Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CROCC	9696	broad.mit.edu	37	1	17296756	17296756	+	Silent	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17296756G>A	uc001azt.2	+	34	5529	c.5460G>A	c.(5458-5460)CGG>CGA	p.R1820R	CROCC_uc001azu.2_Silent_p.R1123R|CROCC_uc001azv.2_Silent_p.R156R	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1820					cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AGGTGCTGCGGCAGCGGCAGG	0.428																0.666667	6.617715	6.455429	2	1	KEEP	---	---	---	---	2	0	2	2	-1	capture	Silent	SNP	17296756	17296756	CROCC	1	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	3858	207
HCRTR1	3061	broad.mit.edu	37	1	32086485	32086485	+	Silent	SNP	C	T	T	rs140406432		TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32086485C>T	uc009vtx.2	+	5	805	c.420C>T	c.(418-420)ATC>ATT	p.I140I	HCRTR1_uc001btb.2_5'UTR|HCRTR1_uc001btc.3_Silent_p.I54I|HCRTR1_uc001btd.2_Silent_p.I140I|HCRTR1_uc010ogl.1_Silent_p.I140I	NM_001525	NP_001516	O43613	OX1R_HUMAN	orexin receptor 1	140	Helical; Name=3; (Potential).				feeding behavior|neuropeptide signaling pathway|synaptic transmission	integral to plasma membrane				ovary(1)	1		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		TCAGCTTCATCGCCCTGGACC	0.612																0.148571	44.908358	65.589669	26	149	KEEP	---	---	---	---	14	16	67	87	-1	capture	Silent	SNP	32086485	32086485	HCRTR1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	6928	207
PABPC4	8761	broad.mit.edu	37	1	40038250	40038250	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40038250C>T	uc010oiv.1	-	2	1100	c.202G>A	c.(202-204)GCT>ACT	p.A68T	PABPC4_uc001cdl.2_Missense_Mutation_p.A68T|PABPC4_uc001cdm.2_Missense_Mutation_p.A68T	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	68	RRM 1.				blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GTGTCCAAAGCCCGCTCAGCT	0.463																0.02963	-25.618	7.19424	4	131	KEEP	---	---	---	---	0	4	65	85	-1	capture	Missense_Mutation	SNP	40038250	40038250	PABPC4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11270	207
CYP4X1	260293	broad.mit.edu	37	1	47512186	47512186	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47512186C>T	uc001cqt.2	+	9	1371	c.1121C>T	c.(1120-1122)ACG>ATG	p.T374M	CYP4X1_uc001cqr.2_Missense_Mutation_p.T373M|CYP4X1_uc001cqs.2_Missense_Mutation_p.T309M	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X,	374						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2						ATCAAGGAGACGTGCCGATTG	0.493																0.370968	134.202036	135.982494	46	78	KEEP	---	---	---	---	27	22	45	37	-1	capture	Missense_Mutation	SNP	47512186	47512186	CYP4X1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4153	207
CYP4A22	284541	broad.mit.edu	37	1	47606460	47606460	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47606460C>T	uc001cqv.1	+	2	255	c.204C>T	c.(202-204)CAC>CAT	p.H68H	CYP4A22_uc009vyo.2_Silent_p.H68H|CYP4A22_uc009vyp.2_Silent_p.H68H	NM_001010969	NP_001010969	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A,	68						endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding			skin(2)|ovary(1)|breast(1)	4						AGTTCCAACACGACCAGGAGC	0.498	Pancreas(88;1240 1470 2099 14214 37557)															0.217391	69.670826	79.83798	30	108	KEEP	---	---	---	---	17	14	54	72	-1	capture	Silent	SNP	47606460	47606460	CYP4A22	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4144	207
FCRLA	84824	broad.mit.edu	37	1	161682005	161682005	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161682005C>T	uc001gbe.2	+	5	1092	c.850C>T	c.(850-852)CAG>TAG	p.Q284*	FCRLA_uc001gbd.2_Nonsense_Mutation_p.Q278*|FCRLA_uc001gbf.2_Nonsense_Mutation_p.Q189*|FCRLA_uc001gbg.2_Nonsense_Mutation_p.Q138*|FCRLA_uc009wuo.2_Nonsense_Mutation_p.Q144*|FCRLA_uc009wup.2_Intron|FCRLA_uc009wuq.2_Intron	NM_032738	NP_116127	Q7L513	FCRLA_HUMAN	Fc receptor-like and mucin-like 1	261					cell differentiation	cytoplasm|extracellular region					0	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			GATCAGAGTGCAGGGTGAGTT	0.527																0.247619	61.092095	67.182949	26	79	KEEP	---	---	---	---	15	11	39	45	-1	capture	Nonsense_Mutation	SNP	161682005	161682005	FCRLA	1	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	5746	207
RYR2	6262	broad.mit.edu	37	1	237754030	237754030	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237754030A>G	uc001hyl.1	+	31	4018	c.3898A>G	c.(3898-3900)ATG>GTG	p.M1300V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1300	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACTGATATCATGTTTTATCG	0.522																0.288515	293.685736	307.997714	103	254	KEEP	---	---	---	---	66	54	154	142	-1	capture	Missense_Mutation	SNP	237754030	237754030	RYR2	1	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	13661	207
KIF5B	3799	broad.mit.edu	37	10	32306085	32306085	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:32306085T>C	uc001iwe.3	-	24	3217	c.2747A>G	c.(2746-2748)CAT>CGT	p.H916R		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	916	Globular.				stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				CTGTGCAGAATGCCCTCTTCT	0.383																0.482201	508.873293	508.957282	149	160	KEEP	---	---	---	---	81	83	91	85	-1	capture	Missense_Mutation	SNP	32306085	32306085	KIF5B	10	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	8228	207
