Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PTCH2	8643	broad.mit.edu	37	1	45288988	45288988	+	Missense_Mutation	SNP	C	T	T	rs142187073	byFrequency	TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45288988C>T	uc010olf.1	-	20	3196	c.3184G>A	c.(3184-3186)GTG>ATG	p.V1062M	PTCH2_uc010olg.1_Missense_Mutation_p.V760M	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	1062	Cytoplasmic (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					CCATCGGTCACGGGGGCAAAT	0.617					193							Basal_Cell_Nevus_syndrome				0.382353	75.482069	76.288333	26	42	KEEP	---	---	---	---	10	17	24	22	-1	capture	Missense_Mutation	SNP	45288988	45288988	PTCH2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12626	195
NRD1	4898	broad.mit.edu	37	1	52260179	52260179	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:52260179C>T	uc001ctc.3	-	26	3266	c.2944G>A	c.(2944-2946)GGT>AGT	p.G982S	NRD1_uc009vzb.2_Missense_Mutation_p.G677S|NRD1_uc001ctd.3_Missense_Mutation_p.G914S|NRD1_uc001cte.2_Missense_Mutation_p.G850S|NRD1_uc001ctf.2_Missense_Mutation_p.G914S|NRD1_uc010ong.1_RNA	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a	913					cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						TTGGCATCACCCTTGTTCAGA	0.547																0.331361	516.66556	529.422807	168	339	KEEP	---	---	---	---	98	82	166	199	-1	capture	Missense_Mutation	SNP	52260179	52260179	NRD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10552	195
HIPK1	204851	broad.mit.edu	37	1	114500841	114500841	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114500841G>A	uc001eem.2	+	8	2070	c.1909G>A	c.(1909-1911)GGA>AGA	p.G637R	HIPK1_uc001eel.2_Missense_Mutation_p.G637R|HIPK1_uc001een.2_Missense_Mutation_p.G637R|HIPK1_uc001eeo.2_Missense_Mutation_p.G263R|HIPK1_uc001eep.2_Missense_Mutation_p.G243R	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	637					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGCAGCCTGGAACCACCCA	0.463					365											0.349515	110.168688	112.227011	36	67	KEEP	---	---	---	---	22	18	36	36	-1	capture	Missense_Mutation	SNP	114500841	114500841	HIPK1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	7041	195
RYR2	6262	broad.mit.edu	37	1	237777379	237777379	+	Silent	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237777379C>T	uc001hyl.1	+	37	5071	c.4951C>T	c.(4951-4953)CTG>TTG	p.L1651L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1651	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAGGAATTGCTGAAATTTCA	0.463																0.318841	60.221856	62.236463	22	47	KEEP	---	---	---	---	17	8	30	24	-1	capture	Silent	SNP	237777379	237777379	RYR2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	13661	195
OR2T34	127068	broad.mit.edu	37	1	248737350	248737350	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248737350C>T	uc001iep.1	-	1	709	c.709G>A	c.(709-711)GCC>ACC	p.A237T		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGCGGCCGGCGGCAGAATTC	0.562																0.316583	164.966866	170.914405	63	136	KEEP	---	---	---	---	38	41	91	83	-1	capture	Missense_Mutation	SNP	248737350	248737350	OR2T34	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10929	195
MUC2	4583	broad.mit.edu	37	11	1094855	1094855	+	Silent	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1094855C>T	uc001lsx.1	+	34	13056	c.13029C>T	c.(13027-13029)TAC>TAT	p.Y4343Y		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4343						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACACCTACTACGCACCAGGTA	0.607																0.357576	168.185445	171.130302	59	106	KEEP	---	---	---	---	27	38	41	70	-1	capture	Silent	SNP	1094855	1094855	MUC2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9885	195
SLC22A10	387775	broad.mit.edu	37	11	63071595	63071595	+	Missense_Mutation	SNP	G	A	A	rs112720090		TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63071595G>A	uc009yor.2	+	8	1509	c.1301G>A	c.(1300-1302)CGT>CAT	p.R434H	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.V228M	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	434	Cytoplasmic (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						CAGACCCTGCGTGTGGCTTTG	0.453																0.312715	263.781903	272.833797	91	200	KEEP	---	---	---	---	61	62	144	133	-1	capture	Missense_Mutation	SNP	63071595	63071595	SLC22A10	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14334	195
