Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF11	440560	broad.mit.edu	37	1	12885059	12885059	+	Missense_Mutation	SNP	C	G	G	rs143004725	by1000genomes	TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12885059C>G	uc001auk.2	-	4	1248	c.1052G>C	c.(1051-1053)TGC>TCC	p.C351S		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	351	LRR 6.										0						GGTGGCCATGCAGATGGGATT	0.532																0.018293	-36.3308	6.530436	3	161	KEEP	---	---	---	---	5	0	168	184	-1	capture	Missense_Mutation	SNP	12885059	12885059	PRAMEF11	1	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	12328	184
HCRTR1	3061	broad.mit.edu	37	1	32084853	32084853	+	Silent	SNP	G	A	A	rs142288232		TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32084853G>A	uc009vtx.2	+	3	445	c.60G>A	c.(58-60)CCG>CCA	p.P20P	HCRTR1_uc001btb.2_Intron|HCRTR1_uc001btc.3_5'UTR|HCRTR1_uc001btd.2_Silent_p.P20P|HCRTR1_uc010ogl.1_Silent_p.P20P	NM_001525	NP_001516	O43613	OX1R_HUMAN	orexin receptor 1	20	Extracellular (Potential).				feeding behavior|neuropeptide signaling pathway|synaptic transmission	integral to plasma membrane				ovary(1)	1		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		GCAGAGAGCCGTCCCCTGTGC	0.607																0.370536	232.783167	236.075049	83	141	KEEP	---	---	---	---	46	41	76	74	-1	capture	Silent	SNP	32084853	32084853	HCRTR1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	6928	184
MSH4	4438	broad.mit.edu	37	1	76269590	76269590	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:76269590G>A	uc001dhd.1	+	2	460	c.419G>A	c.(418-420)GGA>GAA	p.G140E		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	140					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						CCACAAGTGGGATATTCAGGT	0.313											MMR					0.432039	269.133648	269.965186	89	117	KEEP	---	---	---	---	49	47	57	70	-1	capture	Missense_Mutation	SNP	76269590	76269590	MSH4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	9782	184
KCNA10	3744	broad.mit.edu	37	1	111061339	111061339	+	Missense_Mutation	SNP	T	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111061339T>A	uc001dzt.1	-	1	459	c.71A>T	c.(70-72)GAA>GTA	p.E24V		NM_005549	NP_005540	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related	24						voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity			ovary(3)|large_intestine(1)	4		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)		GCCTGGCTCTTCTTGGATTTC	0.522																0.405797	76.883226	77.419146	28	41	KEEP	---	---	---	---	15	14	24	22	-1	capture	Missense_Mutation	SNP	111061339	111061339	KCNA10	1	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	7924	184
TRIM33	51592	broad.mit.edu	37	1	114969900	114969900	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114969900C>T	uc001eew.2	-	8	1403	c.1319G>A	c.(1318-1320)CGT>CAT	p.R440H	TRIM33_uc010owr.1_Missense_Mutation_p.R48H|TRIM33_uc010ows.1_Missense_Mutation_p.R48H|TRIM33_uc001eex.2_Missense_Mutation_p.R440H	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform	440					negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAAAATATGACGCAACTGGAA	0.353					377	T	RET	papillary thyroid								0.393035	230.479206	232.493292	79	122	KEEP	---	---	---	---	48	41	69	67	-1	capture	Missense_Mutation	SNP	114969900	114969900	TRIM33	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16390	184
CRTC2	200186	broad.mit.edu	37	1	153927550	153927550	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153927550G>A	uc010ped.1	-	2	316	c.246C>T	c.(244-246)GCC>GCT	p.A82A	CRTC2_uc001fde.3_5'Flank|CRTC2_uc001fdf.3_5'Flank	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	82					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCTGGAACTCGGCCAGGCCAG	0.547																0.310345	72.588129	75.378705	27	60	KEEP	---	---	---	---	20	8	29	40	-1	capture	Silent	SNP	153927550	153927550	CRTC2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3865	184
GON4L	54856	broad.mit.edu	37	1	155791284	155791284	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155791284G>A	uc001flz.2	-	5	1041	c.944C>T	c.(943-945)ACG>ATG	p.T315M	GON4L_uc001fly.1_Missense_Mutation_p.T315M|GON4L_uc009wrh.1_Missense_Mutation_p.T315M|GON4L_uc001fma.1_Missense_Mutation_p.T315M|GON4L_uc001fmc.2_Missense_Mutation_p.T315M|GON4L_uc001fmd.3_Missense_Mutation_p.T315M|GON4L_uc009wri.2_Translation_Start_Site|GON4L_uc001fme.2_Missense_Mutation_p.T143M|GON4L_uc001fmf.2_Missense_Mutation_p.T9M	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	315					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CATATCTTCCGTCTCACTGAT	0.398																0.342857	168.744592	172.563445	60	115	KEEP	---	---	---	---	32	37	78	58	-1	capture	Missense_Mutation	SNP	155791284	155791284	GON4L	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6506	184
SPTA1	6708	broad.mit.edu	37	1	158609712	158609712	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158609712C>T	uc001fst.1	-	34	5022	c.4823G>A	c.(4822-4824)CGT>CAT	p.R1608H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1608	Spectrin 16.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CCTCTGTTGACGACTGGCCTC	0.463																0.405512	297.986535	299.964725	103	151	KEEP	---	---	---	---	49	56	81	76	-1	capture	Missense_Mutation	SNP	158609712	158609712	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15008	184
DUSP27	92235	broad.mit.edu	37	1	167096396	167096396	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167096396G>A	uc001geb.1	+	5	2028	c.2028G>A	c.(2026-2028)ACG>ACA	p.T676T		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	676					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						GGGACACGACGTCAGTACTGA	0.637																0.359375	64.109362	65.22275	23	41	KEEP	---	---	---	---	11	13	20	22	-1	capture	Silent	SNP	167096396	167096396	DUSP27	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4779	184
C4BPB	725	broad.mit.edu	37	1	207263727	207263727	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207263727G>T	uc001hfj.2	+	3	263	c.133G>T	c.(133-135)GGG>TGG	p.G45W	C4BPB_uc001hfi.2_Missense_Mutation_p.G44W|C4BPB_uc001hfk.2_Missense_Mutation_p.G44W|C4BPB_uc001hfl.2_Missense_Mutation_p.G45W|C4BPB_uc009xcd.2_Missense_Mutation_p.G35W|C4BPB_uc001hfm.2_Missense_Mutation_p.G45W|C4BPB_uc010pse.1_Missense_Mutation_p.G35W	NM_001017365	NP_001017365	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta	45	Sushi 1.				blood coagulation|complement activation, classical pathway|innate immune response	extracellular region				ovary(1)	1						ACAGATTCTGGGGACTTACGT	0.473																0.034014	-27.762549	7.03869	5	142	KEEP	---	---	---	---	2	3	61	87	0.4	capture	Missense_Mutation	SNP	207263727	207263727	C4BPB	1	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	2228	184
