Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1900265	1900265	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1900265C>G	uc001aim.1	-	11	1210	c.1054G>C	c.(1054-1056)GAG>CAG	p.E352Q	KIAA1751_uc009vkz.1_Missense_Mutation_p.E352Q	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	352	Potential.									pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TGCTCCTCCTCAAAGGCCCTG	0.597																0.055556	-4.163467	10.800564	4	68	KEEP	---	---	---	---	4	1	35	39	-1	capture	Missense_Mutation	SNP	1900265	1900265	KIAA1751	1	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	8178	263
MMEL1	79258	broad.mit.edu	37	1	2527458	2527458	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2527458G>A	uc001ajy.2	-	15	1704	c.1490C>T	c.(1489-1491)GCG>GTG	p.A497V	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	497	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CTTCTCCTGCGCCTTCTTCTT	0.632																0.126904	29.903843	56.63694	25	172	KEEP	---	---	---	---	16	14	91	106	-1	capture	Missense_Mutation	SNP	2527458	2527458	MMEL1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9558	263
KLHDC7A	127707	broad.mit.edu	37	1	18809060	18809060	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:18809060G>A	uc001bax.2	+	1	1637	c.1585G>A	c.(1585-1587)GTG>ATG	p.V529M	KLHDC7A_uc009vpg.2_Missense_Mutation_p.V311M	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	529	Kelch 2.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCGAGGCCGTGTCCCGGGG	0.662																0.041667	-15.37415	6.31657	4	92	KEEP	---	---	---	---	3	2	55	53	-1	capture	Missense_Mutation	SNP	18809060	18809060	KLHDC7A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8280	263
TXLNA	200081	broad.mit.edu	37	1	32650218	32650218	+	Splice_Site	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32650218G>A	uc001bui.2	+	4	662	c.597_splice	c.e4+1	p.L199_splice	TXLNA_uc001buj.2_Splice_Site_p.L199_splice	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin						cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TGCTGAACTGGTCAGTTCCCC	0.537																0.269231	66.950096	71.951513	28	76	KEEP	---	---	---	---	20	13	51	31	-1	capture	Splice_Site	SNP	32650218	32650218	TXLNA	1	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	16669	263
EPHA10	284656	broad.mit.edu	37	1	38227170	38227170	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38227170G>A	uc009vvi.2	-	3	843	c.757C>T	c.(757-759)CGC>TGC	p.R253C	EPHA10_uc001cbw.3_Missense_Mutation_p.R253C	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	253	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CAGTGCATGCGTGGGGGGCTG	0.692					328											0.411765	36.839557	37.071584	14	20	KEEP	---	---	---	---	6	12	14	11	-1	capture	Missense_Mutation	SNP	38227170	38227170	EPHA10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5121	263
MACF1	23499	broad.mit.edu	37	1	39913453	39913453	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39913453G>A	uc010oiu.1	+	47	15311	c.15180G>A	c.(15178-15180)CAG>CAA	p.Q5060Q	MACF1_uc010ois.1_Silent_p.Q4558Q	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCCAAAAGCAGGATGTTGTTC	0.438																0.329787	91.491939	93.906459	31	63	KEEP	---	---	---	---	18	15	32	37	-1	capture	Silent	SNP	39913453	39913453	MACF1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	9059	263
SPAG17	200162	broad.mit.edu	37	1	118548128	118548128	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118548128T>C	uc001ehk.2	-	32	4753	c.4685A>G	c.(4684-4686)AAG>AGG	p.K1562R		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1562						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTGCTCACGCTTTTGAAAAGG	0.448																0.029412	-17.367514	7.455051	3	99	KEEP	---	---	---	---	1	2	47	66	-1	capture	Missense_Mutation	SNP	118548128	118548128	SPAG17	1	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	14871	263
HAO2	51179	broad.mit.edu	37	1	119925581	119925581	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:119925581G>T	uc001ehq.1	+	4	527	c.175G>T	c.(175-177)GAC>TAC	p.D59Y	HAO2_uc001ehr.1_Missense_Mutation_p.D59Y	NM_001005783	NP_001005783	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2	59	FMN hydroxy acid dehydrogenase.				fatty acid alpha-oxidation	peroxisome	(S)-2-hydroxy-acid oxidase activity			ovary(2)|skin(2)	4	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		GTCTGAGGTGGACACCAGAAC	0.552																0.367347	49.246787	50.000744	18	31	KEEP	---	---	---	---	8	16	21	16	0.333333333333	capture	Missense_Mutation	SNP	119925581	119925581	HAO2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	6879	263
ZNF697	90874	broad.mit.edu	37	1	120165681	120165681	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120165681G>A	uc001ehy.1	-	3	1399	c.1285C>T	c.(1285-1287)CGC>TGC	p.R429C		NM_001080470	NP_001073939	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	429	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GAGTGCGTGCGCTTGTGCGTG	0.667																0.333333	7.525204	7.745012	3	6	KEEP	---	---	---	---	2	1	5	2	-1	capture	Missense_Mutation	SNP	120165681	120165681	ZNF697	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17978	263
NOTCH2	4853	broad.mit.edu	37	1	120512133	120512133	+	Splice_Site	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120512133C>T	uc001eik.2	-	6	1364	c.1108_splice	c.e6+1	p.G370_splice	NOTCH2_uc001eil.2_Splice_Site_p.G370_splice|NOTCH2_uc001eim.3_Splice_Site_p.G287_splice	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCTACCTACCTGCCTTCCC	0.537					581	N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				0.192308	9.858328	12.158762	5	21	KEEP	---	---	---	---	3	2	13	10	-1	capture	Splice_Site	SNP	120512133	120512133	NOTCH2	1	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	10455	263
BCL9	607	broad.mit.edu	37	1	147091673	147091673	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147091673C>G	uc001epq.2	+	8	2452	c.1712C>G	c.(1711-1713)TCT>TGT	p.S571C	BCL9_uc010ozr.1_Missense_Mutation_p.S497C	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	571	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					ATGATAAACTCTGAAATGGAA	0.547					202	T	IGH@|IGL@	B-ALL								0.371212	165.57036	167.482312	49	83	KEEP	---	---	---	---	24	27	45	51	-1	capture	Missense_Mutation	SNP	147091673	147091673	BCL9	1	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	1370	263
HRNR	388697	broad.mit.edu	37	1	152193180	152193180	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152193180G>A	uc001ezt.1	-	3	1001	c.925C>T	c.(925-927)CAC>TAC	p.H309Y		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	309	3.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCGGACGTGGCTAGGAGAC	0.602																0.382022	182.701662	184.892033	68	110	KEEP	---	---	---	---	31	43	68	55	-1	capture	Missense_Mutation	SNP	152193180	152193180	HRNR	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	7284	263
ZBTB7B	51043	broad.mit.edu	37	1	154987218	154987218	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154987218C>T	uc001fgk.3	+	3	240	c.82C>T	c.(82-84)CGC>TGC	p.R28C	ZBTB7B_uc009wpa.2_Missense_Mutation_p.R28C|ZBTB7B_uc001fgj.3_Missense_Mutation_p.R62C|ZBTB7B_uc010peq.1_Missense_Mutation_p.R62C|ZBTB7B_uc001fgl.3_Missense_Mutation_p.R28C	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	28					cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAATGAGCAGCGCCAGCTGGG	0.592																0.333333	84.3278	86.66068	32	64	KEEP	---	---	---	---	25	13	37	34	-1	capture	Missense_Mutation	SNP	154987218	154987218	ZBTB7B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17434	263
