Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CASZ1	54897	broad.mit.edu	37	1	10699777	10699777	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10699777C>T	uc001aro.2	-	21	4822	c.4502G>A	c.(4501-4503)TGC>TAC	p.C1501Y		NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	1501				C -> R (in Ref. 2; ABB29845).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGCGAAGTGGCAGCTGAGTGA	0.657																0.583333	20.825547	20.898049	7	5	KEEP	---	---	---	---	5	4	1	6	-1	capture	Missense_Mutation	SNP	10699777	10699777	CASZ1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	2661	265
TOE1	114034	broad.mit.edu	37	1	45807217	45807217	+	Silent	SNP	C	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45807217C>G	uc009vxq.2	+	4	892	c.309C>G	c.(307-309)GCC>GCG	p.A103A	MUTYH_uc001cnf.2_5'Flank|MUTYH_uc009vxo.2_5'Flank|MUTYH_uc001cng.2_5'Flank|MUTYH_uc001cnj.2_5'Flank|MUTYH_uc001cni.2_5'Flank|MUTYH_uc001cnh.2_5'Flank|MUTYH_uc001cno.2_5'Flank|MUTYH_uc001cnk.2_5'Flank|MUTYH_uc010oll.1_5'Flank|MUTYH_uc001cnm.2_5'Flank|MUTYH_uc001cnl.2_5'Flank|MUTYH_uc009vxp.2_5'Flank|MUTYH_uc001cnn.2_5'Flank|TOE1_uc001cnq.3_RNA|TOE1_uc010olm.1_Intron|TOE1_uc010oln.1_Silent_p.A109A|TOE1_uc001cnr.3_RNA	NM_025077	NP_079353	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	103						nuclear speck|nucleolus	nucleic acid binding|zinc ion binding			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGGGCCTCGCCTGCTTCAAGC	0.562					28											0.447761	96.737698	96.89754	30	37	KEEP	---	---	---	---	12	20	20	26	-1	capture	Silent	SNP	45807217	45807217	TOE1	1	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	16232	265
MCOLN3	55283	broad.mit.edu	37	1	85491656	85491656	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85491656A>G	uc001dkp.2	-	9	1154	c.1061T>C	c.(1060-1062)ATT>ACT	p.I354T	MCOLN3_uc001dko.2_5'Flank|MCOLN3_uc001dkq.2_Missense_Mutation_p.I298T|MCOLN3_uc001dkr.2_3'UTR|MCOLN3_uc001dks.3_Missense_Mutation_p.I199T	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3	354	Helical; (Potential).					integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		AATTGATCCAATGATTGTCAA	0.303																0.525	77.175272	77.196926	21	19	KEEP	---	---	---	---	12	11	10	10	-1	capture	Missense_Mutation	SNP	85491656	85491656	MCOLN3	1	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9310	265
HFM1	164045	broad.mit.edu	37	1	91739356	91739356	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91739356T>C	uc001doa.3	-	34	3785	c.3685A>G	c.(3685-3687)ATA>GTA	p.I1229V	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.I908V|HFM1_uc001dob.3_Missense_Mutation_p.I417V|HFM1_uc010osv.1_Missense_Mutation_p.I913V	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1229							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AATTCAGATATGTTTAAATAT	0.284																0.485437	160.143948	160.162962	50	53	KEEP	---	---	---	---	30	29	37	31	-1	capture	Missense_Mutation	SNP	91739356	91739356	HFM1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	7008	265
DPYD	1806	broad.mit.edu	37	1	97847978	97847978	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:97847978C>A	uc001drv.2	-	15	2082	c.1945G>T	c.(1945-1947)GAC>TAC	p.D649Y		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	649					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TCCGTCCAGTCATTTTTATTG	0.279				p.D649N(MDAMB453-Tumor)	533											0.34375	30.413268	31.104304	11	21	KEEP	---	---	---	---	9	4	14	15	0.307692307692	capture	Missense_Mutation	SNP	97847978	97847978	DPYD	1	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	4700	265
RORC	6097	broad.mit.edu	37	1	151787517	151787517	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151787517C>T	uc001ezh.2	-	5	791	c.683G>A	c.(682-684)CGA>CAA	p.R228Q	RORC_uc001ezg.2_Missense_Mutation_p.R207Q|RORC_uc010pdo.1_Missense_Mutation_p.R282Q|RORC_uc010pdp.1_Missense_Mutation_p.R228Q	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	228	Hinge (Potential).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAGTCCACATCGGTCAGGGGT	0.612																0.4	109.027013	109.858686	38	57	KEEP	---	---	---	---	27	17	27	39	-1	capture	Missense_Mutation	SNP	151787517	151787517	RORC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13422	265
NTRK1	4914	broad.mit.edu	37	1	156849919	156849919	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156849919G>A	uc001fqh.1	+	16	2231	c.2175G>A	c.(2173-2175)AAG>AAA	p.K725K	NTRK1_uc001fqf.1_Silent_p.K689K|NTRK1_uc009wsi.1_Silent_p.K424K|NTRK1_uc001fqi.1_Silent_p.K719K|NTRK1_uc009wsk.1_Silent_p.K722K	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	725	Cytoplasmic (Potential).|Protein kinase.				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CCTACGGCAAGCAGCCCTGGT	0.632					290	T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			0.406542	257.168991	258.806405	87	127	KEEP	---	---	---	---	47	54	76	70	-1	capture	Silent	SNP	156849919	156849919	NTRK1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	10613	265
DEDD	9191	broad.mit.edu	37	1	161094314	161094314	+	Translation_Start_Site	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161094314G>A	uc001fxz.2	-	3	112	c.-61C>T	c.(-63--59)TACGG>TATGG		NIT1_uc001fxw.2_3'UTR|DEDD_uc009wty.2_Translation_Start_Site|DEDD_uc001fya.2_Translation_Start_Site|DEDD_uc001fyb.2_Translation_Start_Site|DEDD_uc010pkb.1_Translation_Start_Site|DEDD_uc001fyc.2_Intron	NM_001039712	NP_001034801	O75618	DEDD_HUMAN	death effector domain-containing protein						apoptosis|induction of apoptosis via death domain receptors|negative regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			AATCCCCACCGTACTGAAAGG	0.388																0.54717	86.37149	86.473401	29	24	KEEP	---	---	---	---	16	14	16	10	-1	capture	Translation_Start_Site	SNP	161094314	161094314	DEDD	1	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	4342	265
MMRN2	79812	broad.mit.edu	37	10	88703548	88703548	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:88703548G>A	uc001kea.2	-	6	1120	c.993C>T	c.(991-993)GCC>GCT	p.A331A	MMRN2_uc010qmn.1_Intron|MMRN2_uc009xtb.2_Silent_p.A288A	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor	331	Potential.					extracellular space				large_intestine(1)	1						TGTCCACATCGGCTTGGAGCT	0.622																0.90411	234.705534	246.66263	66	7	KEEP	---	---	---	---	41	35	3	7	-1	capture	Silent	SNP	88703548	88703548	MMRN2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9583	265