OR2L13	284521	broad.mit.edu	37	1	248263039	248263039	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248263039G>A	uc001ids.2	+	3	699	c.362G>A	c.(361-363)CGT>CAT	p.R121H		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GCCTACGACCGTTATTTGGCC	0.498				p.R121H(DND41-Tumor)	85											0.364362	374.068394	380.153849	137	239	KEEP	---	---	---	---	71	77	122	131	-1	capture	Missense_Mutation	SNP	248263039	248263039	OR2L13	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10910	184
SVIL	6840	broad.mit.edu	37	10	29751331	29751331	+	Splice_Site	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:29751331C>T	uc001iut.1	-	36	7031	c.6278_splice	c.e36-1	p.G2093_splice	LOC387647_uc001iuo.1_Intron|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Splice_Site_p.G1007_splice|SVIL_uc001iuu.1_Splice_Site_p.G1667_splice	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				AGATTTTTTCCTGTAGTTACA	0.468																0.6	169.715124	170.414194	48	32	KEEP	---	---	---	---	30	21	20	16	-1	capture	Splice_Site	SNP	29751331	29751331	SVIL	10	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	15309	184
MUC5B	727897	broad.mit.edu	37	11	1250506	1250506	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1250506C>T	uc009ycr.1	+	25	3177	c.3051C>T	c.(3049-3051)GAC>GAT	p.D1017D	MUC5B_uc009yct.1_Silent_p.D361D|MUC5B_uc001ltb.2_Silent_p.D361D|MUC5B_uc001lta.2_Silent_p.D29D	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	361	TIL 1.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACTGTGTGGACGGCTGCTTCT	0.682																0.375	8.522893	8.632678	3	5	KEEP	---	---	---	---	4	0	5	3	-1	capture	Silent	SNP	1250506	1250506	MUC5B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9889	184
GAPDH	2597	broad.mit.edu	37	12	6647098	6647098	+	Missense_Mutation	SNP	T	G	G			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6647098T>G	uc001qop.1	+	8	976	c.874T>G	c.(874-876)TCC>GCC	p.S292A	GAPDH_uc009zep.1_Missense_Mutation_p.S250A|GAPDH_uc001qoq.1_Missense_Mutation_p.S217A|GAPDH_uc001qor.1_Missense_Mutation_p.S251A|GAPDH_uc001qos.1_Missense_Mutation_p.S292A|GAPDH_uc001qot.1_Missense_Mutation_p.S292A|GAPDH_uc001qou.1_Missense_Mutation_p.S251A|GAPDH_uc001qov.1_Missense_Mutation_p.S250A|GAPDH_uc001qow.1_Missense_Mutation_p.S245A|GAPDH_uc001qox.1_Missense_Mutation_p.S118A	NM_002046	NP_002037	P04406	G3P_HUMAN	glyceraldehyde-3-phosphate dehydrogenase	292					gluconeogenesis|glycolysis|neuron apoptosis|peptidyl-cysteine S-trans-nitrosylation|protein stabilization	cytosol|membrane|nucleus|perinuclear region of cytoplasm	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|peptidyl-cysteine S-nitrosylase activity|protein binding				0					NADH(DB00157)	CGACACCCACTCCTCCACCTT	0.582														OREG0021628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.350877	121.684926	123.912544	40	74	KEEP	---	---	---	---	15	30	48	36	-1	capture	Missense_Mutation	SNP	6647098	6647098	GAPDH	12	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	6176	184
ATF7IP	55729	broad.mit.edu	37	12	14650695	14650695	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14650695G>A	uc001rbw.2	+	15	3659	c.3501G>A	c.(3499-3501)AAG>AAA	p.K1167K	ATF7IP_uc001rbx.2_Silent_p.K1166K|ATF7IP_uc001rby.3_Silent_p.K1167K|ATF7IP_uc001rca.2_Silent_p.K1167K	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	1167	Interaction with MBD1.|Fibronectin type-III.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						CACACTTGAAGTTAGCACGCG	0.547																0.348315	93.197211	95.004958	31	58	KEEP	---	---	---	---	16	29	34	39	-1	capture	Silent	SNP	14650695	14650695	ATF7IP	12	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	1078	184
PDE3A	5139	broad.mit.edu	37	12	20769164	20769164	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:20769164C>T	uc001reh.1	+	4	1292	c.1270C>T	c.(1270-1272)CGC>TGC	p.R424C		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	424					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TCTTTCCTAGCGCCTGAGAAG	0.428																0.365079	125.416235	127.433378	46	80	KEEP	---	---	---	---	29	25	46	44	-1	capture	Missense_Mutation	SNP	20769164	20769164	PDE3A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11540	184
SOAT2	8435	broad.mit.edu	37	12	53512677	53512677	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53512677G>A	uc001sbv.2	+	9	955	c.867G>A	c.(865-867)ACG>ACA	p.T289T	SOAT2_uc009zms.2_Intron	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2	289					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						GCTGCAGGACGCCCTATGTCA	0.532																0.380952	113.075061	114.380074	40	65	KEEP	---	---	---	---	26	20	44	33	-1	capture	Silent	SNP	53512677	53512677	SOAT2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14803	184
CYP27B1	1594	broad.mit.edu	37	12	58158993	58158993	+	Silent	SNP	G	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58158993G>T	uc001spz.1	-	4	743	c.591C>A	c.(589-591)GGC>GGA	p.G197G	CYP27B1_uc001sqa.1_5'UTR|CYP27B1_uc001sqb.1_Missense_Mutation_p.H78N|CYP27B1_uc001sqc.1_Missense_Mutation_p.H78N	NM_000785	NP_000776	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B,	197					bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding			central_nervous_system(3)	3	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Calcidiol(DB00146)|Calcitriol(DB00136)|Ergocalciferol(DB00153)	CCGCGGCGATGCCTTGTCGGG	0.687					101									OREG0021953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.020734	-150.990141	10.262108	13	614	KEEP	---	---	---	---	10	9	308	386	0.526315789474	capture	Silent	SNP	58158993	58158993	CYP27B1	12	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	4119	184
EFNB2	1948	broad.mit.edu	37	13	107187289	107187289	+	Silent	SNP	C	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:107187289C>A	uc001vqi.2	-	1	49	c.24G>T	c.(22-24)GTG>GTT	p.V8V		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	8					cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AGTACTTCCACACGGAGTCCC	0.542																0.393258	108.904296	109.7926	35	54	KEEP	---	---	---	---	20	16	33	26	0.444444444444	capture	Silent	SNP	107187289	107187289	EFNB2	13	C	A	A	A	1	0	0	0	0	0	0	0	1	210	17	4	4	4911	184
CTSG	1511	broad.mit.edu	37	14	25043934	25043934	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25043934G>T	uc001wpq.2	-	3	323	c.286C>A	c.(286-288)CGC>AGC	p.R96S		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	96	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		TGAGGGTGGCGGATGGCTCTG	0.532																0.423729	227.695617	228.59382	75	102	KEEP	---	---	---	---	43	34	55	54	0.558441558442	capture	Missense_Mutation	SNP	25043934	25043934	CTSG	14	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	3996	184