PTEN	5728	broad.mit.edu	37	10	89720857	89720857	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720857C>A	uc001kfb.2	+	9	2039	c.1008C>A	c.(1006-1008)TAC>TAA	p.Y336*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	336	C2 tensin-type.			Y->F: Significantly lower phosphatase activity, reduced protein stability and decreased growth-inhibitory effect.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y336*(3)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.Y336F(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.R335fs*4(1)|p.W274_F341del(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CCAACCGATACTTTTCTCCAA	0.333			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.385321	123.417112	124.676055	42	67	KEEP	---	---	---	---	27	24	44	42	0.470588235294	capture	Nonsense_Mutation	SNP	89720857	89720857	PTEN	10	C	A	A	A	1	0	0	0	0	0	1	0	0	259	20	5	4	12633	207
SLC6A13	6540	broad.mit.edu	37	12	333249	333249	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:333249G>A	uc001qic.1	-	11	1273	c.1220C>T	c.(1219-1221)CCT>CTT	p.P407L	SLC6A13_uc009zdj.1_Missense_Mutation_p.P397L|SLC6A13_uc010sdl.1_Missense_Mutation_p.P315L	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	407					neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GAACACGTGAGGGTACATGTC	0.562																0.044118	-8.535642	6.594893	3	65	KEEP	---	---	---	---	2	1	36	34	-1	capture	Missense_Mutation	SNP	333249	333249	SLC6A13	12	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	14568	207
LST-3TM12	338821	broad.mit.edu	37	12	21201718	21201718	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21201718C>T	uc010sin.1	+	8	1067	c.1067C>T	c.(1066-1068)TCT>TTT	p.S356F	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.S403F	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	356						membrane	transporter activity				0						TTCAAATTGTCTTTAGTTGGA	0.353																0.423077	33.319951	33.454366	11	15	KEEP	---	---	---	---	5	6	8	8	-1	capture	Missense_Mutation	SNP	21201718	21201718	LST-3TM12	12	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8981	207
E2F7	144455	broad.mit.edu	37	12	77426878	77426878	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:77426878A>G	uc001sym.3	-	9	1570	c.1334T>C	c.(1333-1335)ATT>ACT	p.I445T	E2F7_uc009zse.2_5'Flank	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	445					cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						CAGGCTTCCAATTTCTAAAGA	0.353																0.318471	160.300164	164.895376	50	107	KEEP	---	---	---	---	33	31	76	60	-1	capture	Missense_Mutation	SNP	77426878	77426878	E2F7	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	4827	207
RPH3A	22895	broad.mit.edu	37	12	113313505	113313505	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113313505C>T	uc010syl.1	+	12	1267	c.905C>T	c.(904-906)CCG>CTG	p.P302L	RPH3A_uc001ttz.2_Missense_Mutation_p.P302L|RPH3A_uc001tty.2_Missense_Mutation_p.P298L|RPH3A_uc009zwe.1_Missense_Mutation_p.P298L|RPH3A_uc010sym.1_Missense_Mutation_p.P253L|RPH3A_uc001tua.2_Missense_Mutation_p.P62L	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	302	Pro-rich.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GGAAGCAGACCGGGTCCTGGG	0.577																0.244275	85.356884	93.155888	32	99	KEEP	---	---	---	---	19	22	54	61	-1	capture	Missense_Mutation	SNP	113313505	113313505	RPH3A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13443	207
SLC7A1	6541	broad.mit.edu	37	13	30110213	30110213	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:30110213A>G	uc001uso.2	-	3	500	c.113T>C	c.(112-114)GTG>GCG	p.V38A		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	38	Helical; (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCCGAGGGCCACCAGATCAAA	0.627																0.285714	52.770325	55.655296	20	50	KEEP	---	---	---	---	10	11	27	26	-1	capture	Missense_Mutation	SNP	30110213	30110213	SLC7A1	13	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	14584	207
SPERT	220082	broad.mit.edu	37	13	46287863	46287863	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46287863G>A	uc001van.1	+	3	783	c.703G>A	c.(703-705)GCC>ACC	p.A235T	SPERT_uc001vao.2_Missense_Mutation_p.A199T	NM_152719	NP_689932	Q8NA61	SPERT_HUMAN	spermatid associated	235						cytoplasmic membrane-bounded vesicle				central_nervous_system(1)|pancreas(1)	2		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		GGACCACGTCGCCCTGCAGGT	0.677																0.382353	33.586613	33.991364	13	21	KEEP	---	---	---	---	2	11	14	11	-1	capture	Missense_Mutation	SNP	46287863	46287863	SPERT	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14931	207
C15orf2	23742	broad.mit.edu	37	15	24921157	24921157	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921157G>A	uc001ywo.2	+	1	617	c.143G>A	c.(142-144)CGC>CAC	p.R48H		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	48					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CGCCCTTTCCGCGGCCTGTTC	0.761					443											0.21875	15.717144	18.04313	7	25	KEEP	---	---	---	---	3	4	10	18	-1	capture	Missense_Mutation	SNP	24921157	24921157	C15orf2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1770	207
SPPL2A	84888	broad.mit.edu	37	15	51031880	51031880	+	Silent	SNP	A	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:51031880A>G	uc001zyv.2	-	6	910	c.730T>C	c.(730-732)TTG>CTG	p.L244L		NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A	244						integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TTCTTACCCAACCATTTGTAG	0.308	Melanoma(50;790 1209 4069 22965 33125)															0.265152	108.565475	115.144536	35	97	KEEP	---	---	---	---	14	27	55	58	-1	capture	Silent	SNP	51031880	51031880	SPPL2A	15	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	14980	207