FAM78B	149297	broad.mit.edu	37	1	166039701	166039701	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:166039701G>A	uc001gdr.2	-	3	1153	c.563C>T	c.(562-564)ACC>ATC	p.T188I	FAM78B_uc010plc.1_RNA|FAM78B_uc001gdq.2_5'Flank	NM_001017961	NP_001017961	Q5VT40	FA78B_HUMAN	hypothetical protein LOC149297	188										central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					CCACTTGATGGTCTGCAGAAT	0.572																0.448864	238.273411	238.678014	79	97	KEEP	---	---	---	---	57	32	50	60	-1	capture	Missense_Mutation	SNP	166039701	166039701	FAM78B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	5573	263
URB2	9816	broad.mit.edu	37	1	229772130	229772130	+	Silent	SNP	C	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:229772130C>A	uc001hts.1	+	4	1906	c.1770C>A	c.(1768-1770)ACC>ACA	p.T590T	URB2_uc009xfd.1_Silent_p.T590T	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	590						nucleolus				central_nervous_system(2)|ovary(1)	3						TCCCGGACACCCCAGGCCCAG	0.597					340											0.020101	-44.88215	6.516491	4	195	KEEP	---	---	---	---	3	2	113	108	0.4	capture	Silent	SNP	229772130	229772130	URB2	1	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	16907	263
ZNF365	22891	broad.mit.edu	37	10	64415230	64415230	+	Missense_Mutation	SNP	G	A	A	rs41306564		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64415230G>A	uc001jmd.1	+	4	564	c.230G>A	c.(229-231)CGT>CAT	p.R77H	ZNF365_uc001jmc.2_Intron|ZNF365_uc001jme.1_Intron|ZNF365_uc001jmf.1_Intron|ZNF365_uc009xpg.1_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D	77										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					CAAGTTTGGCGTTGGCAGTCA	0.507																0.47541	84.861057	84.893528	29	32	KEEP	---	---	---	---	22	11	14	24	-1	capture	Missense_Mutation	SNP	64415230	64415230	ZNF365	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17749	263
HPX	3263	broad.mit.edu	37	11	6462111	6462111	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6462111G>A	uc001mdg.2	-	1	144	c.83C>T	c.(82-84)CCG>CTG	p.P28L	HPX_uc009yfc.2_RNA|HPX_uc010rai.1_Missense_Mutation_p.P28L	NM_000613	NP_000604	P02790	HEMO_HUMAN	hemopexin precursor	28	O-glycosylated at one, two and three sites.				cellular iron ion homeostasis|interspecies interaction between organisms	extracellular space	heme transporter activity|metal ion binding|protein binding				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		CTTTACTCACGGAGGAAGAGG	0.572																0.210526	9.889931	11.362353	4	15	KEEP	---	---	---	---	2	2	6	13	-1	capture	Missense_Mutation	SNP	6462111	6462111	HPX	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7271	263
DHCR7	1717	broad.mit.edu	37	11	71146770	71146770	+	Missense_Mutation	SNP	A	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71146770A>T	uc001oqk.2	-	9	1329	c.1079T>A	c.(1078-1080)CTG>CAG	p.L360Q	DHCR7_uc001oql.2_Missense_Mutation_p.L360Q	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	360					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)	GCGGCGGAACAGGTCCTTCTG	0.662												Smith-Lemli-Opitz_syndrome				0.342857	34.890176	35.653356	12	23	KEEP	---	---	---	---	9	6	12	14	-1	capture	Missense_Mutation	SNP	71146770	71146770	DHCR7	11	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	4435	263
C11orf67	28971	broad.mit.edu	37	11	77580777	77580777	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77580777G>A	uc001oyq.2	+	3	240	c.142G>A	c.(142-144)GGT>AGT	p.G48S	C11orf67_uc001oyp.2_Missense_Mutation_p.G48S|C11orf67_uc001oyr.1_Missense_Mutation_p.G48S	NM_024684	NP_078960	Q9H7C9	CK067_HUMAN	hypothetical protein LOC28971	48											0	all_cancers(14;5.69e-19)|all_epithelial(13;2.15e-21)|Breast(9;1.16e-15)|Ovarian(111;0.152)		Epithelial(5;1.37e-49)|all cancers(3;5.58e-46)|BRCA - Breast invasive adenocarcinoma(5;7.26e-31)			GCATTCTCCTGGTGTGCAGCC	0.433																0.354244	262.790833	267.878682	96	175	KEEP	---	---	---	---	49	68	101	103	-1	capture	Missense_Mutation	SNP	77580777	77580777	C11orf67	11	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	1643	263
ASAM	79827	broad.mit.edu	37	11	122945484	122945484	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:122945484G>A	uc001pyt.2	-	6	1106	c.747C>T	c.(745-747)TTC>TTT	p.F249F		NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor	249	Helical; (Potential).					integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		ACACCAAGAGGAAAATCAGCA	0.443																0.09375	-6.176343	10.13406	9	87	KEEP	---	---	---	---	9	6	43	55	-1	capture	Silent	SNP	122945484	122945484	ASAM	11	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	1000	263
NCAPD3	23310	broad.mit.edu	37	11	134048751	134048751	+	Silent	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:134048751C>T	uc001qhd.1	-	21	3246	c.2640G>A	c.(2638-2640)CAG>CAA	p.Q880Q	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	880					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CCAGGACGGACTGAATCAGAA	0.468					861											0.285714	26.734369	28.177275	10	25	KEEP	---	---	---	---	11	1	9	20	-1	capture	Silent	SNP	134048751	134048751	NCAPD3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	10113	263
PLBD1	79887	broad.mit.edu	37	12	14695158	14695158	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14695158C>T	uc001rcc.1	-	3	564	c.403G>A	c.(403-405)GTG>ATG	p.V135M		NM_024829	NP_079105	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	135					lipid catabolic process	extracellular region	hydrolase activity				0						AAATCCTGCACTTTATCCATG	0.343																0.324675	68.645171	70.747323	25	52	KEEP	---	---	---	---	16	16	41	30	-1	capture	Missense_Mutation	SNP	14695158	14695158	PLBD1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	11928	263
ABCC9	10060	broad.mit.edu	37	12	21997449	21997449	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21997449G>A	uc001rfi.1	-	26	3303	c.3283C>T	c.(3283-3285)CGC>TGC	p.R1095C	ABCC9_uc001rfh.2_Missense_Mutation_p.R1095C|ABCC9_uc001rfj.1_Missense_Mutation_p.R1059C	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1095	ABC transmembrane type-1 2.|Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GCTGAAAAGCGATTGAGAATC	0.353																0.364103	203.186436	206.348468	71	124	KEEP	---	---	---	---	51	40	85	62	-1	capture	Missense_Mutation	SNP	21997449	21997449	ABCC9	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	59	263
PKP2	5318	broad.mit.edu	37	12	32977045	32977045	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32977045G>A	uc001rlj.3	-	8	1855	c.1740C>T	c.(1738-1740)GAC>GAT	p.D580D	PKP2_uc001rlk.3_Silent_p.D536D|PKP2_uc010skj.1_Silent_p.D536D	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	580	ARM 4.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CAATGAGTCCGTCACATCTTC	0.398																0.409639	97.423287	98.017728	34	49	KEEP	---	---	---	---	19	22	35	22	-1	capture	Silent	SNP	32977045	32977045	PKP2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11888	263