CABP4	57010	broad.mit.edu	37	11	67223870	67223870	+	Silent	SNP	C	T	T	rs139927588		TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67223870C>T	uc001olo.2	+	3	575	c.498C>T	c.(496-498)ACC>ACT	p.T166T	CABP4_uc001oln.2_Silent_p.T61T	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	166	EF-hand 2.				visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			ACATGCCCACCGAGATGGAGC	0.652																0.359375	70.81072	71.923612	23	41	KEEP	---	---	---	---	12	12	21	24	-1	capture	Silent	SNP	67223870	67223870	CABP4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2509	195
CACNB3	784	broad.mit.edu	37	12	49218469	49218469	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49218469C>T	uc001rsl.1	+	5	626	c.425C>T	c.(424-426)TCC>TTC	p.S142F	CACNB3_uc010slx.1_Missense_Mutation_p.S129F|CACNB3_uc010sly.1_Missense_Mutation_p.S129F|CACNB3_uc010slz.1_Missense_Mutation_p.S141F|CACNB3_uc001rsk.1_5'UTR	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	142					axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	GGGAACCCTTCCAGCCTGAGT	0.493																0.282828	76.261928	80.453835	28	71	KEEP	---	---	---	---	14	19	39	45	-1	capture	Missense_Mutation	SNP	49218469	49218469	CACNB3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2530	195
TP53	7157	broad.mit.edu	37	17	7578217	7578217	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578217G>A	uc002gim.2	-	6	826	c.632C>T	c.(631-633)ACT>ATT	p.T211I	TP53_uc002gig.1_Missense_Mutation_p.T211I|TP53_uc002gih.2_Missense_Mutation_p.T211I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.T79I|TP53_uc010cng.1_Missense_Mutation_p.T79I|TP53_uc002gii.1_Missense_Mutation_p.T79I|TP53_uc010cnh.1_Missense_Mutation_p.T211I|TP53_uc010cni.1_Missense_Mutation_p.T211I|TP53_uc002gij.2_Missense_Mutation_p.T211I|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.T118I|TP53_uc002gio.2_Missense_Mutation_p.T79I|TP53_uc010vug.1_Missense_Mutation_p.T172I	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	211	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.T211T(9)|p.T211I(7)|p.0?(7)|p.T211N(4)|p.T211fs*4(3)|p.R209fs*35(2)|p.T211A(2)|p.T211fs*36(2)|p.T211fs*5(2)|p.D208fs*1(1)|p.T211_F212insX(1)|p.R209_R213delRNTFR(1)|p.D207_R213delDDRNTFR(1)|p.T211fs*28(1)|p.T211_S215delTFRHS(1)|p.K164_P219del(1)|p.D207_V216del10(1)|p.T211P(1)|p.T211S(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGTCGAAAAGTGTTTCTGTC	0.532	Pancreas(47;798 1329 9957 10801)		111	p.T211I(42MGBA-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.240964	54.059566	59.139709	20	63	KEEP	---	---	---	---	9	13	38	35	-1	capture	Missense_Mutation	SNP	7578217	7578217	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	16264	195
DNAH9	1770	broad.mit.edu	37	17	11672470	11672470	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11672470G>A	uc002gne.2	+	38	7444	c.7376G>A	c.(7375-7377)CGT>CAT	p.R2459H	DNAH9_uc010coo.2_Missense_Mutation_p.R1753H	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2459	AAA 3 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAGACCATCCGTGTGTGCTAC	0.612																0.26	101.259446	109.080517	39	111	KEEP	---	---	---	---	17	24	74	66	-1	capture	Missense_Mutation	SNP	11672470	11672470	DNAH9	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4564	195
SMCR7	125170	broad.mit.edu	37	17	18167560	18167560	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18167560A>G	uc002gst.2	+	4	1058	c.847A>G	c.(847-849)ATG>GTG	p.M283V	SMCR7_uc002gsu.2_3'UTR|SMCR7_uc010vxq.1_Missense_Mutation_p.M294V	NM_139162	NP_631901	Q96C03	SMCR7_HUMAN	Smith-Magenis syndrome chromosome region,	283						integral to membrane	protein binding				0	all_neural(463;0.228)					CCGGCCCAGCATGGCCTCGGA	0.667																0.289474	27.308004	28.818678	11	27	KEEP	---	---	---	---	11	4	19	14	-1	capture	Missense_Mutation	SNP	18167560	18167560	SMCR7	17	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	14682	195
CCDC144NL	339184	broad.mit.edu	37	17	20799291	20799291	+	Missense_Mutation	SNP	A	C	C			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:20799291A>C	uc002gyf.2	-	1	163	c.43T>G	c.(43-45)TCT>GCT	p.S15A	uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,	15											0						GGCTTCGGAGACCCCCCAGCC	0.647														OREG0024248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.190476	4.463563	6.395418	4	17	KEEP	---	---	---	---	11	6	9	14	-1	capture	Missense_Mutation	SNP	20799291	20799291	CCDC144NL	17	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	2753	195
