Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FUCA1	2517	broad.mit.edu	37	1	24186383	24186383	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24186383C>G	uc001bie.2	-	4	718	c.673G>C	c.(673-675)GAT>CAT	p.D225H	FUCA1_uc009vqt.1_RNA|FUCA1_uc010oed.1_RNA	NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor	225					fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		CAGATCAGATCAGGTTTATAG	0.373																0.308411	115.034858	118.535219	33	74	KEEP	---	---	---	---	14	27	60	29	-1	capture	Missense_Mutation	SNP	24186383	24186383	FUCA1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	6036	248
PODN	127435	broad.mit.edu	37	1	53544261	53544261	+	Missense_Mutation	SNP	G	A	A	rs138913141		TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53544261G>A	uc001cuv.2	+	8	1230	c.1223G>A	c.(1222-1224)CGG>CAG	p.R408Q	PODN_uc001cuw.2_Missense_Mutation_p.R389Q|PODN_uc010onr.1_Missense_Mutation_p.R389Q|PODN_uc010ons.1_Missense_Mutation_p.R266Q	NM_153703	NP_714914	Q7Z5L7	PODN_HUMAN	podocan	360	LRR 12.				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding			ovary(1)|pancreas(1)	2						GGCCTCAAGCGGTTGCACACG	0.647																0.4	108.885402	109.671312	36	54	KEEP	---	---	---	---	18	23	25	33	-1	capture	Missense_Mutation	SNP	53544261	53544261	PODN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12081	248
INADL	10207	broad.mit.edu	37	1	62299351	62299351	+	Missense_Mutation	SNP	C	G	G	rs112258254	byFrequency	TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62299351C>G	uc001dab.2	+	17	2120	c.2006C>G	c.(2005-2007)ACT>AGT	p.T669S	INADL_uc009waf.1_Missense_Mutation_p.T669S|INADL_uc001daa.2_Missense_Mutation_p.T669S|INADL_uc001dad.3_Missense_Mutation_p.T366S|INADL_uc001dac.2_RNA	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	669					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GATGTCAATACTGAAGAAGAT	0.363																0.408451	207.62239	208.66278	58	84	KEEP	---	---	---	---	24	37	42	49	-1	capture	Missense_Mutation	SNP	62299351	62299351	INADL	1	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	7654	248
TTC24	164118	broad.mit.edu	37	1	156554756	156554756	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156554756G>A	uc009wsc.1	+	5	639	c.499G>A	c.(499-501)GTC>ATC	p.V167I		NM_001105669	NP_001099139	A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	447							binding			pancreas(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CACAGCAGGTGTCCAGCACAG	0.642																0.411765	19.119708	19.235812	7	10	KEEP	---	---	---	---	5	5	5	7	-1	capture	Missense_Mutation	SNP	156554756	156554756	TTC24	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16574	248
ETV3L	440695	broad.mit.edu	37	1	157068529	157068529	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157068529G>T	uc001fqq.1	-	3	740	c.455C>A	c.(454-456)CCA>CAA	p.P152Q		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	152						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				CACCAGCGCTGGCCGACACAG	0.652																0.140187	20.746295	34.13028	15	92	KEEP	---	---	---	---	6	13	49	59	0.315789473684	capture	Missense_Mutation	SNP	157068529	157068529	ETV3L	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	5235	248
PLEKHA6	22874	broad.mit.edu	37	1	204214763	204214763	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204214763G>A	uc001hau.2	-	14	2329	c.2012C>T	c.(2011-2013)ACG>ATG	p.T671M	PLEKHA6_uc009xau.1_5'Flank|PLEKHA6_uc009xav.1_5'Flank	NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	671										ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GGCGGTGTCCGTGCCCCGGGA	0.602																0.428571	171.656945	172.247609	57	76	KEEP	---	---	---	---	43	27	45	44	-1	capture	Missense_Mutation	SNP	204214763	204214763	PLEKHA6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11963	248
OR2T12	127064	broad.mit.edu	37	1	248458330	248458330	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248458330C>T	uc010pzj.1	-	1	551	c.551G>A	c.(550-552)CGT>CAT	p.R184H		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			ACAAGCCAAACGCACCAACAC	0.552																0.369668	225.610666	228.754032	78	133	KEEP	---	---	---	---	57	34	76	81	-1	capture	Missense_Mutation	SNP	248458330	248458330	OR2T12	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10923	248