GRIP1	23426	broad.mit.edu	37	12	66786464	66786464	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66786464C>G	uc001stk.2	-	17	2347	c.2106G>C	c.(2104-2106)CAG>CAC	p.Q702H	GRIP1_uc010sta.1_Missense_Mutation_p.Q646H|GRIP1_uc001stj.2_Missense_Mutation_p.Q484H|GRIP1_uc001stl.1_Missense_Mutation_p.Q594H|GRIP1_uc001stm.2_Missense_Mutation_p.Q702H	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	754	PDZ 6.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CACCATCTGTCTGTTTCTTAA	0.413																0.338346	148.908607	151.994372	45	88	KEEP	---	---	---	---	32	23	65	40	-1	capture	Missense_Mutation	SNP	66786464	66786464	GRIP1	12	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	6720	263
USP30	84749	broad.mit.edu	37	12	109509449	109509449	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109509449G>A	uc010sxi.1	+	5	617	c.513G>A	c.(511-513)TCG>TCA	p.S171S	USP30_uc001tnu.3_Silent_p.S140S	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	171	Cytoplasmic (Potential).				ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						TCATTACCTCGTCATTGGAAG	0.463																0.3375	71.183745	73.060173	27	53	KEEP	---	---	---	---	11	19	28	35	-1	capture	Silent	SNP	109509449	109509449	USP30	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16943	263
TMEM120B	144404	broad.mit.edu	37	12	122209423	122209423	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122209423G>A	uc001ubc.3	+	8	791	c.647G>A	c.(646-648)CGC>CAC	p.R216H	TMEM120B_uc009zxh.2_Missense_Mutation_p.R216H	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B	216						integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CAGAAGTTTCGCAACCAGTTC	0.488																0.342857	97.863752	100.156421	36	69	KEEP	---	---	---	---	22	27	41	45	-1	capture	Missense_Mutation	SNP	122209423	122209423	TMEM120B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15919	263
LAMP1	3916	broad.mit.edu	37	13	113964010	113964010	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113964010C>A	uc001vtm.1	+	3	517	c.236C>A	c.(235-237)TCC>TAC	p.S79Y	LAMP1_uc010tka.1_Missense_Mutation_p.S79Y	NM_005561	NP_005552	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	79	Lumenal (Potential).|First lumenal domain.					endosome membrane|integral to plasma membrane|lysosomal membrane|membrane fraction				central_nervous_system(2)	2	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			AACCGCAGCTCCTGTGGAAAA	0.443					242											0.37963	112.942311	114.317468	41	67	KEEP	---	---	---	---	32	18	40	36	0.36	capture	Missense_Mutation	SNP	113964010	113964010	LAMP1	13	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	8537	263
OR4K1	79544	broad.mit.edu	37	14	20404274	20404274	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20404274C>T	uc001vwj.1	+	1	449	c.449C>T	c.(448-450)GCG>GTG	p.A150V		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		ATTTCCTGGGCGGTGGGCGTT	0.463																0.219653	77.333963	89.81764	38	135	KEEP	---	---	---	---	20	21	61	93	-1	capture	Missense_Mutation	SNP	20404274	20404274	OR4K1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10971	263
TGM5	9333	broad.mit.edu	37	15	43525396	43525396	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43525396G>A	uc001zrd.1	-	13	2164	c.2156C>T	c.(2155-2157)GCA>GTA	p.A719V	TGM5_uc001zrc.1_Missense_Mutation_p.A376V|TGM5_uc001zre.1_Missense_Mutation_p.A637V	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	719					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	AATTTATAATGCAAAGTCTAC	0.438																0.319149	38.905615	40.273219	15	32	KEEP	---	---	---	---	11	7	14	29	-1	capture	Missense_Mutation	SNP	43525396	43525396	TGM5	15	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	15718	263
BTBD1	53339	broad.mit.edu	37	15	83725179	83725179	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:83725179G>A	uc002bjn.2	-	2	723	c.520C>T	c.(520-522)CAT>TAT	p.H174Y	BTBD1_uc002bjo.2_Missense_Mutation_p.H174Y	NM_025238	NP_079514	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1 isoform 1	174						cytoplasmic mRNA processing body|protein complex	protein binding	p.H174D(1)		ovary(1)|central_nervous_system(1)	2				all cancers(203;0.000186)		GCCCTAAGATGTTTGGTGAGA	0.363																0.333333	41.180774	42.363217	16	32	KEEP	---	---	---	---	9	9	19	16	-1	capture	Missense_Mutation	SNP	83725179	83725179	BTBD1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	1525	263
PKD1	5310	broad.mit.edu	37	16	2155892	2155892	+	Silent	SNP	A	G	G	rs149467954	by1000genomes	TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2155892A>G	uc002cos.1	-	20	8046	c.7837T>C	c.(7837-7839)TTG>CTG	p.L2613L	PKD1_uc002cot.1_Silent_p.L2613L|PKD1_uc010bse.1_5'Flank	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2613	Extracellular (Potential).|REJ.		Missing (in ADPKD1; could be a polymorphism).		calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						ACCAGGGCCAACGAGTACTCG	0.657																0.088235	1.298473	7.12673	3	31	KEEP	---	---	---	---	1	2	15	21	-1	capture	Silent	SNP	2155892	2155892	PKD1	16	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	11866	263
DNAH3	55567	broad.mit.edu	37	16	20999316	20999316	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20999316T>A	uc010vbe.1	-	45	6673	c.6673A>T	c.(6673-6675)AGT>TGT	p.S2225C	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2225	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ACAATCGAACTGAAAATCTTG	0.428																0.242424	40.466816	44.459742	16	50	KEEP	---	---	---	---	13	6	29	26	-1	capture	Missense_Mutation	SNP	20999316	20999316	DNAH3	16	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	4560	263
KCTD19	146212	broad.mit.edu	37	16	67327795	67327795	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67327795T>C	uc002esu.2	-	12	1921	c.1870A>G	c.(1870-1872)ACC>GCC	p.T624A	KCTD19_uc002est.2_Missense_Mutation_p.T396A|KCTD19_uc010vjj.1_Missense_Mutation_p.T367A	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	624						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GGGTCTTTGGTTTCAGATTTC	0.532																0.337278	186.907642	190.873046	57	112	KEEP	---	---	---	---	33	30	66	56	-1	capture	Missense_Mutation	SNP	67327795	67327795	KCTD19	16	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	8028	263
SGSM2	9905	broad.mit.edu	37	17	2276367	2276367	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:2276367A>G	uc002fun.3	+	15	1949	c.1774A>G	c.(1774-1776)ATG>GTG	p.M592V	SGSM2_uc002fum.3_Missense_Mutation_p.M637V|SGSM2_uc010vqw.1_Missense_Mutation_p.M592V|SGSM2_uc002fuo.2_3'UTR|SGSM2_uc002fup.1_5'Flank	NM_001098509	NP_001091979	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 2	592	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CAAGAAGGAGATGGAGCAGGT	0.617																0.35	22.220259	22.61672	7	13	KEEP	---	---	---	---	3	6	10	4	-1	capture	Missense_Mutation	SNP	2276367	2276367	SGSM2	17	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	14116	263
UNC45B	146862	broad.mit.edu	37	17	33491149	33491149	+	Missense_Mutation	SNP	G	A	A	rs143612410		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33491149G>A	uc002hja.2	+	9	1212	c.1115G>A	c.(1114-1116)CGC>CAC	p.R372H	UNC45B_uc002hjb.2_Missense_Mutation_p.R372H|UNC45B_uc002hjc.2_Missense_Mutation_p.R372H|UNC45B_uc010cto.2_Missense_Mutation_p.R372H	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	372					cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GACCCGGAGCGCGATCACTTC	0.478																0.294737	140.595336	147.780298	56	134	KEEP	---	---	---	---	34	32	70	84	-1	capture	Missense_Mutation	SNP	33491149	33491149	UNC45B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16871	263