KIF2B	84643	broad.mit.edu	37	17	51900492	51900492	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51900492C>T	uc002iua.2	+	1	254	c.98C>T	c.(97-99)GCG>GTG	p.A33V		NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	33					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						ATCTACGTGGCGATCCAGCGC	0.552																0.260417	60.338039	65.259952	25	71	KEEP	---	---	---	---	10	17	35	41	-1	capture	Missense_Mutation	SNP	51900492	51900492	KIF2B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8220	195
ENPP7	339221	broad.mit.edu	37	17	77705154	77705154	+	Missense_Mutation	SNP	G	A	A	rs150916536		TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77705154G>A	uc002jxa.2	+	1	273	c.253G>A	c.(253-255)GGC>AGC	p.G85S		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	85					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CCTGGTCACCGGTGAGTACTG	0.647																0.103448	3.403143	7.943407	3	26	KEEP	---	---	---	---	4	1	21	16	-1	capture	Missense_Mutation	SNP	77705154	77705154	ENPP7	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5090	195
CELF5	60680	broad.mit.edu	37	19	3282231	3282231	+	Silent	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3282231C>T	uc002lxm.2	+	7	895	c.858C>T	c.(856-858)AAC>AAT	p.N286N	CELF5_uc002lxl.1_Silent_p.N286N|CELF5_uc010dtj.1_Silent_p.N286N|CELF5_uc010xhg.1_Silent_p.N172N|CELF5_uc002lxn.2_RNA	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	286					mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2						TCAGCCTCAACGGGCTGCCTG	0.647																0.333333	24.164868	24.829651	9	18	KEEP	---	---	---	---	9	11	25	13	-1	capture	Silent	SNP	3282231	3282231	CELF5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3187	195
OR7A10	390892	broad.mit.edu	37	19	14951969	14951969	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14951969A>T	uc002mzx.1	-	1	721	c.721T>A	c.(721-723)TGT>AGT	p.C241S		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					TGAGATGCACAGGTGGAAAAT	0.488																0.02459	-24.281009	6.321047	3	119	KEEP	---	---	---	---	0	3	61	68	-1	capture	Missense_Mutation	SNP	14951969	14951969	OR7A10	19	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	11118	195
ZNF208	7757	broad.mit.edu	37	19	22156724	22156724	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22156724C>T	uc002nqp.2	-	4	1261	c.1112G>A	c.(1111-1113)TGT>TAT	p.C371Y	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				GCATTCTTCACATTTGTAGGG	0.383																0.291045	103.36721	108.610891	39	95	KEEP	---	---	---	---	24	23	46	56	-1	capture	Missense_Mutation	SNP	22156724	22156724	ZNF208	19	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17646	195
KLK6	5653	broad.mit.edu	37	19	51466663	51466663	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51466663G>A	uc002pui.2	-	5	600	c.340C>T	c.(340-342)CGC>TGC	p.R114C	KLK6_uc010eoj.2_Intron|KLK6_uc002puh.2_Missense_Mutation_p.R123C|KLK6_uc002puj.2_Missense_Mutation_p.R7C|KLK6_uc010ycn.1_Missense_Mutation_p.R7C|KLK6_uc002pul.2_Missense_Mutation_p.R114C|KLK6_uc002pum.2_Missense_Mutation_p.R7C	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A	114	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		TTGGCTGGGCGTGCCAGGCGC	0.612																0.264151	34.429246	37.09383	14	39	KEEP	---	---	---	---	11	8	23	26	-1	capture	Missense_Mutation	SNP	51466663	51466663	KLK6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8328	195
NLRP11	204801	broad.mit.edu	37	19	56320357	56320357	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56320357G>A	uc010ygf.1	-	5	2330	c.1619C>T	c.(1618-1620)ACG>ATG	p.T540M	NLRP11_uc002qlz.2_Missense_Mutation_p.T441M|NLRP11_uc002qmb.2_Missense_Mutation_p.T441M|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	540							ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CATATGGTGCGTCAACTTTTC	0.448																0.288889	213.872371	224.640783	78	192	KEEP	---	---	---	---	39	45	93	115	-1	capture	Missense_Mutation	SNP	56320357	56320357	NLRP11	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10380	195
