Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FAF1	11124	broad.mit.edu	37	1	51001131	51001131	+	Splice_Site	SNP	T	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51001131T>C	uc009vyx.1	-	16	1469	c.1406_splice	c.e16-1	p.G469_splice	FAF1_uc009vyw.1_Splice_Site|FAF1_uc001cse.1_Splice_Site_p.G469_splice|FAF1_uc010onc.1_Splice_Site_p.G227_splice	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TTGTGTTCCCTAAAAACATAT	0.323																0.019608	-33.306581	6.322765	3	150	KEEP	---	---	---	---	2	1	83	80	-1	capture	Splice_Site	SNP	51001131	51001131	FAF1	1	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	5323	239
C1orf161	126868	broad.mit.edu	37	1	116666896	116666896	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116666896C>T	uc001egc.1	+	4	664	c.399C>T	c.(397-399)ATC>ATT	p.I133I		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	133											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATGTGAACATCGACGGAGACA	0.557																0.546667	129.981304	130.123683	41	34	KEEP	---	---	---	---	25	18	17	20	-1	capture	Silent	SNP	116666896	116666896	C1orf161	1	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	1991	239
ASTN1	460	broad.mit.edu	37	1	176993825	176993825	+	Silent	SNP	C	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:176993825C>A	uc001glc.2	-	6	1376	c.1164G>T	c.(1162-1164)CTG>CTT	p.L388L	ASTN1_uc001glb.1_Silent_p.L388L|ASTN1_uc001gld.1_Silent_p.L388L|ASTN1_uc009wwx.1_Silent_p.L388L|ASTN1_uc001gle.3_RNA	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	388	Helical; (Potential).				cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						TGATGCTGATCAGGGTCAAGG	0.512					849											0.050847	-6.228022	6.384354	3	56	KEEP	---	---	---	---	2	1	28	33	0.333333333333	capture	Silent	SNP	176993825	176993825	ASTN1	1	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	1055	239
PROX1	5629	broad.mit.edu	37	1	214209144	214209144	+	Silent	SNP	C	G	G			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214209144C>G	uc001hkh.2	+	5	2453	c.2181C>G	c.(2179-2181)TCC>TCG	p.S727S		NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	727	Prospero-like.				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TTTTCAAATCCCCGAACTGCC	0.423																0.035714	-18.997805	7.241272	4	108	KEEP	---	---	---	---	2	2	71	55	-1	capture	Silent	SNP	214209144	214209144	PROX1	1	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	12456	239
PARP1	142	broad.mit.edu	37	1	226558164	226558164	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226558164C>T	uc001hqd.3	-	15	2296	c.2125G>A	c.(2125-2127)GCA>ACA	p.A709T		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	709	PARP alpha-helical.				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		ATGGAGTATGCGGCCTGGATC	0.597					1012						Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					0.017021	-55.19975	6.723483	4	231	KEEP	---	---	---	---	5	1	154	122	-1	capture	Missense_Mutation	SNP	226558164	226558164	PARP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11357	239
AKR1C4	1109	broad.mit.edu	37	10	5238864	5238864	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5238864G>A	uc001ihw.2	+	1	67	c.34G>A	c.(34-36)GAT>AAT	p.D12N		NM_001818	NP_001809	P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	12					androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity			ovary(1)	1					NADH(DB00157)	AGAGCTAAATGATGGTCACTT	0.418																0.116279	16.123378	34.826389	15	114	KEEP	---	---	---	---	6	10	66	65	-1	capture	Missense_Mutation	SNP	5238864	5238864	AKR1C4	10	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	472	239
TAF3	83860	broad.mit.edu	37	10	8006394	8006394	+	Silent	SNP	A	G	G			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:8006394A>G	uc010qbd.1	+	3	921	c.921A>G	c.(919-921)AAA>AAG	p.K307K		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	307					maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						CTGTATCCAAAGAAAAGAAAT	0.393																0.075	0.89238	8.304592	3	37	KEEP	---	---	---	---	1	2	14	25	-1	capture	Silent	SNP	8006394	8006394	TAF3	10	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	15413	239
