc010cry.1_Splice_Site_p.R470_splice|SEZ6_uc002hdq.1_Splice_Site_p.R345_splice	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1							integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			ATGATGAGCCTGAACCAGGAG	0.592																0.333333	7.218525	7.441672	3	6	KEEP	---	---	---	---	3	0	10	11	-1	capture	Splice_Site	SNP	27287691	27287691	SEZ6	17	T	A	A	A	1	0	0	0	0	0	0	1	0	715	55	5	4	14035	181
KRT9	3857	broad.mit.edu	37	17	39724628	39724628	+	Silent	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39724628G>A	uc002hxe.3	-	6	1246	c.1180C>T	c.(1180-1182)CTG>TTG	p.L394L	JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9	394	Rod.|Coil 2.				intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				CTCTTCTCCAGAGCTGCTTTC	0.532																0.437247	338.665562	339.512884	108	139	KEEP	---	---	---	---	52	58	73	73	-1	capture	Silent	SNP	39724628	39724628	KRT9	17	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	8421	181
C19orf40	91442	broad.mit.edu	37	19	33464993	33464993	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33464993G>A	uc002nud.3	+	4	389	c.271G>A	c.(271-273)GTT>ATT	p.V91I	CCDC123_uc002nty.2_5'Flank|CCDC123_uc010edg.2_5'Flank|CCDC123_uc002ntz.1_5'Flank|CCDC123_uc002nua.2_5'Flank|CCDC123_uc002nuc.1_5'Flank	NM_152266	NP_689479	Q9BTP7	FAP24_HUMAN	Fanconi anemia-associated protein, 24 kDa	91					DNA repair	Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding				0	Esophageal squamous(110;0.137)					AATTGTAGTCGTTGAAAAAAC	0.418											Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks					0.5	221.650276	221.650276	70	70	KEEP	---	---	---	---	43	34	38	36	-1	capture	Missense_Mutation	SNP	33464993	33464993	C19orf40	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1906	181
DMRTC2	63946	broad.mit.edu	37	19	42352997	42352997	+	Silent	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42352997C>T	uc002ors.2	+	5	665	c.582C>T	c.(580-582)TGC>TGT	p.C194C	DMRTC2_uc002orr.1_Silent_p.C71C|DMRTC2_uc010xwe.1_Silent_p.C194C	NM_001040283	NP_001035373	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	194	Pro-rich.				cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						CAGTGGTGTGCCGCCTGCTGT	0.498																0.023585	-46.083945	7.443898	5	207	KEEP	---	---	---	---	3	2	97	153	-1	capture	Silent	SNP	42352997	42352997	DMRTC2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	4549	181
FBXO41	150726	broad.mit.edu	37	2	73493658	73493658	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73493658G>A	uc002sjb.1	-	3	1241	c.1241C>T	c.(1240-1242)ACG>ATG	p.T414M		NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41	353						intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3						GGCGCTGGGCGTGCTGCCACA	0.692																0.307692	10.196051	10.624143	4	9	KEEP	---	---	---	---	4	4	11	7	-1	capture	Missense_Mutation	SNP	73493658	73493658	FBXO41	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5696	181
SCN7A	6332	broad.mit.edu	37	2	167328840	167328840	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167328840C>T	uc002udu.1	-	5	686	c.559G>A	c.(559-561)GTA>ATA	p.V187I	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	187	Helical; Name=S3 of repeat I; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						AACACAGTTACGCTGAAATCG	0.338																0.5	51.77804	51.77804	17	17	KEEP	---	---	---	---	5	15	8	12	-1	capture	Missense_Mutation	SNP	167328840	167328840	SCN7A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13816	181
CD93	22918	broad.mit.edu	37	20	23065459	23065459	+	Silent	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23065459G>A	uc002wsv.2	-	1	1519	c.1371C>T	c.(1369-1371)GGC>GGT	p.G457G		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	457	Extracellular (Potential).|EGF-like 5; calcium-binding (Potential).				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CCAGCACCCAGCCTGGCAGGC	0.632																0.355828	167.599752	170.586224	58	105	KEEP	---	---	---	---	27	42	53	68	-1	capture	Silent	SNP	23065459	23065459	CD93	20	G	A	A	A	1	0	0	0	0	0	0	0	1	431	34	2	2	3018	181