IL1F6	27179	broad.mit.edu	37	2	113764258	113764258	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113764258C>T	uc010yxr.1	+	3	208	c.208C>T	c.(208-210)CTC>TTC	p.L70F		NM_014440	NP_055255	Q9UHA7	IL36A_HUMAN	interleukin 1 family, member 6 (epsilon)	70					immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding				0						CCTGAATGGACTCAATCTCTG	0.512																0.32312	351.580929	361.549173	116	243	KEEP	---	---	---	---	57	68	124	130	-1	capture	Missense_Mutation	SNP	113764258	113764258	IL1F6	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	7577	195
ZAK	51776	broad.mit.edu	37	2	174131096	174131096	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174131096C>T	uc002uhz.2	+	20	2221	c.2021C>T	c.(2020-2022)TCA>TTA	p.S674L	uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1	674					activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			GGTCGATACTCAGACAGAAGC	0.448					532											0.03252	-21.813981	7.55641	4	119	KEEP	---	---	---	---	2	3	59	68	-1	capture	Missense_Mutation	SNP	174131096	174131096	ZAK	2	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17393	195
ACADL	33	broad.mit.edu	37	2	211070506	211070506	+	Silent	SNP	A	G	G			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:211070506A>G	uc002vdz.3	-	6	846	c.618T>C	c.(616-618)AAT>AAC	p.N206N		NM_001608	NP_001599	P28330	ACADL_HUMAN	long-chain acyl-CoA dehydrogenase precursor	206					carnitine catabolic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial matrix	long-chain-acyl-CoA dehydrogenase activity|palmitoyl-CoA oxidase activity				0		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		TTAATGACCCATTACTGATGA	0.388																0.348259	208.885518	212.971856	70	131	KEEP	---	---	---	---	36	40	69	81	-1	capture	Silent	SNP	211070506	211070506	ACADL	2	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	112	195
DIDO1	11083	broad.mit.edu	37	20	61512320	61512320	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61512320G>A	uc002ydr.1	-	16	5252	c.4988C>T	c.(4987-4989)CCG>CTG	p.P1663L	DIDO1_uc002yds.1_Missense_Mutation_p.P1663L	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1663					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					GCCGCAAGGCGGTGTGGGCAG	0.731	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)															0.323529	31.910125	32.851724	11	23	KEEP	---	---	---	---	4	10	12	17	-1	capture	Missense_Mutation	SNP	61512320	61512320	DIDO1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4480	195
PLA2G3	50487	broad.mit.edu	37	22	31534350	31534350	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31534350C>T	uc003aka.2	-	3	823	c.694G>A	c.(694-696)GTG>ATG	p.V232M		NM_015715	NP_056530	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III precursor	232	Phospholipase A2-like.				cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity				0						GCCACGCCCACGATGTCCGAG	0.617																0.42	61.865558	62.144785	21	29	KEEP	---	---	---	---	12	10	20	13	-1	capture	Missense_Mutation	SNP	31534350	31534350	PLA2G3	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11903	195
TTLL12	23170	broad.mit.edu	37	22	43575872	43575872	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43575872C>T	uc003bdq.2	-	4	713	c.681G>A	c.(679-681)TGG>TGA	p.W227*	TTLL12_uc003bdr.1_Nonsense_Mutation_p.W227*	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	227					protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				CCCTCAGGGGCCACAGCAGCG	0.672																0.253968	34.24084	37.733976	16	47	KEEP	---	---	---	---	7	12	28	22	-1	capture	Nonsense_Mutation	SNP	43575872	43575872	TTLL12	22	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	16607	195
CELSR1	9620	broad.mit.edu	37	22	46931874	46931874	+	Silent	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46931874G>A	uc003bhw.1	-	1	1194	c.1194C>T	c.(1192-1194)GAC>GAT	p.D398D		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	398	Extracellular (Potential).|Cadherin 2.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCTGGAAGACGTCCCACGCGC	0.682																0.4	22.995752	23.170617	8	12	KEEP	---	---	---	---	3	6	5	7	-1	capture	Silent	SNP	46931874	46931874	CELSR1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3189	195