LARP6	55323	broad.mit.edu	37	15	71128745	71128745	+	Silent	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:71128745G>A	uc002ass.2	-	2	371	c.300C>T	c.(298-300)ATC>ATT	p.I100I		NM_018357	NP_060827	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	100	HTH La-type RNA-binding.				RNA processing	Golgi apparatus|nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0						AGTAGAATTCGATCTGATCCA	0.502																0.394737	275.817876	278.023529	90	138	KEEP	---	---	---	---	39	55	58	86	-1	capture	Silent	SNP	71128745	71128745	LARP6	15	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	8552	207
MSLNL	401827	broad.mit.edu	37	16	820272	820272	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:820272C>T	uc002cjz.1	-	15	2713	c.2713G>A	c.(2713-2715)GTG>ATG	p.V905M	MIR662_hsa-mir-662|MI0003670_RNA	NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	554	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						AGCGCAGTCACGTTGCCAACA	0.692																0.411765	21.622179	21.737705	7	10	KEEP	---	---	---	---	5	3	7	7	-1	capture	Missense_Mutation	SNP	820272	820272	MSLNL	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9792	207
OSGIN1	29948	broad.mit.edu	37	16	83994249	83994249	+	Missense_Mutation	SNP	C	T	T	rs62640906	byFrequency	TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:83994249C>T	uc002fha.2	+	5	912	c.529C>T	c.(529-531)CGC>TGC	p.R177C	OSGIN1_uc002fhb.2_Missense_Mutation_p.R94C|OSGIN1_uc002fhc.2_Missense_Mutation_p.R94C	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	177					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						TGCCCTTCTACGCCCAGACAC	0.632																0.317647	74.288195	76.805171	27	58	KEEP	---	---	---	---	11	19	31	34	-1	capture	Missense_Mutation	SNP	83994249	83994249	OSGIN1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11193	207
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	T	T	rs28934576	by1000genomes	TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577120C>T	uc002gim.2	-	8	1012	c.818G>A	c.(817-819)CGT>CAT	p.R273H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141H|TP53_uc010cng.1_Missense_Mutation_p.R141H|TP53_uc002gii.1_Missense_Mutation_p.R141H|TP53_uc010cnh.1_Missense_Mutation_p.R273H|TP53_uc010cni.1_Missense_Mutation_p.R273H|TP53_uc002gij.2_Missense_Mutation_p.R273H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	Pancreas(47;798 1329 9957 10801)	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	p.R273H(SW480-Tumor)|p.R273L(NCIH1876-Tumor)|p.R273H(SW620-Tumor)|p.R273H(MDAMB468-Tumor)|p.R273Y(SW1783-Tumor)|p.R273H(YD8-Tumor)|p.R273L(NCIH1838-Tumor)|p.R273H(HT29-Tumor)|p.R273H(MONOMAC6-Tumor)|p.R273L(SNU503-Tumor)|p.R273H(MOLT13-Tumor)|p.R273Y(PF382-Tumor)|p.R273L(NCIH1734-Tumor)|p.R273H(FTC133-Tumor)|p.R273H(SNU601-Tumor)|p.R273H(NCIH1975-Tumor)|p.R273H(NCIH1793-Tumor)|p.R273L(ECGI10-Tumor)|p.R273H(KP1NL-Tumor)|p.R273H(KP1N-Tumor)|p.R273L(NCIH1623-Tumor)|p.R273L(NCIH2009-Tumor)|p.R273H(NCIH508-Tumor)|p.R273H(MONOMAC1-Tumor)|p.R273H(HEC59-Tumor)|p.R273H(FTC238-Tumor)|p.R273H(OC316-Tumor)|p.R273Y(SNUC2A-Tumor)|p.R273H(SUDHL1-Tumor)|p.R273L(HCC38-Tumor)|p.R273H(NCIH2405-Tumor)|p.R273H(HEC6-Tumor)|p.R273H(EN-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.196429	25.49896	30.303058	11	45	KEEP	---	---	---	---	6	7	21	26	-1	capture	Missense_Mutation	SNP	7577120	7577120	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16264	207
SGK494	124923	broad.mit.edu	37	17	26939067	26939067	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26939067C>T	uc002hbr.1	-	7	720	c.688G>A	c.(688-690)GTG>ATG	p.V230M	SGK494_uc010waq.1_Intron|SGK494_uc010war.1_RNA|uc010crq.1_5'Flank|uc002hbs.1_RNA	NM_144610	NP_653211			uncharacterized serine/threonine-protein kinase												0						TCTACCTTCACATCTCGATGC	0.443					78											0.063492	-11.850599	25.628105	12	177	KEEP	---	---	---	---	10	6	95	113	-1	capture	Missense_Mutation	SNP	26939067	26939067	SGK494	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14106	207
KIF2B	84643	broad.mit.edu	37	17	51901460	51901460	+	Missense_Mutation	SNP	T	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51901460T>A	uc002iua.2	+	1	1222	c.1066T>A	c.(1066-1068)TTT>ATT	p.F356I	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	356	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CTATGGGACATTTTTTGAGAT	0.453																0.263441	126.595753	136.006125	49	137	KEEP	---	---	---	---	30	24	67	75	-1	capture	Missense_Mutation	SNP	51901460	51901460	KIF2B	17	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	8220	207
USH1G	124590	broad.mit.edu	37	17	72916669	72916669	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72916669C>T	uc002jme.1	-	2	445	c.262G>A	c.(262-264)GGA>AGA	p.G88R	USH1G_uc010wro.1_5'UTR	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	88	ANK 2.				equilibrioception|photoreceptor cell maintenance|sensory perception of sound	actin cytoskeleton				skin(2)	2	all_lung(278;0.172)|Lung NSC(278;0.207)					ATGTTGGCTCCGAAGGACACC	0.602																0.239669	73.329506	80.805238	29	92	KEEP	---	---	---	---	15	15	52	52	-1	capture	Missense_Mutation	SNP	72916669	72916669	USH1G	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16917	207
DNAH17	8632	broad.mit.edu	37	17	76502887	76502887	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76502887G>A	uc010wtu.1	-	4	770	c.593C>T	c.(592-594)ACG>ATG	p.T198M						full-length cDNA clone CS0DJ002YI14 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CAGTCTTTTCGTCTCTAAATA	0.557																0.269565	84.37816	89.885377	31	84	KEEP	---	---	---	---	15	19	44	50	-1	capture	Missense_Mutation	SNP	76502887	76502887	DNAH17	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4558	207