OPN4	94233	broad.mit.edu	37	10	88419055	88419055	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:88419055C>T	uc001kdq.2	+	5	857	c.630C>T	c.(628-630)AGC>AGT	p.S210S	OPN4_uc001kdp.2_Silent_p.S221S|OPN4_uc010qmk.1_Silent_p.S221S|OPN4_uc009xsx.1_5'Flank	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1	210	Extracellular (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						GGCTCCCAGGCGCCTACGTGC	0.622																0.644068	113.558239	114.635946	38	21	KEEP	---	---	---	---	18	24	9	16	-1	capture	Silent	SNP	88419055	88419055	OPN4	10	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	10786	239
LOC729020	729020	broad.mit.edu	37	10	105005758	105005758	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105005758C>T	uc009xxi.2	+	1	115	c.5C>T	c.(4-6)GCG>GTG	p.A2V	uc001kwr.2_Intron	NM_001143909	NP_001137381	Q2QD12	Q2QD12_HUMAN	rcRPE protein	2					carbohydrate metabolic process		ribulose-phosphate 3-epimerase activity				0						AGCGGTATGGCGTCGGGCTGC	0.522																0.702703	81.26624	82.632362	26	11	KEEP	---	---	---	---	23	7	7	6	-1	capture	Missense_Mutation	SNP	105005758	105005758	LOC729020	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8805	239
OR52M1	119772	broad.mit.edu	37	11	4566916	4566916	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4566916C>T	uc010qyf.1	+	1	496	c.496C>T	c.(496-498)CGC>TGC	p.R166C		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTGATGATCCGCCTGCGGCT	0.522																0.40367	141.882335	142.765593	44	65	KEEP	---	---	---	---	32	22	45	32	-1	capture	Missense_Mutation	SNP	4566916	4566916	OR52M1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11030	239
MRVI1	10335	broad.mit.edu	37	11	10647541	10647541	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10647541C>G	uc010rcc.1	-	9	1726	c.1340G>C	c.(1339-1341)CGG>CCG	p.R447P	MRVI1_uc001miw.2_Missense_Mutation_p.R438P|MRVI1_uc010rcb.1_Missense_Mutation_p.R439P|MRVI1_uc009ygb.1_Missense_Mutation_p.R132P|MRVI1_uc001mix.2_Missense_Mutation_p.R132P|MRVI1_uc001miz.2_Missense_Mutation_p.R356P|MRVI1_uc009ygc.1_Missense_Mutation_p.R356P|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Missense_Mutation_p.R132P|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	420					platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TTTCTGCATCCGCACGGGCTG	0.597																0.153846	4.941948	6.430651	2	11	KEEP	---	---	---	---	0	4	7	4	-1	capture	Missense_Mutation	SNP	10647541	10647541	MRVI1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	9763	239
HTR3A	3359	broad.mit.edu	37	11	113853896	113853896	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113853896C>T	uc010rxb.1	+	5	680	c.447C>T	c.(445-447)GGC>GGT	p.G149G	HTR3A_uc010rxa.1_Silent_p.G149G|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.G128G	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	143	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	GGCATCAAGGCGAAGTTCAGA	0.537																0.304348	161.651335	168.71943	63	144	KEEP	---	---	---	---	35	32	79	73	-1	capture	Silent	SNP	113853896	113853896	HTR3A	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7369	239
CPNE8	144402	broad.mit.edu	37	12	39155951	39155951	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:39155951T>A	uc001rls.1	-	9	727	c.643A>T	c.(643-645)ATC>TTC	p.I215F		NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII	215	C2 2.									pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				CTGACTGAGATCTTGAATGCT	0.308																0.371429	124.700797	126.224751	39	66	KEEP	---	---	---	---	24	22	36	46	-1	capture	Missense_Mutation	SNP	39155951	39155951	CPNE8	12	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	3783	239
KIF21A	55605	broad.mit.edu	37	12	39726188	39726188	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:39726188C>A	uc001rly.2	-	21	3025	c.2879G>T	c.(2878-2880)AGA>ATA	p.R960I	KIF21A_uc001rlv.2_5'UTR|KIF21A_uc001rlw.2_Missense_Mutation_p.R277I|KIF21A_uc001rlx.2_Missense_Mutation_p.R947I|KIF21A_uc001rlz.2_Missense_Mutation_p.R924I|KIF21A_uc010skl.1_Missense_Mutation_p.R947I	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	960	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TTTCTCTCGTCTTTTTGTGAG	0.398																0.400585	389.583524	392.545937	137	205	KEEP	---	---	---	---	91	63	109	122	0.409090909091	capture	Missense_Mutation	SNP	39726188	39726188	KIF21A	12	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	8210	239