NKTR	4820	broad.mit.edu	37	3	42676817	42676817	+	Silent	SNP	A	G	G	rs142015233		TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42676817A>G	uc003clo.2	+	12	1269	c.1122A>G	c.(1120-1122)GCA>GCG	p.A374A	NKTR_uc003clm.1_Silent_p.A121A|NKTR_uc003clp.2_Silent_p.A121A|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Silent_p.A264A|NKTR_uc003clr.1_Silent_p.A121A|NKTR_uc003cls.2_Silent_p.A74A	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	374					protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GATTAAGAGCATATAGACCAC	0.388																0.4	166.543354	167.630613	50	75	KEEP	---	---	---	---	18	35	41	38	-1	capture	Silent	SNP	42676817	42676817	NKTR	3	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	10355	195
KBTBD8	84541	broad.mit.edu	37	3	67054666	67054666	+	Silent	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:67054666C>T	uc003dmy.2	+	3	1328	c.1275C>T	c.(1273-1275)TGC>TGT	p.C425C	KBTBD8_uc011bfv.1_Intron	NM_032505	NP_115894	Q8NFY9	KBTB8_HUMAN	T-cell activation kelch repeat protein	425	Kelch 2.									ovary(2)|large_intestine(1)|breast(1)	4		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		CGACTGTTTGCGCGATGCCAG	0.413																0.015707	-91.693022	9.876315	6	376	KEEP	---	---	---	---	2	4	207	190	-1	capture	Silent	SNP	67054666	67054666	KBTBD8	3	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	7921	195
ROBO1	6091	broad.mit.edu	37	3	78734960	78734960	+	Silent	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:78734960G>A	uc003dqe.2	-	10	1486	c.1278C>T	c.(1276-1278)TAC>TAT	p.Y426Y	ROBO1_uc003dqb.2_Silent_p.Y387Y|ROBO1_uc003dqc.2_Silent_p.Y390Y|ROBO1_uc003dqd.2_Silent_p.Y390Y|ROBO1_uc010hoh.2_5'UTR|ROBO1_uc003dqf.1_Silent_p.Y105Y	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	426	Extracellular (Potential).|Ig-like C2-type 4.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TCTGGCAGATGTAATAACCAA	0.393					693											0.310345	48.426083	50.28585	18	40	KEEP	---	---	---	---	9	11	27	22	-1	capture	Silent	SNP	78734960	78734960	ROBO1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	13405	195
DNAJB8	165721	broad.mit.edu	37	3	128181904	128181904	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:128181904C>T	uc003ekk.1	-	3	1846	c.185G>A	c.(184-186)CGC>CAC	p.R62H	uc003ekl.1_5'Flank	NM_153330	NP_699161	Q8NHS0	DNJB8_HUMAN	DnaJ homolog, subfamily B, member 8	62	J.				protein folding		heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(114;0.177)		ATACAGGGAGCGTTTCTTGGA	0.602																0.267327	134.359531	144.23721	54	148	KEEP	---	---	---	---	33	35	96	75	-1	capture	Missense_Mutation	SNP	128181904	128181904	DNAJB8	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4582	195
ARL14	80117	broad.mit.edu	37	3	160395695	160395695	+	Silent	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160395695G>A	uc003fdq.2	+	1	748	c.561G>A	c.(559-561)GCG>GCA	p.A187A		NM_025047	NP_079323	Q8N4G2	ARL14_HUMAN	ADP-ribosylation factor-like 14	187					small GTPase mediated signal transduction	intracellular	GTP binding				0			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)			ACACTTTGGCGTTCTTCAAGC	0.473																0.296296	63.166594	66.173856	24	57	KEEP	---	---	---	---	11	14	33	29	-1	capture	Silent	SNP	160395695	160395695	ARL14	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	923	195
KNG1	3827	broad.mit.edu	37	3	186459456	186459456	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186459456G>A	uc011bsa.1	+	10	1483	c.1271G>A	c.(1270-1272)GGG>GAG	p.G424E	KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	424	|His-rich.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	AAAGAACAAGGGCATACTCGT	0.458																0.295918	86.139893	89.788629	29	69	KEEP	---	---	---	---	15	15	36	38	-1	capture	Missense_Mutation	SNP	186459456	186459456	KNG1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	8347	195
UGT2B10	7365	broad.mit.edu	37	4	69681966	69681966	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69681966C>A	uc003hee.2	+	1	254	c.229C>A	c.(229-231)CCT>ACT	p.P77T	UGT2B10_uc011cam.1_Missense_Mutation_p.P77T	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	77					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						TGAAGTTTATCCTACATCTTT	0.348	Melanoma(133;755 1763 25578 26334 46021)															0.378109	216.558348	219.175807	76	125	KEEP	---	---	---	---	38	39	61	68	0.506493506494	capture	Missense_Mutation	SNP	69681966	69681966	UGT2B10	4	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	16838	195