ART1	417	broad.mit.edu	37	11	3681258	3681258	+	Missense_Mutation	SNP	G	A	A	rs141732093		TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3681258G>A	uc001lye.1	+	3	610	c.509G>A	c.(508-510)CGT>CAT	p.R170H	ART1_uc009yeb.1_Missense_Mutation_p.R170H	NM_004314	NP_004305	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1 precursor	170					protein ADP-ribosylation	anchored to membrane|integral to plasma membrane|sarcoplasmic reticulum membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity				0		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)	Becaplermin(DB00102)	AGCGGCCAGCGTCCACCCCGG	0.701																0.328571	58.341471	60.145511	23	47	KEEP	---	---	---	---	11	25	27	29	-1	capture	Missense_Mutation	SNP	3681258	3681258	ART1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	990	265
OR10A3	26496	broad.mit.edu	37	11	7960954	7960954	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7960954G>A	uc010rbi.1	-	1	114	c.114C>T	c.(112-114)ACC>ACT	p.T38T		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TTCCCATCAGGGTCACCACAT	0.473																0.402367	214.87151	216.278609	68	101	KEEP	---	---	---	---	34	35	46	61	-1	capture	Silent	SNP	7960954	7960954	OR10A3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	10795	265
CALCA	796	broad.mit.edu	37	11	14991572	14991572	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:14991572C>T	uc001mlt.1	-	3	211	c.136G>A	c.(136-138)GAA>AAA	p.E46K	CALCA_uc001mlu.1_RNA|CALCA_uc001mlv.1_Missense_Mutation_p.E46K|CALCA_uc001mlw.1_Missense_Mutation_p.E46K	NM_001033953	NP_001029125	P06881	CALCA_HUMAN	calcitonin isoform CGRP preproprotein	46					activation of adenylate cyclase activity|cell-cell signaling|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|endothelial cell migration|endothelial cell proliferation|leukocyte cell-cell adhesion|negative regulation of blood pressure|negative regulation of bone resorption|negative regulation of calcium ion transport into cytosol|negative regulation of osteoclast differentiation|neurological system process involved in regulation of systemic arterial blood pressure|positive regulation of interleukin-1 alpha production|positive regulation of interleukin-8 production|positive regulation of macrophage differentiation|positive regulation of vasodilation|regulation of blood pressure|vasculature development|vasodilation	cytosol|extracellular space	hormone activity			central_nervous_system(1)	1					Phentolamine(DB00692)	AGGCGCGCTTCGTCCTCACTG	0.642														OREG0020791	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.553398	180.078128	180.333173	57	46	KEEP	---	---	---	---	30	32	34	22	-1	capture	Missense_Mutation	SNP	14991572	14991572	CALCA	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2551	265
SYT13	57586	broad.mit.edu	37	11	45274024	45274024	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45274024G>A	uc001myq.2	-	4	920	c.794C>T	c.(793-795)ACA>ATA	p.T265I	SYT13_uc009yku.1_Missense_Mutation_p.T121I	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	265	Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						AGGCACAGATGTCCCGTCCAG	0.647														OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.471774	340.14205	340.315014	117	131	KEEP	---	---	---	---	62	67	66	74	-1	capture	Missense_Mutation	SNP	45274024	45274024	SYT13	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	15357	265
TCN1	6947	broad.mit.edu	37	11	59629066	59629066	+	Missense_Mutation	SNP	C	T	T	rs77116206	by1000genomes	TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59629066C>T	uc001noj.2	-	4	588	c.490G>A	c.(490-492)GCC>ACC	p.A164T		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	164					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAACTTCGGCGGTTGAGTAG	0.453																0.447581	327.691451	328.284905	111	137	KEEP	---	---	---	---	62	59	72	83	-1	capture	Missense_Mutation	SNP	59629066	59629066	TCN1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15591	265
MTA2	9219	broad.mit.edu	37	11	62364206	62364206	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62364206C>T	uc001ntq.1	-	9	1166	c.785G>A	c.(784-786)CGG>CAG	p.R262Q	MTA2_uc010rlx.1_Missense_Mutation_p.R89Q	NM_004739	NP_004730	O94776	MTA2_HUMAN	metastasis-associated protein 2	262					chromatin assembly or disassembly	NuRD complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CATCTCATCCCGACACAGCAC	0.542																0.443787	239.012247	239.475834	75	94	KEEP	---	---	---	---	36	44	47	56	-1	capture	Missense_Mutation	SNP	62364206	62364206	MTA2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9819	265
SF1	7536	broad.mit.edu	37	11	64537728	64537728	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64537728T>C	uc001obb.1	-	4	766	c.389A>G	c.(388-390)AAA>AGA	p.K130R	SF1_uc010rnm.1_5'Flank|SF1_uc010rnn.1_Missense_Mutation_p.K104R|SF1_uc001oaz.1_Missense_Mutation_p.K255R|SF1_uc001oba.1_Missense_Mutation_p.K130R|SF1_uc001obc.1_Missense_Mutation_p.K130R|SF1_uc001obd.1_Missense_Mutation_p.K130R|SF1_uc001obe.1_Missense_Mutation_p.K15R|SF1_uc010rno.1_Missense_Mutation_p.K15R	NM_004630	NP_004621	Q15637	SF01_HUMAN	splicing factor 1 isoform 1	130					nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3						CTCCGCTTACTTGTAATCTGC	0.532																0.470588	501.308921	501.5314	136	153	KEEP	---	---	---	---	61	89	74	110	-1	capture	Missense_Mutation	SNP	64537728	64537728	SF1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	14038	265
USP35	57558	broad.mit.edu	37	11	77921629	77921629	+	Missense_Mutation	SNP	A	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77921629A>C	uc009yva.1	+	10	2974	c.2728A>C	c.(2728-2730)ACC>CCC	p.T910P	USP35_uc001oze.2_Missense_Mutation_p.T666P|USP35_uc001ozc.2_Missense_Mutation_p.T478P|USP35_uc010rsp.1_Missense_Mutation_p.T342P|USP35_uc001ozd.2_Missense_Mutation_p.T521P|USP35_uc001ozf.2_Missense_Mutation_p.T641P	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	910					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CAGCAACGTCACCTCCTTCTT	0.572																0.485342	546.703974	546.759199	149	158	KEEP	---	---	---	---	84	94	92	84	-1	capture	Missense_Mutation	SNP	77921629	77921629	USP35	11	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	16948	265
MMP13	4322	broad.mit.edu	37	11	102822866	102822866	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102822866C>T	uc001phl.2	-	5	702	c.674G>A	c.(673-675)GGC>GAC	p.G225D		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	225					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		TAAGGAGTGGCCGAACTCATG	0.443																0.409091	334.969427	337.018041	117	169	KEEP	---	---	---	---	61	68	95	91	-1	capture	Missense_Mutation	SNP	102822866	102822866	MMP13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9564	265