SLCO2A1	6578	broad.mit.edu	37	3	133653573	133653573	+	Missense_Mutation	SNP	G	A	A	rs142805553	byFrequency	TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:133653573G>A	uc003eqa.3	-	14	2190	c.1916C>T	c.(1915-1917)GCG>GTG	p.A639V	SLCO2A1_uc003eqb.3_Missense_Mutation_p.A563V	NM_005630	NP_005621	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family,	639	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding			central_nervous_system(1)	1						GAGGCCTGCCGCCTTCTGCAC	0.567																0.046296	-14.468883	9.206374	5	103	KEEP	---	---	---	---	6	1	58	57	-1	capture	Missense_Mutation	SNP	133653573	133653573	SLCO2A1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14618	181
DNAJC19	131118	broad.mit.edu	37	3	180705861	180705861	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:180705861T>C	uc003fkt.2	-	3	219	c.79A>G	c.(79-81)AAG>GAG	p.K27E	DNAJC19_uc003fku.2_RNA	NM_145261	NP_660304	Q96DA6	TIM14_HUMAN	DnaJ homolog, subfamily C, member 19	27	Mitochondrial matrix (Potential).				genitalia development|protein folding|protein targeting to mitochondrion|transmembrane transport|visual perception	integral to membrane|mitochondrial inner membrane	heat shock protein binding				0	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			TCCATATGCTTCATGGCTTGC	0.388																0.45	295.66419	296.054783	81	99	KEEP	---	---	---	---	42	43	52	65	-1	capture	Missense_Mutation	SNP	180705861	180705861	DNAJC19	3	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	4594	181
LGI2	55203	broad.mit.edu	37	4	25014080	25014080	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25014080C>T	uc003grf.2	-	7	796	c.697G>A	c.(697-699)GTG>ATG	p.V233M		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	233	EAR 1.					extracellular region					0		Breast(46;0.173)				AACGTATCCACTGAAACCGAC	0.453																0.38191	231.253025	233.686731	76	123	KEEP	---	---	---	---	35	44	56	78	-1	capture	Missense_Mutation	SNP	25014080	25014080	LGI2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	8672	181
DCHS2	54798	broad.mit.edu	37	4	155219629	155219629	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155219629G>T	uc003inw.2	-	18	4472	c.4472C>A	c.(4471-4473)GCT>GAT	p.A1491D		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1491	Cadherin 13.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCCCACTTCAGCATCTTCTCT	0.463																0.389439	349.775742	353.022485	118	185	KEEP	---	---	---	---	64	60	98	104	0.516129032258	capture	Missense_Mutation	SNP	155219629	155219629	DCHS2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	4247	181
SLC6A19	340024	broad.mit.edu	37	5	1214110	1214110	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1214110G>A	uc003jbw.3	+	6	873	c.817G>A	c.(817-819)GCA>ACA	p.A273T		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	273	Helical; Name=6; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGACGCGGGCGCACAGGTCTT	0.647																0.510309	301.484617	301.504996	99	95	KEEP	---	---	---	---	55	58	65	51	-1	capture	Missense_Mutation	SNP	1214110	1214110	SLC6A19	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14574	181
SLC6A3	6531	broad.mit.edu	37	5	1403128	1403128	+	Missense_Mutation	SNP	G	A	A	rs28364997	byFrequency	TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1403128G>A	uc003jck.2	-	13	1797	c.1676C>T	c.(1675-1677)GCG>GTG	p.A559V		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	559					cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CCAGCCCAGCGCGTTGGCCCA	0.602																0.414634	98.03322	98.555281	34	48	KEEP	---	---	---	---	16	21	30	22	-1	capture	Missense_Mutation	SNP	1403128	1403128	SLC6A3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14577	181
ADAMTS12	81792	broad.mit.edu	37	5	33576573	33576573	+	Silent	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33576573G>A	uc003jia.1	-	19	3721	c.3558C>T	c.(3556-3558)GAC>GAT	p.D1186D	ADAMTS12_uc010iuq.1_Silent_p.D1101D	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1186	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CCACTGGAGCGTCATTTCCAG	0.498													HNSCC(64;0.19)			0.394558	345.337034	348.197885	116	178	KEEP	---	---	---	---	59	63	87	105	-1	capture	Silent	SNP	33576573	33576573	ADAMTS12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	257	181