GRIP1	23426	broad.mit.edu	37	12	66838466	66838466	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66838466C>T	uc001stk.2	-	12	1670	c.1429G>A	c.(1429-1431)GGA>AGA	p.G477R	GRIP1_uc010sta.1_Missense_Mutation_p.G421R|GRIP1_uc001stj.2_Missense_Mutation_p.G259R|GRIP1_uc001stl.1_Missense_Mutation_p.G369R|GRIP1_uc001stm.2_Missense_Mutation_p.G477R	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	529	PDZ 4.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GTTGGAATTCCATTGATGGCC	0.458																0.437908	193.892701	194.408583	67	86	KEEP	---	---	---	---	38	31	51	43	-1	capture	Missense_Mutation	SNP	66838466	66838466	GRIP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	6720	239
OAS2	4939	broad.mit.edu	37	12	113435338	113435338	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113435338T>A	uc001tuj.2	+	4	781	c.641T>A	c.(640-642)ATC>AAC	p.I214N	OAS2_uc001tui.1_Missense_Mutation_p.I214N	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	214	OAS domain 1.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						CAGAAAAAAATCAAGGATTTA	0.488	Pancreas(199;709 2232 18410 33584 35052)															0.072072	-1.08728	19.837328	8	103	KEEP	---	---	---	---	3	5	66	45	-1	capture	Missense_Mutation	SNP	113435338	113435338	OAS2	12	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	10705	239
ULK1	8408	broad.mit.edu	37	12	132379629	132379629	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132379629C>T	uc001uje.2	+	1	351	c.83C>T	c.(82-84)GCG>GTG	p.A28V		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	28	Protein kinase.|ATP (By similarity).				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GGCGCCTTCGCGGTGGTCTTC	0.692					916											0.466667	21.72461	21.739007	7	8	KEEP	---	---	---	---	4	4	3	6	-1	capture	Missense_Mutation	SNP	132379629	132379629	ULK1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16857	239
KLHL1	57626	broad.mit.edu	37	13	70314591	70314591	+	Silent	SNP	T	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:70314591T>C	uc001vip.2	-	8	2531	c.1737A>G	c.(1735-1737)CAA>CAG	p.Q579Q	KLHL1_uc010thm.1_Silent_p.Q518Q	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	579	Kelch 3.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CAAATGTCCATTGTTGACTCT	0.413																0.40625	124.131362	124.860737	39	57	KEEP	---	---	---	---	21	23	31	36	-1	capture	Silent	SNP	70314591	70314591	KLHL1	13	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	8285	239
CLEC14A	161198	broad.mit.edu	37	14	38723832	38723832	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38723832C>A	uc001wum.1	-	1	1743	c.1396G>T	c.(1396-1398)GTC>TTC	p.V466F		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	466	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CAGTCCCCGACTTTCACCCCA	0.602																0.690722	221.05376	224.194411	67	30	KEEP	---	---	---	---	28	44	10	23	0.611111111111	capture	Missense_Mutation	SNP	38723832	38723832	CLEC14A	14	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	3464	239
NR2F2	7026	broad.mit.edu	37	15	96877485	96877485	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:96877485G>C	uc010uri.1	+	2	1847	c.623G>C	c.(622-624)GGT>GCT	p.G208A	NR2F2_uc002btp.2_Missense_Mutation_p.G75A|NR2F2_uc010urj.1_Missense_Mutation_p.G55A|NR2F2_uc010urk.1_Missense_Mutation_p.G55A	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	208	Interaction with ZFPM2 (By similarity).|Ligand-binding (By similarity).				lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			AACATCATGGGTATCGAGAAC	0.602																0.028	-47.686384	13.705056	7	243	KEEP	---	---	---	---	4	6	146	167	-1	capture	Missense_Mutation	SNP	96877485	96877485	NR2F2	15	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	10535	239
KRTAP4-7	100132476	broad.mit.edu	37	17	39240900	39240900	+	Missense_Mutation	SNP	T	G	G	rs61746948		TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240900T>G	uc010wfn.1	+	1	442	c.442T>G	c.(442-444)TTG>GTG	p.L148V		NM_033061	NP_149050			keratin associated protein 4-7												0						TCCCCGCCCCTTGTGCTGTGC	0.552																0.15	6.51139	8.860136	3	17	KEEP	---	---	---	---	3	2	9	11	-1	capture	Missense_Mutation	SNP	39240900	39240900	KRTAP4-7	17	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	8475	239
KRTAP4-7	100132476	broad.mit.edu	37	17	39240908	39240908	+	Silent	SNP	T	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240908T>C	uc010wfn.1	+	1	450	c.450T>C	c.(448-450)TGT>TGC	p.C150C		NM_033061	NP_149050			keratin associated protein 4-7												0						CCTTGTGCTGTGCCTCCTCTT	0.567																0.157895	4.811955	6.933649	3	16	KEEP	---	---	---	---	2	2	8	11	-1	capture	Silent	SNP	39240908	39240908	KRTAP4-7	17	T	C	C	C	1	0	0	0	0	0	0	0	1	764	59	3	3	8475	239
