Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
LEPRE1	64175	broad.mit.edu	37	1	43215947	43215947	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43215947T>C	uc001chv.2	-	11	1743	c.1630A>G	c.(1630-1632)AAG>GAG	p.K544E	LEPRE1_uc001chw.2_Missense_Mutation_p.K544E|LEPRE1_uc001chx.3_Missense_Mutation_p.K544E	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	544					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CGCCGCACCTTCTCCGTCACG	0.572																0.039474	-10.730917	6.649711	3	73	KEEP	---	---	---	---	0	3	46	35	-1	capture	Missense_Mutation	SNP	43215947	43215947	LEPRE1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	8649	272
NEXN	91624	broad.mit.edu	37	1	78401572	78401572	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78401572G>T	uc001dic.3	+	11	1613	c.1316G>T	c.(1315-1317)AGG>ATG	p.R439M	NEXN_uc001dia.3_Missense_Mutation_p.R425M|NEXN_uc009wcb.1_Missense_Mutation_p.R361M|NEXN_uc001dib.3_Missense_Mutation_p.R375M|NEXN_uc001did.1_Missense_Mutation_p.R349M|NEXN_uc001dif.1_Missense_Mutation_p.R331M|NEXN_uc001dig.3_Missense_Mutation_p.R80M	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)	439	Glu-rich.				regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		AAATTAAAAAGGAGTGGCTCT	0.313																0.155172	32.067874	45.250583	18	98	KEEP	---	---	---	---	6	12	48	63	0.333333333333	capture	Missense_Mutation	SNP	78401572	78401572	NEXN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	10262	272
LPAR3	23566	broad.mit.edu	37	1	85331314	85331314	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85331314T>C	uc001dkl.2	-	1	529	c.490A>G	c.(490-492)ACA>GCA	p.T164A	LPAR3_uc009wcj.1_Missense_Mutation_p.T164A	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	164	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						CAGCCCAGTGTGGGGACCGCC	0.527																0.221918	216.623712	242.673962	81	284	KEEP	---	---	---	---	45	39	136	155	-1	capture	Missense_Mutation	SNP	85331314	85331314	LPAR3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	8822	272
SLC39A12	221074	broad.mit.edu	37	10	18276538	18276538	+	Silent	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:18276538C>T	uc001ipo.2	+	7	1500	c.1227C>T	c.(1225-1227)GTC>GTT	p.V409V	SLC39A12_uc001ipn.2_Silent_p.V409V|SLC39A12_uc001ipp.2_Silent_p.V409V|SLC39A12_uc010qck.1_Silent_p.V275V	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	409	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						GCTTGGCCGTCGGGACACTGT	0.502																0.717647	404.522645	411.766115	122	48	KEEP	---	---	---	---	70	76	29	27	-1	capture	Silent	SNP	18276538	18276538	SLC39A12	10	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	14507	272
SVIL	6840	broad.mit.edu	37	10	29784039	29784039	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:29784039C>T	uc001iut.1	-	19	4489	c.3736G>A	c.(3736-3738)GTT>ATT	p.V1246I	SVIL_uc010qdw.1_Missense_Mutation_p.V160I|SVIL_uc001iuu.1_Missense_Mutation_p.V820I|SVIL_uc009xlc.2_Missense_Mutation_p.V38I	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1246					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GGTTTGGAAACGGGTGTGGTG	0.552																0.627119	121.087128	121.924137	37	22	KEEP	---	---	---	---	29	22	14	19	-1	capture	Missense_Mutation	SNP	29784039	29784039	SVIL	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15309	272
PTEN	5728	broad.mit.edu	37	10	89692778	89692778	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692778T>C	uc001kfb.2	+	6	1293	c.262T>C	c.(262-264)TAT>CAT	p.Y88H		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	88	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Y88C(5)|p.R55fs*1(4)|p.?(2)|p.Y27fs*1(2)|p.Y88fs*3(2)|p.Y27_N212>Y(2)|p.Y88N(1)|p.Y88H(1)|p.Q87_P96del(1)|p.Y88S(1)|p.N82_P95del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGTTGCACAATATCCTTTTGA	0.338			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.808696	365.54955	375.795359	93	22	KEEP	---	---	---	---	53	51	13	17	-1	capture	Missense_Mutation	SNP	89692778	89692778	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	12633	272