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358																0.034188	-19.500203	8.142804	4	113	KEEP	---	---	---	---	2	2	92	94	-1	capture	Missense_Mutation	SNP	14513764	14513764	POTEC	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12164	207
POLRMT	5442	broad.mit.edu	37	19	619972	619972	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:619972C>T	uc002lpf.1	-	12	2928	c.2872G>A	c.(2872-2874)GGC>AGC	p.G958S		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	958	Mediates interaction with TEFM.				transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGCCACGCCGCTGTACACG	0.701																0.136364	5.011709	7.826864	3	19	KEEP	---	---	---	---	2	1	10	14	-1	capture	Missense_Mutation	SNP	619972	619972	POLRMT	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12140	207
SIPA1L3	23094	broad.mit.edu	37	19	38655177	38655177	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38655177G>T	uc002ohk.2	+	15	4348	c.3839G>T	c.(3838-3840)AGC>ATC	p.S1280I		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	1280					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AACGCATCCAGCAGCCACAGC	0.607																0.294118	25.734388	27.025543	10	24	KEEP	---	---	---	---	15	20	32	31	0.428571428571	capture	Missense_Mutation	SNP	38655177	38655177	SIPA1L3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	14224	207
LILRB2	10288	broad.mit.edu	37	19	54780739	54780739	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54780739C>T	uc002qfb.2	-	10	1671	c.1405G>A	c.(1405-1407)GTC>ATC	p.V469I	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.V469I|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.V468I|LILRB2_uc010yet.1_Missense_Mutation_p.V353I	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	469	Helical; (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		agtaggaCGACGGCCACCAAG	0.413																0.042553	-26.302368	15.868112	8	180	KEEP	---	---	---	---	4	5	99	98	-1	capture	Missense_Mutation	SNP	54780739	54780739	LILRB2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8711	207
LENG8	114823	broad.mit.edu	37	19	54967251	54967251	+	Silent	SNP	T	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54967251T>G	uc002qfv.1	+	8	1164	c.1020T>G	c.(1018-1020)GGT>GGG	p.G340G	LENG8_uc002qfw.2_Silent_p.G377G			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	340							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GGGGCGGGGGTGCCCCGTCCC	0.687																0.151515	2.982892	7.184261	5	28	KEEP	---	---	---	---	7	9	23	19	-1	capture	Silent	SNP	54967251	54967251	LENG8	19	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	8644	207
LILRB1	10859	broad.mit.edu	37	19	55146136	55146136	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55146136G>A	uc002qgj.2	+	11	1745	c.1405G>A	c.(1405-1407)GTC>ATC	p.V469I	LILRB1_uc010erp.1_Missense_Mutation_p.V84I|LILRB1_uc002qgl.2_Missense_Mutation_p.V469I|LILRB1_uc002qgk.2_Missense_Mutation_p.V470I|LILRB1_uc002qgm.2_Missense_Mutation_p.V470I|LILRB1_uc010erq.2_Missense_Mutation_p.V453I|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	469	Helical; (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CTTGGTGGCCGTCAtcctact	0.413													HNSCC(37;0.09)			0.135135	16.60722	26.147692	10	64	KEEP	---	---	---	---	7	8	36	39	-1	capture	Missense_Mutation	SNP	55146136	55146136	LILRB1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8710	207
TEKT4	150483	broad.mit.edu	37	2	95539765	95539765	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:95539765G>A	uc002stw.1	+	3	718	c.625G>A	c.(625-627)GCC>ACC	p.A209T	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	209					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						CAAGATGGAGGCCTACAACAT	0.652																0.41	119.350505	120.059122	41	59	KEEP	---	---	---	---	25	23	42	38	-1	capture	Missense_Mutation	SNP	95539765	95539765	TEKT4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15640	207
MARCO	8685	broad.mit.edu	37	2	119752091	119752091	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:119752091G>A	uc002tln.1	+	17	1690	c.1558G>A	c.(1558-1560)GTC>ATC	p.V520I	MARCO_uc010yyf.1_Missense_Mutation_p.V442I	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	520	Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GGAGTGCAGCGTCTGACCCGG	0.602	GBM(8;18 374 7467 11269 32796)															0.252747	58.78682	63.834903	23	68	KEEP	---	---	---	---	15	14	52	38	-1	capture	Missense_Mutation	SNP	119752091	119752091	MARCO	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9224	207
NEB	4703	broad.mit.edu	37	2	152484105	152484105	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152484105C>T	uc010fnx.2	-	65	9537	c.9346G>A	c.(9346-9348)GAG>AAG	p.E3116K		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3116	Nebulin 84.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACGTCCACTCGTGCAGGTAG	0.532																0.327273	411.845169	423.49024	144	296	KEEP	---	---	---	---	76	79	168	171	-1	capture	Missense_Mutation	SNP	152484105	152484105	NEB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10209	207
LRP2	4036	broad.mit.edu	37	2	170044684	170044684	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170044684C>T	uc002ues.2	-	49	9337	c.9124G>A	c.(9124-9126)GGG>AGG	p.G3042R		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3042	LDL-receptor class A 24.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ATGCAGCGCCCGTTCTGACAG	0.512				p.G3042R(IGROV1-Tumor)	2055											0.264249	145.271046	154.946476	51	142	KEEP	---	---	---	---	24	28	73	78	-1	capture	Missense_Mutation	SNP	170044684	170044684	LRP2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8872	207