IQSEC3	440073	broad.mit.edu	37	12	247574	247574	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:247574C>T	uc001qhw.1	+	1	142	c.136C>T	c.(136-138)CGG>TGG	p.R46W	IQSEC3_uc001qhu.1_Missense_Mutation_p.R46W|IQSEC3_uc001qht.1_Missense_Mutation_p.R131W|uc001qhv.1_RNA	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	349					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CCGCCTGCCACGGCGGATCTC	0.667																0.545455	35.49681	35.535998	12	10	KEEP	---	---	---	---	7	15	9	7	-1	capture	Missense_Mutation	SNP	247574	247574	IQSEC3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	7742	265
CLEC4C	170482	broad.mit.edu	37	12	7898972	7898972	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7898972C>T	uc001qtg.1	-	2	253	c.79G>A	c.(79-81)GTA>ATA	p.V27I	CLEC4C_uc001qth.1_Missense_Mutation_p.V27I|CLEC4C_uc001qti.1_Intron	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	27	Helical; Signal-anchor for type II membrane protein; (Potential).				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		AAGATGGATACGACTGCCATG	0.483																0.46087	158.117684	158.274954	53	62	KEEP	---	---	---	---	27	40	36	42	-1	capture	Missense_Mutation	SNP	7898972	7898972	CLEC4C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3478	265
C12orf51	283450	broad.mit.edu	37	12	112605619	112605619	+	Missense_Mutation	SNP	T	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112605619T>A	uc009zwc.2	-	64	11063	c.11045A>T	c.(11044-11046)AAG>ATG	p.K3682M		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TCTGCCTACCTTGTTCTTATT	0.617																0.064	-8.409133	16.317876	8	117	KEEP	---	---	---	---	5	5	72	71	-1	capture	Missense_Mutation	SNP	112605619	112605619	C12orf51	12	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	1682	265
POLE2	5427	broad.mit.edu	37	14	50120778	50120778	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50120778G>A	uc001wwu.2	-	15	1155	c.1141C>T	c.(1141-1143)CTT>TTT	p.L381F	SDCCAG1_uc010anj.1_Intron|POLE2_uc010ann.2_Missense_Mutation_p.L95F|POLE2_uc001wwv.2_RNA|POLE2_uc010ano.2_Missense_Mutation_p.L96F	NM_002692	NP_002683	P56282	DPOE2_HUMAN	DNA-directed DNA polymerase epsilon 2	381					DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity			ovary(1)|skin(1)	2	all_epithelial(31;0.0021)|Breast(41;0.0124)					CTTTCAGCAAGTGGTGGCCTA	0.294																0.47619	129.094425	129.135906	40	44	KEEP	---	---	---	---	24	21	23	24	-1	capture	Missense_Mutation	SNP	50120778	50120778	POLE2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	12100	265
MYO9A	4649	broad.mit.edu	37	15	72195395	72195395	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72195395T>C	uc002atl.3	-	22	3360	c.2887A>G	c.(2887-2889)AGC>GGC	p.S963G	MYO9A_uc010biq.2_Missense_Mutation_p.S583G|MYO9A_uc002atn.1_Missense_Mutation_p.S944G	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	963	Myosin head-like 2.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TGGAAGTGGCTCACAAAATCC	0.269																0.033708	-14.554917	6.540702	3	86	KEEP	---	---	---	---	3	0	49	51	-1	capture	Missense_Mutation	SNP	72195395	72195395	MYO9A	15	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	9994	265
IL16	3603	broad.mit.edu	37	15	81598457	81598457	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81598457C>G	uc002bgh.3	+	17	4005	c.3629C>G	c.(3628-3630)ACT>AGT	p.T1210S	IL16_uc010blq.1_Missense_Mutation_p.T1164S|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.T1252S|IL16_uc002bgg.2_Missense_Mutation_p.T1210S|IL16_uc002bgi.1_Missense_Mutation_p.T600S|IL16_uc002bgj.2_Missense_Mutation_p.T704S|IL16_uc002bgk.2_Missense_Mutation_p.T509S|IL16_uc002bgl.1_Missense_Mutation_p.T509S|IL16_uc010unq.1_Missense_Mutation_p.T509S	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	1210					immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						AACTCCTCCACTGACTCTGCA	0.562																0.469613	311.566263	311.711489	85	96	KEEP	---	---	---	---	54	40	50	58	-1	capture	Missense_Mutation	SNP	81598457	81598457	IL16	15	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	7556	265
HS3ST6	64711	broad.mit.edu	37	16	1961835	1961835	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1961835C>T	uc002cnf.2	-	2	692	c.692G>A	c.(691-693)CGC>CAC	p.R231H		NM_001009606	NP_001009606	C9JH64	C9JH64_HUMAN	heparan sulfate (glucosamine)	231											0						GTCCTGCACGCGGCCGACCTC	0.667																0.762887	231.885409	238.01026	74	23	KEEP	---	---	---	---	55	35	15	11	-1	capture	Missense_Mutation	SNP	1961835	1961835	HS3ST6	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7294	265
CLUAP1	23059	broad.mit.edu	37	16	3554767	3554767	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3554767A>G	uc002cvk.1	+	2	175	c.70A>G	c.(70-72)ATG>GTG	p.M24V	CLUAP1_uc002cvj.1_Missense_Mutation_p.M24V|CLUAP1_uc002cvl.1_Missense_Mutation_p.M24V	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	24						nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3						ACATATTTCTATGGAAAATTT	0.408																0.913043	341.799074	357.676547	84	8	KEEP	---	---	---	---	55	45	8	1	-1	capture	Missense_Mutation	SNP	3554767	3554767	CLUAP1	16	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	3534	265
CREBBP	1387	broad.mit.edu	37	16	3790494	3790494	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3790494G>A	uc002cvv.2	-	24	4243	c.4039C>T	c.(4039-4041)CGG>TGG	p.R1347W	CREBBP_uc002cvw.2_Missense_Mutation_p.R1309W	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1347	Cys/His-rich.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTCTGGCGCCGCAAAAATTTG	0.562					748	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				0.051282	-9.541553	7.068967	4	74	KEEP	---	---	---	---	3	2	34	45	-1	capture	Missense_Mutation	SNP	3790494	3790494	CREBBP	16	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	3826	265
PLCG2	5336	broad.mit.edu	37	16	81891938	81891938	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81891938G>A	uc002fgt.2	+	4	560	c.408G>A	c.(406-408)GCG>GCA	p.A136A	PLCG2_uc010chg.1_Silent_p.A136A	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	136					intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						CGATGAATGCGTCCACGCCCA	0.478					1880											0.43662	328.289377	329.292487	124	160	KEEP	---	---	---	---	74	56	81	95	-1	capture	Silent	SNP	81891938	81891938	PLCG2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11939	265
TP53	7157	broad.mit.edu	37	17	7577535	7577535	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577535C>G	uc002gim.2	-	7	940	c.746G>C	c.(745-747)AGG>ACG	p.R249T	TP53_uc002gig.1_Missense_Mutation_p.R249T|TP53_uc002gih.2_Missense_Mutation_p.R249T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117T|TP53_uc010cng.1_Missense_Mutation_p.R117T|TP53_uc002gii.1_Missense_Mutation_p.R117T|TP53_uc010cnh.1_Missense_Mutation_p.R249T|TP53_uc010cni.1_Missense_Mutation_p.R249T|TP53_uc002gij.2_Missense_Mutation_p.R249T|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156T|TP53_uc002gio.2_Missense_Mutation_p.R117T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	249	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249_T256delRPILTIIT(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GAGGATGGGCCTCCGGTTCAT	0.567	Pancreas(47;798 1329 9957 10801)		111		690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.659091	97.183708	98.166475	29	15	KEEP	---	---	---	---	13	22	7	11	-1	capture	Missense_Mutation	SNP	7577535	7577535	TP53	17	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	16264	265