LRFN5	145581	broad.mit.edu	37	14	42356801	42356801	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42356801G>T	uc001wvm.2	+	3	2171	c.973G>T	c.(973-975)GGG>TGG	p.G325W	LRFN5_uc010ana.2_Missense_Mutation_p.G325W	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	325	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TTCTCCTGAAGGGAAGCTTAT	0.453													HNSCC(30;0.082)			0.388393	247.761424	250.210206	87	137	KEEP	---	---	---	---	41	52	65	81	0.440860215054	capture	Missense_Mutation	SNP	42356801	42356801	LRFN5	14	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	8857	184
FOXN3	1112	broad.mit.edu	37	14	89647054	89647054	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:89647054G>A	uc001xxo.3	-	6	1045	c.908C>T	c.(907-909)GCG>GTG	p.A303V	FOXN3_uc001xxn.3_Missense_Mutation_p.A281V|FOXN3_uc010atk.2_Missense_Mutation_p.A281V	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1	303					DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						CCTCATGGCCGCTGTCACCCC	0.637																0.46875	45.222515	45.249672	15	17	KEEP	---	---	---	---	8	13	10	14	-1	capture	Missense_Mutation	SNP	89647054	89647054	FOXN3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5965	184
BAHD1	22893	broad.mit.edu	37	15	40758215	40758215	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40758215C>T	uc001zlu.2	+	7	2300	c.2229C>T	c.(2227-2229)GAC>GAT	p.D743D	BAHD1_uc001zlt.2_Silent_p.D742D|BAHD1_uc010bbp.1_Silent_p.D739D|BAHD1_uc001zlv.2_Silent_p.D740D	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	743	BAH.				heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CCTCTGCAGACTATTCCACCC	0.602																0.46789	476.445392	476.739078	153	174	KEEP	---	---	---	---	74	88	87	100	-1	capture	Silent	SNP	40758215	40758215	BAHD1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	1286	184
TARSL2	123283	broad.mit.edu	37	15	102242566	102242566	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:102242566C>T	uc002bxm.2	-	9	1152	c.1097G>A	c.(1096-1098)GGC>GAC	p.G366D	TARSL2_uc002bxl.2_5'UTR|TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	366					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTCCGGATTGCCCTCCCAATA	0.353																0.02381	-44.35672	8.542269	5	205	KEEP	---	---	---	---	2	3	113	105	-1	capture	Missense_Mutation	SNP	102242566	102242566	TARSL2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15449	184
IL32	9235	broad.mit.edu	37	16	3119233	3119233	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3119233C>T	uc002cto.2	+	6	793	c.582C>T	c.(580-582)TTC>TTT	p.F194F	IL32_uc002ctk.2_Intron|IL32_uc010uwp.1_Silent_p.F128F|IL32_uc010btb.2_Silent_p.F138F|IL32_uc002ctl.2_Silent_p.F148F|IL32_uc002ctm.2_Silent_p.F148F|IL32_uc002ctn.2_Silent_p.F148F|IL32_uc002cts.3_Silent_p.F148F|IL32_uc002ctp.2_Silent_p.F128F|IL32_uc002ctq.2_Silent_p.F194F|IL32_uc002ctr.2_Silent_p.F128F|IL32_uc002ctt.2_Silent_p.F148F|IL32_uc010uwr.1_Silent_p.F108F|IL32_uc002ctu.2_Silent_p.F139F	NM_004221	NP_004212	P24001	IL32_HUMAN	interleukin 32 isoform B	194					cell adhesion|defense response|immune response	extracellular space	cytokine activity			pancreas(1)	1						GGAAACAGTTCCAGAGTTTCT	0.612																0.360577	213.560261	217.122574	75	133	KEEP	---	---	---	---	37	46	68	80	-1	capture	Silent	SNP	3119233	3119233	IL32	16	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	7615	184
ITGAM	3684	broad.mit.edu	37	16	31309135	31309135	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31309135G>T	uc002ebq.2	+	14	1665	c.1567G>T	c.(1567-1569)GCC>TCC	p.A523S	ITGAM_uc002ebr.2_Missense_Mutation_p.A524S|ITGAM_uc010cam.1_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	523	FG-GAP 6.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CTTTGGGGCAGCCCTAACAGT	0.607																0.028777	-27.018904	6.94411	4	135	KEEP	---	---	---	---	0	4	76	78	-1	capture	Missense_Mutation	SNP	31309135	31309135	ITGAM	16	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	7810	184
CHST5	23563	broad.mit.edu	37	16	75564025	75564025	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75564025G>A	uc002fei.2	-	3	1653	c.258C>T	c.(256-258)CCC>CCT	p.P86P	CHST5_uc002fej.1_Silent_p.P92P	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	86	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						AGAAGACGTCGGGGTGCTGGC	0.677																0.457143	101.595763	101.707214	32	38	KEEP	---	---	---	---	20	14	25	15	-1	capture	Silent	SNP	75564025	75564025	CHST5	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3372	184
SUPT6H	6830	broad.mit.edu	37	17	27010834	27010834	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27010834G>A	uc002hby.2	+	17	2319	c.2229G>A	c.(2227-2229)AAG>AAA	p.K743K	SUPT6H_uc010crt.2_Silent_p.K743K	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	743					chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					ATGTCATAAAGGTGAGGACAG	0.294																0.461538	57.145671	57.195978	18	21	KEEP	---	---	---	---	11	7	12	9	-1	capture	Silent	SNP	27010834	27010834	SUPT6H	17	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	15288	184
DSG4	147409	broad.mit.edu	37	18	28968937	28968937	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28968937C>T	uc002kwq.2	+	5	608	c.473C>T	c.(472-474)TCG>TTG	p.S158L	DSG4_uc002kwr.2_Missense_Mutation_p.S158L	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	158	Cadherin 2.|Extracellular (Potential).		Missing (in LAH1).		homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CCAGTCTTTTCGCAAAGTGTA	0.413																0.42623	304.0808	305.233256	104	140	KEEP	---	---	---	---	60	53	65	90	-1	capture	Missense_Mutation	SNP	28968937	28968937	DSG4	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4734	184
ZNF57	126295	broad.mit.edu	37	19	2918067	2918067	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2918067A>G	uc002lwr.2	+	4	1596	c.1448A>G	c.(1447-1449)AAA>AGA	p.K483R	ZNF57_uc010xha.1_Missense_Mutation_p.K451R	NM_173480	NP_775751	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	483	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		CAATGTGGAAAAACCTTCACT	0.448	NSCLC(150;910 1964 4303 10464 26498)															0.442424	268.065654	268.54029	73	92	KEEP	---	---	---	---	38	39	40	58	-1	capture	Missense_Mutation	SNP	2918067	2918067	ZNF57	19	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	17880	184
MUC16	94025	broad.mit.edu	37	19	9062081	9062081	+	Silent	SNP	G	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9062081G>C	uc002mkp.2	-	3	25569	c.25365C>G	c.(25363-25365)TCC>TCG	p.S8455S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8457	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCCCCTAGAGGATATCACTT	0.522																0.346801	298.222838	304.382004	103	194	KEEP	---	---	---	---	49	59	101	103	-1	capture	Silent	SNP	9062081	9062081	MUC16	19	G	C	C	C	1	0	0	0	0	0	0	0	1	444	35	4	4	9883	184