TTN	7273	broad.mit.edu	37	2	179437646	179437646	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179437646C>T	uc010zfg.1	-	275	65733	c.65509G>A	c.(65509-65511)GAA>AAA	p.E21837K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E15532K|TTN_uc010zfi.1_Missense_Mutation_p.E15465K|TTN_uc010zfj.1_Missense_Mutation_p.E15340K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22764							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAAGTCCTTCGGAATTCATG	0.488				p.E21837K(MEWO-Tumor)	8722											0.365854	89.62715	90.925131	30	52	KEEP	---	---	---	---	16	14	29	27	-1	capture	Missense_Mutation	SNP	179437646	179437646	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16617	207
ITGA4	3676	broad.mit.edu	37	2	182360569	182360569	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:182360569C>T	uc002unu.2	+	14	2208	c.1445C>T	c.(1444-1446)ACG>ATG	p.T482M	ITGA4_uc010frj.1_5'Flank	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	482	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	GTAAATAGAACGAAATTTGAC	0.388																0.327103	199.275135	204.949766	70	144	KEEP	---	---	---	---	32	43	69	88	-1	capture	Missense_Mutation	SNP	182360569	182360569	ITGA4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7801	207
BARD1	580	broad.mit.edu	37	2	215646041	215646041	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:215646041C>T	uc002veu.2	-	4	692	c.557G>A	c.(556-558)AGT>AAT	p.S186N	BARD1_uc010zjm.1_Missense_Mutation_p.S42N	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	186					cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGCAGGAGGACTTGGGGAAAC	0.383												Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				0.355422	175.973996	179.033307	59	107	KEEP	---	---	---	---	34	33	53	66	-1	capture	Missense_Mutation	SNP	215646041	215646041	BARD1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	1301	207
SPEG	10290	broad.mit.edu	37	2	220342016	220342016	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220342016C>T	uc010fwg.2	+	20	4578	c.4578C>T	c.(4576-4578)ACC>ACT	p.T1526T		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1526	Ig-like 8.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGCTGCTGACCGAGAGCAGCC	0.642					482											0.266667	21.688451	23.162535	8	22	KEEP	---	---	---	---	2	9	11	15	-1	capture	Silent	SNP	220342016	220342016	SPEG	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14928	207
TPTE	7179	broad.mit.edu	37	21	10951337	10951337	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10951337C>T	uc002yip.1	-	10	743	c.375G>A	c.(373-375)GAG>GAA	p.E125E	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.E107E|TPTE_uc002yir.1_Silent_p.E87E|TPTE_uc010gkv.1_5'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	125					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGAACGATACTCCAAAGGAA	0.328																0.048913	-19.689823	20.09491	9	175	KEEP	---	---	---	---	7	4	97	106	-1	capture	Silent	SNP	10951337	10951337	TPTE	21	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	16313	207
KRTAP6-1	337966	broad.mit.edu	37	21	31986020	31986020	+	Silent	SNP	G	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31986020G>T	uc002yop.2	-	1	204	c.204C>A	c.(202-204)GGC>GGA	p.G68G	KRTAP20-1_uc011ade.1_5'Flank	NM_181602	NP_853633	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	68						cytosol|intermediate filament					0						AATAATAGTAGCCAGAGCCAG	0.537																0.038168	-21.244885	8.978561	5	126	KEEP	---	---	---	---	4	4	73	66	0.5	capture	Silent	SNP	31986020	31986020	KRTAP6-1	21	G	T	T	T	1	0	0	0	0	0	0	0	1	431	34	4	4	8489	207
ITSN1	6453	broad.mit.edu	37	21	35254584	35254584	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35254584C>T	uc002yta.1	+	35	4647	c.4379C>T	c.(4378-4380)CCG>CTG	p.P1460L	DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Missense_Mutation_p.P1455L|ITSN1_uc002ytj.2_Missense_Mutation_p.P1399L|ITSN1_uc010gmm.1_RNA|ITSN1_uc010gmn.1_Intron|ITSN1_uc002ytk.1_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1460					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						TGCTTGGGGCCGCGCAAATTT	0.473																0.253012	61.247253	65.835937	21	62	KEEP	---	---	---	---	11	12	29	39	-1	capture	Missense_Mutation	SNP	35254584	35254584	ITSN1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7849	207
DIP2A	23181	broad.mit.edu	37	21	47957153	47957153	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47957153C>T	uc002zjo.2	+	14	1842	c.1659C>T	c.(1657-1659)AAC>AAT	p.N553N	DIP2A_uc011afy.1_Silent_p.N489N|DIP2A_uc011afz.1_Silent_p.N549N|DIP2A_uc002zjl.2_Silent_p.N553N|DIP2A_uc002zjm.2_Silent_p.N553N|DIP2A_uc010gql.2_Silent_p.N510N|DIP2A_uc002zjn.2_Silent_p.N553N|DIP2A_uc002zjp.1_Silent_p.N298N|DIP2A_uc002zjq.2_5'Flank	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	553					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CATTAACAAACGTGCTGGATT	0.443																0.128261	86.100843	148.043982	59	401	KEEP	---	---	---	---	33	37	232	243	-1	capture	Silent	SNP	47957153	47957153	DIP2A	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4485	207
SUSD2	56241	broad.mit.edu	37	22	24582099	24582099	+	Silent	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24582099G>A	uc002zzn.1	+	9	1499	c.1455G>A	c.(1453-1455)GCG>GCA	p.A485A		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	485	VWFD.|Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						GGGTGCAGGCGCGGGCCCAGC	0.647																0.392857	30.625757	30.904671	11	17	KEEP	---	---	---	---	8	3	9	13	-1	capture	Silent	SNP	24582099	24582099	SUSD2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	15296	207