HIST1H4G	8369	broad.mit.edu	37	6	26247188	26247188	+	Silent	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26247188C>T	uc003nhf.2	-	1	18	c.18G>A	c.(16-18)AAG>AAA	p.K6K		NM_003547	NP_003538	Q99525	H4G_HUMAN	histone cluster 1, H4g	6					nucleosome assembly	nucleosome|nucleus	DNA binding				0		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				CTTTTCCGGCCTTGCCCCGAA	0.483																0.351648	97.972039	99.738836	32	59	KEEP	---	---	---	---	18	17	21	51	-1	capture	Silent	SNP	26247188	26247188	HIST1H4G	6	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	7096	181
ZFP57	346171	broad.mit.edu	37	6	29641134	29641134	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29641134C>T	uc011dlw.1	-	4	905	c.754G>A	c.(754-756)GTC>ATC	p.V252I	ZFP57_uc003nnl.3_Missense_Mutation_p.V232I	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	168	C2H2-type 3.				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CCCAGATGGACGCGGCGGTGA	0.557																0.052381	-21.942019	22.524882	11	199	KEEP	---	---	---	---	9	4	85	132	-1	capture	Missense_Mutation	SNP	29641134	29641134	ZFP57	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17531	181
TJAP1	93643	broad.mit.edu	37	6	43470020	43470020	+	Splice_Site	SNP	G	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43470020G>T	uc003ovd.2	+	7	667	c.291_splice	c.e7-1	p.R97_splice	TJAP1_uc003ovf.2_Splice_Site_p.R97_splice|TJAP1_uc003ove.2_Splice_Site_p.R97_splice|TJAP1_uc003ovc.2_Splice_Site_p.R97_splice|TJAP1_uc010jyp.2_Splice_Site_p.R56_splice|TJAP1_uc011dvh.1_Splice_Site_p.R97_splice|TJAP1_uc003ovg.2_Splice_Site|TJAP1_uc010jyq.2_Splice_Site_p.R97_splice|TJAP1_uc011dvi.1_Splice_Site_p.R97_splice|TJAP1_uc011dvj.1_Splice_Site|TJAP1_uc003ovi.2_Translation_Start_Site	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a							Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			TCCCTTTTCAGGCTGCAGAAC	0.363																0.045455	-12.986712	6.520834	4	84	KEEP	---	---	---	---	1	4	41	53	0.2	capture	Splice_Site	SNP	43470020	43470020	TJAP1	6	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	15813	181
HEY2	23493	broad.mit.edu	37	6	126080793	126080793	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:126080793C>T	uc003qad.2	+	5	1050	c.859C>T	c.(859-861)CCC>TCC	p.P287S	HEY2_uc011ebr.1_Missense_Mutation_p.P241S	NM_012259	NP_036391	Q9UBP5	HEY2_HUMAN	hairy/enhancer-of-split related with YRPW motif	287	Ala-rich.				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		GGGGGCATTCCCCATGCTTCC	0.667																0.352239	334.613582	341.07948	118	217	KEEP	---	---	---	---	60	75	113	127	-1	capture	Missense_Mutation	SNP	126080793	126080793	HEY2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7004	181
HOXA6	3203	broad.mit.edu	37	7	27185435	27185435	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:27185435G>A	uc003syo.1	-	2	544	c.544C>T	c.(544-546)CGG>TGG	p.R182W	HOXA5_uc003syn.1_5'Flank|uc003syp.1_5'Flank	NM_024014	NP_076919	P31267	HXA6_HUMAN	homeobox A6	182	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CGGCGGCGCCGTGTCAGGTAG	0.602																0.322967	344.987795	356.61688	135	283	KEEP	---	---	---	---	82	69	156	174	-1	capture	Missense_Mutation	SNP	27185435	27185435	HOXA6	7	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	7221	181
CCDC132	55610	broad.mit.edu	37	7	92985271	92985271	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92985271T>C	uc003umo.2	+	27	2782	c.2654T>C	c.(2653-2655)TTA>TCA	p.L885S	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.L855S|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.L605S	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	885											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CAACAGTTTTTAATGAAACTT	0.303																0.288732	134.194269	139.893566	41	101	KEEP	---	---	---	---	19	25	56	62	-1	capture	Missense_Mutation	SNP	92985271	92985271	CCDC132	7	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	2741	181
PEG10	23089	broad.mit.edu	37	7	94293142	94293142	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94293142A>G	uc011kie.1	+	2	719	c.502A>G	c.(502-504)ATG>GTG	p.M168V		NM_001040152	NP_001035242	Q86TG7	PEG10_HUMAN	paternally expressed 10 isoform RF1	92	Necessary for interaction with ALK1.				apoptosis|cell differentiation|negative regulation of transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CAACCCAGACATGCTGGCTCC	0.562																0.030612	-17.16105	6.510016	3	95	KEEP	---	---	---	---	3	1	42	54	-1	capture	Missense_Mutation	SNP	94293142	94293142	PEG10	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11622	181