ARHGAP21	57584	broad.mit.edu	37	10	24873489	24873489	+	Missense_Mutation	SNP	A	C	C			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24873489A>C	uc001isb.2	-	26	6216	c.5729T>G	c.(5728-5730)CTT>CGT	p.L1910R	ARHGAP21_uc010qdb.1_RNA	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1909					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						TATGGAAAGAAGGGGCCTGTT	0.483																0.638655	263.569857	265.569789	76	43	KEEP	---	---	---	---	44	44	19	27	-1	capture	Missense_Mutation	SNP	24873489	24873489	ARHGAP21	10	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	864	248
BTAF1	9044	broad.mit.edu	37	10	93786503	93786503	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93786503G>A	uc001khr.2	+	36	5328	c.5230G>A	c.(5230-5232)GGG>AGG	p.G1744R		NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	1744	Helicase C-terminal.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	p.G1744G(1)		ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				CCATCGCATTGGGCAGGTAAA	0.383																0.105263	3.537919	6.478274	2	17	KEEP	---	---	---	---	0	2	7	14	-1	capture	Missense_Mutation	SNP	93786503	93786503	BTAF1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	1524	248
KNDC1	85442	broad.mit.edu	37	10	135020727	135020727	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135020727C>A	uc001llz.1	+	20	3667	c.3666C>A	c.(3664-3666)GAC>GAA	p.D1222E		NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	1222					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		ACACGCTGGACTTCAGCCCCC	0.687																0.083333	2.330488	6.564871	2	22	KEEP	---	---	---	---	2	0	13	11	-1	capture	Missense_Mutation	SNP	135020727	135020727	KNDC1	10	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	8346	248
LRP4	4038	broad.mit.edu	37	11	46894746	46894746	+	Silent	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46894746G>A	uc001ndn.3	-	30	4634	c.4488C>T	c.(4486-4488)ATC>ATT	p.I1496I	uc001ndl.2_RNA	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1496	Extracellular (Potential).|LDL-receptor class B 18.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		TTGCCCGTTCGATCTTGGCAA	0.552																0.168421	31.637823	41.532611	16	79	KEEP	---	---	---	---	10	10	43	46	-1	capture	Silent	SNP	46894746	46894746	LRP4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	8875	248
OR4A15	81328	broad.mit.edu	37	11	55135883	55135883	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55135883C>T	uc010rif.1	+	1	524	c.524C>T	c.(523-525)GCG>GTG	p.A175V		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	175	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						ATGCTGTTGGCGGCCTGGATT	0.443																0.428256	593.185223	595.216857	194	259	KEEP	---	---	---	---	101	144	128	206	-1	capture	Missense_Mutation	SNP	55135883	55135883	OR4A15	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10944	248
TECTA	7007	broad.mit.edu	37	11	121000704	121000704	+	Missense_Mutation	SNP	C	T	T	rs139132568		TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:121000704C>T	uc010rzo.1	+	9	2725	c.2725C>T	c.(2725-2727)CGC>TGC	p.R909C		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	909	VWFD 2.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TTATCGAAGCCGCTCCAGGTG	0.562																0.287356	70.5415	74.068394	25	62	KEEP	---	---	---	---	13	14	27	47	-1	capture	Missense_Mutation	SNP	121000704	121000704	TECTA	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15632	248
PIK3C2G	5288	broad.mit.edu	37	12	18699324	18699324	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18699324G>A	uc001rdt.2	+	25	3541	c.3425G>A	c.(3424-3426)CGT>CAT	p.R1142H	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.R1183H|PIK3C2G_uc010sic.1_Missense_Mutation_p.R961H	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1142	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				AATAATCTTCGTCCACAAGAC	0.408				p.R1142H(ISHIKAWAHERAKLIO02ER-Tumor)	655											0.285714	15.040701	15.906513	6	15	KEEP	---	---	---	---	3	4	11	8	-1	capture	Missense_Mutation	SNP	18699324	18699324	PIK3C2G	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11814	248
KRT79	338785	broad.mit.edu	37	12	53218087	53218087	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53218087G>T	uc001sbb.2	-	5	948	c.915C>A	c.(913-915)AAC>AAA	p.N305K	KRT79_uc001sba.2_Missense_Mutation_p.N76K	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	305	Rod.|Linker 12.					keratin filament	structural molecule activity	p.N305K(1)		ovary(2)|skin(2)	4						GGTTGCGGTTGTTGTCCATGG	0.597																0.240506	50.02209	54.943346	19	60	KEEP	---	---	---	---	6	18	35	30	0.25	capture	Missense_Mutation	SNP	53218087	53218087	KRT79	12	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	8412	248