FGD5	152273	broad.mit.edu	37	3	14861789	14861789	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14861789C>T	uc003bzc.2	+	1	1321	c.1211C>T	c.(1210-1212)GCG>GTG	p.A404V	FGD5_uc011avk.1_Missense_Mutation_p.A404V	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	404					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CAGGGTGGAGCGGCCGAGGGT	0.647																0.305556	29.830795	31.034087	11	25	KEEP	---	---	---	---	3	10	13	18	-1	capture	Missense_Mutation	SNP	14861789	14861789	FGD5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5782	207
COL7A1	1294	broad.mit.edu	37	3	48621742	48621742	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48621742T>G	uc003ctz.2	-	36	4187	c.4186A>C	c.(4186-4188)ACA>CCA	p.T1396P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1396	Triple-helical region.|Interrupted collagenous region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTCATGGCTGTTCCAGGAAGC	0.607																0.384615	7.08048	7.293722	5	8	KEEP	---	---	---	---	10	3	2	9	-1	capture	Missense_Mutation	SNP	48621742	48621742	COL7A1	3	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	3669	207
CD86	942	broad.mit.edu	37	3	121822548	121822548	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121822548G>A	uc003eet.2	+	3	370	c.254G>A	c.(253-255)CGC>CAC	p.R85H	CD86_uc011bjo.1_Missense_Mutation_p.R3H|CD86_uc011bjp.1_Intron|CD86_uc003eeu.2_Missense_Mutation_p.R79H	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1	85	Ig-like V-type.|Extracellular (Potential).				interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	TATATGGGCCGCACAAGTTTT	0.423	GBM(67;1379 1389 36064 39806)															0.021552	-50.586949	8.720479	5	227	KEEP	---	---	---	---	3	4	125	120	-1	capture	Missense_Mutation	SNP	121822548	121822548	CD86	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3014	207
SLBP	7884	broad.mit.edu	37	4	1701407	1701407	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1701407C>T	uc003gdi.1	-	5	478	c.363G>A	c.(361-363)ATG>ATA	p.M121I	SLBP_uc010ibx.1_Missense_Mutation_p.M128I|SLBP_uc003gdj.1_Missense_Mutation_p.M101I|SLBP_uc003gdk.1_Missense_Mutation_p.M82I|SLBP_uc011bvf.1_Missense_Mutation_p.M86I|SLBP_uc003gdl.1_Missense_Mutation_p.M38I	NM_006527	NP_006518	Q14493	SLBP_HUMAN	stem-loop (histone) binding protein	121					DNA replication involved in S phase|histone mRNA 3'-end processing|mRNA export from nucleus|regulation of S phase|termination of RNA polymerase II transcription	cytosol|histone pre-mRNA 3'end processing complex|nucleoplasm	histone pre-mRNA DCP binding|histone pre-mRNA stem-loop binding|protein binding				0		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.0055)			GCACAGTAGACATAGACTCCT	0.393																0.313433	112.295854	116.450089	42	92	KEEP	---	---	---	---	25	22	41	63	-1	capture	Missense_Mutation	SNP	1701407	1701407	SLBP	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14265	207
ANK2	287	broad.mit.edu	37	4	114278539	114278539	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114278539C>T	uc003ibe.3	+	38	8865	c.8765C>T	c.(8764-8766)CCA>CTA	p.P2922L	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.P224L|ANK2_uc011cgb.1_Missense_Mutation_p.P2937L	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2889					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCTATGATCCACAAATCACT	0.408																0.276231	360.669378	381.722089	129	338	KEEP	---	---	---	---	76	74	188	216	-1	capture	Missense_Mutation	SNP	114278539	114278539	ANK2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	618	207
ZFP42	132625	broad.mit.edu	37	4	188924445	188924445	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:188924445C>G	uc003izg.1	+	3	729	c.484C>G	c.(484-486)CTA>GTA	p.L162V	ZFP42_uc003izh.1_Missense_Mutation_p.L162V|ZFP42_uc003izi.1_Missense_Mutation_p.L162V	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	162					female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TGGCATTGACCTATCAGATCC	0.453																0.245283	206.180987	224.984718	78	240	KEEP	---	---	---	---	40	49	120	156	-1	capture	Missense_Mutation	SNP	188924445	188924445	ZFP42	4	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	17530	207
PCDHB16	57717	broad.mit.edu	37	5	140563779	140563779	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140563779G>T	uc003liv.2	+	1	2800	c.1645G>T	c.(1645-1647)GTG>TTG	p.V549L		NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	549	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGGTGCGCGTGCTGGTGCT	0.711																0.203125	29.8515	35.080007	13	51	KEEP	---	---	---	---	11	8	39	51	0.578947368421	capture	Missense_Mutation	SNP	140563779	140563779	PCDHB16	5	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	11444	207
GABRG2	2566	broad.mit.edu	37	5	161580200	161580200	+	Silent	SNP	C	T	T	rs113085352		TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161580200C>T	uc003lyz.3	+	9	1588	c.1230C>T	c.(1228-1230)GAC>GAT	p.D410D	GABRG2_uc010jjc.2_Silent_p.D458D|GABRG2_uc003lyy.3_Silent_p.D418D|GABRG2_uc011dej.1_Silent_p.D315D	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	410	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		AGTGTCTGGACGGCAAGGACT	0.463																0.279221	106.459569	113.21637	43	111	KEEP	---	---	---	---	24	20	51	65	-1	capture	Silent	SNP	161580200	161580200	GABRG2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6114	207