KIF2B	84643	broad.mit.edu	37	17	51900723	51900723	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51900723G>A	uc002iua.2	+	1	485	c.329G>A	c.(328-330)CGT>CAT	p.R110H	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	110					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	p.R110C(1)		ovary(5)|skin(3)	8						AGGGACCAGCGTACCGCCACG	0.607																0.378151	123.743767	125.294735	45	74	KEEP	---	---	---	---	23	24	33	47	-1	capture	Missense_Mutation	SNP	51900723	51900723	KIF2B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8220	263
ENPP7	339221	broad.mit.edu	37	17	77708908	77708908	+	Missense_Mutation	SNP	C	T	T	rs142610423		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77708908C>T	uc002jxa.2	+	3	486	c.466C>T	c.(466-468)CGG>TGG	p.R156W		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	156					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGCTGTGACGCGGAGCCGGAA	0.592																0.352113	64.007339	65.396601	25	46	KEEP	---	---	---	---	17	12	31	24	-1	capture	Missense_Mutation	SNP	77708908	77708908	ENPP7	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	5090	263
C17orf70	80233	broad.mit.edu	37	17	79516305	79516305	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79516305C>G	uc002kaq.2	-	4	1385	c.1330G>C	c.(1330-1332)GCC>CCC	p.A444P	C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.A293P	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	444					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GTCATCCTGGCTGGGCCAGGC	0.592																0.046154	-7.011884	7.254379	3	62	KEEP	---	---	---	---	0	3	39	30	-1	capture	Missense_Mutation	SNP	79516305	79516305	C17orf70	17	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	1862	263
ZNF556	80032	broad.mit.edu	37	19	2877392	2877392	+	Missense_Mutation	SNP	C	T	T	rs138176298	byFrequency	TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2877392C>T	uc002lwp.1	+	4	523	c.436C>T	c.(436-438)CGG>TGG	p.R146W	ZNF556_uc002lwq.2_Missense_Mutation_p.R145W	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	146					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGTGTAAGACGGTACGAATG	0.393																0.15873	35.120667	49.105678	20	106	KEEP	---	---	---	---	13	9	53	62	-1	capture	Missense_Mutation	SNP	2877392	2877392	ZNF556	19	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	17866	263
MUC16	94025	broad.mit.edu	37	19	9047753	9047753	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9047753G>A	uc002mkp.2	-	5	34082	c.33878C>T	c.(33877-33879)CCT>CTT	p.P11293L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11295	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GACTGTAGAAGGCATAGTGTC	0.473																0.262295	43.880884	46.993297	16	45	KEEP	---	---	---	---	10	6	23	26	-1	capture	Missense_Mutation	SNP	9047753	9047753	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9883	263
SLC1A6	6511	broad.mit.edu	37	19	15082585	15082585	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15082585G>T	uc002naa.1	-	2	315	c.307C>A	c.(307-309)CTG>ATG	p.L103M	SLC1A6_uc010dzu.1_Missense_Mutation_p.L103M|SLC1A6_uc010xod.1_Missense_Mutation_p.A107D|SLC1A6_uc002nab.2_Missense_Mutation_p.L103M|SLC1A6_uc002nac.2_Missense_Mutation_p.L103M|SLC1A6_uc002nad.1_Missense_Mutation_p.L103M	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	103	Helical; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	GGTAACACCAGCATCTGCAGC	0.567																0.241935	71.395057	78.922567	30	94	KEEP	---	---	---	---	12	22	57	51	0.352941176471	capture	Missense_Mutation	SNP	15082585	15082585	SLC1A6	19	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	14329	263
CILP2	148113	broad.mit.edu	37	19	19655518	19655518	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19655518C>T	uc002nmv.3	+	8	2249	c.2164C>T	c.(2164-2166)CGG>TGG	p.R722W	CILP2_uc002nmw.3_Missense_Mutation_p.R728W	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	722						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						CGTGGAGATCCGGGAGCGGCG	0.706																0.166667	6.11457	8.010042	3	15	KEEP	---	---	---	---	2	2	10	8	-1	capture	Missense_Mutation	SNP	19655518	19655518	CILP2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	3395	263
FGF21	26291	broad.mit.edu	37	19	49261318	49261318	+	Silent	SNP	A	C	C			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49261318A>C	uc002pkn.1	+	4	1043	c.471A>C	c.(469-471)GCA>GCC	p.A157A	FUT1_uc002pkk.2_5'Flank|FUT1_uc002pkm.1_5'Flank|FGF21_uc002pko.1_Silent_p.A157A	NM_019113	NP_061986	Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21 precursor	157					cell-cell signaling|positive regulation of ERK1 and ERK2 cascade|positive regulation of glucose import	extracellular region|soluble fraction	growth factor activity			breast(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		GGGACCCTGCACCCCGAGGAC	0.682																0.119403	-2.318709	7.490266	8	59	KEEP	---	---	---	---	9	9	25	41	-1	capture	Silent	SNP	49261318	49261318	FGF21	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	5796	263
LILRB5	10990	broad.mit.edu	37	19	54758761	54758761	+	Silent	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54758761C>T	uc002qex.2	-	6	1203	c.1092G>A	c.(1090-1092)CCG>CCA	p.P364P	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.P355P|LILRB5_uc002qey.2_Silent_p.P364P|LILRB5_uc002qez.2_Silent_p.P264P|LILRB5_uc002qfa.1_Silent_p.P254P|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	364	Ig-like C2-type 4.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTAGACACAGCGGGGGATGGG	0.547																0.329412	74.206428	76.381496	28	57	KEEP	---	---	---	---	22	12	34	33	-1	capture	Silent	SNP	54758761	54758761	LILRB5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8714	263
TNNT1	7138	broad.mit.edu	37	19	55648558	55648558	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55648558C>T	uc002qjb.3	-	11	613	c.524G>A	c.(523-525)CGG>CAG	p.R175Q	TNNT1_uc002qiz.3_Missense_Mutation_p.R105Q|TNNT1_uc002qja.3_Missense_Mutation_p.R105Q|TNNT1_uc002qjc.3_Missense_Mutation_p.R175Q|TNNT1_uc002qje.3_Missense_Mutation_p.R164Q|TNNT1_uc002qjd.3_Missense_Mutation_p.R164Q	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a	175					muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		CCCCGTCTGCCGCTTACCACG	0.627																0.277778	52.670611	55.868879	20	52	KEEP	---	---	---	---	9	16	34	33	-1	capture	Missense_Mutation	SNP	55648558	55648558	TNNT1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16213	263
PNPT1	87178	broad.mit.edu	37	2	55874482	55874482	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:55874482C>G	uc002rzf.2	-	19	1655	c.1602G>C	c.(1600-1602)TTG>TTC	p.L534F	PNPT1_uc002rzg.2_RNA	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	534					mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATATACTTGCCAAAATATCTG	0.284																0.354545	105.790236	107.84265	39	71	KEEP	---	---	---	---	19	24	47	39	-1	capture	Missense_Mutation	SNP	55874482	55874482	PNPT1	2	C	G	G	G	1	0	0	0	0	1	0	0	0	272	21	4	4	12076	263
SLC5A7	60482	broad.mit.edu	37	2	108625088	108625088	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108625088G>A	uc002tdv.2	+	8	1339	c.1063G>A	c.(1063-1065)GCA>ACA	p.A355T	SLC5A7_uc010ywm.1_Missense_Mutation_p.A108T|SLC5A7_uc010fjj.2_Missense_Mutation_p.A355T|SLC5A7_uc010ywn.1_Missense_Mutation_p.A242T	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	355	Extracellular (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	CATCTTGTCAGCAAGTTCCAT	0.413																0.343284	67.102699	68.557275	23	44	KEEP	---	---	---	---	12	15	26	26	-1	capture	Missense_Mutation	SNP	108625088	108625088	SLC5A7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	14562	263