GATA6	2627	broad.mit.edu	37	18	19762767	19762767	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19762767G>A	uc002ktt.1	+	5	1743	c.1478G>A	c.(1477-1479)CGA>CAA	p.R493Q	GATA6_uc002ktu.1_Missense_Mutation_p.R493Q	NM_005257	NP_005248	Q92908	GATA6_HUMAN	GATA binding protein 6	493					blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(3)	3	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			ACCAGGAAACGAAAACCTAAG	0.313	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)															0.3	66.372794	69.229539	24	56	KEEP	---	---	---	---	16	13	40	26	-1	capture	Missense_Mutation	SNP	19762767	19762767	GATA6	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6198	265
CREB3L3	84699	broad.mit.edu	37	19	4168400	4168400	+	Missense_Mutation	SNP	C	T	T	rs147422200	by1000genomes	TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4168400C>T	uc002lzl.2	+	6	883	c.767C>T	c.(766-768)TCG>TTG	p.S256L	CREB3L3_uc002lzm.2_Missense_Mutation_p.S246L|CREB3L3_uc010xib.1_Missense_Mutation_p.S245L|CREB3L3_uc010xic.1_Intron	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	256	Basic motif.|Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		AACAAGCAGTCGGCGCAAGAA	0.398																0.342105	74.327257	76.00123	26	50	KEEP	---	---	---	---	14	14	21	34	-1	capture	Missense_Mutation	SNP	4168400	4168400	CREB3L3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3823	265
RAVER1	125950	broad.mit.edu	37	19	10434119	10434119	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10434119C>T	uc002moa.2	-	4	1011	c.931G>A	c.(931-933)GTC>ATC	p.V311I		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	294	RRM 3.					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			CAGAAGGAGACTCGCAGGTGG	0.716																0.333333	16.252687	16.691182	6	12	KEEP	---	---	---	---	2	5	10	5	-1	capture	Missense_Mutation	SNP	10434119	10434119	RAVER1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12989	265
GATAD2A	54815	broad.mit.edu	37	19	19576172	19576172	+	Silent	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19576172C>T	uc010xqt.1	+	2	330	c.18C>T	c.(16-18)TGC>TGT	p.C6C	GATAD2A_uc010xqu.1_5'UTR|GATAD2A_uc010xqv.1_Silent_p.C25C|GATAD2A_uc010xqw.1_5'UTR	NM_017660	NP_060130	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	6					DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AAGAAGCATGCCGAACACGGA	0.473																0.020833	-53.043343	8.645868	5	235	KEEP	---	---	---	---	2	4	121	156	-1	capture	Silent	SNP	19576172	19576172	GATAD2A	19	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	6200	265
PLEKHG2	64857	broad.mit.edu	37	19	39908646	39908646	+	Silent	SNP	C	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39908646C>G	uc010xuz.1	+	9	1309	c.984C>G	c.(982-984)CCC>CCG	p.P328P	PLEKHG2_uc010xuy.1_Silent_p.P269P|PLEKHG2_uc002olj.2_Silent_p.P328P|PLEKHG2_uc010xva.1_Silent_p.P135P	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	328	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGGGTGGCCCCCGGCTACGAG	0.662																0.857143	19.864371	20.713585	6	1	KEEP	---	---	---	---	5	9	0	2	-1	capture	Silent	SNP	39908646	39908646	PLEKHG2	19	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	11972	265
KLK5	25818	broad.mit.edu	37	19	51453308	51453308	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51453308G>A	uc002pue.2	-	4	356	c.138C>T	c.(136-138)AGC>AGT	p.S46S	KLK5_uc002puf.2_Silent_p.S46S|KLK5_uc002pug.2_Silent_p.S46S	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein	46				Missing (in Ref. 3; AAG33358).	epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		GGTCCTGGTTGCTCCCAGAGG	0.612																0.842105	100.11903	104.356643	32	6	KEEP	---	---	---	---	24	9	3	5	-1	capture	Silent	SNP	51453308	51453308	KLK5	19	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	8327	265
SUCLG1	8802	broad.mit.edu	37	2	84676841	84676841	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:84676841C>T	uc002son.2	-	2	326	c.133G>A	c.(133-135)GCT>ACT	p.A45T	SUCLG1_uc010ysk.1_Missense_Mutation_p.A32T	NM_003849	NP_003840	P53597	SUCA_HUMAN	succinate-CoA ligase, GDP-forming alpha subunit	45					tricarboxylic acid cycle		ATP citrate synthase activity|GTP binding|succinate-CoA ligase (GDP-forming) activity				0					Succinic acid(DB00139)	TGCCGAGAAGCTGTGTAGGAA	0.299	Ovarian(48;203 1101 37206 40305 50790)															0.392523	131.724674	132.807714	42	65	KEEP	---	---	---	---	33	18	36	43	-1	capture	Missense_Mutation	SNP	84676841	84676841	SUCLG1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	15254	265
C2orf55	343990	broad.mit.edu	37	2	99412664	99412664	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99412664C>T	uc002szf.1	-	9	2962	c.2668G>A	c.(2668-2670)GCT>ACT	p.A890T		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	890											0						CGGTCCACAGCGGGCTTCACA	0.498																0.435115	512.071021	513.511854	171	222	KEEP	---	---	---	---	91	94	112	123	-1	capture	Missense_Mutation	SNP	99412664	99412664	C2orf55	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2156	265
THSD7B	80731	broad.mit.edu	37	2	137928455	137928455	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:137928455G>T	uc002tva.1	+	6	1577	c.1577G>T	c.(1576-1578)GGA>GTA	p.G526V	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.G416V	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCTGATCATGGAAAATGTGGC	0.522																0.505155	144.967934	144.970079	49	48	KEEP	---	---	---	---	20	34	24	28	0.37037037037	capture	Missense_Mutation	SNP	137928455	137928455	THSD7B	2	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	15765	265
PROKR2	128674	broad.mit.edu	37	20	5283350	5283350	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5283350C>T	uc010zqw.1	-	2	491	c.491G>A	c.(490-492)CGG>CAG	p.R164Q	PROKR2_uc010zqx.1_Missense_Mutation_p.R164Q|PROKR2_uc010zqy.1_Missense_Mutation_p.R164Q	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	164	Cytoplasmic (Potential).		R -> Q (in KAL3).			integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						ATAATTCATCCGTGGTTTCAA	0.493													HNSCC(71;0.22)			0.301703	342.451185	356.877812	124	287	KEEP	---	---	---	---	59	72	152	155	-1	capture	Missense_Mutation	SNP	5283350	5283350	PROKR2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12449	265