OR52E8	390079	broad.mit.edu	37	11	5878741	5878741	+	Silent	SNP	A	G	G	rs147064631		TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5878741A>G	uc010qzr.1	-	1	192	c.192T>C	c.(190-192)CCT>CCC	p.P64P	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTAGTACATAGGCTCATGGA	0.458																0.019231	-45.780905	8.231506	4	204	KEEP	---	---	---	---	3	3	101	122	-1	capture	Silent	SNP	5878741	5878741	OR52E8	11	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	11022	272
OR52E8	390079	broad.mit.edu	37	11	5878765	5878765	+	Silent	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5878765C>T	uc010qzr.1	-	1	168	c.168G>A	c.(166-168)CAG>CAA	p.Q56Q	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	56	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGCTCAGTCTGGATCACAA	0.483																0.020408	-42.787496	7.735542	4	192	KEEP	---	---	---	---	2	3	95	110	-1	capture	Silent	SNP	5878765	5878765	OR52E8	11	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	11022	272
SYT12	91683	broad.mit.edu	37	11	66797643	66797643	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66797643C>A	uc009yrl.2	+	2	258	c.28C>A	c.(28-30)CTG>ATG	p.L10M	SYT12_uc001oju.2_Missense_Mutation_p.L10M	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII	10	Vesicular (Potential).					cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						AGAATACCATCTGAGCGGTGA	0.428	Ovarian(65;2862 3307)															0.047619	-10.47682	7.830441	4	80	KEEP	---	---	---	---	3	1	39	43	0.25	capture	Missense_Mutation	SNP	66797643	66797643	SYT12	11	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	15356	272
KDM5A	5927	broad.mit.edu	37	12	416979	416979	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:416979G>A	uc001qif.1	-	23	3934	c.3571C>T	c.(3571-3573)CTT>TTT	p.L1191F	KDM5A_uc001qie.1_Missense_Mutation_p.L1191F	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1191	PHD-type 2.				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						GATTTAGGAAGAGGAACACAG	0.443					958	T 	NUP98	AML								0.167247	102.405593	132.534327	48	239	KEEP	---	---	---	---	21	28	130	144	-1	capture	Missense_Mutation	SNP	416979	416979	KDM5A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	8055	272
TNFRSF1A	7132	broad.mit.edu	37	12	6442637	6442637	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6442637G>T	uc001qnu.2	-	4	649	c.368C>A	c.(367-369)ACC>AAC	p.T123N	TNFRSF1A_uc001qnt.2_Missense_Mutation_p.T15N|TNFRSF1A_uc010sey.1_Intron|TNFRSF1A_uc010sez.1_Missense_Mutation_p.T15N|TNFRSF1A_uc009zek.2_Missense_Mutation_p.T80N|TNFRSF1A_uc010sfa.1_Missense_Mutation_p.T123N	NM_001065	NP_001056	P19438	TNR1A_HUMAN	tumor necrosis factor receptor 1 precursor	123	TNFR-Cys 2.|Extracellular (Potential).				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|inflammatory response|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of transcription from RNA polymerase II promoter|prostaglandin metabolic process	extracellular region|integral to plasma membrane|membrane raft	tumor necrosis factor receptor activity			lung(2)|skin(1)	3						GCCACACACGGTGTCCCGGTC	0.552					109											0.39759	95.96338	96.72276	33	50	KEEP	---	---	---	---	16	19	24	30	0.457142857143	capture	Missense_Mutation	SNP	6442637	6442637	TNFRSF1A	12	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	16176	272