SLC16A7	9194	broad.mit.edu	37	12	60169207	60169207	+	Silent	SNP	T	G	G			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:60169207T>G	uc001sqs.2	+	5	1430	c.1131T>G	c.(1129-1131)CTT>CTG	p.L377L	SLC16A7_uc001sqt.2_Silent_p.L377L|SLC16A7_uc001squ.2_Silent_p.L377L|SLC16A7_uc009zqi.2_Silent_p.L278L|SLC16A7_uc010ssi.1_Silent_p.L278L	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7	377	Helical; (Potential).					integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)	CCGTCGGACTTGTCACAATTG	0.438																0.325843	192.394325	197.181172	58	120	KEEP	---	---	---	---	28	32	81	63	-1	capture	Silent	SNP	60169207	60169207	SLC16A7	12	T	G	G	G	1	0	0	0	0	0	0	0	1	808	63	4	4	14306	248
KCTD10	83892	broad.mit.edu	37	12	109889455	109889455	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109889455C>T	uc001toi.1	-	7	975	c.887G>A	c.(886-888)CGC>CAC	p.R296H	KCTD10_uc001toh.1_RNA|KCTD10_uc009zvi.1_Missense_Mutation_p.R270H|KCTD10_uc001toj.1_Missense_Mutation_p.R305H|KCTD10_uc001tok.1_Missense_Mutation_p.R115H	NM_031954	NP_114160	Q9H3F6	BACD3_HUMAN	potassium channel tetramerisation domain	296					proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0						CCTCCGCACGCGCTCGATCCG	0.716																0.25	37.944227	41.816903	17	51	KEEP	---	---	---	---	11	10	37	25	-1	capture	Missense_Mutation	SNP	109889455	109889455	KCTD10	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8019	248
OR4K5	79317	broad.mit.edu	37	14	20389343	20389343	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20389343A>T	uc010tkw.1	+	1	578	c.578A>T	c.(577-579)TAC>TTC	p.Y193F		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTGGACTCTTACATCATTGAA	0.393																0.351759	607.494783	619.055345	210	387	KEEP	---	---	---	---	111	121	201	225	-1	capture	Missense_Mutation	SNP	20389343	20389343	OR4K5	14	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	10977	248
GABRB3	2562	broad.mit.edu	37	15	26825472	26825472	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26825472C>T	uc001zaz.2	-	6	818	c.676G>A	c.(676-678)GCC>ACC	p.A226T	GABRB3_uc010uae.1_Missense_Mutation_p.A141T|GABRB3_uc001zba.2_Missense_Mutation_p.A226T|GABRB3_uc001zbb.2_Missense_Mutation_p.A282T	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	226	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCACCTGTGGCGAAGACAACA	0.572																0.319588	82.086449	84.894263	31	66	KEEP	---	---	---	---	20	17	39	37	-1	capture	Missense_Mutation	SNP	26825472	26825472	GABRB3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6110	248
GOLGA6C	653641	broad.mit.edu	37	15	75557692	75557692	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75557692G>A	uc002azs.1	+	9	727	c.650G>A	c.(649-651)CGG>CAG	p.R217Q	uc002azt.1_5'Flank	NM_001145224	NP_001138696	A6NDK9	GOG6C_HUMAN	golgi autoantigen, golgin subfamily a, 6D	229	Potential.									ovary(1)	1						CAGCTAGAGCGGGACGAATAT	0.542																0.135135	6.748795	11.524864	5	32	KEEP	---	---	---	---	10	14	17	25	-1	capture	Missense_Mutation	SNP	75557692	75557692	GOLGA6C	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6495	248
HAGH	3029	broad.mit.edu	37	16	1867224	1867224	+	Missense_Mutation	SNP	G	A	A	rs150713216		TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1867224G>A	uc002cna.2	-	6	997	c.590C>T	c.(589-591)GCG>GTG	p.A197V	HAGH_uc002cmz.2_Missense_Mutation_p.A149V|HAGH_uc010uvp.1_Missense_Mutation_p.R161W|HAGH_uc002cnb.1_Missense_Mutation_p.A149V	NM_005326	NP_005317	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase isoform 1	197					glutathione biosynthetic process	cytoplasm|mitochondrial matrix|mitochondrial matrix	hydroxyacylglutathione hydrolase activity|zinc ion binding			ovary(1)	1		Hepatocellular(780;0.00335)			Glutathione(DB00143)	CATCTCATCCGCAGTCCCTTC	0.637	Pancreas(55;1048 1176 25227 40124 41333)															0.434783	91.254563	91.50692	30	39	KEEP	---	---	---	---	18	18	24	19	-1	capture	Missense_Mutation	SNP	1867224	1867224	HAGH	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6872	248
PDILT	204474	broad.mit.edu	37	16	20376785	20376785	+	Silent	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20376785G>A	uc002dhc.1	-	9	1417	c.1194C>T	c.(1192-1194)AAC>AAT	p.N398N		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	398	Thioredoxin.				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						AGACGACTACGTTGAAGTTCT	0.448																0.446735	393.515132	394.233571	130	161	KEEP	---	---	---	---	64	78	64	110	-1	capture	Silent	SNP	20376785	20376785	PDILT	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11577	248