TFAP2C	7022	broad.mit.edu	37	20	55206728	55206728	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55206728C>A	uc002xya.2	+	2	759	c.516C>A	c.(514-516)CAC>CAA	p.H172Q	TFAP2C_uc010zzi.1_Missense_Mutation_p.H3Q	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma	172					cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)			ACATGCCTCACCAGATGGACG	0.711																0.326531	46.883562	48.191296	16	33	KEEP	---	---	---	---	11	9	15	19	0.45	capture	Missense_Mutation	SNP	55206728	55206728	TFAP2C	20	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	15674	265
TMPRSS15	5651	broad.mit.edu	37	21	19698772	19698772	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19698772G>T	uc002ykw.2	-	16	1929	c.1898C>A	c.(1897-1899)ACT>AAT	p.T633N		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	633	Extracellular (Potential).|CUB 2.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						GTGATAGCCAGTAGTAAAGTT	0.438																0.02994	-30.083305	10.434583	5	162	KEEP	---	---	---	---	4	3	96	96	0.571428571429	capture	Missense_Mutation	SNP	19698772	19698772	TMPRSS15	21	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	16129	265
ADAMTS9	56999	broad.mit.edu	37	3	64527058	64527058	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:64527058G>A	uc003dmg.2	-	35	5357	c.5325C>T	c.(5323-5325)CCC>CCT	p.P1775P	ADAMTS9_uc011bfo.1_Silent_p.P1747P|ADAMTS9_uc011bfp.1_Silent_p.P686P	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1775	GON.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CGTACTCTTTGGGGTGGTCAG	0.502																0.45045	488.815196	489.52676	150	183	KEEP	---	---	---	---	91	72	90	117	-1	capture	Silent	SNP	64527058	64527058	ADAMTS9	3	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	273	265
CNTN3	5067	broad.mit.edu	37	3	74334529	74334529	+	Silent	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:74334529C>T	uc003dpm.1	-	19	2711	c.2631G>A	c.(2629-2631)ACG>ACA	p.T877T		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	877	Fibronectin type-III 3.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CCCGGACAGCCGTGTAATAGG	0.498																0.494975	646.081491	646.089977	197	201	KEEP	---	---	---	---	90	113	110	104	-1	capture	Silent	SNP	74334529	74334529	CNTN3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3607	265
POPDC2	64091	broad.mit.edu	37	3	119373376	119373376	+	Silent	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:119373376C>T	uc003ecx.1	-	2	710	c.576G>A	c.(574-576)CAG>CAA	p.Q192Q	POPDC2_uc010hqw.1_Silent_p.Q192Q|POPDC2_uc003ecy.1_Silent_p.Q10Q	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN	popeye protein 2	192						integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		CCTCAGAAGGCTGTAGTGATT	0.562																0.371585	198.441748	201.097096	68	115	KEEP	---	---	---	---	36	42	68	62	-1	capture	Silent	SNP	119373376	119373376	POPDC2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	12157	265
COPG	22820	broad.mit.edu	37	3	128982760	128982760	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:128982760A>G	uc003els.2	+	13	1242	c.1142A>G	c.(1141-1143)CAG>CGG	p.Q381R	COPG_uc010htb.2_Missense_Mutation_p.Q287R	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	381	HEAT 4.				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						GTGGTTGTCCAGGCCATCAGT	0.537																0.406504	151.815577	152.757283	50	73	KEEP	---	---	---	---	26	28	44	39	-1	capture	Missense_Mutation	SNP	128982760	128982760	COPG	3	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	3696	265
ZIC1	7545	broad.mit.edu	37	3	147128086	147128086	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:147128086G>A	uc003ewe.2	+	1	906	c.187G>A	c.(187-189)GCC>ACC	p.A63T		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	63					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CGGCCAGACGGCCTTCACGTC	0.687																0.565217	108.217465	108.471309	39	30	KEEP	---	---	---	---	20	24	13	23	-1	capture	Missense_Mutation	SNP	147128086	147128086	ZIC1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17558	265
MED12L	116931	broad.mit.edu	37	3	150906259	150906259	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:150906259C>T	uc003eyp.2	+	12	1783	c.1745C>T	c.(1744-1746)CCC>CTC	p.P582L	MED12L_uc011bnz.1_Missense_Mutation_p.P442L|MED12L_uc003eyn.2_Missense_Mutation_p.P582L|MED12L_uc003eyo.2_Missense_Mutation_p.P582L	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	582					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACACAGGCCCCCTCTTTGTGT	0.343					59											0.432432	357.489502	358.511265	112	147	KEEP	---	---	---	---	73	60	90	81	-1	capture	Missense_Mutation	SNP	150906259	150906259	MED12L	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	9342	265
MAPKSP1	8649	broad.mit.edu	37	4	100805284	100805284	+	Splice_Site	SNP	T	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100805284T>G	uc003hvg.2	-	6	487	c.238_splice	c.e6-1	p.V80_splice	MAPKSP1_uc003hvi.2_Splice_Site|MAPKSP1_uc003hvh.2_Splice_Site_p.V73_splice	NM_021970	NP_068805	Q9UHA4	LTOR3_HUMAN	MAPK scaffold protein 1						cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	Ragulator complex	protein binding				0						TTGAACCACCTAAAAAGAAAA	0.308																0.442857	110.320385	110.518836	31	39	KEEP	---	---	---	---	23	11	20	26	-1	capture	Splice_Site	SNP	100805284	100805284	MAPKSP1	4	T	G	G	G	1	0	0	0	0	0	0	1	0	689	53	5	4	9206	265
MTMR12	54545	broad.mit.edu	37	5	32255876	32255876	+	Splice_Site	SNP	T	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32255876T>C	uc003jhq.2	-	8	884	c.714_splice	c.e8-1	p.R238_splice	MTMR12_uc010iuk.2_Splice_Site_p.R238_splice|MTMR12_uc010iul.2_Splice_Site_p.R238_splice	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1						GCTGGCAATCTAGAAGAAAGA	0.418																0.357143	33.942461	34.445669	10	18	KEEP	---	---	---	---	10	2	15	7	-1	capture	Splice_Site	SNP	32255876	32255876	MTMR12	5	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	9851	265
SLCO6A1	133482	broad.mit.edu	37	5	101815988	101815988	+	Missense_Mutation	SNP	T	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101815988T>A	uc003knn.2	-	2	681	c.509A>T	c.(508-510)AAA>ATA	p.K170I	SLCO6A1_uc003kno.2_Missense_Mutation_p.K170I|SLCO6A1_uc003knp.2_Missense_Mutation_p.K170I|SLCO6A1_uc003knq.2_Missense_Mutation_p.K170I	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	170	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CCATATTACTTTTTTTCTGTC	0.333																0.431818	216.482283	217.192162	76	100	KEEP	---	---	---	---	36	51	41	60	-1	capture	Missense_Mutation	SNP	101815988	101815988	SLCO6A1	5	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	14624	265