TLR2	7097	broad.mit.edu	37	4	154625962	154625962	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:154625962C>T	uc003inq.2	+	3	2122	c.1903C>T	c.(1903-1905)CCC>TCC	p.P635S	TLR2_uc003inr.2_Missense_Mutation_p.P635S|TLR2_uc003ins.2_Missense_Mutation_p.P635S	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	635	Cytoplasmic (Potential).				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				CAGGAAAGCTCCCAGCAGGAA	0.537																0.284091	67.64687	71.325097	25	63	KEEP	---	---	---	---	13	14	27	39	-1	capture	Missense_Mutation	SNP	154625962	154625962	TLR2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	15836	195
CDH9	1007	broad.mit.edu	37	5	26902589	26902589	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26902589T>A	uc003jgs.1	-	7	1418	c.1249A>T	c.(1249-1251)ATA>TTA	p.I417L		NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	417	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						ACTTACTTTATTAAATTGTTC	0.308	Melanoma(8;187 585 15745 40864 52829)															0.300813	111.429794	115.787132	37	86	KEEP	---	---	---	---	21	19	53	43	-1	capture	Missense_Mutation	SNP	26902589	26902589	CDH9	5	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	3088	195
SPEF2	79925	broad.mit.edu	37	5	35641735	35641735	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35641735C>T	uc003jjo.2	+	3	475	c.364C>T	c.(364-366)CGT>TGT	p.R122C	SPEF2_uc003jjn.1_Missense_Mutation_p.R122C|SPEF2_uc003jjq.3_Missense_Mutation_p.R122C	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	122					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AACCATGCAACGTCTGACAAA	0.358																0.3125	115.458654	119.461696	40	88	KEEP	---	---	---	---	20	23	37	59	-1	capture	Missense_Mutation	SNP	35641735	35641735	SPEF2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14927	195
EFNA5	1946	broad.mit.edu	37	5	106763058	106763058	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:106763058G>C	uc003kol.2	-	2	560	c.278C>G	c.(277-279)ACT>AGT	p.T93S	EFNA5_uc010jbr.1_Missense_Mutation_p.T93S	NM_001962	NP_001953	P52803	EFNA5_HUMAN	ephrin-A5 precursor	93					cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		CCCTTTGGAAGTGTGGTCGCA	0.488																0.390863	245.942461	247.993247	77	120	KEEP	---	---	---	---	46	36	65	69	-1	capture	Missense_Mutation	SNP	106763058	106763058	EFNA5	5	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	4909	195
KIF4B	285643	broad.mit.edu	37	5	154396474	154396474	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154396474G>A	uc010jih.1	+	1	3215	c.3055G>A	c.(3055-3057)GAA>AAA	p.E1019K		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1019	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTCTTCTTTTGAATATATCCC	0.403																0.31405	214.223899	221.663897	76	166	KEEP	---	---	---	---	39	44	92	100	-1	capture	Missense_Mutation	SNP	154396474	154396474	KIF4B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	8226	195
SLIT3	6586	broad.mit.edu	37	5	168176560	168176560	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168176560C>T	uc003mab.2	-	19	2474	c.2054G>A	c.(2053-2055)AGT>AAT	p.S685N	SLIT3_uc010jjg.2_Missense_Mutation_p.S685N	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	685	LRRCT 3.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGGTTCCCACTGACGATCCG	0.557	Ovarian(29;311 847 10864 17279 24903)															0.321678	128.401196	132.438975	46	97	KEEP	---	---	---	---	27	21	44	64	-1	capture	Missense_Mutation	SNP	168176560	168176560	SLIT3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	14633	195
COL11A2	1302	broad.mit.edu	37	6	33143356	33143356	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33143356C>T	uc003ocx.1	-	30	2599	c.2371G>A	c.(2371-2373)GAG>AAG	p.E791K	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.E705K|COL11A2_uc003ocz.1_Missense_Mutation_p.E684K	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	791	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						ATCACCTTCTCGCCCATGAGC	0.657	Melanoma(1;90 116 3946 5341 17093)															0.271028	78.025589	83.086195	29	78	KEEP	---	---	---	---	20	13	45	37	-1	capture	Missense_Mutation	SNP	33143356	33143356	COL11A2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3633	195