ART4	420	broad.mit.edu	37	12	14993552	14993552	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14993552G>A	uc001rcl.1	-	2	1046	c.680C>T	c.(679-681)ACC>ATC	p.T227I	ART4_uc009zid.1_Intron|ART4_uc009zie.1_Intron|ART4_uc001rcm.1_Missense_Mutation_p.T227I	NM_021071	NP_066549	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 precursor	227					arginine metabolic process|protein ADP-ribosylation	anchored to membrane|plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity				0						GGTGAATATGGTAAATAGTGT	0.463																0.34507	137.526229	140.538889	49	93	KEEP	---	---	---	---	24	31	57	52	-1	capture	Missense_Mutation	SNP	14993552	14993552	ART4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	992	272
KRT73	319101	broad.mit.edu	37	12	53011874	53011874	+	Silent	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53011874G>A	uc001sas.2	-	1	470	c.435C>T	c.(433-435)TCC>TCT	p.S145S		NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73	145	Coil 1A.|Rod.					keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGTCAATGAAGGAGGCGAACT	0.547																0.39207	284.819026	287.136698	89	138	KEEP	---	---	---	---	48	49	94	61	-1	capture	Silent	SNP	53011874	53011874	KRT73	12	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	8406	272
LRP1	4035	broad.mit.edu	37	12	57581169	57581169	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57581169G>T	uc001snd.2	+	42	7427	c.6961G>T	c.(6961-6963)GAG>TAG	p.E2321*		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2321	LDL-receptor class B 22.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGGGGCCTTCGAGCGTGAGAC	0.607					1456											0.026316	-29.93569	7.783624	4	148	KEEP	---	---	---	---	2	2	83	96	0.5	capture	Nonsense_Mutation	SNP	57581169	57581169	LRP1	12	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	8867	272
LRIG3	121227	broad.mit.edu	37	12	59274532	59274532	+	Silent	SNP	A	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:59274532A>G	uc001sqr.2	-	13	1878	c.1632T>C	c.(1630-1632)GCT>GCC	p.A544A	LRIG3_uc009zqh.2_Silent_p.A484A|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	544	Ig-like C2-type 1.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TTTCCATTTCAGCATCATGCA	0.488																0.396226	246.34801	248.347706	84	128	KEEP	---	---	---	---	50	40	68	66	-1	capture	Silent	SNP	59274532	59274532	LRIG3	12	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	8862	272
TPTE2	93492	broad.mit.edu	37	13	20039688	20039688	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20039688G>A	uc001umd.2	-	9	740	c.529C>T	c.(529-531)CGA>TGA	p.R177*	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Nonsense_Mutation_p.R66*|TPTE2_uc001ume.2_Nonsense_Mutation_p.R100*|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	177						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTAGAAGTCGAACTAAATGT	0.289																0.246377	43.648585	47.683988	17	52	KEEP	---	---	---	---	13	7	19	36	-1	capture	Nonsense_Mutation	SNP	20039688	20039688	TPTE2	13	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	16314	272
MPHOSPH8	54737	broad.mit.edu	37	13	20235946	20235946	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20235946G>A	uc001umh.2	+	8	1909	c.1900G>A	c.(1900-1902)GGG>AGG	p.G634R	MPHOSPH8_uc001umg.2_Missense_Mutation_p.G634R	NM_017520	NP_059990	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	634	ANK 2.				cell cycle	cytoplasm|nucleus					0		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		GCAGAAGAACGGGACCACCGC	0.552																0.227848	94.841221	105.561754	36	122	KEEP	---	---	---	---	13	28	64	73	-1	capture	Missense_Mutation	SNP	20235946	20235946	MPHOSPH8	13	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9639	272
NALCN	259232	broad.mit.edu	37	13	101728226	101728226	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:101728226G>A	uc001vox.1	-	35	4141	c.3952C>T	c.(3952-3954)CAT>TAT	p.H1318Y		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1318	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTACTTACATGTTTTCCACAG	0.323																0.626263	374.71684	377.480547	124	74	KEEP	---	---	---	---	76	62	33	50	-1	capture	Missense_Mutation	SNP	101728226	101728226	NALCN	13	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10057	272