IL17C	27189	broad.mit.edu	37	16	88705562	88705562	+	Silent	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88705562G>A	uc002fla.2	+	2	229	c.180G>A	c.(178-180)CAG>CAA	p.Q60Q		NM_013278	NP_037410	Q9P0M4	IL17C_HUMAN	interleukin 17C precursor	60					cell surface receptor linked signaling pathway|cell-cell signaling|inflammatory response	extracellular space|soluble fraction	cytokine activity				0				BRCA - Breast invasive adenocarcinoma(80;0.0477)		AGTGGGGGCAGGCTTTGCCTG	0.697																0.45977	127.286525	127.40954	40	47	KEEP	---	---	---	---	30	16	27	23	-1	capture	Silent	SNP	88705562	88705562	IL17C	16	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7559	248
RAPGEFL1	51195	broad.mit.edu	37	17	38340589	38340589	+	Silent	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38340589C>T	uc010cwu.1	+	3	595	c.105C>T	c.(103-105)GGC>GGT	p.G35G		NM_016339	NP_057423	Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor	241					G-protein coupled receptor protein signaling pathway|nervous system development|small GTPase mediated signal transduction	intracellular|membrane fraction	guanyl-nucleotide exchange factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						AGGGGGCCGGCCACATCATCA	0.587	Esophageal Squamous(28;274 750 6870 14218 42203)															0.452991	328.958954	329.403394	106	128	KEEP	---	---	---	---	65	58	77	82	-1	capture	Silent	SNP	38340589	38340589	RAPGEFL1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	12944	248
DHX40	79665	broad.mit.edu	37	17	57665340	57665340	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57665340C>T	uc002ixn.1	+	12	1655	c.1508C>T	c.(1507-1509)GCT>GTT	p.A503V	DHX40_uc010woe.1_Missense_Mutation_p.A426V|DHX40_uc010wof.1_Missense_Mutation_p.A18V	NM_024612	NP_078888	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	503							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATAAAAGCTGCTTCCCTGGAT	0.398																0.104839	13.682773	32.935626	13	111	KEEP	---	---	---	---	4	13	64	81	-1	capture	Missense_Mutation	SNP	57665340	57665340	DHX40	17	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	4470	248
SCN4A	6329	broad.mit.edu	37	17	62019282	62019282	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62019282G>A	uc002jds.1	-	24	4437	c.4360C>T	c.(4360-4362)CGG>TGG	p.R1454W		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1454	Helical; Voltage-sensor; Name=S4 of repeat IV; (Potential).|IV.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	CGCCCAATCCGCGCCAGGCGG	0.642																0.395349	45.462057	45.875285	17	26	KEEP	---	---	---	---	11	8	20	14	-1	capture	Missense_Mutation	SNP	62019282	62019282	SCN4A	17	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	13813	248
LAMA1	284217	broad.mit.edu	37	18	6982557	6982557	+	Silent	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6982557C>T	uc002knm.2	-	41	5923	c.5829G>A	c.(5827-5829)GCG>GCA	p.A1943A	LAMA1_uc010wzj.1_Silent_p.A1419A	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1943	Domain II and I.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCTGCACGGCCGCTTTCCCGT	0.547					1597											0.4047	485.482074	488.512802	155	228	KEEP	---	---	---	---	94	78	106	159	-1	capture	Silent	SNP	6982557	6982557	LAMA1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8525	248
ATP8B3	148229	broad.mit.edu	37	19	1805392	1805392	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1805392C>A	uc002ltw.2	-	10	1119	c.885G>T	c.(883-885)AAG>AAT	p.K295N	ATP8B3_uc002ltv.2_Missense_Mutation_p.K242N|ATP8B3_uc002ltx.2_RNA|ATP8B3_uc002lty.1_Missense_Mutation_p.K43N|ATP8B3_uc002ltz.1_Missense_Mutation_p.K242N	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	295	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGCCATCTTCTTTATAGTGG	0.478																0.222222	5.944858	6.583901	2	7	KEEP	---	---	---	---	2	0	3	5	-1	capture	Missense_Mutation	SNP	1805392	1805392	ATP8B3	19	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	1187	248
DOT1L	84444	broad.mit.edu	37	19	2227030	2227030	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2227030G>A	uc002lvb.3	+	27	4546	c.4510G>A	c.(4510-4512)GCC>ACC	p.A1504T	DOT1L_uc002lvc.1_Missense_Mutation_p.A798T	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	1504						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGCCGGCCGCCGCAGGCCT	0.697																0.444444	11.10024	11.124119	4	5	KEEP	---	---	---	---	2	2	10	6	-1	capture	Missense_Mutation	SNP	2227030	2227030	DOT1L	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4665	248