KRTAP4-9	100132386	broad.mit.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	T	T	rs113059833	by1000genomes	TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39261693A>T	uc010wfp.1	+	1	53	c.53A>T	c.(52-54)GAC>GTC	p.D18V		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18						keratin filament					0						TGCGGCCAAGACCTCTGTCAG	0.627																0.153846	6.022498	10.502353	6	33	KEEP	---	---	---	---	5	1	15	18	-1	capture	Missense_Mutation	SNP	39261693	39261693	KRTAP4-9	17	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	8477	239
CDKN2D	1032	broad.mit.edu	37	19	10678076	10678076	+	Silent	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10678076G>A	uc002mpa.2	-	2	461	c.159C>T	c.(157-159)AGC>AGT	p.S53S	KRI1_uc002mox.1_5'Flank|KRI1_uc002moy.1_5'Flank|CDKN2D_uc002mpb.2_Silent_p.S53S	NM_001800	NP_001791	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D	53	ANK 1.				anti-apoptosis|autophagic cell death|cell cycle arrest|DNA synthesis involved in DNA repair|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|negative regulation of caspase activity|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|response to retinoic acid|response to UV|response to vitamin D	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding				0			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CGATGGCGGTGCTGCCAAACA	0.592					14							Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				0.25	112.531064	123.215482	47	141	KEEP	---	---	---	---	33	19	91	77	-1	capture	Silent	SNP	10678076	10678076	CDKN2D	19	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	3135	239
CYP4F11	57834	broad.mit.edu	37	19	16025181	16025181	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16025181C>T	uc002nbu.2	-	12	1367	c.1331G>A	c.(1330-1332)CGT>CAT	p.R444H	CYP4F11_uc010eab.1_Silent_p.P422P|CYP4F11_uc002nbt.2_Missense_Mutation_p.R444H	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	444					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						TTGGTCGAAACGGAAGGGGTC	0.587																0.462222	324.889072	325.167201	104	121	KEEP	---	---	---	---	51	59	55	73	-1	capture	Missense_Mutation	SNP	16025181	16025181	CYP4F11	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4146	239
HKR1	284459	broad.mit.edu	37	19	37853365	37853365	+	Missense_Mutation	SNP	G	A	A	rs112164866		TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37853365G>A	uc002ogb.2	+	6	937	c.668G>A	c.(667-669)CGG>CAG	p.R223Q	HKR1_uc002ofx.2_5'UTR|HKR1_uc002ofy.2_5'UTR|HKR1_uc002oga.2_Missense_Mutation_p.R205Q|HKR1_uc010xto.1_Missense_Mutation_p.R205Q|HKR1_uc002ogc.2_Missense_Mutation_p.R204Q|HKR1_uc010xtp.1_Missense_Mutation_p.R162Q|HKR1_uc002ogd.2_Missense_Mutation_p.R162Q	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1	223					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGCCCTGAACGGAGGGCAGAT	0.468																0.027273	-20.666852	6.457096	3	107	KEEP	---	---	---	---	1	3	50	68	-1	capture	Missense_Mutation	SNP	37853365	37853365	HKR1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7119	239
CRX	1406	broad.mit.edu	37	19	48342915	48342915	+	Silent	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48342915G>A	uc002phq.3	+	4	795	c.591G>A	c.(589-591)CCG>CCA	p.P197P		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	197					organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.P197P(1)		breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		CCTACGCCCCGGCCTCCGCTT	0.672	Pancreas(57;461 1196 22201 40716 47188)															0.4375	192.633355	193.115199	63	81	KEEP	---	---	---	---	33	30	32	51	-1	capture	Silent	SNP	48342915	48342915	CRX	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3867	239
TPO	7173	broad.mit.edu	37	2	1480946	1480946	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1480946C>T	uc002qww.2	+	8	999	c.908C>T	c.(907-909)GCG>GTG	p.A303V	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.A303V|TPO_uc002qwr.2_Missense_Mutation_p.A303V|TPO_uc002qwx.2_Missense_Mutation_p.A303V|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Missense_Mutation_p.A303V	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	303	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GACCAAGGCGCGCTCTTTGGG	0.706					723											0.416667	12.368564	12.442166	5	7	KEEP	---	---	---	---	3	3	6	5	-1	capture	Missense_Mutation	SNP	1480946	1480946	TPO	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16293	239