OR4Q3	441669	broad.mit.edu	37	14	20215929	20215930	+	Missense_Mutation	DNP	TT	AG	AG	rs138558904	byFrequency	TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20215929_20215930TT>AG	uc010tkt.1	+	1	343_344	c.343_344TT>AG	c.(343-345)TTG>AGG	p.L115R		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGAGATGTTTTTGCTGACAGTC	0.495																0.764706	258.390697	264.924571	78	24	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	20215929	20215930	OR4Q3	14	TT	AG	AG	AG	1	0	0	0	0	1	0	0	0	829	64	4	4	10985	272
BATF	10538	broad.mit.edu	37	14	76012841	76012841	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:76012841C>T	uc001xrr.2	+	3	447	c.205C>T	c.(205-207)CGC>TGC	p.R69C		NM_006399	NP_006390	Q16520	BATF_HUMAN	basic leucine zipper transcription factor,	69	Leucine-zipper.					nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.028)		CGCGGCTCTACGCAAGGAGAT	0.612																0.71875	148.872157	151.623562	46	18	KEEP	---	---	---	---	24	26	8	14	-1	capture	Missense_Mutation	SNP	76012841	76012841	BATF	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1314	272
HEATR3	55027	broad.mit.edu	37	16	50112858	50112858	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50112858G>C	uc002efw.2	+	7	1132	c.970G>C	c.(970-972)GAT>CAT	p.D324H	HEATR3_uc002efx.2_Missense_Mutation_p.D238H	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	324							binding			ovary(1)|skin(1)	2						TTTGATTGAAGATGATGAAAT	0.368																0.484848	297.295013	297.328007	80	85	KEEP	---	---	---	---	49	36	50	46	-1	capture	Missense_Mutation	SNP	50112858	50112858	HEATR3	16	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	6956	272
SLC12A3	6559	broad.mit.edu	37	16	56904089	56904089	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56904089C>T	uc010ccm.2	+	5	712	c.683C>T	c.(682-684)GCC>GTC	p.A228V	SLC12A3_uc002ekd.3_Missense_Mutation_p.A228V|SLC12A3_uc010ccn.2_Missense_Mutation_p.A227V	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	228	Helical; (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTCGCCAATGCCGTGGGTGTG	0.662																0.021505	-40.954267	6.539204	4	182	KEEP	---	---	---	---	0	4	103	92	-1	capture	Missense_Mutation	SNP	56904089	56904089	SLC12A3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14277	272
ZC3H18	124245	broad.mit.edu	37	16	88688690	88688690	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88688690C>T	uc002fky.2	+	9	1761	c.1561C>T	c.(1561-1563)CGA>TGA	p.R521*	ZC3H18_uc010voz.1_Nonsense_Mutation_p.R545*|ZC3H18_uc010chw.2_RNA	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	521						nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CCCTTGGCGCCGATCCAAGTC	0.602	Ovarian(121;375 2276 20373 38669)															0.557143	118.914453	119.111911	39	31	KEEP	---	---	---	---	19	21	12	22	-1	capture	Nonsense_Mutation	SNP	88688690	88688690	ZC3H18	16	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	17448	272
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	T	T	rs28934576	by1000genomes	TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577120C>T	uc002gim.2	-	8	1012	c.818G>A	c.(817-819)CGT>CAT	p.R273H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141H|TP53_uc010cng.1_Missense_Mutation_p.R141H|TP53_uc002gii.1_Missense_Mutation_p.R141H|TP53_uc010cnh.1_Missense_Mutation_p.R273H|TP53_uc010cni.1_Missense_Mutation_p.R273H|TP53_uc002gij.2_Missense_Mutation_p.R273H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	Pancreas(47;798 1329 9957 10801)	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	