OR7G3	390883	broad.mit.edu	37	19	9237058	9237058	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9237058G>A	uc010xkl.1	-	1	569	c.569C>T	c.(568-570)TCT>TTT	p.S190F		NM_001001958	NP_001001958	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G,	190	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GAGGACATCAGAACAGGCGAG	0.463																0.168067	42.920016	55.343713	20	99	KEEP	---	---	---	---	14	7	46	61	-1	capture	Missense_Mutation	SNP	9237058	9237058	OR7G3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	11128	248
GPR77	27202	broad.mit.edu	37	19	47844107	47844107	+	Silent	SNP	G	A	A	rs115216760	byFrequency;by1000genomes	TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47844107G>A	uc010ela.1	+	2	269	c.51G>A	c.(49-51)TCG>TCA	p.S17S	GPR77_uc002pgk.1_Silent_p.S17S	NM_018485	NP_060955	Q9P296	C5ARL_HUMAN	G protein-coupled receptor 77	17	Extracellular (Potential).				chemotaxis	integral to membrane|plasma membrane	C5a anaphylatoxin receptor activity			ovary(1)	1		all_cancers(25;1.72e-06)|all_lung(116;2.15e-05)|all_epithelial(76;3.44e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.0652)|Ovarian(192;0.086)		all cancers(93;0.000129)|OV - Ovarian serous cystadenocarcinoma(262;0.000415)|Epithelial(262;0.0109)|GBM - Glioblastoma multiforme(486;0.0138)		GCGACCTCTCGGACCGCCCTG	0.627																0.365269	185.160972	187.814278	61	106	KEEP	---	---	---	---	40	36	57	71	-1	capture	Silent	SNP	47844107	47844107	GPR77	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6642	248
PTPN18	26469	broad.mit.edu	37	2	131128796	131128796	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131128796G>A	uc002trc.2	+	12	1050	c.949G>A	c.(949-951)GCC>ACC	p.A317T	PTPN18_uc002trd.2_Missense_Mutation_p.A296T|PTPN18_uc002trb.2_Missense_Mutation_p.A210T|PTPN18_uc002tre.2_5'Flank	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	317						cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)					CTACGACGATGCCCTCTTCCT	0.622																0.33945	93.546723	96.077397	37	72	KEEP	---	---	---	---	16	28	41	44	-1	capture	Missense_Mutation	SNP	131128796	131128796	PTPN18	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	12679	248
LRP1B	53353	broad.mit.edu	37	2	141812781	141812781	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141812781A>T	uc002tvj.1	-	10	2428	c.1456T>A	c.(1456-1458)TGT>AGT	p.C486S	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	486	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGTGTGAACAGCCCCCTGGC	0.438	Colon(99;50 2074 2507 20106)			p.C486S(SW1271-Tumor)|p.C486S(NCIH1703-Tumor)	2546								TSP Lung(27;0.18)			0.162963	45.496153	60.043939	22	113	KEEP	---	---	---	---	11	14	55	76	-1	capture	Missense_Mutation	SNP	141812781	141812781	LRP1B	2	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	8871	248
TTN	7273	broad.mit.edu	37	2	179606204	179606204	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179606204G>T	uc010zfh.1	-	46	11467	c.11243C>A	c.(11242-11244)ACT>AAT	p.T3748N	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.T3681N|TTN_uc010zfj.1_Missense_Mutation_p.T3556N|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	3721							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTGTTTCAGTGTCTTTGTG	0.428				p.T3748N(RS411-Tumor)	8722											0.424699	460.417735	462.061224	141	191	KEEP	---	---	---	---	71	92	74	131	0.435582822086	capture	Missense_Mutation	SNP	179606204	179606204	TTN	2	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	16617	248
FN1	2335	broad.mit.edu	37	2	216232682	216232682	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:216232682C>G	uc002vfa.2	-	42	7188	c.6922G>C	c.(6922-6924)GTT>CTT	p.V2308L	FN1_uc002vfb.2_Missense_Mutation_p.V2096L|FN1_uc002vfc.2_Missense_Mutation_p.V2071L|FN1_uc002vfd.2_Missense_Mutation_p.V2252L|FN1_uc002vfe.2_Missense_Mutation_p.V2186L|FN1_uc002vff.2_Missense_Mutation_p.V2161L|FN1_uc002vfg.2_Missense_Mutation_p.V2127L|FN1_uc002vfh.2_Missense_Mutation_p.V2007L|FN1_uc002vfi.2_Missense_Mutation_p.V2277L|FN1_uc002vfj.2_Missense_Mutation_p.V2098L|FN1_uc002vez.2_Missense_Mutation_p.V471L|FN1_uc010zjp.1_Missense_Mutation_p.V845L|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_RNA|FN1_uc010fvb.1_RNA	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	2217	Fibronectin type-I 10.|Fibrin-binding 2.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCATCTCCAACGGCATAATGG	0.438				p.V2252I(HEC151-Tumor)	1374											0.254777	129.429547	137.991424	40	117	KEEP	---	---	---	---	24	25	59	74	-1	capture	Missense_Mutation	SNP	216232682	216232682	FN1	2	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	5906	248