FBXL12	54850	broad.mit.edu	37	19	9921682	9921682	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9921682C>T	uc002mme.2	-	3	1113	c.871G>A	c.(871-873)GGG>AGG	p.G291R	FBXL12_uc002mmd.2_Missense_Mutation_p.G238R|FBXL12_uc002mmf.2_Missense_Mutation_p.G238R|FBXL12_uc002mmg.2_Missense_Mutation_p.G238R|FBXL12_uc002mmh.2_Missense_Mutation_p.G238R	NM_017703	NP_060173	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	291	LRR 8.						protein binding			lung(1)|kidney(1)	2						CACCCCAGCCCCTGCAGCTCA	0.612																0.42029	88.661271	89.044359	29	40	KEEP	---	---	---	---	21	23	24	23	-1	capture	Missense_Mutation	SNP	9921682	9921682	FBXL12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5654	184
JAK3	3718	broad.mit.edu	37	19	17945947	17945947	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17945947C>T	uc002nhn.3	-	15	2092	c.1992G>A	c.(1990-1992)CCG>CCA	p.P664P	JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Silent_p.P664P	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	664	Protein kinase 1.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						TGATGAAGGGCGGGCTCCCAT	0.637			2		364	Mis		acute megakaryocytic leukemia|								0.45045	130.90755	131.146966	50	61	KEEP	---	---	---	---	28	27	30	35	-1	capture	Silent	SNP	17945947	17945947	JAK3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7862	184
CD22	933	broad.mit.edu	37	19	35837570	35837570	+	Missense_Mutation	SNP	A	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35837570A>C	uc010edt.2	+	14	2591	c.2514A>C	c.(2512-2514)GAA>GAC	p.E838D	CD22_uc010xst.1_Missense_Mutation_p.E666D|CD22_uc010edu.2_Missense_Mutation_p.E750D|CD22_uc010edv.2_3'UTR|CD22_uc002nzb.3_Missense_Mutation_p.E661D|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	838	Cytoplasmic (Potential).				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	AGGCACAAGAAAATGTGGACT	0.552	Ovarian(42;1009 1133 23674 26041)															0.3	29.464085	30.535675	9	21	KEEP	---	---	---	---	4	6	10	14	-1	capture	Missense_Mutation	SNP	35837570	35837570	CD22	19	A	C	C	C	1	0	0	0	0	1	0	0	0	11	1	4	4	2956	184
SIPA1L3	23094	broad.mit.edu	37	19	38572329	38572329	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38572329C>T	uc002ohk.2	+	3	633	c.124C>T	c.(124-126)CAG>TAG	p.Q42*		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	42					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ATTCTGGGCCCAGAATGGCAG	0.572																0.325581	34.332784	35.494875	14	29	KEEP	---	---	---	---	4	12	19	14	-1	capture	Nonsense_Mutation	SNP	38572329	38572329	SIPA1L3	19	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	14224	184
ZNF285	26974	broad.mit.edu	37	19	44891167	44891167	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44891167C>T	uc002ozd.3	-	4	1327	c.1240G>A	c.(1240-1242)GTT>ATT	p.V414I	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Missense_Mutation_p.V421I	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	414	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						ACTTGAAGAACGGAGCTTGAA	0.488																0.41958	171.866963	172.675715	60	83	KEEP	---	---	---	---	32	32	46	49	-1	capture	Missense_Mutation	SNP	44891167	44891167	ZNF285	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17702	184
CKM	1158	broad.mit.edu	37	19	45821144	45821144	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45821144C>T	uc002pbd.2	-	3	361	c.287G>A	c.(286-288)CGC>CAC	p.R96H		NM_001824	NP_001815	P06732	KCRM_HUMAN	muscle creatine kinase	96	Phosphagen kinase N-terminal.				creatine metabolic process	cytosol	ATP binding|creatine kinase activity			skin(1)	1		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	GCCCCCGTGGCGATCCGAGAT	0.582																0.411765	99.613073	100.18969	35	50	KEEP	---	---	---	---	19	18	29	24	-1	capture	Missense_Mutation	SNP	45821144	45821144	CKM	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3413	184
ZNF805	390980	broad.mit.edu	37	19	57765629	57765629	+	Missense_Mutation	SNP	A	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57765629A>C	uc010ygt.1	+	4	1649	c.1442A>C	c.(1441-1443)AAG>ACG	p.K481T	ZNF805_uc010ygu.1_Missense_Mutation_p.K348T	NM_001023563	NP_001018857	Q5CZA5	ZN805_HUMAN	zinc finger protein 805 isoform 1	481					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACTGGAGAGAAGCCCTATGAG	0.527																0.326733	101.24098	103.930171	33	68	KEEP	---	---	---	---	18	19	45	35	-1	capture	Missense_Mutation	SNP	57765629	57765629	ZNF805	19	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	18048	184
C2orf70	339778	broad.mit.edu	37	2	26798883	26798883	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26798883C>T	uc010eyn.2	+	2	188	c.188C>T	c.(187-189)CCC>CTC	p.P63L		NM_001105519	NP_001098989	A6NJV1	CB070_HUMAN	hypothetical protein LOC339778	63										skin(1)	1						AGCCACACTCCCTTCAGCCAA	0.637																0.357542	195.143373	198.345758	64	115	KEEP	---	---	---	---	36	37	57	76	-1	capture	Missense_Mutation	SNP	26798883	26798883	C2orf70	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	2170	184
VAMP5	10791	broad.mit.edu	37	2	85818867	85818867	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85818867G>A	uc002spu.1	+	2	106	c.23G>A	c.(22-24)CGG>CAG	p.R8Q		NM_006634	NP_006625	O95183	VAMP5_HUMAN	vesicle-associated membrane protein 5	8	v-SNARE coiled-coil homology.|Cytoplasmic (Potential).				cell differentiation|vesicle-mediated transport	endomembrane system					0						GAGTTGGAGCGGTGCCAGCAG	0.602																0.370861	162.066425	164.276716	56	95	KEEP	---	---	---	---	26	34	55	68	-1	capture	Missense_Mutation	SNP	85818867	85818867	VAMP5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16998	184
SEMA4C	54910	broad.mit.edu	37	2	97533539	97533539	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97533539G>A	uc002sxh.3	-	2	245	c.85C>T	c.(85-87)CCG>TCG	p.P29S	SEMA4C_uc002sxg.3_5'Flank	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN	semaphorin 4C precursor	29	Extracellular (Potential).				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity			skin(2)	2						GTCTTACGCGGCACAAGGTTC	0.642																0.014925	-81.992594	7.529765	5	330	KEEP	---	---	---	---	5	2	183	217	-1	capture	Missense_Mutation	SNP	97533539	97533539	SEMA4C	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13926	184
GGTLC1	92086	broad.mit.edu	37	20	23967182	23967182	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23967182A>G	uc002wts.2	-	2	200	c.67T>C	c.(67-69)TCC>CCC	p.S23P	GGTLC1_uc002wtu.2_Missense_Mutation_p.S23P	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	23							gamma-glutamyltransferase activity			ovary(1)	1						TTGTAGTAGGAGATCGGGTGA	0.632																0.343511	155.742182	158.572779	45	86	KEEP	---	---	---	---	39	21	61	39	-1	capture	Missense_Mutation	SNP	23967182	23967182	GGTLC1	20	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	6304	184