p.R273H(SW480-Tumor)|p.R273L(NCIH1876-Tumor)|p.R273H(SW620-Tumor)|p.R273H(MDAMB468-Tumor)|p.R273Y(SW1783-Tumor)|p.R273H(YD8-Tumor)|p.R273L(NCIH1838-Tumor)|p.R273H(HT29-Tumor)|p.R273H(MONOMAC6-Tumor)|p.R273L(SNU503-Tumor)|p.R273H(MOLT13-Tumor)|p.R273Y(PF382-Tumor)|p.R273L(NCIH1734-Tumor)|p.R273H(FTC133-Tumor)|p.R273H(SNU601-Tumor)|p.R273H(NCIH1975-Tumor)|p.R273H(NCIH1793-Tumor)|p.R273L(ECGI10-Tumor)|p.R273H(KP1NL-Tumor)|p.R273H(KP1N-Tumor)|p.R273L(NCIH1623-Tumor)|p.R273L(NCIH2009-Tumor)|p.R273H(NCIH508-Tumor)|p.R273H(MONOMAC1-Tumor)|p.R273H(HEC59-Tumor)|p.R273H(FTC238-Tumor)|p.R273H(OC316-Tumor)|p.R273Y(SNUC2A-Tumor)|p.R273H(SUDHL1-Tumor)|p.R273L(HCC38-Tumor)|p.R273H(NCIH2405-Tumor)|p.R273H(HEC6-Tumor)|p.R273H(EN-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.77551	126.674585	130.092822	38	11	KEEP	---	---	---	---	17	23	5	6	-1	capture	Missense_Mutation	SNP	7577120	7577120	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16264	272
KRT16	3868	broad.mit.edu	37	17	39766792	39766792	+	Silent	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39766792C>T	uc002hxg.3	-	6	1210	c.1071G>A	c.(1069-1071)CTG>CTA	p.L357L	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	357	Rod.|Coil 2.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				GGCTGTTCTCCAGGGATGCTT	0.522																0.027027	-30.041759	6.535838	4	144	KEEP	---	---	---	---	2	2	75	78	-1	capture	Silent	SNP	39766792	39766792	KRT16	17	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8373	272
NDC80	10403	broad.mit.edu	37	18	2610820	2610820	+	Missense_Mutation	SNP	G	A	A	rs144795559		TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2610820G>A	uc002kli.2	+	16	1933	c.1751G>A	c.(1750-1752)CGT>CAT	p.R584H		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	584	Potential.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.|Interaction with NEK2 and ZWINT.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						AACTTGCAACGTCTGTTAGAG	0.373																0.425287	441.438027	443.133778	148	200	KEEP	---	---	---	---	87	74	114	114	-1	capture	Missense_Mutation	SNP	2610820	2610820	NDC80	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10149	272
PCSK4	54760	broad.mit.edu	37	19	1482471	1482471	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1482471G>A	uc002ltb.1	-	14	1762	c.1700C>T	c.(1699-1701)ACG>ATG	p.T567M	PCSK4_uc002lsz.2_Missense_Mutation_p.T54M|PCSK4_uc002lta.2_Silent_p.D337D	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN	proprotein convertase subtilisin/kexin type 4	567					proteolysis	integral to membrane	serine-type endopeptidase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGTACAACGTCCCTGGACA	0.687																0.267606	46.190297	49.655903	19	52	KEEP	---	---	---	---	13	10	28	42	-1	capture	Missense_Mutation	SNP	1482471	1482471	PCSK4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11505	272
PSG11	5680	broad.mit.edu	37	19	43523198	43523198	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43523198C>G	uc002ovm.1	-	3	540	c.433G>C	c.(433-435)GAG>CAG	p.E145Q	PSG11_uc002ouw.2_Missense_Mutation_p.E151Q|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.E151Q|PSG11_uc002ovn.1_Missense_Mutation_p.E151Q|PSG11_uc002ovo.1_Missense_Mutation_p.E23Q|PSG11_uc002ovp.1_Missense_Mutation_p.E23Q	NM_002785	NP_002776	Q9UQ72	PSG11_HUMAN	pregnancy specific beta-1-glycoprotein 11	145					female pregnancy	extracellular region					0		Prostate(69;0.00682)				TTGGGAGTCTCCACTGTGCAG	0.507																0.380846	593.993369	599.592481	171	278	KEEP	---	---	---	---	102	97	177	162	-1	capture	Missense_Mutation	SNP	43523198	43523198	PSG11	19	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	12549	272