PAX3	5077	broad.mit.edu	37	2	223066852	223066852	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223066852C>T	uc010fwo.2	-	8	1597	c.1231G>A	c.(1231-1233)GCG>ACG	p.A411T	PAX3_uc002vmt.1_Missense_Mutation_p.A411T|PAX3_uc002vmy.1_Missense_Mutation_p.A410T|PAX3_uc002vmv.1_Missense_Mutation_p.A411T|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	411					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGAGAGCGCGTAATCAGTC	0.547					141	T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						0.125	6.57778	10.973425	4	28	KEEP	---	---	---	---	3	1	14	15	-1	capture	Missense_Mutation	SNP	223066852	223066852	PAX3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11383	248
KLHL30	377007	broad.mit.edu	37	2	239049594	239049594	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239049594G>A	uc002vxr.1	+	1	178	c.145G>A	c.(145-147)GCC>ACC	p.A49T		NM_198582	NP_940984	Q0D2K2	KLH30_HUMAN	kelch-like 30	67	BTB.										0		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GGGTGACTTCGCCGAGAGCTT	0.677																0.406593	331.406127	333.476635	111	162	KEEP	---	---	---	---	67	66	102	95	-1	capture	Missense_Mutation	SNP	239049594	239049594	KLHL30	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8304	248
ERG	2078	broad.mit.edu	37	21	39755623	39755623	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:39755623A>G	uc010gnw.2	-	12	1458	c.1163T>C	c.(1162-1164)GTC>GCC	p.V388A	ERG_uc002yxa.2_Missense_Mutation_p.V381A|ERG_uc011aek.1_Missense_Mutation_p.V289A|ERG_uc010gnv.2_Missense_Mutation_p.V265A|ERG_uc010gnx.2_Missense_Mutation_p.V364A|ERG_uc011ael.1_Missense_Mutation_p.V388A|ERG_uc002yxb.2_Missense_Mutation_p.V364A	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	388	ETS.				cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				CTTCCCATGGACCTTGGTCAT	0.592	Esophageal Squamous(130;336 1700 3010 3083 40589)				177											0.401163	230.71592	232.190708	69	103	KEEP	---	---	---	---	28	56	60	58	-1	capture	Missense_Mutation	SNP	39755623	39755623	ERG	21	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	5177	248
PRDM15	63977	broad.mit.edu	37	21	43230571	43230571	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43230571C>T	uc002yzq.1	-	28	3800	c.3689G>A	c.(3688-3690)TGC>TAC	p.C1230Y	PRDM15_uc002yzo.2_Missense_Mutation_p.C901Y|PRDM15_uc002yzp.2_Missense_Mutation_p.C921Y|PRDM15_uc002yzr.1_Missense_Mutation_p.C921Y	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	1230	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTTGGTCCCGCACAGCTGGCA	0.652																0.204545	18.344764	21.915741	9	35	KEEP	---	---	---	---	5	5	17	24	-1	capture	Missense_Mutation	SNP	43230571	43230571	PRDM15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	12352	248
CELSR1	9620	broad.mit.edu	37	22	46931595	46931595	+	Silent	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46931595G>A	uc003bhw.1	-	1	1473	c.1473C>T	c.(1471-1473)AAC>AAT	p.N491N		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	491	Extracellular (Potential).|Cadherin 3.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GAATGGCCGCGTTCTGGCCCT	0.632																0.360902	127.705732	129.952333	48	85	KEEP	---	---	---	---	28	28	49	42	-1	capture	Silent	SNP	46931595	46931595	CELSR1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3189	248
ANKRD28	23243	broad.mit.edu	37	3	15778600	15778600	+	Silent	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15778600G>A	uc003caj.1	-	5	545	c.402C>T	c.(400-402)AAC>AAT	p.N134N	ANKRD28_uc003cai.1_Translation_Start_Site|ANKRD28_uc011avz.1_Translation_Start_Site|ANKRD28_uc003cak.1_RNA|ANKRD28_uc011awa.1_RNA|ANKRD28_uc003cal.1_Silent_p.N164N|ANKRD28_uc003cam.2_Silent_p.N167N	NM_015199	NP_056014	O15084	ANR28_HUMAN	ankyrin repeat domain 28	134	ANK 3.					nucleoplasm	protein binding			breast(1)	1						GATCAGATACGTTTACATTAC	0.428																0.348416	220.931221	225.402389	77	144	KEEP	---	---	---	---	36	56	81	81	-1	capture	Silent	SNP	15778600	15778600	ANKRD28	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	652	248
BCL6	604	broad.mit.edu	37	3	187443315	187443315	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:187443315C>T	uc003frp.3	-	8	2268	c.1811G>A	c.(1810-1812)TGC>TAC	p.C604Y	BCL6_uc011bsf.1_Missense_Mutation_p.C548Y|BCL6_uc010hza.2_Missense_Mutation_p.C502Y|BCL6_uc003frq.1_Missense_Mutation_p.C604Y	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	604	C2H2-type 4.				negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GCAGGTTTCGCATTTGTAGGG	0.328					277	T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								0.413265	225.324058	226.615172	81	115	KEEP	---	---	---	---	35	56	62	73	-1	capture	Missense_Mutation	SNP	187443315	187443315	BCL6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	1365	248