MATN4	8785	broad.mit.edu	37	20	43922452	43922452	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43922452C>T	uc002xnn.2	-	10	1888	c.1701G>A	c.(1699-1701)ACG>ACA	p.T567T	MATN4_uc002xno.2_Silent_p.T526T|MATN4_uc002xnp.2_Silent_p.T485T	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	608	Potential.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				CCAGGCGCGCCGTCAGCTGGG	0.687																0.380952	48.288878	48.811382	16	26	KEEP	---	---	---	---	9	8	14	20	-1	capture	Silent	SNP	43922452	43922452	MATN4	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9249	184
FAM65C	140876	broad.mit.edu	37	20	49232571	49232571	+	Missense_Mutation	SNP	G	A	A	rs147229572		TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49232571G>A	uc002xvm.2	-	4	622	c.304C>T	c.(304-306)CGC>TGC	p.R102C	FAM65C_uc010zyt.1_Missense_Mutation_p.R106C|FAM65C_uc010zyu.1_RNA|FAM65C_uc002xvn.1_Missense_Mutation_p.R102C|MIR1302-5_hsa-mir-1302-5|MI0006366_5'Flank	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876	102										ovary(2)	2						TCTTTGTGGCGTCCAGACAGG	0.542																0.285714	20.1884	21.34228	8	20	KEEP	---	---	---	---	3	6	4	17	-1	capture	Missense_Mutation	SNP	49232571	49232571	FAM65C	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5549	184
KRTAP10-6	386674	broad.mit.edu	37	21	46011400	46011400	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46011400G>A	uc002zfm.2	-	1	987	c.966C>T	c.(964-966)TCC>TCT	p.S322S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament					0						AGGCACCACAGGAGGGGACGG	0.692																0.04	-17.337323	11.173014	5	120	KEEP	---	---	---	---	5	3	71	68	-1	capture	Silent	SNP	46011400	46011400	KRTAP10-6	21	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	8433	184
FYCO1	79443	broad.mit.edu	37	3	45996750	45996750	+	Missense_Mutation	SNP	G	A	A	rs140583635		TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45996750G>A	uc003cpb.3	-	14	4141	c.3935C>T	c.(3934-3936)GCG>GTG	p.A1312V	FYCO1_uc011bal.1_Missense_Mutation_p.A1312V	NM_024513	NP_078789	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1312					transport	integral to membrane	metal ion binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CTGTTCAGCCGCATTTGGGTC	0.498																0.017143	-84.316083	7.833206	6	344	KEEP	---	---	---	---	3	3	199	193	-1	capture	Missense_Mutation	SNP	45996750	45996750	FYCO1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6067	184
PFKFB4	5210	broad.mit.edu	37	3	48563038	48563038	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48563038C>T	uc003ctv.2	-	10	1069	c.1052G>A	c.(1051-1053)CGG>CAG	p.R351Q	PFKFB4_uc003ctw.2_Missense_Mutation_p.R160Q|PFKFB4_uc010hkc.2_Intron|PFKFB4_uc003ctx.2_Missense_Mutation_p.R308Q|PFKFB4_uc010hkb.2_Missense_Mutation_p.R344Q|PFKFB4_uc011bbm.1_Missense_Mutation_p.R340Q|PFKFB4_uc011bbn.1_RNA	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,	351	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		GTCCTGGTCCCGCAGGGCGAA	0.562																0.37931	103.35433	104.466102	33	54	KEEP	---	---	---	---	16	24	25	43	-1	capture	Missense_Mutation	SNP	48563038	48563038	PFKFB4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11666	184
NISCH	11188	broad.mit.edu	37	3	52521957	52521957	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52521957G>A	uc011beg.1	+	17	2521	c.2449G>A	c.(2449-2451)GCC>ACC	p.A817T	NISCH_uc003ded.3_Missense_Mutation_p.A817T|NISCH_uc003dee.3_Missense_Mutation_p.A306T|NISCH_uc003deg.1_RNA	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	817	Interaction with LIMK (By similarity).|Interaction with PAK1 (By similarity).				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CCAGCACATGGCCATGCTGTG	0.622																0.057692	-3.73995	6.857312	3	49	KEEP	---	---	---	---	2	1	26	25	-1	capture	Missense_Mutation	SNP	52521957	52521957	NISCH	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10339	184
ADCY5	111	broad.mit.edu	37	3	123046533	123046533	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123046533C>T	uc003egh.1	-	7	1879	c.1879G>A	c.(1879-1881)GAG>AAG	p.E627K	ADCY5_uc003egg.1_Missense_Mutation_p.E260K|ADCY5_uc003egi.1_Missense_Mutation_p.E186K	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	627	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		GCGTTGCGCTCGCCCCCACAG	0.642																0.380952	66.384553	67.167656	24	39	KEEP	---	---	---	---	16	10	17	25	-1	capture	Missense_Mutation	SNP	123046533	123046533	ADCY5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	297	184
RBP2	5948	broad.mit.edu	37	3	139195249	139195249	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:139195249T>C	uc003eth.2	-	1	104	c.53A>G	c.(52-54)GAG>GGG	p.E18G		NM_004164	NP_004155	P50120	RET2_HUMAN	retinol binding protein 2, cellular	18					epidermis development|retinoid metabolic process|steroid metabolic process|vitamin A metabolic process	cytosol	retinal binding|retinol binding|transporter activity			skin(1)	1					Vitamin A(DB00162)	CATGTAGCCCTCAAAGTTTTC	0.542																0.023952	-35.058941	7.109516	4	163	KEEP	---	---	---	---	1	3	92	89	-1	capture	Missense_Mutation	SNP	139195249	139195249	RBP2	3	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	13051	184
PSMD2	5708	broad.mit.edu	37	3	184021749	184021749	+	Silent	SNP	T	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184021749T>C	uc003fnn.1	+	11	1371	c.1338T>C	c.(1336-1338)CTT>CTC	p.L446L	PSMD2_uc011brj.1_Silent_p.L287L|PSMD2_uc011brk.1_Silent_p.L316L	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	446	PC 2.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	GAGCTCTTCTTGCCTGTGGCA	0.512	Colon(24;313 636 6917 9932 15554)															0.39604	251.058767	252.968757	80	122	KEEP	---	---	---	---	48	36	65	65	-1	capture	Silent	SNP	184021749	184021749	PSMD2	3	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	12593	184
LRRC15	131578	broad.mit.edu	37	3	194080518	194080518	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194080518G>A	uc003ftu.2	-	2	1341	c.1255C>T	c.(1255-1257)CGG>TGG	p.R419W	LRRC15_uc003ftt.2_Missense_Mutation_p.R425W	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	419	Extracellular (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TCATACAGCCGCAGCTCACAC	0.577																0.431373	63.741017	63.950611	22	29	KEEP	---	---	---	---	8	16	14	17	-1	capture	Missense_Mutation	SNP	194080518	194080518	LRRC15	3	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8886	184
ADD1	118	broad.mit.edu	37	4	2930135	2930135	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2930135G>A	uc003gfr.2	+	15	2287	c.2099G>A	c.(2098-2100)GGG>GAG	p.G700E	ADD1_uc003gfn.2_RNA|ADD1_uc003gfo.2_3'UTR|ADD1_uc003gfp.2_3'UTR|ADD1_uc003gfq.2_Missense_Mutation_p.G731E|ADD1_uc003gfs.2_3'UTR	NM_001119	NP_001110	P35611	ADDA_HUMAN	adducin 1 (alpha) isoform a	700					actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTCGAGGAGGGGGCCGCCGCG	0.662	Esophageal Squamous(71;505 1201 20414 34538 37449)															0.421053	163.229113	163.937601	56	77	KEEP	---	---	---	---	28	35	44	49	-1	capture	Missense_Mutation	SNP	2930135	2930135	ADD1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	304	184