OR2AE1	81392	broad.mit.edu	37	7	99474406	99474406	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99474406T>C	uc003usc.1	-	1	251	c.251A>G	c.(250-252)AAC>AGC	p.N84S		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	84	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					AGATAGGTAGTTGGTAGCCAT	0.468																0.282178	181.277442	189.897811	57	145	KEEP	---	---	---	---	30	37	86	77	-1	capture	Missense_Mutation	SNP	99474406	99474406	OR2AE1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	10887	181
KRBA1	84626	broad.mit.edu	37	7	149431067	149431067	+	Silent	SNP	A	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149431067A>T	uc003wfz.2	+	18	3423	c.3024A>T	c.(3022-3024)GGA>GGT	p.G1008G	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_Silent_p.G615G	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	1008										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGCTGGGAGGAGTGCAGAGGG	0.647																0.3125	21.932368	22.937566	10	22	KEEP	---	---	---	---	6	5	10	16	-1	capture	Silent	SNP	149431067	149431067	KRBA1	7	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	8359	181
ANK1	286	broad.mit.edu	37	8	41519452	41519452	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41519452C>T	uc003xok.2	-	41	5570	c.5486G>A	c.(5485-5487)CGC>CAC	p.R1829H	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.R983H|ANK1_uc003xoi.2_Missense_Mutation_p.R1829H|ANK1_uc003xoj.2_Missense_Mutation_p.R1829H|ANK1_uc003xol.2_Missense_Mutation_p.R1667H|ANK1_uc003xom.2_Missense_Mutation_p.R1870H|ANK1_uc011lcl.1_Missense_Mutation_p.R104H|ANK1_uc003xod.2_Missense_Mutation_p.R104H|ANK1_uc003xoc.2_Missense_Mutation_p.R104H|ANK1_uc003xof.2_Intron|MIR486_hsa-mir-486|MI0002470_5'Flank	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1829	55 kDa regulatory domain.			R->G: Abolishes interaction with OBSCN (in isoform Mu17).	axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AACCACCTTGCGAATGATCTA	0.423																0.361345	126.807881	128.814835	43	76	KEEP	---	---	---	---	20	29	44	45	-1	capture	Missense_Mutation	SNP	41519452	41519452	ANK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	617	181
SLC28A3	64078	broad.mit.edu	37	9	86917142	86917142	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86917142A>G	uc010mpz.2	-	5	622	c.497T>C	c.(496-498)CTA>CCA	p.L166P	SLC28A3_uc011lsy.1_Missense_Mutation_p.L97P|SLC28A3_uc004anu.1_Missense_Mutation_p.L166P|SLC28A3_uc010mqb.2_Missense_Mutation_p.L97P	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter	166	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						ATGGCTGTTTAGAAGCCTTCT	0.433	Ovarian(106;425 1539 34835 42413 43572)															0.42487	284.792722	285.746626	82	111	KEEP	---	---	---	---	44	45	75	55	-1	capture	Missense_Mutation	SNP	86917142	86917142	SLC28A3	9	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	14425	181
NAA35	60560	broad.mit.edu	37	9	88627995	88627995	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:88627995A>T	uc004aoi.3	+	16	1462	c.1325A>T	c.(1324-1326)AAC>ATC	p.N442I	NAA35_uc004aoj.3_Missense_Mutation_p.N442I	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein	442					smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						CATGGACATAACAGGGCTCGA	0.378																0.290323	73.089697	76.752006	27	66	KEEP	---	---	---	---	18	14	41	38	-1	capture	Missense_Mutation	SNP	88627995	88627995	NAA35	9	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	10033	181
SUSD3	203328	broad.mit.edu	37	9	95841846	95841846	+	Silent	SNP	C	T	T	rs146086851	byFrequency;by1000genomes	TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95841846C>T	uc004atb.2	+	4	555	c.519C>T	c.(517-519)AGC>AGT	p.S173S	SUSD3_uc004atc.2_Silent_p.S160S	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3	173	Cytoplasmic (Potential).					integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6						AACCCGTGAGCGGGCCCAGCC	0.642																0.409091	99.867525	100.505974	36	52	KEEP	---	---	---	---	19	22	22	33	-1	capture	Silent	SNP	95841846	95841846	SUSD3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	15297	181