TAPT1	202018	broad.mit.edu	37	4	16204132	16204132	+	Silent	SNP	A	G	G			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:16204132A>G	uc010ied.1	-	3	483	c.402T>C	c.(400-402)GTT>GTC	p.V134V	TAPT1_uc011bxe.1_Silent_p.V23V|TAPT1_uc003gow.3_Intron	NM_153365	NP_699196	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation	134						integral to membrane	growth hormone-releasing hormone receptor activity				0						GTGCCAGGAAAACTCTTAAAG	0.353																0.4	6.849202	6.892877	2	3	KEEP	---	---	---	---	0	3	2	1	-1	capture	Silent	SNP	16204132	16204132	TAPT1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	2	1	3	3	15442	248
BRD8	10902	broad.mit.edu	37	5	137476545	137476545	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137476545C>T	uc003lcf.1	-	26	3519	c.3464G>A	c.(3463-3465)AGA>AAA	p.R1155K	BRD8_uc003lcc.1_Intron|NME5_uc003lce.2_5'Flank	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	1155	Bromo 2.				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AGAGAGATTTCTCTTCAGGCT	0.428																0.361607	767.367054	778.725005	243	429	KEEP	---	---	---	---	131	145	270	237	-1	capture	Missense_Mutation	SNP	137476545	137476545	BRD8	5	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	1494	248
WDR46	9277	broad.mit.edu	37	6	33255194	33255194	+	Missense_Mutation	SNP	G	A	A	rs141256696	byFrequency	TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33255194G>A	uc003ods.2	-	8	861	c.817C>T	c.(817-819)CGC>TGC	p.R273C	WDR46_uc011dra.1_Missense_Mutation_p.R219C|WDR46_uc010juo.1_RNA|PFDN6_uc003odt.1_5'Flank|PFDN6_uc010jup.1_5'Flank	NM_005452	NP_005443	O15213	WDR46_HUMAN	WD repeat domain 46 isoform 1	273											0						TCACAGCGGCGGATACAGTGG	0.572																0.518519	95.003116	95.019289	28	26	KEEP	---	---	---	---	18	14	17	23	-1	capture	Missense_Mutation	SNP	33255194	33255194	WDR46	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17180	248
MACC1	346389	broad.mit.edu	37	7	20199676	20199676	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20199676A>G	uc003sus.3	-	5	617	c.308T>C	c.(307-309)TTC>TCC	p.F103S	MACC1_uc010kug.2_Missense_Mutation_p.F103S	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	103					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						TTCTCTACAGAAAAGAAAAGG	0.348																0.419355	90.9407	91.292327	26	36	KEEP	---	---	---	---	11	15	21	15	-1	capture	Missense_Mutation	SNP	20199676	20199676	MACC1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	9058	248
ABCB5	340273	broad.mit.edu	37	7	20767947	20767947	+	Silent	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20767947G>A	uc003suw.3	+	14	1947	c.1401G>A	c.(1399-1401)TCG>TCA	p.S467S	ABCB5_uc010kuh.2_Silent_p.S912S|ABCB5_uc003sux.1_Silent_p.S90S	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	467	Cytoplasmic (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						GAAATACCTCGAAGAAAGCAC	0.353																0.365559	363.686871	368.948343	121	210	KEEP	---	---	---	---	70	80	142	114	-1	capture	Silent	SNP	20767947	20767947	ABCB5	7	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	44	248
OR6V1	346517	broad.mit.edu	37	7	142750291	142750291	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142750291C>T	uc011ksv.1	+	1	854	c.854C>T	c.(853-855)CCC>CTC	p.P285L		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					TTTCTCAATCCCTTTATCCTT	0.507																0.4	93.46354	94.168415	32	48	KEEP	---	---	---	---	11	24	20	30	-1	capture	Missense_Mutation	SNP	142750291	142750291	OR6V1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11115	248
DOCK8	81704	broad.mit.edu	37	9	426982	426982	+	Splice_Site	SNP	G	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:426982G>T	uc003zgf.2	+	34	4450	c.4338_splice	c.e34+1	p.Q1446_splice	DOCK8_uc010mgu.2_Splice_Site_p.Q748_splice|DOCK8_uc010mgv.2_Splice_Site_p.Q1346_splice|DOCK8_uc003zgk.2_Splice_Site_p.Q904_splice	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CATTATCCAGGTGAGGAAAAC	0.383																0.589744	78.830694	79.104682	23	16	KEEP	---	---	---	---	11	16	8	8	0.407407407407	capture	Splice_Site	SNP	426982	426982	DOCK8	9	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	4649	248