RFX6	222546	broad.mit.edu	37	6	117232121	117232121	+	Silent	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117232121G>A	uc003pxm.2	+	7	759	c.696G>A	c.(694-696)TCG>TCA	p.S232S		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	232					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						GTAAATATTCGCTTAGCTCAA	0.343																0.340314	191.665225	195.947091	65	126	KEEP	---	---	---	---	42	35	79	67	-1	capture	Silent	SNP	117232121	117232121	RFX6	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13162	207
CD36	948	broad.mit.edu	37	7	80300317	80300317	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80300317C>T	uc003uhc.2	+	13	1527	c.843C>T	c.(841-843)TCC>TCT	p.S281S	CD36_uc003uhd.3_Silent_p.S281S|CD36_uc011kgv.1_Silent_p.S205S|CD36_uc003uhe.3_Silent_p.S281S|CD36_uc003uhf.3_Silent_p.S281S|CD36_uc003uhg.3_Silent_p.S281S|CD36_uc003uhh.3_Silent_p.S281S	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen	281	Extracellular (Potential).				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						TATTTGAATCCGACGTTAATC	0.388																0.197397	232.465124	271.770888	91	370	KEEP	---	---	---	---	53	54	201	221	-1	capture	Silent	SNP	80300317	80300317	CD36	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2978	207
SEMA3C	10512	broad.mit.edu	37	7	80434993	80434993	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80434993G>A	uc003uhj.2	-	7	1182	c.620C>T	c.(619-621)GCG>GTG	p.A207V	SEMA3C_uc011kgw.1_Missense_Mutation_p.A225V|SEMA3C_uc011kgx.1_Missense_Mutation_p.A59V	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	207	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						AGTTCTGACCGCATTCCTCTT	0.323																0.035461	-23.344395	9.712674	5	136	KEEP	---	---	---	---	3	3	86	69	-1	capture	Missense_Mutation	SNP	80434993	80434993	SEMA3C	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13919	207
TES	26136	broad.mit.edu	37	7	115892026	115892026	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:115892026C>T	uc003vho.2	+	5	1096	c.915C>T	c.(913-915)GAC>GAT	p.D305D	TES_uc011kmy.1_Silent_p.D63D|TES_uc003vhp.2_Silent_p.D296D|uc003vhq.1_5'Flank	NM_015641	NP_056456	Q9UGI8	TES_HUMAN	testin isoform 1	305	LIM zinc-binding 2.				negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			CTGGCTGTGACGAGGTATGTT	0.478																0.210526	48.753934	56.11315	20	75	KEEP	---	---	---	---	8	14	41	39	-1	capture	Silent	SNP	115892026	115892026	TES	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15650	207
WEE2	494551	broad.mit.edu	37	7	141408767	141408767	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141408767C>T	uc003vwn.2	+	1	615	c.209C>T	c.(208-210)TCG>TTG	p.S70L	FLJ40852_uc011krh.1_Intron|FLJ40852_uc010lnm.2_Intron|FLJ40852_uc010lnn.2_Intron|FLJ40852_uc003vwm.3_Intron|FLJ40852_uc010lno.2_Intron	NM_001105558	NP_001099028	P0C1S8	WEE2_HUMAN	WEE1 homolog 2	70					egg activation|female meiosis|female pronucleus assembly|meiotic metaphase II|meiotic prophase I|mitosis|negative regulation of oocyte development|regulation of meiosis I	centrosome|nucleus	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2	Melanoma(164;0.0171)					GACACATCTTCGGAAAAAGAC	0.517					241											0.037221	-64.325275	29.159048	15	388	KEEP	---	---	---	---	7	8	174	244	-1	capture	Missense_Mutation	SNP	141408767	141408767	WEE2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17226	207
ARHGEF5	7984	broad.mit.edu	37	7	144060365	144060365	+	Missense_Mutation	SNP	T	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144060365T>A	uc003wel.2	+	2	721	c.603T>A	c.(601-603)AGT>AGA	p.S201R	ARHGEF5_uc003wek.2_Missense_Mutation_p.S201R	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	201					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					GCTCTGAAAGTGGGACTATCA	0.532																0.050761	-63.317392	63.127927	30	561	KEEP	---	---	---	---	19	15	309	307	-1	capture	Missense_Mutation	SNP	144060365	144060365	ARHGEF5	7	T	A	A	A	1	0	0	0	0	1	0	0	0	764	59	4	4	902	207
DOCK5	80005	broad.mit.edu	37	8	25190203	25190203	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25190203G>A	uc003xeg.2	+	20	2223	c.2086G>A	c.(2086-2088)GCA>ACA	p.A696T	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.A410T|DOCK5_uc003xei.2_Missense_Mutation_p.A266T|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	696						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TGTGTTTGACGCACTGGTAAG	0.214	Pancreas(145;34 1887 3271 10937 30165)															0.351852	55.307838	56.353624	19	35	KEEP	---	---	---	---	8	14	22	16	-1	capture	Missense_Mutation	SNP	25190203	25190203	DOCK5	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4646	207
DOCK5	80005	broad.mit.edu	37	8	25225732	25225732	+	Silent	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25225732C>T	uc003xeg.2	+	32	3386	c.3249C>T	c.(3247-3249)ATC>ATT	p.I1083I	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Silent_p.I797I|DOCK5_uc003xei.2_Silent_p.I653I|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1083						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAAAGGAAATCGGCTTTAGAA	0.413	Pancreas(145;34 1887 3271 10937 30165)															0.342857	36.491136	37.253866	12	23	KEEP	---	---	---	---	8	6	15	12	-1	capture	Silent	SNP	25225732	25225732	DOCK5	8	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	4646	207
NOV	4856	broad.mit.edu	37	8	120431487	120431487	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120431487C>T	uc003yoq.2	+	4	900	c.679C>T	c.(679-681)CGG>TGG	p.R227W		NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor	227	TSP type-1.				regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTTCTCCACCCGGGTCACCAA	0.532					71											0.053942	-25.22534	25.465435	13	228	KEEP	---	---	---	---	10	6	112	145	-1	capture	Missense_Mutation	SNP	120431487	120431487	NOV	8	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	10460	207