GPR31	2853	broad.mit.edu	37	6	167571202	167571202	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167571202G>C	uc011egq.1	-	1	118	c.118C>G	c.(118-120)CTG>GTG	p.L40V		NM_005299	NP_005290	O00270	GPR31_HUMAN	G protein-coupled receptor 31	40	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		ACCCGGAACAGGAAGGTCCAC	0.662																0.27027	26.632472	28.394703	10	27	KEEP	---	---	---	---	5	7	16	18	-1	capture	Missense_Mutation	SNP	167571202	167571202	GPR31	6	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	6621	195
TNKS	8658	broad.mit.edu	37	8	9565981	9565981	+	Silent	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:9565981G>A	uc003wss.2	+	9	1562	c.1557G>A	c.(1555-1557)CCG>CCA	p.P519P	TNKS_uc011kwv.1_Silent_p.P519P|TNKS_uc011kww.1_Silent_p.P282P	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	519					mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TCAAACAACCGCAGTCTCATG	0.328																0.019544	-69.813054	9.753625	6	301	KEEP	---	---	---	---	3	5	176	174	-1	capture	Silent	SNP	9565981	9565981	TNKS	8	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16202	195
KIAA1429	25962	broad.mit.edu	37	8	95531632	95531632	+	Silent	SNP	A	G	G			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95531632A>G	uc003ygo.1	-	9	2107	c.2094T>C	c.(2092-2094)CCT>CCC	p.P698P	KIAA1429_uc003ygp.2_Silent_p.P698P|KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	698					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GCAGCACACCAGGGTGAGCAC	0.388																0.03252	-20.372338	8.954708	4	119	KEEP	---	---	---	---	3	1	59	73	-1	capture	Silent	SNP	95531632	95531632	KIAA1429	8	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	8153	195
FOXH1	8928	broad.mit.edu	37	8	145700407	145700407	+	Silent	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145700407C>T	uc003zdc.2	-	3	891	c.312G>A	c.(310-312)AAG>AAA	p.K104K		NM_003923	NP_003914	O75593	FOXH1_HUMAN	forkhead box H1	104	Fork-head.				axial mesoderm development|blood vessel development|cell migration involved in gastrulation|embryonic heart tube anterior/posterior pattern formation|floor plate formation|heart looping|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|specification of organ position|transforming growth factor beta receptor signaling pathway	activin responsive factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|R-SMAD binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AGAAGTTGCCCTTGGCCTGGG	0.687																0.272727	8.519973	9.03217	3	8	KEEP	---	---	---	---	2	1	5	4	-1	capture	Silent	SNP	145700407	145700407	FOXH1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	5952	195
KIAA1539	80256	broad.mit.edu	37	9	35108147	35108147	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35108147G>A	uc003zwl.2	-	3	450	c.125C>T	c.(124-126)GCG>GTG	p.A42V	KIAA1539_uc003zwm.2_Missense_Mutation_p.A42V|KIAA1539_uc003zwn.2_5'UTR|KIAA1539_uc003zwo.2_Missense_Mutation_p.A42V|KIAA1539_uc003zwp.1_Missense_Mutation_p.A42V|KIAA1539_uc010mkk.1_RNA	NM_025182	NP_079458	Q7L5A3	K1539_HUMAN	hypothetical protein LOC80256	42						nucleus				ovary(2)	2	all_epithelial(49;0.217)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GGGGGATGTCGCCCCCCCTGC	0.652																0.411765	35.737347	35.969783	14	20	KEEP	---	---	---	---	8	7	10	12	-1	capture	Missense_Mutation	SNP	35108147	35108147	KIAA1539	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8164	195
FAM102A	399665	broad.mit.edu	37	9	130710434	130710434	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130710434C>T	uc004bsx.1	-	6	611	c.532G>A	c.(532-534)GGT>AGT	p.G178S	FAM102A_uc004bsw.1_Missense_Mutation_p.G36S|FAM102A_uc004bsy.1_5'UTR	NM_001035254	NP_001030331	Q5T9C2	F102A_HUMAN	early estrogen-induced gene 1 protein isoform a	178	Ser-rich.									ovary(1)	1						CTGGTCCCACCACCCTTACAC	0.612																0.320513	67.051254	69.281677	25	53	KEEP	---	---	---	---	17	9	32	28	-1	capture	Missense_Mutation	SNP	130710434	130710434	FAM102A	9	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5336	195
LAMC3	10319	broad.mit.edu	37	9	133947006	133947006	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133947006C>T	uc004caa.1	+	18	3303	c.3205C>T	c.(3205-3207)CTT>TTT	p.L1069F		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1069	Domain II and I.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCATCACCTGCTTCCAGGTAC	0.672																0.382716	97.105587	98.082719	31	50	KEEP	---	---	---	---	16	20	35	19	-1	capture	Missense_Mutation	SNP	133947006	133947006	LAMC3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8536	195