MAP4K3	8491	broad.mit.edu	37	2	39515367	39515367	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:39515367C>A	uc002rro.2	-	20	1460	c.1369G>T	c.(1369-1371)GGA>TGA	p.G457*	MAP4K3_uc002rrp.2_Nonsense_Mutation_p.G436*|MAP4K3_uc010yns.1_Nonsense_Mutation_p.G10*	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	457					JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				TTGATTGTTCCTTGATTTTCA	0.428					525											0.023729	-62.440427	11.983846	7	288	KEEP	---	---	---	---	4	3	143	169	0.428571428571	capture	Nonsense_Mutation	SNP	39515367	39515367	MAP4K3	2	C	A	A	A	1	0	0	0	0	0	1	0	0	312	24	5	4	9175	272
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48809103	48809103	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48809103G>T	uc010yol.1	+	1	1378	c.1331G>T	c.(1330-1332)TGC>TTC	p.C444F	STON1_uc002rwo.3_Missense_Mutation_p.C444F|STON1_uc010fbm.2_Missense_Mutation_p.C444F|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.C444F|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.C444F	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	444					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CAAATTTATTGCCTCTGCTTT	0.383																0.52924	582.384523	582.638105	181	161	KEEP	---	---	---	---	105	105	92	101	0.5	capture	Missense_Mutation	SNP	48809103	48809103	STON1-GTF2A1L	2	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	15207	272
CCDC85A	114800	broad.mit.edu	37	2	56420085	56420085	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:56420085G>C	uc002rzn.2	+	2	1252	c.750G>C	c.(748-750)AAG>AAC	p.K250N		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	250	His-rich.									breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGCACTCCAAGCACAGGAGCG	0.662																0.149254	19.606422	27.515643	10	57	KEEP	---	---	---	---	3	8	24	35	-1	capture	Missense_Mutation	SNP	56420085	56420085	CCDC85A	2	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	2833	272
GLI2	2736	broad.mit.edu	37	2	121726342	121726342	+	Silent	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:121726342G>A	uc010flp.2	+	5	726	c.696G>A	c.(694-696)GCG>GCA	p.A232A	GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Missense_Mutation_p.A103T|GLI2_uc010flo.1_Silent_p.A107A|GLI2_uc002tmw.1_Silent_p.A232A	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	232					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GCAAGCGGGCGCTGTCCATCT	0.632					376											0.526042	301.400523	301.516766	101	91	KEEP	---	---	---	---	59	53	64	47	-1	capture	Silent	SNP	121726342	121726342	GLI2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6374	272
ZDBF2	57683	broad.mit.edu	37	2	207173022	207173022	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207173022C>A	uc002vbp.2	+	5	4020	c.3770C>A	c.(3769-3771)CCT>CAT	p.P1257H		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1257							nucleic acid binding|zinc ion binding			ovary(3)	3						GCTGGCCAACCTGAAGAAGTA	0.383																0.314815	43.351538	45.001445	17	37	KEEP	---	---	---	---	12	11	16	26	0.478260869565	capture	Missense_Mutation	SNP	207173022	207173022	ZDBF2	2	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	17479	272
PRKAG3	53632	broad.mit.edu	37	2	219691740	219691740	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219691740G>A	uc002vjb.1	-	10	1098	c.1079C>T	c.(1078-1080)GCT>GTT	p.A360V	PRKAG3_uc010zkn.1_RNA|PRKAG3_uc010fvy.1_Silent_p.L402L	NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN	AMP-activated protein kinase, non-catalytic	360	CBS 3.				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding			ovary(1)|lung(1)	2		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGCACCACAGCCAAGTCTCG	0.602																0.292887	191.839746	201.02822	70	169	KEEP	---	---	---	---	39	43	114	103	-1	capture	Missense_Mutation	SNP	219691740	219691740	PRKAG3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	12398	272