APOB	338	broad.mit.edu	37	2	21233706	21233706	+	Nonsense_Mutation	SNP	G	A	A	rs147863759		TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21233706G>A	uc002red.2	-	26	6162	c.6034C>T	c.(6034-6036)CGA>TGA	p.R2012*		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2012					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GCCAGAGTTCGTCCAGTAAGC	0.428																0.407216	237.383692	238.844244	79	115	KEEP	---	---	---	---	37	47	91	47	-1	capture	Nonsense_Mutation	SNP	21233706	21233706	APOB	2	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	778	239
THSD7B	80731	broad.mit.edu	37	2	137988734	137988734	+	Missense_Mutation	SNP	A	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:137988734A>C	uc002tva.1	+	7	1751	c.1751A>C	c.(1750-1752)CAG>CCG	p.Q584P	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.Q474P	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCCTGTTCCCAGTCCTGTTCA	0.507																0.432432	45.690767	45.838621	16	21	KEEP	---	---	---	---	6	10	18	3	-1	capture	Missense_Mutation	SNP	137988734	137988734	THSD7B	2	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	15765	239
R3HDML	140902	broad.mit.edu	37	20	42979302	42979302	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42979302G>A	uc002xls.1	+	5	804	c.632G>A	c.(631-633)GGC>GAC	p.G211D		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	211						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			TCTTCCAGGGGCAACTGGATT	0.423																0.407407	98.363639	98.96904	33	48	KEEP	---	---	---	---	20	16	26	26	-1	capture	Missense_Mutation	SNP	42979302	42979302	R3HDML	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12784	239
MPPED1	758	broad.mit.edu	37	22	43831125	43831125	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43831125C>T	uc011apv.1	+	3	619	c.396C>T	c.(394-396)AAC>AAT	p.N132N	MPPED1_uc011apw.1_Silent_p.N26N|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Silent_p.N132N|MPPED1_uc011apz.1_Silent_p.N165N	NM_001044370	NP_001037835	O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	132							hydrolase activity				0		all_neural(38;0.0244)|Ovarian(80;0.0694)				AGAAGTTCAACGAGTGGCTGG	0.682																0.62963	55.6817	56.08069	17	10	KEEP	---	---	---	---	9	9	7	4	-1	capture	Silent	SNP	43831125	43831125	MPPED1	22	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9653	239
ITIH3	3699	broad.mit.edu	37	3	52828907	52828907	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52828907C>T	uc003dfv.2	+	1	124	c.88C>T	c.(88-90)CTT>TTT	p.L30F	ITIH3_uc011bek.1_Missense_Mutation_p.L30F	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	30	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTTTCGGCTGCTTGGGGTGAG	0.572																0.491525	191.444158	191.451615	58	60	KEEP	---	---	---	---	46	28	36	36	-1	capture	Missense_Mutation	SNP	52828907	52828907	ITIH3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	7828	239
DPPA4	55211	broad.mit.edu	37	3	109046840	109046840	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:109046840C>T	uc003dxq.3	-	7	965	c.910G>A	c.(910-912)GAA>AAA	p.E304K	DPPA4_uc011bho.1_3'UTR	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	304						nucleus	protein binding			upper_aerodigestive_tract(1)	1						ATATTCTATTCCCATTGGAGG	0.373																0.298361	256.395983	267.486037	91	214	KEEP	---	---	---	---	57	50	119	128	-1	capture	Missense_Mutation	SNP	109046840	109046840	DPPA4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	4691	239
BOD1L	259282	broad.mit.edu	37	4	13605551	13605551	+	Silent	SNP	T	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13605551T>C	uc003gmz.1	-	10	3090	c.2973A>G	c.(2971-2973)AGA>AGG	p.R991R	BOD1L_uc010idr.1_Silent_p.R328R	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	991	Lys-rich.						DNA binding			ovary(5)|breast(1)	6						GTAACTTGGCTCTATGACTAG	0.403																0.449244	745.454159	746.491905	208	255	KEEP	---	---	---	---	125	91	154	115	-1	capture	Silent	SNP	13605551	13605551	BOD1L	4	T	C	C	C	1	0	0	0	0	0	0	0	1	699	54	3	3	1471	239