CKAP2L	150468	broad.mit.edu	37	2	113504041	113504041	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113504041C>A	uc002tie.2	-	6	1793	c.1714G>T	c.(1714-1716)GAT>TAT	p.D572Y	CKAP2L_uc002tif.2_Missense_Mutation_p.D161Y|CKAP2L_uc010yxp.1_Missense_Mutation_p.D407Y	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	572						centrosome					0						CCAATAACATCAAAGGTGCCT	0.373																0.02924	-35.635211	6.51632	5	166	KEEP	---	---	---	---	5	1	86	102	0.166666666667	capture	Missense_Mutation	SNP	113504041	113504041	CKAP2L	2	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	3408	263
ABCB11	8647	broad.mit.edu	37	2	169791877	169791877	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169791877C>T	uc002ueo.1	-	23	2999	c.2873G>A	c.(2872-2874)CGG>CAG	p.R958Q	ABCB11_uc010zda.1_Missense_Mutation_p.R400Q|ABCB11_uc010zdb.1_Missense_Mutation_p.R434Q	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	958	Cytoplasmic (Potential).|ABC transmembrane type-1 2.		R -> Q.		bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	TTCAATGAACCGCCTCTCCTT	0.448																0.066038	-10.00564	31.395141	14	198	KEEP	---	---	---	---	7	8	106	115	-1	capture	Missense_Mutation	SNP	169791877	169791877	ABCB11	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	42	263
FZD5	7855	broad.mit.edu	37	2	208632195	208632195	+	Silent	SNP	G	A	A	rs35642228		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208632195G>A	uc002vcj.2	-	2	1679	c.1269C>T	c.(1267-1269)TTC>TTT	p.F423F		NM_003468	NP_003459	Q13467	FZD5_HUMAN	frizzled 5 precursor	423	Helical; Name=5; (Potential).				angiogenesis|anterior/posterior axis specification, embryo|axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to molecule of bacterial origin|embryonic camera-type eye development|gonad development|labyrinthine layer blood vessel development|positive regulation of interferon-gamma production|positive regulation of transcription from RNA polymerase II promoter|post-embryonic camera-type eye development|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell projection|cell surface|Golgi membrane|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|protein kinase binding|Wnt-protein binding			ovary(2)|lung(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		AGAGCGACACGAAGCCCGCCA	0.637																0.36	49.636026	50.498645	18	32	KEEP	---	---	---	---	10	9	18	17	-1	capture	Silent	SNP	208632195	208632195	FZD5	2	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	6075	263
RBM44	375316	broad.mit.edu	37	2	238727201	238727201	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238727201G>A	uc002vxi.3	+	3	1774	c.1642G>A	c.(1642-1644)GTT>ATT	p.V548I		NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	547							nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		ATCTCTCTCCGTTGACAGTTT	0.308																0.666667	55.755872	56.419264	18	9	KEEP	---	---	---	---	9	10	6	5	-1	capture	Missense_Mutation	SNP	238727201	238727201	RBM44	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13033	263
SNRPB2	6629	broad.mit.edu	37	20	16721056	16721056	+	Silent	SNP	T	C	C			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16721056T>C	uc002wph.1	+	6	732	c.516T>C	c.(514-516)AAT>AAC	p.N172N	SNRPB2_uc002wpi.1_Silent_p.N172N	NM_003092	NP_003083	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B''	172	RRM 2.					catalytic step 2 spliceosome|nucleoplasm|U2 snRNP	nucleotide binding|protein binding|RNA binding			large_intestine(1)	1						TGCTGTTTAATCAGTAAGTTT	0.348																0.033898	-18.704176	9.225482	4	114	KEEP	---	---	---	---	3	1	69	51	-1	capture	Silent	SNP	16721056	16721056	SNRPB2	20	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	14754	263
NKX2-4	644524	broad.mit.edu	37	20	21377636	21377636	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:21377636G>A	uc010gcz.2	-	1	412	c.402C>T	c.(400-402)ACC>ACT	p.T134T		NM_033176	NP_149416	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	134					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CGTACCAGCCGGTGGCCGCGC	0.736																0.428571	9.624154	9.655254	3	4	KEEP	---	---	---	---	4	0	1	5	-1	capture	Silent	SNP	21377636	21377636	NKX2-4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10359	263
CST9	128822	broad.mit.edu	37	20	23584188	23584188	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23584188C>T	uc002wtl.2	-	2	548	c.439G>A	c.(439-441)GGA>AGA	p.G147R		NM_001008693	NP_001008693	Q5W186	CST9_HUMAN	cystatin 9 precursor	147						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Colorectal(13;0.0993)					TCAGCTGCTCCTGTGCCCACA	0.577																0.396825	79.661982	80.248874	25	38	KEEP	---	---	---	---	10	16	20	21	-1	capture	Missense_Mutation	SNP	23584188	23584188	CST9	20	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	3944	263
TPTE	7179	broad.mit.edu	37	21	10906911	10906911	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10906911G>A	uc002yip.1	-	24	2018	c.1650C>T	c.(1648-1650)TCC>TCT	p.S550S	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.S532S|TPTE_uc002yir.1_Silent_p.S512S|TPTE_uc010gkv.1_Silent_p.S412S	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	550					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATACTTAATCGGATCCAGCTA	0.398																0.117117	15.301078	31.300511	13	98	KEEP	---	---	---	---	9	6	47	68	-1	capture	Silent	SNP	10906911	10906911	TPTE	21	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16313	263
CELSR1	9620	broad.mit.edu	37	22	46932243	46932243	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46932243G>A	uc003bhw.1	-	1	825	c.825C>T	c.(823-825)GGC>GGT	p.G275G		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	275	Extracellular (Potential).|Cadherin 1.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCTCCTCCTCGCCCTCGATGG	0.632																0.114754	5.186413	14.118808	7	54	KEEP	---	---	---	---	6	2	32	30	-1	capture	Silent	SNP	46932243	46932243	CELSR1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3189	263
DLEC1	9940	broad.mit.edu	37	3	38153750	38153750	+	Silent	SNP	T	C	C			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38153750T>C	uc003cho.1	+	25	3585	c.3564T>C	c.(3562-3564)CCT>CCC	p.P1188P	DLEC1_uc003chp.1_Silent_p.P1188P|DLEC1_uc010hgv.1_Silent_p.P1191P|DLEC1_uc003chr.1_Intron|DLEC1_uc010hgx.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	1188					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CTTTCTTCCCTCACTTTTCCC	0.572																0.028571	-18.96661	6.718286	3	102	KEEP	---	---	---	---	1	2	58	62	-1	capture	Silent	SNP	38153750	38153750	DLEC1	3	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	4510	263
SCN5A	6331	broad.mit.edu	37	3	38591818	38591818	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38591818G>A	uc003cio.2	-	28	6239	c.6045C>T	c.(6043-6045)ATC>ATT	p.I2015I	SCN5A_uc003cin.2_Silent_p.I2014I|SCN5A_uc003cil.3_Silent_p.I2015I|SCN5A_uc010hhi.2_Silent_p.I1997I|SCN5A_uc010hhk.2_Silent_p.I1982I|SCN5A_uc011ayr.1_Silent_p.I1961I	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	2015					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	AGGCTCACACGATGGACTCAC	0.592																0.325203	109.962905	113.294842	40	83	KEEP	---	---	---	---	33	15	58	43	-1	capture	Silent	SNP	38591818	38591818	SCN5A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	13815	263