PASK	23178	broad.mit.edu	37	2	242065780	242065780	+	Silent	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242065780C>T	uc002wao.1	-	10	2642	c.2550G>A	c.(2548-2550)ACG>ACA	p.T850T	PASK_uc010zol.1_Silent_p.T664T|PASK_uc010zom.1_Silent_p.T815T|PASK_uc010fzl.1_Silent_p.T850T|PASK_uc010zon.1_Silent_p.T631T|PASK_uc002wap.2_Silent_p.T393T|PASK_uc002waq.2_Silent_p.T850T	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	850				T -> M (in Ref. 2; BAA09484).	regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CAGCATCCAACGTGGAAGGAA	0.587					754											0.541502	429.99057	430.369761	137	116	KEEP	---	---	---	---	87	79	65	73	-1	capture	Silent	SNP	242065780	242065780	PASK	2	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11375	272
CD40	958	broad.mit.edu	37	20	44750990	44750990	+	Silent	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44750990C>T	uc002xrg.1	+	3	326	c.249C>T	c.(247-249)TGC>TGT	p.C83C	CD40_uc002xrf.1_Silent_p.C83C|CD40_uc002xrh.1_Silent_p.C83C|CD40_uc002xri.1_Silent_p.C83C|CD40_uc002xrj.1_RNA|CD40_uc002xrk.1_RNA	NM_001250	NP_001241	P25942	TNR5_HUMAN	CD40 antigen isoform 1 precursor	83	TNFR-Cys 2.|Extracellular (Potential).				B cell proliferation|cellular response to mechanical stimulus|inflammatory response|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein complex assembly	CD40 receptor complex|extracellular region	enzyme binding|receptor activity			lung(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)			Simvastatin(DB00641)	ACAAATACTGCGACCCCAGTG	0.393					521							Immune_Deficiency_with_Hyper-IgM				0.25974	99.955207	107.991308	40	114	KEEP	---	---	---	---	15	27	68	73	-1	capture	Silent	SNP	44750990	44750990	CD40	20	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	2986	272
TRIOBP	11078	broad.mit.edu	37	22	38120676	38120676	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38120676G>A	uc003atr.2	+	7	2384	c.2113G>A	c.(2113-2115)GAT>AAT	p.D705N	TRIOBP_uc003atu.2_Missense_Mutation_p.D533N|TRIOBP_uc003atq.1_Missense_Mutation_p.D705N|TRIOBP_uc003ats.1_Missense_Mutation_p.D533N	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	705					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CCAACGGGACGATCCCAGAGC	0.582																0.04878	-19.517451	7.5609	6	117	KEEP	---	---	---	---	1	5	59	76	-1	capture	Missense_Mutation	SNP	38120676	38120676	TRIOBP	22	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16436	272
ALG12	79087	broad.mit.edu	37	22	50307405	50307405	+	Silent	SNP	T	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50307405T>C	uc003biy.2	-	2	283	c.9A>G	c.(7-9)GGA>GGG	p.G3G		NM_024105	NP_077010	Q9BV10	ALG12_HUMAN	alpha-1,6-mannosyltransferase ALG12	3					dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane					0		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		ATGACCCCTTTCCAGCCATTC	0.597																0.07767	-13.159143	6.541567	8	95	KEEP	---	---	---	---	12	10	70	97	-1	capture	Silent	SNP	50307405	50307405	ALG12	22	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	514	272
FBXL2	25827	broad.mit.edu	37	3	33415165	33415165	+	Missense_Mutation	SNP	T	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33415165T>G	uc003cfp.2	+	8	622	c.551T>G	c.(550-552)CTG>CGG	p.L184R	FBXL2_uc011axm.1_RNA|FBXL2_uc011axn.1_RNA|FBXL2_uc011axo.1_Missense_Mutation_p.L79R|FBXL2_uc011axp.1_Missense_Mutation_p.L100R|FBXL2_uc011axq.1_RNA|FBXL2_uc011axr.1_RNA|FBXL2_uc011axs.1_RNA	NM_012157	NP_036289	Q9UKC9	FBXL2_HUMAN	F-box and leucine-rich repeat protein 2	184	LRR 5.				interspecies interaction between organisms|proteolysis	cytoplasm|membrane	protein binding|ubiquitin-protein ligase activity			large_intestine(1)	1						TGTCGAGGCCTGAAAGCCCTG	0.552																0.020408	-30.909682	6.973617	3	144	KEEP	---	---	---	---	0	4	83	81	-1	capture	Missense_Mutation	SNP	33415165	33415165	FBXL2	3	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	5662	272