RXFP1	59350	broad.mit.edu	37	4	159538309	159538309	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159538309G>A	uc003ipz.2	+	9	789	c.707G>A	c.(706-708)CGT>CAT	p.R236H	RXFP1_uc010iqj.1_Missense_Mutation_p.R65H|RXFP1_uc011cja.1_Missense_Mutation_p.R155H|RXFP1_uc010iqo.2_Missense_Mutation_p.R236H|RXFP1_uc011cjb.1_Missense_Mutation_p.R182H|RXFP1_uc010iqk.2_Missense_Mutation_p.R104H|RXFP1_uc011cjc.1_Missense_Mutation_p.R155H|RXFP1_uc011cjd.1_Missense_Mutation_p.R155H|RXFP1_uc010iql.2_Missense_Mutation_p.R104H|RXFP1_uc011cje.1_Missense_Mutation_p.R263H|RXFP1_uc010iqm.2_Missense_Mutation_p.R203H|RXFP1_uc011cjf.1_Missense_Mutation_p.R106H|RXFP1_uc010iqn.2_Missense_Mutation_p.R182H	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	236	Extracellular (Potential).|LRR 4.					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		GTCCTCACCCGTTTACCTGAT	0.363																0.446602	270.663947	271.176626	92	114	KEEP	---	---	---	---	56	55	57	81	-1	capture	Missense_Mutation	SNP	159538309	159538309	RXFP1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13651	184
ODZ3	55714	broad.mit.edu	37	4	183713542	183713542	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183713542G>A	uc003ivd.1	+	25	5754	c.5717G>A	c.(5716-5718)CGA>CAA	p.R1906Q		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1906	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CAGACCATCCGATCCATTGGC	0.542																0.488889	65.846754	65.851629	22	23	KEEP	---	---	---	---	21	26	34	40	-1	capture	Missense_Mutation	SNP	183713542	183713542	ODZ3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10741	184
SLC6A19	340024	broad.mit.edu	37	5	1216784	1216784	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1216784C>T	uc003jbw.3	+	7	1055	c.999C>T	c.(997-999)TAC>TAT	p.Y333Y		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	333	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CACAGCGCTACGACGACTGCT	0.617																0.486842	110.870227	110.881699	37	39	KEEP	---	---	---	---	22	21	17	37	-1	capture	Silent	SNP	1216784	1216784	SLC6A19	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14574	184
UGT3A1	133688	broad.mit.edu	37	5	35955903	35955903	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35955903C>T	uc003jjv.1	-	6	1296	c.1139G>A	c.(1138-1140)CGT>CAT	p.R380H	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.R380H|UGT3A1_uc011cor.1_Missense_Mutation_p.R346H	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	380	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CACACCATGACGGATGGCCTC	0.493																0.387097	232.944401	235.369726	84	133	KEEP	---	---	---	---	53	41	75	79	-1	capture	Missense_Mutation	SNP	35955903	35955903	UGT3A1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16845	184
HCN1	348980	broad.mit.edu	37	5	45262136	45262136	+	Nonsense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262136G>A	uc003jok.2	-	8	2585	c.2560C>T	c.(2560-2562)CGA>TGA	p.R854*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	854	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GGGACTCCTCGGTTCGGGGGG	0.632																0.419355	233.291035	234.351051	78	108	KEEP	---	---	---	---	44	41	73	45	-1	capture	Nonsense_Mutation	SNP	45262136	45262136	HCN1	5	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	6922	184
HCN1	348980	broad.mit.edu	37	5	45353296	45353296	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45353296C>T	uc003jok.2	-	5	1308	c.1283G>A	c.(1282-1284)CGT>CAT	p.R428H		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	428	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TATCTTCTGACGCATATCAGC	0.338																0.351111	221.653487	226.054969	79	146	KEEP	---	---	---	---	39	54	81	82	-1	capture	Missense_Mutation	SNP	45353296	45353296	HCN1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6922	184
PTCD2	79810	broad.mit.edu	37	5	71634538	71634538	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71634538C>T	uc003kcb.2	+	7	739	c.729C>T	c.(727-729)TTC>TTT	p.F243F	PTCD2_uc011csf.1_Silent_p.F53F|PTCD2_uc003kcc.2_Silent_p.F91F|PTCD2_uc011csg.1_Silent_p.F71F|PTCD2_uc011csh.1_Silent_p.F134F|PTCD2_uc003kcd.2_RNA	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	243											0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		CATCCTGTTTCGCTGTGGCAT	0.423																0.367521	122.792145	124.598129	43	74	KEEP	---	---	---	---	22	28	43	33	-1	capture	Silent	SNP	71634538	71634538	PTCD2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	12623	184
FCHO2	115548	broad.mit.edu	37	5	72370577	72370577	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72370577C>T	uc003kcl.2	+	20	1704	c.1588C>T	c.(1588-1590)CGG>TGG	p.R530W	FCHO2_uc011csl.1_Missense_Mutation_p.R497W|FCHO2_uc010izb.2_Translation_Start_Site|FCHO2_uc011csn.1_Translation_Start_Site	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a	530										ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		AGGTGTGTCACGGGGTCCCAG	0.403																0.403846	60.662554	61.083492	21	31	KEEP	---	---	---	---	13	11	16	18	-1	capture	Missense_Mutation	SNP	72370577	72370577	FCHO2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	5734	184
ARRDC3	57561	broad.mit.edu	37	5	90672545	90672545	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90672545G>A	uc003kjz.2	-	3	643	c.403C>T	c.(403-405)CGC>TGC	p.R135C		NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	135					signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		ACCCAATAGCGCACACTGCCA	0.398																0.033613	-21.50637	6.7195	4	115	KEEP	---	---	---	---	1	4	65	67	-1	capture	Missense_Mutation	SNP	90672545	90672545	ARRDC3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	977	184
SLIT3	6586	broad.mit.edu	37	5	168112721	168112721	+	Missense_Mutation	SNP	C	T	T	rs143177032		TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168112721C>T	uc003mab.2	-	31	3946	c.3526G>A	c.(3526-3528)GTC>ATC	p.V1176I	SLIT3_uc010jjg.2_Missense_Mutation_p.V1183I	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1176	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGGGTCGGACCTTGGCGGAG	0.607	Ovarian(29;311 847 10864 17279 24903)															0.4	190.982856	192.377078	64	96	KEEP	---	---	---	---	33	35	55	48	-1	capture	Missense_Mutation	SNP	168112721	168112721	SLIT3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	14633	184