PBRM1	55193	broad.mit.edu	37	3	52598198	52598198	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52598198T>C	uc003des.2	-	23	3755	c.3743A>G	c.(3742-3744)GAA>GGA	p.E1248G	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.E1248G|PBRM1_uc003der.2_Missense_Mutation_p.E1216G|PBRM1_uc003det.2_Missense_Mutation_p.E1263G|PBRM1_uc003deu.2_Missense_Mutation_p.E1263G|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.E1248G|PBRM1_uc010hmk.1_Missense_Mutation_p.E1223G|PBRM1_uc003dey.2_Missense_Mutation_p.E1223G|PBRM1_uc003dez.1_Missense_Mutation_p.E1247G	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1248	BAH 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTCTGGTATTTCAGTTGGCCT	0.408						Mis|N|F|S|D|O		clear cell renal carcinoma|breast								0.024793	-23.284371	7.030024	3	118	KEEP	---	---	---	---	3	0	70	75	-1	capture	Missense_Mutation	SNP	52598198	52598198	PBRM1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11394	263
UBA3	9039	broad.mit.edu	37	3	69120763	69120763	+	Silent	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:69120763C>T	uc003dno.2	-	5	290	c.270G>A	c.(268-270)TTG>TTA	p.L90L	UBA3_uc003dnq.2_Silent_p.L76L|UBA3_uc011bfy.1_5'UTR|UBA3_uc011bfz.1_Intron	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1	90					protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		TAAAACCAGACAAGGCCTGTG	0.313																0.333333	39.556877	40.751384	16	32	KEEP	---	---	---	---	7	13	15	21	-1	capture	Silent	SNP	69120763	69120763	UBA3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	16711	263
SENP7	57337	broad.mit.edu	37	3	101080632	101080632	+	Missense_Mutation	SNP	T	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101080632T>G	uc003dut.2	-	11	1661	c.1550A>C	c.(1549-1551)GAT>GCT	p.D517A	SENP7_uc003duu.2_Missense_Mutation_p.D452A|SENP7_uc003duv.2_Missense_Mutation_p.D484A|SENP7_uc003duw.2_Missense_Mutation_p.D451A|SENP7_uc003dux.2_Missense_Mutation_p.D353A	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	517					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						CAGTTGTAGATCCATCTCATT	0.289																0.407895	108.515239	109.077391	31	45	KEEP	---	---	---	---	12	22	23	29	-1	capture	Missense_Mutation	SNP	101080632	101080632	SENP7	3	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	13944	263
PIK3CA	5290	broad.mit.edu	37	3	178936092	178936092	+	Missense_Mutation	SNP	A	C	C	rs121913274		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936092A>C	uc003fjk.2	+	10	1791	c.1634A>C	c.(1633-1635)GAG>GCG	p.E545A		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAATCACTGAGCAGGAGAAA	0.353	Colon(199;1504 1750 3362 26421 31210 32040)	E545G(KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545A(AGS_STOMACH)	57	p.E545G(SNUC4-Tumor)|p.E545G(KCL22-Tumor)|p.E545G(253J-Tumor)|p.E545A(AGS-Tumor)|p.E545A(SNU869-Tumor)|p.E545V(OVMANA-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.297619	69.23864	72.316853	25	59	KEEP	---	---	---	---	17	11	38	33	-1	capture	Missense_Mutation	SNP	178936092	178936092	PIK3CA	3	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	11816	263
TTC14	151613	broad.mit.edu	37	3	180321035	180321035	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:180321035G>A	uc003fkk.2	+	3	542	c.410G>A	c.(409-411)CGG>CAG	p.R137Q	TTC14_uc003fkl.2_Missense_Mutation_p.R137Q|TTC14_uc003fkm.2_Missense_Mutation_p.R137Q	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	137	S1 motif.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AGTTCTATTCGGGAATTCGGT	0.373																0.330709	123.523082	126.740469	42	85	KEEP	---	---	---	---	29	15	56	40	-1	capture	Missense_Mutation	SNP	180321035	180321035	TTC14	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16563	263
ACAP2	23527	broad.mit.edu	37	3	195015481	195015481	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195015481A>G	uc003fun.3	-	18	1973	c.1732T>C	c.(1732-1734)TCC>CCC	p.S578P		NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	578					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GACACCGTGGAGGGTAAAGAT	0.368																0.030928	-16.560492	6.822673	3	94	KEEP	---	---	---	---	1	3	50	70	-1	capture	Missense_Mutation	SNP	195015481	195015481	ACAP2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	119	263
TLR6	10333	broad.mit.edu	37	4	38830189	38830189	+	Silent	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38830189C>T	uc003gtm.2	-	1	972	c.906G>A	c.(904-906)ACG>ACA	p.T302T	TLR6_uc010ifg.1_Silent_p.T302T	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	302	Extracellular (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						CTTTCAATGTCGTTTTAGAAT	0.318																0.487179	59.324231	59.329772	19	20	KEEP	---	---	---	---	13	6	11	12	-1	capture	Silent	SNP	38830189	38830189	TLR6	4	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	15840	263
CENPC1	1060	broad.mit.edu	37	4	68396616	68396616	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68396616G>A	uc003hdd.1	-	5	431	c.248C>T	c.(247-249)CCA>CTA	p.P83L	CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Missense_Mutation_p.P83L	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1	83					mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						AACTGACTTTGGATGTGATTT	0.363																0.230769	14.735471	16.463282	6	20	KEEP	---	---	---	---	2	6	10	15	-1	capture	Missense_Mutation	SNP	68396616	68396616	CENPC1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	3197	263
UGT2B7	7364	broad.mit.edu	37	4	69978432	69978432	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69978432C>G	uc003heg.3	+	6	1614	c.1568C>G	c.(1567-1569)GCA>GGA	p.A523G	UGT2B7_uc010ihq.2_3'UTR	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	523					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						GCTAGAAAAGCAAAGAAGGGA	0.378																0.368421	119.497887	120.944402	35	60	KEEP	---	---	---	---	19	22	27	42	-1	capture	Missense_Mutation	SNP	69978432	69978432	UGT2B7	4	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	16844	263
SHROOM3	57619	broad.mit.edu	37	4	77660381	77660381	+	Missense_Mutation	SNP	G	A	A	rs146652221	byFrequency	TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77660381G>A	uc011cbx.1	+	5	2008	c.1055G>A	c.(1054-1056)CGG>CAG	p.R352Q	SHROOM3_uc011cbz.1_Missense_Mutation_p.R176Q|SHROOM3_uc003hkf.1_Missense_Mutation_p.R227Q|SHROOM3_uc003hkg.2_Missense_Mutation_p.R130Q	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	352					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			AATATTCCTCGGGGCAAGGGA	0.582																0.318841	61.626513	63.638547	22	47	KEEP	---	---	---	---	15	11	31	28	-1	capture	Missense_Mutation	SNP	77660381	77660381	SHROOM3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14188	263
FRAS1	80144	broad.mit.edu	37	4	79351554	79351554	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79351554G>A	uc003hlb.2	+	37	5392	c.4952G>A	c.(4951-4953)CGA>CAA	p.R1651Q	FRAS1_uc003hkw.2_Missense_Mutation_p.R1651Q|FRAS1_uc010ijj.1_Missense_Mutation_p.R71Q	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1650	CSPG 5.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GCTGAGTTCCGAAGGCCGATG	0.493																0.318182	19.718263	20.36415	7	15	KEEP	---	---	---	---	2	6	3	12	-1	capture	Missense_Mutation	SNP	79351554	79351554	FRAS1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5986	263