CPSF1	29894	broad.mit.edu	37	8	145620691	145620691	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145620691G>A	uc003zcj.2	-	27	3130	c.3055C>T	c.(3055-3057)CGC>TGC	p.R1019C	MIR939_hsa-mir-939|MI0005761_5'Flank|CPSF1_uc011lld.1_RNA	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	1019					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GCCGTGCAGCGCAGCGGGATC	0.667	NSCLC(133;1088 1848 27708 34777 35269)															0.051724	-5.801343	6.508378	3	55	KEEP	---	---	---	---	0	4	22	40	-1	capture	Missense_Mutation	SNP	145620691	145620691	CPSF1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3789	207
UHRF2	115426	broad.mit.edu	37	9	6413501	6413501	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6413501A>G	uc003zjy.2	+	1	351	c.11A>G	c.(10-12)CAG>CGG	p.Q4R	UHRF2_uc003zjz.2_RNA	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains	4	Ubiquitin-like.				cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		ATGTGGATACAGGTTCGCACC	0.512																0.277778	40.49451	42.90057	15	39	KEEP	---	---	---	---	8	12	17	38	-1	capture	Missense_Mutation	SNP	6413501	6413501	UHRF2	9	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	16852	207
IPPK	64768	broad.mit.edu	37	9	95400529	95400529	+	Missense_Mutation	SNP	G	A	A	rs146634367		TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95400529G>A	uc004asl.1	-	9	947	c.670C>T	c.(670-672)CGG>TGG	p.R224W	IPPK_uc004ask.1_5'Flank	NM_022755	NP_073592	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	224					inositol or phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol pentakisphosphate 2-kinase activity			ovary(2)	2						ACGGGGCTCCGGGCATCTTTG	0.562																0.27027	47.131372	50.618218	20	54	KEEP	---	---	---	---	9	12	28	33	-1	capture	Missense_Mutation	SNP	95400529	95400529	IPPK	9	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	7724	207
CYBB	1536	broad.mit.edu	37	X	37668843	37668843	+	Silent	SNP	T	C	C			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37668843T>C	uc004ddr.2	+	12	1546	c.1485T>C	c.(1483-1485)CAT>CAC	p.H495H	CYBB_uc011mkf.1_Silent_p.H463H|CYBB_uc011mkg.1_Silent_p.H228H	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	495	Cytoplasmic (Potential).				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						CTGTGCACCATGATGAGGAGA	0.398																0.166667	5.042712	6.306392	2	10	KEEP	---	---	---	---	0	2	5	6	-1	capture	Silent	SNP	37668843	37668843	CYBB	23	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	4093	207
GDPD2	54857	broad.mit.edu	37	X	69652284	69652284	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69652284C>T	uc004dyh.2	+	13	1686	c.1435C>T	c.(1435-1437)CGT>TGT	p.R479C	GDPD2_uc010nky.1_3'UTR|GDPD2_uc011mpk.1_Missense_Mutation_p.R530C|GDPD2_uc011mpl.1_Missense_Mutation_p.R400C|GDPD2_uc011mpm.1_Missense_Mutation_p.R400C	NM_017711	NP_060181	Q9HCC8	GDPD2_HUMAN	osteoblast differentiation promoting factor	479	Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol inositolphosphodiesterase activity|metal ion binding			ovary(2)	2	Renal(35;0.156)					GCAGCAGATGCGTTACCCTAT	0.522																0.587302	229.494211	230.348489	74	52	KEEP	---	---	---	---	45	46	30	34	-1	capture	Missense_Mutation	SNP	69652284	69652284	GDPD2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6264	207
NXF3	56000	broad.mit.edu	37	X	102337213	102337213	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102337213G>A	uc004eju.2	-	9	931	c.860C>T	c.(859-861)ACG>ATG	p.T287M	NXF3_uc010noi.1_Missense_Mutation_p.T137M|NXF3_uc011mrw.1_Missense_Mutation_p.T287M|NXF3_uc011mrx.1_Missense_Mutation_p.T198M	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	287						cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3						CGAGAAGGTCGTGCACACTGG	0.542																0.633333	442.328666	445.613386	133	77	KEEP	---	---	---	---	74	76	32	59	-1	capture	Missense_Mutation	SNP	102337213	102337213	NXF3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10690	207
IRS4	8471	broad.mit.edu	37	X	107978476	107978476	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107978476C>G	uc004eoc.2	-	1	1132	c.1099G>C	c.(1099-1101)GAG>CAG	p.E367Q		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	367						plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						CCTCCCGGCTCGAGCGGCACC	0.632																0.041322	-14.830382	12.543899	5	116	KEEP	---	---	---	---	6	1	86	77	-1	capture	Missense_Mutation	SNP	107978476	107978476	IRS4	23	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	7765	207
CDKN2C	1031	broad.mit.edu	37	1	51439583	51439583	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-1753-01	TCGA-28-1753-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51439583delC	uc001csf.2	+	3	1364	c.148delC	c.(148-150)CCCfs	p.P50fs	CDKN2C_uc001csg.2_Frame_Shift_Del_p.P50fs	NM_001262	NP_001253	P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C	50	ANK 2.				cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding	p.0?(4)|p.?(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(2)|thyroid(1)|lung(1)|kidney(1)	17				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		ACTTGGAAATCCCGAGATTGC	0.428	Melanoma(47;50 1155 4767 22863 47597)				40	D		glioma|MM				Multiple_Endocrine_Neoplasia_type_1				0.31			76	166		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	51439583	51439583	CDKN2C	1	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	3134	207