PPEF1	5475	broad.mit.edu	37	X	18797156	18797156	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18797156A>T	uc004cyq.2	+	10	1068	c.587A>T	c.(586-588)TAT>TTT	p.Y196F	PPEF1_uc004cyp.2_Missense_Mutation_p.Y196F|PPEF1_uc004cyr.2_Missense_Mutation_p.Y196F|PPEF1_uc004cys.2_Missense_Mutation_p.Y196F|PPEF1_uc011mja.1_Missense_Mutation_p.Y131F|PPEF1_uc011mjb.1_Missense_Mutation_p.Y140F	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	196	Catalytic.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					AGGAACCCGTATGTTTTTAAT	0.408																0.279749	379.860451	400.745146	134	345	KEEP	---	---	---	---	77	73	208	185	-1	capture	Missense_Mutation	SNP	18797156	18797156	PPEF1	23	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	12208	195
F8	2157	broad.mit.edu	37	X	154159916	154159916	+	Missense_Mutation	SNP	G	A	A	rs137852435		TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154159916G>A	uc004fmt.2	-	14	2320	c.2149C>T	c.(2149-2151)CGG>TGG	p.R717W		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	717	F5/8 type A 2.|Plastocyanin-like 4.		R -> L (in HEMA; mild).|R -> W (in HEMA; mild).		acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CCTCTGTTCCGAAAGTCTGAG	0.423					359											0.307692	148.436787	154.008141	52	117	KEEP	---	---	---	---	27	30	68	58	-1	capture	Missense_Mutation	SNP	154159916	154159916	F8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	5304	195
PRB2	653247	broad.mit.edu	37	12	11546320	11546322	+	In_Frame_Del	DEL	TTG	-	-			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11546320_11546322delTTG	uc010shk.1	-	3	725_727	c.690_692delCAA	c.(688-693)AACAAG>AAG	p.N230del		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTTGGGACTTGTTGTCTCCTT	0.601																0.05			8	154		---	---	---	---						capture_indel	In_Frame_Del	DEL	11546320	11546322	PRB2	12	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12339	195
KIF13A	63971	broad.mit.edu	37	6	17788096	17788097	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17788096_17788097delAA	uc003ncg.3	-	27	3376_3377	c.3271_3272delTT	c.(3271-3273)TTAfs	p.L1091fs	KIF13A_uc003ncf.2_Frame_Shift_Del_p.L1078fs|KIF13A_uc003nch.3_Frame_Shift_Del_p.L1091fs|KIF13A_uc003nci.3_Frame_Shift_Del_p.L1078fs	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1091					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TACGCAGTTTAAGTCTTCTTCC	0.366																0.24			66	205		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	17788096	17788097	KIF13A	6	AA	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	8196	195
GPR64	10149	broad.mit.edu	37	X	19025360	19025360	+	Frame_Shift_Del	DEL	G	-	-			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:19025360delG	uc004cyx.2	-	20	1846	c.1682delC	c.(1681-1683)CCGfs	p.P561fs	GPR64_uc004cyy.2_Frame_Shift_Del_p.P558fs|GPR64_uc004cyz.2_Frame_Shift_Del_p.P547fs|GPR64_uc004czb.2_Frame_Shift_Del_p.P561fs|GPR64_uc004czc.2_Frame_Shift_Del_p.P545fs|GPR64_uc004czd.2_Frame_Shift_Del_p.P537fs|GPR64_uc004cze.2_Frame_Shift_Del_p.P531fs|GPR64_uc004czf.2_Frame_Shift_Del_p.P523fs|GPR64_uc004cza.2_Frame_Shift_Del_p.P539fs|GPR64_uc004cyw.2_Frame_Shift_Del_p.P545fs|GPR64_uc010nfj.2_Intron	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	561	Extracellular (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					CACCTGGCTCGGGTTGATGTG	0.502																0.27			37	98		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	19025360	19025360	GPR64	23	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	6638	195
NXF5	55998	broad.mit.edu	37	X	101096651	101096651	+	Frame_Shift_Del	DEL	G	-	-			TCGA-27-1836-01	TCGA-27-1836-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101096651delG	uc011mrk.1	-	5	595	c.235delC	c.(235-237)CAAfs	p.Q79fs	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	79	RRM.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						CACACCTTTTGGTTCTCATCA	0.488																0.28			70	176		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	101096651	101096651	NXF5	23	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	10691	195