OR12D2	26529	broad.mit.edu	37	6	29364964	29364964	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29364964G>A	uc003nmf.3	+	1	549	c.488G>A	c.(487-489)CGC>CAC	p.R163H		NM_013936	NP_039224	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D,	163	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATGACTTCTCGCTTGAACTTC	0.468																0.022059	-59.239261	10.069166	6	266	KEEP	---	---	---	---	5	1	135	156	-1	capture	Missense_Mutation	SNP	29364964	29364964	OR12D2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10835	184
HLA-G	3135	broad.mit.edu	37	6	29797340	29797340	+	Silent	SNP	G	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29797340G>C	uc003nnw.2	+	5	943	c.765G>C	c.(763-765)GTG>GTC	p.V255V	HLA-G_uc011dmb.1_Silent_p.V227V|HLA-G_uc003raj.3_Silent_p.V260V|HLA-G_uc003nnz.3_Silent_p.V163V|HLA-G_uc010jrn.2_Intron|HLA-G_uc003nny.3_RNA|HLA-G_uc003ran.1_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	255	Extracellular (Potential).|Ig-like C1-type.|Alpha-3.				antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						TGGAGCTCGTGGAGACCAGGC	0.632																0.339056	231.789299	237.108415	79	154	KEEP	---	---	---	---	48	36	89	78	-1	capture	Silent	SNP	29797340	29797340	HLA-G	6	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	7137	184
SKIV2L	6499	broad.mit.edu	37	6	31936703	31936703	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31936703G>A	uc003nyn.1	+	26	3625	c.3236G>A	c.(3235-3237)CGG>CAG	p.R1079Q	SKIV2L_uc011dou.1_Missense_Mutation_p.R921Q|SKIV2L_uc011dov.1_Missense_Mutation_p.R886Q|STK19_uc003nyt.2_5'Flank|STK19_uc011dow.1_5'Flank|STK19_uc011dox.1_5'Flank|STK19_uc003nyv.2_5'Flank|STK19_uc003nyw.2_5'Flank	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	1079						nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						CTGGCAGGGCGGGTGGCTTGT	0.592																0.352941	106.615007	108.883369	42	77	KEEP	---	---	---	---	25	35	43	62	-1	capture	Missense_Mutation	SNP	31936703	31936703	SKIV2L	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14252	184
SFRS3	6428	broad.mit.edu	37	6	36564707	36564707	+	Silent	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36564707C>T	uc003omj.2	+	2	339	c.168C>T	c.(166-168)CCC>CCT	p.P56P	SFRS3_uc003omk.2_RNA|SFRS3_uc011dtp.1_Silent_p.P56P	NM_003017	NP_003008	P84103	SRSF3_HUMAN	splicing factor, arginine/serine-rich 3	56	RRM.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						TTGAAGATCCCCGAGATGCAG	0.433						T	BCL6	follicular lymphoma								0.279503	125.63295	132.655418	45	116	KEEP	---	---	---	---	27	22	73	56	-1	capture	Silent	SNP	36564707	36564707	SFRS3	6	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14071	184
HMGCLL1	54511	broad.mit.edu	37	6	55360237	55360237	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55360237T>C	uc003pcn.2	-	8	1024	c.865A>G	c.(865-867)AAT>GAT	p.N289D	HMGCLL1_uc003pco.2_Missense_Mutation_p.N259D|HMGCLL1_uc010jzx.2_Missense_Mutation_p.N160D|HMGCLL1_uc011dxc.1_Missense_Mutation_p.N227D|HMGCLL1_uc011dxd.1_Missense_Mutation_p.N156D|HMGCLL1_uc011dxe.1_Intron	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-Coenzyme A	289							hydroxymethylglutaryl-CoA lyase activity|metal ion binding			skin(2)|ovary(1)|pancreas(1)	4	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			GTAAGGATATTTGCTAAGGCT	0.398	Ovarian(35;840 893 7837 15538 42887)															0.254237	94.497741	100.962265	30	88	KEEP	---	---	---	---	17	18	46	51	-1	capture	Missense_Mutation	SNP	55360237	55360237	HMGCLL1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	7155	184
TIAM2	26230	broad.mit.edu	37	6	155504465	155504465	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155504465C>G	uc003qqb.2	+	16	4168	c.2895C>G	c.(2893-2895)AGC>AGG	p.S965R	TIAM2_uc003qqe.2_Missense_Mutation_p.S965R|TIAM2_uc010kjj.2_Missense_Mutation_p.S498R|TIAM2_uc003qqf.2_Missense_Mutation_p.S341R|TIAM2_uc011efl.1_Missense_Mutation_p.S301R|TIAM2_uc003qqg.2_Missense_Mutation_p.S277R	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	965	PDZ.				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTGAGAAGAGCGTCGGACTCA	0.527																0.326531	158.358617	162.277716	48	99	KEEP	---	---	---	---	17	35	51	53	-1	capture	Missense_Mutation	SNP	155504465	155504465	TIAM2	6	C	G	G	G	1	0	0	0	0	1	0	0	0	350	27	4	4	15776	184
TMEM195	392636	broad.mit.edu	37	7	15425167	15425167	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:15425167G>A	uc003stb.1	-	10	1148	c.978C>T	c.(976-978)CCC>CCT	p.P326P		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	326					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						ATGATGAGAAGGGAACTTCTT	0.368																0.290984	214.531291	224.077584	71	173	KEEP	---	---	---	---	38	38	85	109	-1	capture	Silent	SNP	15425167	15425167	TMEM195	7	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	16000	184
PIK3CG	5294	broad.mit.edu	37	7	106508579	106508579	+	Silent	SNP	C	T	T	rs145944814		TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508579C>T	uc003vdv.3	+	2	658	c.573C>T	c.(571-573)CGC>CGT	p.R191R	PIK3CG_uc003vdu.2_Silent_p.R191R|PIK3CG_uc003vdw.2_Silent_p.R191R	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	191					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TGGCCAGCCGCGACCCCAAGC	0.612				p.R191R(NCIH2172-Tumor)	292											0.325926	105.646892	109.279835	44	91	KEEP	---	---	---	---	15	33	56	56	-1	capture	Silent	SNP	106508579	106508579	PIK3CG	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11819	184
CTTNBP2	83992	broad.mit.edu	37	7	117368153	117368153	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117368153C>A	uc003vjf.2	-	17	4137	c.4045G>T	c.(4045-4047)GTG>TTG	p.V1349L		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1349										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TTCACTGTCACTTGGGCATGC	0.493																0.300699	251.537315	261.685468	86	200	KEEP	---	---	---	---	44	51	119	97	0.536842105263	capture	Missense_Mutation	SNP	117368153	117368153	CTTNBP2	7	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	4006	184
RNF133	168433	broad.mit.edu	37	7	122338662	122338662	+	Missense_Mutation	SNP	A	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:122338662A>C	uc003vkj.1	-	1	547	c.311T>G	c.(310-312)CTT>CGT	p.L104R	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	NM_139175	NP_631914	Q8WVZ7	RN133_HUMAN	ring finger protein 133	104	PA.					endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding			skin(1)	1						CCGTTCAATAAGTGCAAGCCA	0.458	Colon(198;1778 2057 7449 19869 45985)															0.023551	-117.650465	22.053645	13	539	KEEP	---	---	---	---	4	9	305	316	-1	capture	Missense_Mutation	SNP	122338662	122338662	RNF133	7	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	13331	184
GCC1	79571	broad.mit.edu	37	7	127222596	127222596	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127222596G>A	uc003vma.2	-	2	2218	c.1800C>T	c.(1798-1800)GAC>GAT	p.D600D		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	600	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						CCAGTTCCAAGTCCTTCTCGG	0.627																0.266304	122.290572	131.373149	49	135	KEEP	---	---	---	---	29	27	56	87	-1	capture	Silent	SNP	127222596	127222596	GCC1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	6225	184