VAV2	7410	broad.mit.edu	37	9	136656960	136656960	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136656960C>T	uc004ces.2	-	13	1179	c.1133G>A	c.(1132-1134)CGG>CAG	p.R378Q	VAV2_uc004cer.2_Missense_Mutation_p.R373Q|VAV2_uc004cet.1_5'Flank	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	378					angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		CTCCTTGTCCCGTTTAACTTC	0.488																0.060976	-11.881818	21.132813	10	154	KEEP	---	---	---	---	7	4	85	97	-1	capture	Missense_Mutation	SNP	136656960	136656960	VAV2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17014	248
FAM47C	442444	broad.mit.edu	37	X	37028050	37028050	+	Missense_Mutation	SNP	C	T	T	rs145081405		TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37028050C>T	uc004ddl.1	+	1	1581	c.1567C>T	c.(1567-1569)CGC>TGC	p.R523C		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	523										ovary(3)	3						GTCCCATCTCCGCCCAGAGCC	0.612																0.703297	218.230953	221.635425	64	27	KEEP	---	---	---	---	33	36	11	17	-1	capture	Missense_Mutation	SNP	37028050	37028050	FAM47C	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5519	248
PCDH11X	27328	broad.mit.edu	37	X	91090711	91090711	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91090711G>A	uc004efk.1	+	1	1053	c.208G>A	c.(208-210)GGA>AGA	p.G70R	PCDH11X_uc004efl.1_Missense_Mutation_p.G70R|PCDH11X_uc004efo.1_Missense_Mutation_p.G70R|PCDH11X_uc010nmv.1_Missense_Mutation_p.G70R|PCDH11X_uc004efm.1_Missense_Mutation_p.G70R|PCDH11X_uc004efn.1_Missense_Mutation_p.G70R|PCDH11X_uc004efh.1_Missense_Mutation_p.G70R|PCDH11X_uc004efj.1_Missense_Mutation_p.G70R	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	70	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						GTACAAGACCGGAGATGTGCC	0.458	NSCLC(38;925 1092 2571 38200 45895)															0.756579	403.400754	412.52318	115	37	KEEP	---	---	---	---	63	69	18	26	-1	capture	Missense_Mutation	SNP	91090711	91090711	PCDH11X	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11411	248
VSIG1	340547	broad.mit.edu	37	X	107301373	107301373	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107301373G>A	uc004eno.2	+	2	316	c.155G>A	c.(154-156)CGA>CAA	p.R52Q	VSIG1_uc011msk.1_Missense_Mutation_p.R52Q	NM_182607	NP_872413	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	52	Extracellular (Potential).|Ig-like V-type 1.					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GTGGCCTCCCGAGAACAGCTT	0.468																0.744186	214.837154	219.488428	64	22	KEEP	---	---	---	---	36	33	15	12	-1	capture	Missense_Mutation	SNP	107301373	107301373	VSIG1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17104	248
DNMT1	1786	broad.mit.edu	37	19	10262139	10262139	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10262139delT	uc002mng.2	-	23	2332	c.2152delA	c.(2152-2154)ATGfs	p.M718fs	DNMT1_uc010xlc.1_Frame_Shift_Del_p.M734fs|DNMT1_uc002mnh.2_Frame_Shift_Del_p.M613fs|DNMT1_uc010xld.1_Frame_Shift_Del_p.M718fs	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	718					chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	CCCTGGTGCATTTTTTTGGGT	0.507					705											0.02			7	451		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	10262139	10262139	DNMT1	19	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	4631	248
EGFLAM	133584	broad.mit.edu	37	5	38463973	38463974	+	Frame_Shift_Ins	INS	-	T	T			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:38463973_38463974insT	uc003jlc.1	+	23	3263_3264	c.2939_2940insT	c.(2938-2940)TATfs	p.Y980fs	EGFLAM_uc003jlb.1_Frame_Shift_Ins_p.Y972fs|EGFLAM_uc003jle.1_Frame_Shift_Ins_p.Y738fs|EGFLAM_uc003jlf.1_Frame_Shift_Ins_p.Y338fs|EGFLAM_uc003jlg.1_Frame_Shift_Ins_p.Y115fs|EGFLAM_uc003jlh.1_Frame_Shift_Ins_p.Y62fs	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	980	Laminin G-like 3.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					AACAGGCAATATATGAGAGGGC	0.520	Colon(62;485 1295 3347 17454)															0.38			59	96		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	38463973	38463974	EGFLAM	5	-	T	T	T	1	0	1	1	0	0	0	0	0	208	16	5	5	4921	248
RGS3	5998	broad.mit.edu	37	9	116259676	116259677	+	Frame_Shift_Ins	INS	-	GCTGAGAG	GCTGAGAG			TCGA-32-4719-01	TCGA-32-4719-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116259676_116259677insGCTGAGAG	uc004bhq.2	+	10	1042_1043	c.833_834insGCTGAGAG	c.(832-834)CCGfs	p.P278fs	RGS3_uc004bhr.2_Frame_Shift_Ins_p.P166fs|RGS3_uc004bhs.2_Frame_Shift_Ins_p.P168fs	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	278					inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CGACTGCGGCCGCTGAGAGGTA	0.619																0.10			7	63		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	116259676	116259677	RGS3	9	-	GCTGAGAG	GCTGAGAG	GCTGAGAG	1	0	1	1	0	0	0	0	0	299	23	5	5	13198	248