NUP54	53371	broad.mit.edu	37	4	77069476	77069476	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77069476T>G	uc003hjs.2	-	1	180	c.52A>C	c.(52-54)ACC>CCC	p.T18P	NUP54_uc010ije.2_5'UTR|NUP54_uc011cbs.1_5'UTR|NUP54_uc011cbt.1_Missense_Mutation_p.T18P|NUP54_uc003hjt.2_5'UTR	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	18	Gly-rich.|9 X 2 AA repeats of F-G.				carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						GGGGCCGCGGTGGCTGCAGCG	0.667																0.25	8.218569	8.901092	3	9	KEEP	---	---	---	---	0	4	8	4	-1	capture	Missense_Mutation	SNP	77069476	77069476	NUP54	4	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	10674	239
PET112L	5188	broad.mit.edu	37	4	152680061	152680061	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:152680061C>T	uc003iml.2	-	2	202	c.190G>A	c.(190-192)GCT>ACT	p.A64T	PET112L_uc003imm.3_Missense_Mutation_p.A64T	NM_004564	NP_004555	O75879	GATB_HUMAN	PET112-like precursor	64						mitochondrion	ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor|translation factor activity, nucleic acid binding				0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)			L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	ACCACAGCAGCCCATTTGTGT	0.363																0.380165	138.721231	140.245469	46	75	KEEP	---	---	---	---	21	30	33	57	-1	capture	Missense_Mutation	SNP	152680061	152680061	PET112L	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11637	239
EGR1	1958	broad.mit.edu	37	5	137803130	137803130	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137803130C>T	uc003ldb.1	+	2	1262	c.992C>T	c.(991-993)ACG>ATG	p.T331M	EGR1_uc011cyu.1_Intron	NM_001964	NP_001955	P18146	EGR1_HUMAN	early growth response 1	331					cellular response to heparin|cellular response to mycophenolic acid|glomerular mesangial cell proliferation|interleukin-1-mediated signaling pathway|positive regulation of glomerular metanephric mesangial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of protein sumoylation|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytoplasm|nucleus	histone acetyltransferase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CCCAGCAAGACGCCCCCCCAC	0.652																0.413408	216.819434	217.990272	74	105	KEEP	---	---	---	---	32	47	47	69	-1	capture	Missense_Mutation	SNP	137803130	137803130	EGR1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4926	239
PCDHA3	56145	broad.mit.edu	37	5	140181750	140181750	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140181750C>T	uc003lhf.2	+	1	968	c.968C>T	c.(967-969)ACG>ATG	p.T323M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.T323M	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	323	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAGAAGCCACGGATAAAGGA	0.378																0.411111	225.817289	227.059476	74	106	KEEP	---	---	---	---	31	48	55	60	-1	capture	Missense_Mutation	SNP	140181750	140181750	PCDHA3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11428	239
ARAP3	64411	broad.mit.edu	37	5	141041300	141041300	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141041300G>A	uc003llm.2	-	21	3148	c.3070C>T	c.(3070-3072)CCG>TCG	p.P1024S	ARAP3_uc003lll.2_5'UTR|ARAP3_uc011dbe.1_Missense_Mutation_p.P686S|ARAP3_uc003lln.2_Missense_Mutation_p.P855S	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1024	Rho-GAP.				cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						TTGACCCGCGGCAGGCAGCCA	0.572																0.041667	-15.376186	6.303144	4	92	KEEP	---	---	---	---	3	3	97	96	-1	capture	Missense_Mutation	SNP	141041300	141041300	ARAP3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	833	239
SH3RF2	153769	broad.mit.edu	37	5	145428731	145428731	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145428731C>T	uc003lnt.2	+	7	1483	c.1245C>T	c.(1243-1245)GAC>GAT	p.D415D	SH3RF2_uc011dbl.1_Silent_p.D415D|SH3RF2_uc011dbm.1_5'Flank|SH3RF2_uc003lnu.2_5'Flank	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	415	SH3 3.						ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTGCCAGGACGGCTGGCTCA	0.597														OREG0016895	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.333333	111.030208	114.057982	41	82	KEEP	---	---	---	---	20	24	47	45	-1	capture	Silent	SNP	145428731	145428731	SH3RF2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14152	239
PRSS16	10279	broad.mit.edu	37	6	27216987	27216987	+	Missense_Mutation	SNP	G	A	A	rs145240806		TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27216987G>A	uc003nja.2	+	4	458	c.446G>A	c.(445-447)CGC>CAC	p.R149H	PRSS16_uc011dkt.1_Intron|PRSS16_uc003njb.2_Intron|PRSS16_uc010jqq.1_Missense_Mutation_p.R39H|PRSS16_uc010jqr.1_Missense_Mutation_p.R39H|PRSS16_uc003njc.1_RNA|PRSS16_uc003njd.2_5'Flank	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	149					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						GCCCAGCTCCGCTTCTTGTCC	0.512	NSCLC(178;1118 2105 17078 23587 44429)															0.24031	73.468906	81.403844	31	98	KEEP	---	---	---	---	11	24	56	61	-1	capture	Missense_Mutation	SNP	27216987	27216987	PRSS16	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12511	239