TRPC7	57113	broad.mit.edu	37	5	135692995	135692995	+	Silent	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135692995C>T	uc003lbn.1	-	1	81	c.78G>A	c.(76-78)CGG>CGA	p.R26R	TRPC7_uc010jef.1_Silent_p.R18R|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Silent_p.R18R|TRPC7_uc010jei.1_Silent_p.R18R|TRPC7_uc010jej.1_5'UTR	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	27	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGGCGGGACCCCGGATGGCCT	0.612																0.49505	307.378439	307.382733	100	102	KEEP	---	---	---	---	57	47	57	53	-1	capture	Silent	SNP	135692995	135692995	TRPC7	5	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	16467	265
PCDHA3	56145	broad.mit.edu	37	5	140182972	140182972	+	Silent	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140182972C>T	uc003lhf.2	+	1	2190	c.2190C>T	c.(2188-2190)GGC>GGT	p.G730G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.G730G	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	730	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACCGAAGGCGACTGTGGGC	0.642																0.45583	376.343125	376.823221	129	154	KEEP	---	---	---	---	71	73	97	78	-1	capture	Silent	SNP	140182972	140182972	PCDHA3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11428	265
ZFP57	346171	broad.mit.edu	37	6	29641071	29641071	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29641071C>G	uc011dlw.1	-	4	968	c.817G>C	c.(817-819)GAG>CAG	p.E273Q	ZFP57_uc003nnl.3_Missense_Mutation_p.E253Q	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	189	C2H2-type 4.				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CGTTTGAGCTCAGACTGGTCC	0.552																0.409326	277.172328	278.56274	79	114	KEEP	---	---	---	---	35	57	64	63	-1	capture	Missense_Mutation	SNP	29641071	29641071	ZFP57	6	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17531	265
C6orf127	340204	broad.mit.edu	37	6	35754859	35754859	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35754859G>A	uc003old.3	+	2	241	c.184G>A	c.(184-186)GCG>ACG	p.A62T		NM_001010886	NP_001010886	A2RUU4	CF127_HUMAN	hypothetical protein LOC340204 precursor	62					digestion|lipid catabolic process	extracellular region	enzyme activator activity			skin(1)	1						GTCGCACTGCGCGGAGAAGGG	0.662																1	14.467842	14.407157	4	0	KEEP	---	---	---	---	2	2	0	0	-1	capture	Missense_Mutation	SNP	35754859	35754859	C6orf127	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2304	265
STXBP5	134957	broad.mit.edu	37	6	147704054	147704054	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:147704054G>C	uc003qlz.2	+	27	3495	c.3334G>C	c.(3334-3336)GGG>CGG	p.G1112R	STXBP5_uc010khz.1_Missense_Mutation_p.G1076R|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.G767R	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	1112	v-SNARE coiled-coil homology.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		AGATGAAAGAGGGCAGAAACT	0.483																0.402062	224.492596	226.124717	78	116	KEEP	---	---	---	---	45	36	64	57	-1	capture	Missense_Mutation	SNP	147704054	147704054	STXBP5	6	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	15246	265
NDUFA4	4697	broad.mit.edu	37	7	10979661	10979661	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:10979661C>G	uc003srx.1	-	1	153	c.24G>C	c.(22-24)CAG>CAC	p.Q8H		NM_002489	NP_002480	O00483	NDUA4_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	8					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)	NADH(DB00157)	GCTTCTTGGCCTGACCGATGA	0.547																0.215971	315.221389	356.237378	119	432	KEEP	---	---	---	---	57	75	235	264	-1	capture	Missense_Mutation	SNP	10979661	10979661	NDUFA4	7	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	10173	265
DNAH11	8701	broad.mit.edu	37	7	21611464	21611464	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21611464G>A	uc003svc.2	+	8	1497	c.1466G>A	c.(1465-1467)AGA>AAA	p.R489K		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	489	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AAGCTGGAAAGACTGGAATTT	0.353												Kartagener_syndrome				0.285714	85.002885	89.331562	30	75	KEEP	---	---	---	---	18	16	37	53	-1	capture	Missense_Mutation	SNP	21611464	21611464	DNAH11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4557	265
CHN2	1124	broad.mit.edu	37	7	29539565	29539565	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29539565G>A	uc003szz.2	+	9	1259	c.822G>A	c.(820-822)GTG>GTA	p.V274V	CHN2_uc011jzs.1_Silent_p.V349V|CHN2_uc010kva.2_Silent_p.V44V|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Silent_p.V239V|CHN2_uc011jzt.1_Silent_p.V287V|CHN2_uc010kvd.2_Silent_p.V130V|CHN2_uc011jzu.1_Silent_p.V259V|CHN2_uc010kvg.2_Silent_p.V138V|CHN2_uc010kvh.2_Intron|CHN2_uc010kvi.2_Silent_p.V138V|CHN2_uc010kve.2_Silent_p.V138V|CHN2_uc003taa.2_Silent_p.V138V|CHN2_uc010kvf.2_Intron|CHN2_uc010kvj.2_Silent_p.V93V|CHN2_uc010kvk.2_Intron|CHN2_uc010kvl.2_RNA|CHN2_uc010kvm.2_Silent_p.V93V|CHN2_uc011jzv.1_Silent_p.V67V	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	274					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						TCAAGAAAGTGTACTGTTGTG	0.448	Ovarian(1;44 48 13232 18918 31480)															0.26875	106.456488	114.178242	43	117	KEEP	---	---	---	---	21	24	53	67	-1	capture	Silent	SNP	29539565	29539565	CHN2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	3328	265
ELN	2006	broad.mit.edu	37	7	73472022	73472022	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73472022G>A	uc003tzw.2	+	22	1501	c.1410G>A	c.(1408-1410)CAG>CAA	p.Q470Q	RFC2_uc011kfa.1_Intron|ELN_uc011kfe.1_Silent_p.Q439Q|ELN_uc003tzn.2_Silent_p.Q470Q|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Silent_p.Q475Q|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Silent_p.Q460Q|ELN_uc011kff.1_Silent_p.Q470Q|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	499	Ala-rich.				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	AAGCCGCCCAGTTTGGTAAGT	0.612					434	T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						0.266667	29.834649	32.013949	12	33	KEEP	---	---	---	---	20	26	44	61	-1	capture	Silent	SNP	73472022	73472022	ELN	7	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	5026	265
GNAT3	346562	broad.mit.edu	37	7	80091548	80091548	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80091548G>C	uc011kgu.1	-	7	801	c.801C>G	c.(799-801)TTC>TTG	p.F267L	CD36_uc003uhc.2_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	267					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						TTTTGTTGAGGAACAGGACAA	0.343																0.314815	57.356403	59.003371	17	37	KEEP	---	---	---	---	8	9	24	15	-1	capture	Missense_Mutation	SNP	80091548	80091548	GNAT3	7	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	6449	265