KEL	3792	broad.mit.edu	37	7	142643377	142643377	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142643377C>T	uc003wcb.2	-	11	1441	c.1231G>A	c.(1231-1233)GTG>ATG	p.V411M		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	411	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GTCTCCTCCACGCACTTCATC	0.567																0.25	50.735318	55.507436	21	63	KEEP	---	---	---	---	15	8	41	33	-1	capture	Missense_Mutation	SNP	142643377	142643377	KEL	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8064	184
ADAM7	8756	broad.mit.edu	37	8	24324411	24324411	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24324411G>A	uc003xeb.2	+	6	602	c.489G>A	c.(487-489)CCG>CCA	p.P163P	ADAM7_uc003xea.1_Silent_p.P163P	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	163	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TGAGGGTGCCGTATGGTGCCA	0.388																0.334711	223.600012	229.450945	81	161	KEEP	---	---	---	---	45	46	89	90	-1	capture	Silent	SNP	24324411	24324411	ADAM7	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	251	184
SLCO5A1	81796	broad.mit.edu	37	8	70667740	70667740	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70667740C>T	uc003xyl.2	-	4	1884	c.1177G>A	c.(1177-1179)GAT>AAT	p.D393N	SLCO5A1_uc010lzb.2_Missense_Mutation_p.D393N|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Missense_Mutation_p.D393N|SLCO5A1_uc010lzc.2_Missense_Mutation_p.D393N	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	393	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TTCAGAACATCGTCATCACTA	0.363																0.404412	163.397822	164.484241	55	81	KEEP	---	---	---	---	25	32	35	48	-1	capture	Missense_Mutation	SNP	70667740	70667740	SLCO5A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14623	184
MTSS1	9788	broad.mit.edu	37	8	125568545	125568545	+	Silent	SNP	G	A	A			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125568545G>A	uc003yrk.2	-	12	1866	c.1332C>T	c.(1330-1332)ACC>ACT	p.T444T	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_5'UTR|MTSS1_uc011lin.1_Silent_p.T218T|MTSS1_uc011lio.1_Silent_p.T334T|MTSS1_uc003yri.2_Silent_p.T162T|MTSS1_uc003yrj.2_Silent_p.T419T|MTSS1_uc003yrl.2_Silent_p.T448T	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	444					actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GGCCGCTGGCGGTAGTGGGTC	0.627	Esophageal Squamous(160;622 1893 3862 8546 12509)															0.04918	-6.525476	6.639281	3	58	KEEP	---	---	---	---	1	2	35	36	-1	capture	Silent	SNP	125568545	125568545	MTSS1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9872	184
CEL	1056	broad.mit.edu	37	9	135946656	135946656	+	Silent	SNP	G	C	C			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135946656G>C	uc010naa.1	+	11	1792	c.1776G>C	c.(1774-1776)GGG>GGC	p.G592G		NM_001807	NP_001798	P19835	CEL_HUMAN	carboxyl ester lipase precursor	589	3.|17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		GTGACTCCGGGGCCCCCCCCG	0.811																0.428571	10.724091	10.755222	3	4	KEEP	---	---	---	---	2	1	2	4	-1	capture	Silent	SNP	135946656	135946656	CEL	9	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	3177	184
RPL7A	6130	broad.mit.edu	37	9	136217156	136217156	+	Silent	SNP	C	T	T	rs142456845	by1000genomes	TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136217156C>T	uc004cde.1	+	5	507	c.477C>T	c.(475-477)CAC>CAT	p.H159H	MED22_uc004cdc.2_5'Flank|MED22_uc004cdd.2_5'Flank|RPL7A_uc004cdf.1_Translation_Start_Site|SNORD36A_uc010naj.2_5'Flank|SNORD36C_uc010nak.2_5'Flank	NM_000972	NP_000963	P62424	RL7A_HUMAN	ribosomal protein L7a	159					endocrine pancreas development|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|membrane fraction|polysomal ribosome	RNA binding|structural constituent of ribosome				0				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		TGATTGCACACGACGTGGATC	0.522																0.355932	59.259094	60.337648	21	38	KEEP	---	---	---	---	7	15	20	22	-1	capture	Silent	SNP	136217156	136217156	RPL7A	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13492	184
UBQLN3	50613	broad.mit.edu	37	11	5529918	5529920	+	In_Frame_Del	DEL	TGG	-	-	rs2234451	byFrequency;by1000genomes	TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5529918_5529920delTGG	uc001may.1	-	2	955_957	c.869_871delCCA	c.(868-873)ACCAGC>AGC	p.T290del	HBG2_uc001mak.1_Intron	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	290										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAGGTTGGCTGGTGGTGGTGGT	0.537	Ovarian(72;684 1260 12332 41642 52180)															0.02			8	317		---	---	---	---						capture_indel	In_Frame_Del	DEL	5529918	5529920	UBQLN3	11	TGG	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	16780	184
PMEPA1	56937	broad.mit.edu	37	20	56284593	56284595	+	In_Frame_Del	DEL	CGG	-	-			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56284593_56284595delCGG	uc002xyq.2	-	1	437_439	c.44_46delCCG	c.(43-48)GCCGGG>GGG	p.A15del	PMEPA1_uc002xyr.2_Intron|PMEPA1_uc002xys.2_Intron|PMEPA1_uc002xyt.2_Intron|uc002xyu.1_5'Flank	NM_020182	NP_064567	Q969W9	PMEPA_HUMAN	transmembrane prostate androgen-induced protein	15	Extracellular (Potential).				androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1						TTGGGCTgcccggcggcggcggc	0.369																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	56284593	56284595	PMEPA1	20	CGG	-	-	-	1	0	1	0	1	0	0	0	0	299	23	5	5	12035	184
TAF4	6874	broad.mit.edu	37	20	60572701	60572706	+	In_Frame_Del	DEL	TTTGTG	-	-			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60572701_60572706delTTTGTG	uc002ybs.2	-	14	2990_2995	c.2990_2995delCACAAA	c.(2989-2997)GCACAAATG>GTG	p.997_999AQM>V		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	997_999					interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CGCTGTCTCATTTGTGCCAGTTCCTG	0.471																0.25			59	178		---	---	---	---						capture_indel	In_Frame_Del	DEL	60572701	60572706	TAF4	20	TTTGTG	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	15414	184
ERC2	26059	broad.mit.edu	37	3	55733470	55733472	+	In_Frame_Del	DEL	TGG	-	-			TCGA-26-5135-01	TCGA-26-5135-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:55733470_55733472delTGG	uc003dhr.1	-	16	3037_3039	c.2781_2783delCCA	c.(2779-2784)CACCAT>CAT	p.927_928HH>H	ERC2_uc003dhq.1_RNA	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	927_928	Poly-His.					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		gtggtggtgatggtggtggtggt	0.389																0.01			7	513		---	---	---	---						capture_indel	In_Frame_Del	DEL	55733470	55733472	ERC2	3	TGG	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	5166	184