DCAF8L1	139425	broad.mit.edu	37	X	27998785	27998785	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27998785A>G	uc004dbx.1	-	1	782	c.667T>C	c.(667-669)TGG>CGG	p.W223R		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	223	WD 1.									ovary(3)|skin(1)	4						ACCCAGTCCCACACTATCACC	0.498																0.807692	75.690581	77.991554	21	5	KEEP	---	---	---	---	15	13	1	4	-1	capture	Missense_Mutation	SNP	27998785	27998785	DCAF8L1	23	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	4236	181
MED12	9968	broad.mit.edu	37	X	70341430	70341430	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70341430C>T	uc004dyy.2	+	7	1064	c.865C>T	c.(865-867)CAG>TAG	p.Q289*	MED12_uc011mpq.1_Nonsense_Mutation_p.Q289*|MED12_uc004dyz.2_Nonsense_Mutation_p.Q289*|MED12_uc004dza.2_Nonsense_Mutation_p.Q136*	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	289					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GGAATTTGTTCAGTCTGCATA	0.502																0.234043	25.897379	28.942744	11	36	KEEP	---	---	---	---	10	3	20	21	-1	capture	Nonsense_Mutation	SNP	70341430	70341430	MED12	23	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	9341	181
MAGEA6	4105	broad.mit.edu	37	X	151870122	151870122	+	Missense_Mutation	SNP	T	A	A			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151870122T>A	uc004ffq.1	+	3	1006	c.812T>A	c.(811-813)TTC>TAC	p.F271Y	MAGEA6_uc004ffr.1_Missense_Mutation_p.F271Y|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	271	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					TGCTATGAGTTCCTGTGGGGT	0.532																0.144628	50.065371	79.483901	35	207	KEEP	---	---	---	---	16	19	99	117	-1	capture	Missense_Mutation	SNP	151870122	151870122	MAGEA6	23	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	9084	181
TOP1	7150	broad.mit.edu	37	20	39704846	39704848	+	In_Frame_Del	DEL	AGG	-	-			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39704846_39704848delAGG	uc002xjl.2	+	4	437_439	c.191_193delAGG	c.(190-195)AAGGAG>AAG	p.E65del	TOP1_uc010gge.1_RNA	NM_003286	NP_003277	P11387	TOP1_HUMAN	DNA topoisomerase I	65	Lys-rich.				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)	cacaaagagaaggagaagaccaa	0.207					252	T	NUP98	AML*								0.39			56	88		---	---	---	---						capture_indel	In_Frame_Del	DEL	39704846	39704848	TOP1	20	AGG	-	-	-	1	0	1	0	1	0	0	0	0	39	3	5	5	16246	181
DCLK3	85443	broad.mit.edu	37	3	36779849	36779850	+	Frame_Shift_Ins	INS	-	C	C			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:36779849_36779850insC	uc003cgi.2	-	2	792_793	c.301_302insG	c.(301-303)GAGfs	p.E101fs		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	101						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						GGGTTCTGGCTCCCATTTCCCC	0.589					128											0.02			7	432		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	36779849	36779850	DCLK3	3	-	C	C	C	1	0	1	1	0	0	0	0	0	702	54	5	5	4252	181
HDAC2	3066	broad.mit.edu	37	6	114264560	114264563	+	Frame_Shift_Del	DEL	CTTT	-	-			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:114264560_114264563delCTTT	uc003pwd.1	-	12	1612_1615	c.1612_1615delAAAG	c.(1612-1617)AAAGCTfs	p.K538fs	HDAC2_uc003pwc.1_Frame_Shift_Del_p.K414fs|HDAC2_uc003pwe.1_Frame_Shift_Del_p.K414fs	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2	444_445					blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	tcaattctagctttctttgctcct	0.260					302											0.41			74	106		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	114264560	114264563	HDAC2	6	CTTT	-	-	-	1	0	1	0	1	0	0	0	0	364	28	5	5	6934	181
DDX31	64794	broad.mit.edu	37	9	135470499	135470500	+	Splice_Site	DEL	CC	-	-			TCGA-26-5132-01	TCGA-26-5132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135470499_135470500delCC	uc004cbq.1	-	20	2462	c.2310_splice	c.e20-1	p.R770_splice	DDX31_uc010mzu.1_Splice_Site_p.R697_splice	NM_022779	NP_073616	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GAAGGTCAGGCCTGAAGAACAG	0.460																0.39			100	155		---	---	---	---						capture_indel	Splice_Site	DEL	135470499	135470500	DDX31	9	CC	-	-	-	1	0	1	0	1	0	0	1	0	337	26	5	5	4314	181