CALCR	799	broad.mit.edu	37	7	93091387	93091387	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93091387T>C	uc003umv.1	-	8	872	c.611A>G	c.(610-612)TAT>TGT	p.Y204C	CALCR_uc011kia.1_5'Flank|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_Intron|CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	186	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	TGCCTTCCTATATTTCCAATT	0.284																0.2	8.717181	9.97195	3	12	KEEP	---	---	---	---	2	1	9	5	-1	capture	Missense_Mutation	SNP	93091387	93091387	CALCR	7	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	2555	265
GRM8	2918	broad.mit.edu	37	7	126882860	126882860	+	Silent	SNP	A	G	G			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126882860A>G	uc003vlr.2	-	1	710	c.399T>C	c.(397-399)TGT>TGC	p.C133C	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.C133C|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	133	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CTCCATTAGCACACTTCACAT	0.483													HNSCC(24;0.065)			0.273504	184.822008	195.623649	64	170	KEEP	---	---	---	---	29	38	86	97	-1	capture	Silent	SNP	126882860	126882860	GRM8	7	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	6736	265
TSGA13	114960	broad.mit.edu	37	7	130357671	130357671	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130357671G>A	uc003vqi.2	-	6	890	c.433C>T	c.(433-435)CGC>TGC	p.R145C	TSGA13_uc003vqj.2_Missense_Mutation_p.R145C	NM_052933	NP_443165	Q96PP4	TSG13_HUMAN	testis specific, 13	145										ovary(2)	2	Melanoma(18;0.0435)					TGAGGCATGCGGGGCAGCCAG	0.473																0.284848	134.254405	141.111386	47	118	KEEP	---	---	---	---	22	32	60	67	-1	capture	Missense_Mutation	SNP	130357671	130357671	TSGA13	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16502	265
TRPV5	56302	broad.mit.edu	37	7	142625188	142625188	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142625188G>A	uc003wby.1	-	7	1168	c.904C>T	c.(904-906)CGA>TGA	p.R302*	TRPV5_uc003wbz.2_Nonsense_Mutation_p.R302*	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	302	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	p.R302R(1)		ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					CATACCTCTCGTTTATCAGAG	0.527																0.311927	190.320957	197.186263	68	150	KEEP	---	---	---	---	40	39	91	71	-1	capture	Nonsense_Mutation	SNP	142625188	142625188	TRPV5	7	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	16482	265
MLL3	58508	broad.mit.edu	37	7	151944990	151944990	+	Silent	SNP	T	C	C			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151944990T>C	uc003wla.2	-	14	2748	c.2529A>G	c.(2527-2529)AAA>AAG	p.K843K		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	843					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ACCCTACCTGTTTGGACCGAG	0.368	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.071121	5.309257	93.261142	33	431	KEEP	---	---	---	---	20	29	302	303	-1	capture	Silent	SNP	151944990	151944990	MLL3	7	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	9534	265
EIF3H	8667	broad.mit.edu	37	8	117738327	117738327	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:117738327C>T	uc003yoa.2	-	2	243	c.217G>A	c.(217-219)GAA>AAA	p.E73K	EIF3H_uc003yob.2_Missense_Mutation_p.E87K|EIF3H_uc011lhz.1_Missense_Mutation_p.E73K	NM_003756	NP_003747	O15372	EIF3H_HUMAN	eukaryotic translation initiation factor 3,	73	MPN.			E -> K (in Ref. 2; AAC84044).	regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(3)	3	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					AGCCGATCTTCTACAACCAGA	0.403					241											0.405172	147.201136	148.113458	47	69	KEEP	---	---	---	---	18	34	36	44	-1	capture	Missense_Mutation	SNP	117738327	117738327	EIF3H	8	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4973	265
FAM83H	286077	broad.mit.edu	37	8	144808899	144808899	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144808899C>T	uc003yzk.2	-	5	2801	c.2732G>A	c.(2731-2733)CGC>CAC	p.R911H	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	911					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACTACCCCTGCGCTCGGGGTA	0.682																0.487179	56.119315	56.125012	19	20	KEEP	---	---	---	---	13	9	11	10	-1	capture	Missense_Mutation	SNP	144808899	144808899	FAM83H	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5586	265
DENND4C	55667	broad.mit.edu	37	9	19305352	19305352	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19305352G>A	uc003znq.2	+	6	639	c.606G>A	c.(604-606)ATG>ATA	p.M202I	DENND4C_uc011lnc.1_5'UTR	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	202	DENN.|Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2						TTCCCCAGATGATCTTTCCAT	0.343																0.832402	478.459605	497.185084	149	30	KEEP	---	---	---	---	94	68	13	20	-1	capture	Missense_Mutation	SNP	19305352	19305352	DENND4C	9	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	4393	265
CYLC2	1539	broad.mit.edu	37	9	105763888	105763888	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:105763888A>T	uc004bbs.2	+	2	116	c.46A>T	c.(46-48)AAT>TAT	p.N16Y		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	16					cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				GCCATATGATAATTACATTCC	0.259																0.428571	97.85908	98.202153	33	44	KEEP	---	---	---	---	24	16	28	24	-1	capture	Missense_Mutation	SNP	105763888	105763888	CYLC2	9	A	T	T	T	1	0	0	0	0	1	0	0	0	169	13	4	4	4102	265
C9orf84	158401	broad.mit.edu	37	9	114466161	114466161	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114466161C>A	uc004bfr.2	-	20	2910	c.2775G>T	c.(2773-2775)CAG>CAT	p.Q925H	C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfq.2_Missense_Mutation_p.Q886H|C9orf84_uc010mug.2_Missense_Mutation_p.Q836H	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	925										ovary(2)	2						CTAGTTTTACCTGCAAAATTA	0.318																0.046154	-7.83279	6.454691	3	62	KEEP	---	---	---	---	2	1	32	37	0.333333333333	capture	Missense_Mutation	SNP	114466161	114466161	C9orf84	9	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	2476	265