ANK2	287	broad.mit.edu	37	4	114262932	114262932	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114262932G>A	uc003ibe.3	+	33	4082	c.3982G>A	c.(3982-3984)GCC>ACC	p.A1328T	ANK2_uc003ibd.3_Missense_Mutation_p.A1319T|ANK2_uc003ibf.3_Missense_Mutation_p.A1328T|ANK2_uc011cgc.1_Missense_Mutation_p.A504T|ANK2_uc003ibg.3_Missense_Mutation_p.A323T|ANK2_uc003ibh.3_Missense_Mutation_p.A2T|ANK2_uc011cgb.1_Missense_Mutation_p.A1343T	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1295					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACCTTATATGGCCAAATTTGT	0.393																0.022222	-38.904661	6.794421	4	176	KEEP	---	---	---	---	0	5	106	93	-1	capture	Missense_Mutation	SNP	114262932	114262932	ANK2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	618	263
RGNEF	64283	broad.mit.edu	37	5	73128174	73128174	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73128174G>A	uc011csq.1	+	9	1047	c.1036G>A	c.(1036-1038)GAT>AAT	p.D346N	RGNEF_uc003kcx.2_Missense_Mutation_p.D346N|RGNEF_uc003kcy.1_Missense_Mutation_p.D346N|RGNEF_uc010izf.2_Missense_Mutation_p.D346N|RGNEF_uc011csr.1_Missense_Mutation_p.D33N	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	346					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		TCGCTCCTTCGATATCCTAAA	0.423																0.257143	22.258488	24.129885	9	26	KEEP	---	---	---	---	5	4	18	13	-1	capture	Missense_Mutation	SNP	73128174	73128174	RGNEF	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13178	263
SLC36A2	153201	broad.mit.edu	37	5	150726999	150726999	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150726999T>A	uc003lty.2	-	1	153	c.23A>T	c.(22-24)GAG>GTG	p.E8V	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_5'UTR|SLC36A2_uc010jhv.2_Missense_Mutation_p.E8V|SLC36A2_uc011dct.1_Missense_Mutation_p.E8V	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	8	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGGGACCCTCAGTACTTTT	0.493																0.372727	223.673202	226.810394	82	138	KEEP	---	---	---	---	44	54	77	85	-1	capture	Missense_Mutation	SNP	150726999	150726999	SLC36A2	5	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	14486	263
DSP	1832	broad.mit.edu	37	6	7575560	7575560	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7575560G>A	uc003mxp.1	+	18	2748	c.2469G>A	c.(2467-2469)TCG>TCA	p.S823S	DSP_uc003mxq.1_Silent_p.S823S	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	823	Globular 1.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGAAGAAGTCGTTGTTGGCCA	0.393																0.381295	149.952187	151.665859	53	86	KEEP	---	---	---	---	33	25	50	49	-1	capture	Silent	SNP	7575560	7575560	DSP	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4736	263
RHAG	6005	broad.mit.edu	37	6	49582542	49582542	+	Missense_Mutation	SNP	C	A	A	rs77467572		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49582542C>A	uc003ozk.3	-	5	727	c.665G>T	c.(664-666)TGG>TTG	p.W222L	RHAG_uc010jzl.2_Missense_Mutation_p.W222L|RHAG_uc010jzm.2_Missense_Mutation_p.W222L	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	222	Helical; (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					AAAGCTGGGCCAAAACATCCA	0.463	Ovarian(176;476 2003 7720 43408 44749)															0.297619	67.766629	70.828634	25	59	KEEP	---	---	---	---	13	17	33	34	0.566666666667	capture	Missense_Mutation	SNP	49582542	49582542	RHAG	6	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	13207	263
COL9A1	1297	broad.mit.edu	37	6	70961988	70961988	+	Nonsense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70961988G>A	uc003pfg.3	-	27	1954	c.1795C>T	c.(1795-1797)CAG>TAG	p.Q599*	COL9A1_uc003pfe.3_Nonsense_Mutation_p.Q172*|COL9A1_uc003pff.3_Nonsense_Mutation_p.Q356*	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	599	Triple-helical region (COL2).				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						TTTCCCATCTGACCAGGCTTC	0.423																0.051948	-8.867521	7.486833	4	73	KEEP	---	---	---	---	2	3	34	54	-1	capture	Nonsense_Mutation	SNP	70961988	70961988	COL9A1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	3672	263
COL1A2	1278	broad.mit.edu	37	7	94039079	94039079	+	Silent	SNP	C	T	T	rs141762645	byFrequency	TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94039079C>T	uc003ung.1	+	19	1452	c.981C>T	c.(979-981)CGC>CGT	p.R327R	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	327					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CTGGACCCCGCGGTATTCCTG	0.592													HNSCC(75;0.22)			0.239316	64.747893	72.005502	28	89	KEEP	---	---	---	---	18	15	60	43	-1	capture	Silent	SNP	94039079	94039079	COL1A2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3643	263
CNTNAP2	26047	broad.mit.edu	37	7	146536869	146536869	+	Missense_Mutation	SNP	G	A	A	rs138924087		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146536869G>A	uc003weu.1	+	3	791	c.275G>A	c.(274-276)CGG>CAG	p.R92Q		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	92	F5/8 type C.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTTGGCAATCGGAAGCAGATC	0.502													HNSCC(39;0.1)			0.210526	38.059894	43.949861	16	60	KEEP	---	---	---	---	8	9	32	39	-1	capture	Missense_Mutation	SNP	146536869	146536869	CNTNAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3612	263
DOCK5	80005	broad.mit.edu	37	8	25220568	25220568	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25220568C>A	uc003xeg.2	+	29	3092	c.2955C>A	c.(2953-2955)TTC>TTA	p.F985L	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.F699L|DOCK5_uc003xei.2_Missense_Mutation_p.F555L|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	985						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CGCAGGACTTCCTCATGGAAA	0.443	Pancreas(145;34 1887 3271 10937 30165)															0.308943	95.196682	99.20218	38	85	KEEP	---	---	---	---	23	18	55	50	0.439024390244	capture	Missense_Mutation	SNP	25220568	25220568	DOCK5	8	C	A	A	A	1	0	0	0	0	1	0	0	0	389	30	4	4	4646	263
FNTA	2339	broad.mit.edu	37	8	42939877	42939877	+	Silent	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42939877C>T	uc003xps.2	+	8	918	c.870C>T	c.(868-870)TCC>TCT	p.S290S	FNTA_uc003xpt.2_Silent_p.S199S|FNTA_uc003xpu.2_Silent_p.S223S|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	290					cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GTGGTCTTTCCAAATATCCTA	0.343					148											0.304348	57.449007	59.805946	21	48	KEEP	---	---	---	---	13	10	22	35	-1	capture	Silent	SNP	42939877	42939877	FNTA	8	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	5921	263
SPAG1	6674	broad.mit.edu	37	8	101203698	101203698	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101203698G>A	uc003yjh.1	+	9	999	c.913G>A	c.(913-915)GTT>ATT	p.V305I	SPAG1_uc003yjg.1_Missense_Mutation_p.V305I|SPAG1_uc003yji.1_Missense_Mutation_p.V305I	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1	305	TPR 3.				single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		AGTACTAGATGTTGAGCCTGA	0.348																0.411765	76.979899	77.444084	28	40	KEEP	---	---	---	---	13	18	24	24	-1	capture	Missense_Mutation	SNP	101203698	101203698	SPAG1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14867	263
FER1L6	654463	broad.mit.edu	37	8	125131869	125131869	+	Silent	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125131869G>A	uc003yqw.2	+	41	5618	c.5412G>A	c.(5410-5412)TCG>TCA	p.S1804S	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1804	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCTCCTTTTCGTGGTTCATGA	0.378																0.347826	133.15848	135.978974	48	90	KEEP	---	---	---	---	26	32	53	54	-1	capture	Silent	SNP	125131869	125131869	FER1L6	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5761	263