HIST1H2BO	8348	broad.mit.edu	37	6	27861564	27861564	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27861564C>T	uc003nkc.1	+	1	362	c.324C>T	c.(322-324)GCC>GCT	p.A108A	HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	NM_003527	NP_003518	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	108					nucleosome assembly	nucleosome|nucleus	DNA binding				0						GGGAGCTGGCCAAGCACGCCG	0.637																0.033613	-21.502774	6.719274	4	115	KEEP	---	---	---	---	3	2	63	68	-1	capture	Silent	SNP	27861564	27861564	HIST1H2BO	6	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	7079	239
OR2J3	442186	broad.mit.edu	37	6	29080293	29080293	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29080293T>C	uc011dll.1	+	1	626	c.626T>C	c.(625-627)TTT>TCT	p.F209S		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGCTCCATATTTGTTCTCATA	0.448																0.343434	117.821867	119.964719	34	65	KEEP	---	---	---	---	25	17	30	35	-1	capture	Missense_Mutation	SNP	29080293	29080293	OR2J3	6	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	10908	239
ZBTB12	221527	broad.mit.edu	37	6	31868436	31868436	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31868436G>A	uc003nyd.1	-	2	823	c.647C>T	c.(646-648)GCC>GTC	p.A216V	EHMT2_uc003nxz.1_5'Flank|EHMT2_uc003nya.1_5'Flank|EHMT2_uc003nyb.1_5'Flank|C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_5'Flank	NM_181842	NP_862825	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	216					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACCTCCAGGGCCGACTCCAC	0.627																0.025157	-32.944501	6.81012	4	155	KEEP	---	---	---	---	1	4	100	85	-1	capture	Missense_Mutation	SNP	31868436	31868436	ZBTB12	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17405	239
ZNF318	24149	broad.mit.edu	37	6	43325085	43325085	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43325085G>A	uc003oux.2	-	3	1045	c.967C>T	c.(967-969)CGA>TGA	p.R323*	ZNF318_uc003ouw.2_RNA	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	323	Potential.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TCTCGCTTTCGTCTGGCAAGA	0.522																0.470588	149.382201	149.459607	48	54	KEEP	---	---	---	---	29	20	28	30	-1	capture	Nonsense_Mutation	SNP	43325085	43325085	ZNF318	6	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	17716	239
TNPO3	23534	broad.mit.edu	37	7	128612562	128612562	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128612562G>A	uc003vol.1	-	19	2722	c.2348C>T	c.(2347-2349)TCT>TTT	p.S783F	TNPO3_uc010llx.1_Missense_Mutation_p.S194F|TNPO3_uc003vom.1_Missense_Mutation_p.S717F|TNPO3_uc010lly.1_Missense_Mutation_p.S817F|TNPO3_uc010llz.1_Missense_Mutation_p.S719F	NM_012470	NP_036602	Q9Y5L0	TNPO3_HUMAN	transportin 3	783					splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5						CAGGGTAGTAGAGGCAATGGC	0.478	Pancreas(147;583 2585 39696 52331)															0.101449	12.539092	34.412058	14	124	KEEP	---	---	---	---	6	8	79	57	-1	capture	Missense_Mutation	SNP	128612562	128612562	TNPO3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16220	239
PARP12	64761	broad.mit.edu	37	7	139746776	139746776	+	Silent	SNP	C	T	T	rs147556524		TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139746776C>T	uc003vvl.1	-	5	1768	c.894G>A	c.(892-894)CCG>CCA	p.P298P	PARP12_uc003vvk.1_Silent_p.P84P|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	298	WWE 1.					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					GCCATCGATACGGCAAATGGA	0.403																0.5	125.328443	125.328443	39	39	KEEP	---	---	---	---	21	22	27	15	-1	capture	Silent	SNP	139746776	139746776	PARP12	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11360	239
NOBOX	135935	broad.mit.edu	37	7	144097327	144097327	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144097327G>A	uc011kue.1	-	5	923	c.923C>T	c.(922-924)ACG>ATG	p.T308M		NM_001080413	NP_001073882	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	308	Homeobox.				cell differentiation|oogenesis	nucleus	sequence-specific DNA binding			ovary(1)	1	Melanoma(164;0.14)					CACCCCCACCGTCTGGGCAAT	0.552																0.3625	83.530665	84.870295	29	51	KEEP	---	---	---	---	15	18	28	31	-1	capture	Missense_Mutation	SNP	144097327	144097327	NOBOX	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10419	239