ENG	2022	broad.mit.edu	37	9	130605418	130605418	+	Silent	SNP	G	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130605418G>A	uc004bsj.3	-	2	587	c.174C>T	c.(172-174)CCC>CCT	p.P58P	ENG_uc011mam.1_5'UTR|ENG_uc004bsk.3_Silent_p.P58P	NM_001114753	NP_001108225	P17813	EGLN_HUMAN	endoglin isoform 1 precursor	58	Extracellular (Potential).				artery morphogenesis|BMP signaling pathway|cell adhesion|cell chemotaxis|central nervous system vasculogenesis|chronological cell aging|detection of hypoxia|extracellular matrix disassembly|heart looping|negative regulation of endothelial cell proliferation|negative regulation of nitric-oxide synthase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of protein autophosphorylation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|patterning of blood vessels|positive regulation of BMP signaling pathway|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of systemic arterial blood pressure|positive regulation of transcription from RNA polymerase II promoter|regulation of cell adhesion|regulation of cell proliferation|regulation of transcription, DNA-dependent|regulation of transforming growth factor beta receptor signaling pathway|smooth muscle tissue development|transforming growth factor beta receptor signaling pathway|venous blood vessel morphogenesis|wound healing	cell surface|external side of plasma membrane|extracellular space|membrane fraction	activin binding|galactose binding|glycosaminoglycan binding|protein homodimerization activity|transforming growth factor beta binding|transforming growth factor beta receptor activity|transforming growth factor beta receptor, cytoplasmic mediator activity|transmembrane receptor activity|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding				0						GGATGGCATTGGGGGCCTGAG	0.602												Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				0.48184	644.996339	645.115304	199	214	KEEP	---	---	---	---	98	117	98	134	-1	capture	Silent	SNP	130605418	130605418	ENG	9	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	5072	265
BHLHB9	80823	broad.mit.edu	37	X	102004405	102004405	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102004405C>T	uc010nog.2	+	4	1053	c.482C>T	c.(481-483)CCT>CTT	p.P161L	BHLHB9_uc011mrq.1_Missense_Mutation_p.P161L|BHLHB9_uc011mrr.1_Missense_Mutation_p.P161L|BHLHB9_uc011mrs.1_Missense_Mutation_p.P161L|BHLHB9_uc011mrt.1_Missense_Mutation_p.P161L|BHLHB9_uc004ejo.2_Missense_Mutation_p.P161L|BHLHB9_uc011mru.1_Missense_Mutation_p.P161L|BHLHB9_uc011mrv.1_Missense_Mutation_p.P161L	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	161						cytoplasm|nucleus	binding			ovary(2)	2						GATTGCAAACCTAGGTCAGGG	0.493																0.942675	529.079147	552.907857	148	9	KEEP	---	---	---	---	80	90	3	9	-1	capture	Missense_Mutation	SNP	102004405	102004405	BHLHB9	23	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	1408	265
FAM127C	441518	broad.mit.edu	37	X	134156181	134156181	+	Silent	SNP	C	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134156181C>T	uc004eyc.1	-	1	386	c.309G>A	c.(307-309)CGG>CGA	p.R103R		NM_001078173	NP_001071641	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	103											0	Acute lymphoblastic leukemia(192;0.000127)					ATCCAAAGACCCGCTTCATCT	0.667																0.855263	231.723223	240.95138	65	11	KEEP	---	---	---	---	37	39	6	6	-1	capture	Silent	SNP	134156181	134156181	FAM127C	23	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	5387	265
NCDN	23154	broad.mit.edu	37	1	36026428	36026431	+	Frame_Shift_Del	DEL	AGTG	-	-			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36026428_36026431delAGTG	uc001bza.2	+	4	803_806	c.676_679delAGTG	c.(676-681)AGTGAGfs	p.S226fs	KIAA0319L_uc010ohw.1_5'Flank|NCDN_uc001bzb.2_Frame_Shift_Del_p.S226fs|NCDN_uc001bzc.2_Frame_Shift_Del_p.S209fs	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1	226_227					neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCGGGGCCTCAGTGAGGATTTCCA	0.642																0.33			58	117		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	36026428	36026431	NCDN	1	AGTG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	10121	265
PTEN	5728	broad.mit.edu	37	10	89717715	89717716	+	Frame_Shift_Ins	INS	-	A	A			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717715_89717716insA	uc001kfb.2	+	8	1771_1772	c.740_741insA	c.(739-741)TTAfs	p.L247fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	247	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.P248fs*5(11)|p.R55fs*1(4)|p.L247*(3)|p.L247fs*10(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.L247fs*11(1)|p.L247fs*12(1)|p.G165_*404del(1)|p.L247fs*6(1)|p.L247fs*4(1)|p.?(1)|p.L247fs*5(1)|p.G165_K342del(1)|p.L247fs*8(1)|p.P246_L247insGP(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CCTCAGCCGTTACCTGTGTGTG	0.406			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.84			89	17		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	89717715	89717716	PTEN	10	-	A	A	A	1	0	1	1	0	0	0	0	0	793	61	5	5	12633	265
OR8K3	219473	broad.mit.edu	37	11	56086116	56086116	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56086116delC	uc010rjf.1	+	1	334	c.334delC	c.(334-336)CTTfs	p.L112fs		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					TGGTAGTGAACTTTTTATTCT	0.378																0.42			74	104		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	56086116	56086116	OR8K3	11	C	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	11148	265
DDX5	1655	broad.mit.edu	37	17	62500099	62500102	+	Splice_Site	DEL	ACAG	-	-			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62500099_62500102delACAG	uc002jek.2	-	4	688	c.441_splice	c.e4+1	p.S147_splice	DDX5_uc010deh.2_Splice_Site_p.S147_splice|DDX5_uc002jej.2_Splice_Site_p.S42_splice|DDX5_uc010wqa.1_Intron|DDX5_uc002jel.1_5'Flank	NM_004396	NP_004387	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5						cell growth|regulation of alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA helicase activity|transcription cofactor activity			ovary(2)|lung(1)	3	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCCAAACTTACAGACAATGTTTT	0.397	NSCLC(22;406 813 4871 19580 40307)					T	ETV4	prostate								0.35			119	220		---	---	---	---						capture_indel	Splice_Site	DEL	62500099	62500102	DDX5	17	ACAG	-	-	-	1	0	1	0	1	0	0	1	0	182	14	5	5	4325	265
PCDP1	200373	broad.mit.edu	37	2	120362804	120362805	+	Frame_Shift_Ins	INS	-	CACT	CACT			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:120362804_120362805insCACT	uc002tmb.2	+	12	1306_1307	c.214_215insCACT	c.(214-216)GCAfs	p.A72fs	PCDP1_uc010yyq.1_Frame_Shift_Ins_p.A202fs	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	358						cilium	calmodulin binding				0	Colorectal(110;0.196)					GATGAAGGAGGCACTCTTTGAA	0.386																0.32			56	118		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	120362804	120362805	PCDP1	2	-	CACT	CACT	CACT	1	0	1	1	0	0	0	0	0	546	42	5	5	11475	265
ATAD2	29028	broad.mit.edu	37	8	124384892	124384893	+	Frame_Shift_Ins	INS	-	T	T			TCGA-76-4925-01	TCGA-76-4925-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124384892_124384893insT	uc003yqh.3	-	3	462_463	c.354_355insA	c.(352-357)AAAGAAfs	p.K118fs	ATAD2_uc011lii.1_5'UTR|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Frame_Shift_Ins_p.K118fs	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	118_119					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTGTGCTCTTCTTTTTTTTTAT	0.198																0.02			7	316		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	124384892	124384893	ATAD2	8	-	T	T	T	1	0	1	1	0	0	0	0	0	416	32	5	5	1062	265