PLEC	5339	broad.mit.edu	37	8	144992335	144992335	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144992335A>G	uc003zaf.1	-	32	12235	c.12065T>C	c.(12064-12066)TTC>TCC	p.F4022S	PLEC_uc003zab.1_Missense_Mutation_p.F3885S|PLEC_uc003zac.1_Missense_Mutation_p.F3889S|PLEC_uc003zad.2_Missense_Mutation_p.F3885S|PLEC_uc003zae.1_Missense_Mutation_p.F3853S|PLEC_uc003zag.1_Missense_Mutation_p.F3863S|PLEC_uc003zah.2_Missense_Mutation_p.F3871S|PLEC_uc003zaj.2_Missense_Mutation_p.F3912S	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4022	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CAGGCCACGGAAGGTCAGCTT	0.692																0.2	16.500466	19.437387	7	28	KEEP	---	---	---	---	1	10	17	26	-1	capture	Missense_Mutation	SNP	144992335	144992335	PLEC	8	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	11955	263
GLDC	2731	broad.mit.edu	37	9	6592871	6592871	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6592871G>A	uc003zkc.2	-	10	1574	c.1381C>T	c.(1381-1383)CGG>TGG	p.R461W		NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	461					glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	TCAAAAAGCCGAAAATTGATC	0.403																0.358209	68.085127	69.269702	24	43	KEEP	---	---	---	---	18	11	32	19	-1	capture	Missense_Mutation	SNP	6592871	6592871	GLDC	9	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	6369	263
PAX5	5079	broad.mit.edu	37	9	37020754	37020754	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37020754G>A	uc003zzo.1	-	2	539	c.91C>T	c.(91-93)CGG>TGG	p.R31W	PAX5_uc011lpw.1_Missense_Mutation_p.R31W|PAX5_uc011lpx.1_Missense_Mutation_p.R31W|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Missense_Mutation_p.R31W|PAX5_uc011lpz.1_Missense_Mutation_p.R31W|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_RNA|PAX5_uc011lqb.1_RNA|PAX5_uc010mlo.1_Missense_Mutation_p.R31W|PAX5_uc010mlp.1_Missense_Mutation_p.R31W|PAX5_uc011lqc.1_Missense_Mutation_p.R31W|PAX5_uc010mlr.1_Missense_Mutation_p.R31W|PAX5_uc011lqd.1_Missense_Mutation_p.R30W|PAX5_uc011lqe.1_Intron|PAX5_uc011lqf.1_Intron|PAX5_uc011lqg.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5	31	Paired.				cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(31)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		GGGAGTGGCCGTCCATTCACA	0.522					323	T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								0.330097	88.118235	90.751929	34	69	KEEP	---	---	---	---	21	17	39	36	-1	capture	Missense_Mutation	SNP	37020754	37020754	PAX5	9	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	11385	263
NOXA1	10811	broad.mit.edu	37	9	140327980	140327980	+	Nonsense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140327980C>T	uc004cmv.2	+	11	1120	c.985C>T	c.(985-987)CGA>TGA	p.R329*	C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Nonsense_Mutation_p.R329*|NOXA1_uc010nch.2_Nonsense_Mutation_p.R273*	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	329	OPR.		Missing (in NOXA1truncated, a cDNA isolated from Caco-2 cells treated with butyrate).	R -> G (in Ref. 6; AAC18046).	regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CCTGAGGGCACGAAGAGGAGC	0.701																0.529412	24.859506	24.87157	9	8	KEEP	---	---	---	---	6	4	3	6	-1	capture	Nonsense_Mutation	SNP	140327980	140327980	NOXA1	9	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	10467	263
DACH2	117154	broad.mit.edu	37	X	86068163	86068163	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:86068163C>T	uc004eew.2	+	9	1590	c.1420C>T	c.(1420-1422)CGC>TGC	p.R474C	DACH2_uc004eex.2_Missense_Mutation_p.R461C|DACH2_uc010nmq.2_Missense_Mutation_p.R340C|DACH2_uc011mra.1_Missense_Mutation_p.R307C|DACH2_uc010nmr.2_Missense_Mutation_p.R255C|DACH2_uc004eey.2_Missense_Mutation_p.R167C|DACH2_uc004eez.2_Missense_Mutation_p.R157C	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	474	Potential.|DACHbox-C.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						GGATAATGCTCGCATCCAGGA	0.368																0.6	19.351608	19.438995	6	4	KEEP	---	---	---	---	3	5	5	1	-1	capture	Missense_Mutation	SNP	86068163	86068163	DACH2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4181	263
SLC6A14	11254	broad.mit.edu	37	X	115588823	115588823	+	Missense_Mutation	SNP	G	A	A	rs142971231		TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115588823G>A	uc004eqi.2	+	13	1767	c.1663G>A	c.(1663-1665)GCA>ACA	p.A555T		NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	555					cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	TAATTATGGCGCAATTCCATA	0.358																0.690909	239.927331	243.499795	76	34	KEEP	---	---	---	---	35	51	17	20	-1	capture	Missense_Mutation	SNP	115588823	115588823	SLC6A14	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14569	263
SMC3	9126	broad.mit.edu	37	10	112350849	112350851	+	In_Frame_Del	DEL	AAC	-	-			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112350849_112350851delAAC	uc001kze.2	+	17	1897_1899	c.1771_1773delAAC	c.(1771-1773)AACdel	p.N591del		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	591	Flexible hinge.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TCTGCCTCTTAACAAGTTAGATG	0.325																0.53			26	23		---	---	---	---						capture_indel	In_Frame_Del	DEL	112350849	112350851	SMC3	10	AAC	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	14676	263
PTOV1	53635	broad.mit.edu	37	19	50360994	50360996	+	In_Frame_Del	DEL	CAA	-	-			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50360994_50360996delCAA	uc002pqf.1	+	7	929_931	c.759_761delCAA	c.(757-762)GTCAAC>GTC	p.N255del	PTOV1_uc002ppz.3_RNA|PTOV1_uc002pqb.3_In_Frame_Del_p.N223del|PTOV1_uc002pqa.2_RNA|PTOV1_uc002pqc.1_RNA|PTOV1_uc002pqd.2_RNA|PTOV1_uc002pqe.1_RNA	NM_017432	NP_059128	Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	255	Interaction with FLOT1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|plasma membrane					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		TCCAGATCGTCAACAACAAGTTT	0.616																0.22			15	54		---	---	---	---						capture_indel	In_Frame_Del	DEL	50360994	50360996	PTOV1	19	CAA	-	-	-	1	0	1	0	1	0	0	0	0	366	29	5	5	12664	263
NEUROD6	63974	broad.mit.edu	37	7	31378634	31378635	+	Frame_Shift_Ins	INS	-	T	T			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31378634_31378635insT	uc003tch.2	-	2	601_602	c.248_249insA	c.(247-249)AAGfs	p.K83fs		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	83	Nuclear localization signal (Potential).				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						GCTTTGTTGTCTTTTTTTTCCT	0.396																0.02			7	418		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	31378634	31378635	NEUROD6	7	-	T	T	T	1	0	1	1	0	0	0	0	0	415	32	5	5	10258	263
CYLC2	1539	broad.mit.edu	37	9	105767035	105767035	+	Frame_Shift_Del	DEL	C	-	-			TCGA-74-6578-01	TCGA-74-6578-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:105767035delC	uc004bbs.2	+	4	309	c.239delC	c.(238-240)TCTfs	p.S80fs		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	80	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				ATGTACCGTTCTTTAATGAGA	0.398																0.43			29	38		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	105767035	105767035	CYLC2	9	C	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	4102	263