XKR4	114786	broad.mit.edu	37	8	56270319	56270319	+	Silent	SNP	A	G	G			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56270319A>G	uc003xsf.2	+	2	920	c.888A>G	c.(886-888)GTA>GTG	p.V296V		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	296						integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			GGAAAATGGTATATGAGTATG	0.438																0.153846	51.660205	68.03753	22	121	KEEP	---	---	---	---	16	8	83	54	-1	capture	Silent	SNP	56270319	56270319	XKR4	8	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	17314	239
CPSF1	29894	broad.mit.edu	37	8	145624369	145624369	+	Silent	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145624369G>A	uc003zcj.2	-	16	1602	c.1527C>T	c.(1525-1527)AAC>AAT	p.N509N		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	509					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			ACAAAGCCCCGTTCTTCCCGT	0.627	NSCLC(133;1088 1848 27708 34777 35269)															0.458333	32.422701	32.458902	11	13	KEEP	---	---	---	---	4	12	5	9	-1	capture	Silent	SNP	145624369	145624369	CPSF1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3789	239
ASS1	445	broad.mit.edu	37	9	133342180	133342180	+	Silent	SNP	C	T	T			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133342180C>T	uc004bzm.2	+	7	845	c.489C>T	c.(487-489)TAC>TAT	p.Y163Y	ASS1_uc004bzn.2_Silent_p.Y163Y|ASS1_uc010mza.2_Silent_p.Y239Y|ASS1_uc004bzo.2_Silent_p.Y144Y|ASS1_uc010mzb.2_Silent_p.Y201Y|ASS1_uc004bzp.2_Silent_p.Y163Y|ASS1_uc010mzc.2_Silent_p.Y163Y	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	163					arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	TGATGGAGTACGCAAAGGTAT	0.612																0.4	77.373355	77.929659	26	39	KEEP	---	---	---	---	14	14	19	23	-1	capture	Silent	SNP	133342180	133342180	ASS1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1052	239
SFRS17A	8227	broad.mit.edu	37	X	1712915	1712915	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1712915T>C	uc004cqa.2	+	2	756	c.560T>C	c.(559-561)GTG>GCG	p.V187A	SFRS17A_uc010ncx.1_Missense_Mutation_p.V187A|SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_5'Flank	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	187	RRM.				B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATCCGGAATGTGGACATCCCC	0.607																0.08284	4.72953	34.625744	14	155	KEEP	---	---	---	---	8	6	73	89	-1	capture	Missense_Mutation	SNP	1712915	1712915	SFRS17A	23	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	14066	239
ZIC3	7547	broad.mit.edu	37	X	136649606	136649606	+	Silent	SNP	G	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:136649606G>A	uc004fak.2	+	1	1261	c.756G>A	c.(754-756)TCG>TCA	p.S252S		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	252	C2H2-type 1; atypical.				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					AGGAGCTGTCGTGCAAGTGGA	0.607																0.763636	136.456433	139.944491	42	13	KEEP	---	---	---	---	30	25	6	7	-1	capture	Silent	SNP	136649606	136649606	ZIC3	23	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17560	239
IMPG1	3617	broad.mit.edu	37	6	76782168	76782169	+	Frame_Shift_Ins	INS	-	A	A			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76782168_76782169insA	uc003pik.1	-	1	167_168	c.37_38insT	c.(37-39)TGGfs	p.W13fs		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	13					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GAGAAAAATCCAAAAAACAAAA	0.287	Pancreas(37;839 1141 2599 26037)															0.61			36	23		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	76782168	76782169	IMPG1	6	-	A	A	A	1	0	1	1	0	0	0	0	0	273	21	5	5	7651	239
ZNF282	8427	broad.mit.edu	37	7	148920939	148920940	+	Frame_Shift_Ins	INS	-	C	C			TCGA-32-2615-01	TCGA-32-2615-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148920939_148920940insC	uc003wfm.2	+	8	1321_1322	c.1216_1217insC	c.(1216-1218)GCCfs	p.A406fs	ZNF282_uc011kun.1_Frame_Shift_Ins_p.A406fs|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	406					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		cccacccccggccccgccacag	0.386																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	148920939	148920940	ZNF282	7	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	17699	239