CSRNP1	64651	broad.mit.edu	37	3	39188146	39188146	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39188146C>A	uc003cjg.2	-	2	242	c.28G>T	c.(28-30)GAC>TAC	p.D10Y	CSRNP1_uc003cjh.2_Missense_Mutation_p.D10Y	NM_033027	NP_149016	Q96S65	CSRN1_HUMAN	AXIN1 up-regulated 1	10					apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(4)|skin(1)	5						TCCAGCTGGTCAAATTTCCTC	0.587																0.384615	13.770891	13.922955	5	8	KEEP	---	---	---	---	2	5	5	5	0.714285714286	capture	Missense_Mutation	SNP	39188146	39188146	CSRNP1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	3928	272
C3orf15	89876	broad.mit.edu	37	3	119462994	119462994	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:119462994G>A	uc003ede.3	+	14	1930	c.1853G>A	c.(1852-1854)CGC>CAC	p.R618H	C3orf15_uc010hqz.2_Missense_Mutation_p.R556H|C3orf15_uc011bjd.1_Missense_Mutation_p.R492H|C3orf15_uc011bje.1_Missense_Mutation_p.R598H	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	454						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		AGTGGTCGGCGCCAGGTGGAA	0.592																0.529412	237.166544	237.280546	81	72	KEEP	---	---	---	---	35	52	45	31	-1	capture	Missense_Mutation	SNP	119462994	119462994	C3orf15	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2189	272
FAM194A	131831	broad.mit.edu	37	3	150387205	150387205	+	Silent	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:150387205C>T	uc003eyg.2	-	12	1434	c.1377G>A	c.(1375-1377)GTG>GTA	p.V459V	FAM194A_uc003eyh.2_Silent_p.V313V	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831	459										skin(2)|ovary(1)	3						CCTTGTTGGGCACTCGAATGA	0.418																0.419872	367.740316	369.495283	131	181	KEEP	---	---	---	---	76	78	92	115	-1	capture	Silent	SNP	150387205	150387205	FAM194A	3	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	5478	272
ZNF595	152687	broad.mit.edu	37	4	86956	86956	+	Nonsense_Mutation	SNP	C	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:86956C>G	uc003fzv.1	+	6	1718	c.1562C>G	c.(1561-1563)TCA>TGA	p.S521*	ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_Nonsense_Mutation_p.S289*|ZNF595_uc011but.1_Nonsense_Mutation_p.S289*	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	521					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		AACCAATCCTCAGGCCTTATT	0.393																0.245509	132.990767	142.840253	41	126	KEEP	---	---	---	---	14	31	62	81	-1	capture	Nonsense_Mutation	SNP	86956	86956	ZNF595	4	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	17903	272
KIT	3815	broad.mit.edu	37	4	55561742	55561742	+	Silent	SNP	A	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55561742A>G	uc010igr.2	+	2	219	c.132A>G	c.(130-132)TCA>TCG	p.S44S	KIT_uc010igs.2_Silent_p.S44S	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	44	Extracellular (Potential).|Ig-like C2-type 1.				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGGAAAATCAGACTTAATAG	0.468			1		431	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				0.975992	3442.662594	3483.788762	935	23	KEEP	---	---	---	---	438	542	9	11	-1	capture	Silent	SNP	55561742	55561742	KIT	4	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	8250	272
GUCY1A3	2982	broad.mit.edu	37	4	156634553	156634553	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:156634553C>T	uc003iov.2	+	8	1926	c.1390C>T	c.(1390-1392)CAG>TAG	p.Q464*	GUCY1A3_uc010iqc.2_Nonsense_Mutation_p.Q464*|GUCY1A3_uc003iow.2_Nonsense_Mutation_p.Q464*|GUCY1A3_uc010iqd.2_Nonsense_Mutation_p.Q463*|GUCY1A3_uc003iox.2_Nonsense_Mutation_p.Q464*|GUCY1A3_uc003ioz.2_Nonsense_Mutation_p.Q229*|GUCY1A3_uc003ioy.2_Nonsense_Mutation_p.Q464*|GUCY1A3_uc010iqe.2_Nonsense_Mutation_p.Q229*|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Nonsense_Mutation_p.Q464*	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	464					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TGAGGTTGCTCAGCAGCTGTG	0.522																0.471545	169.930923	170.01828	58	65	KEEP	---	---	---	---	30	31	33	36	-1	capture	Nonsense_Mutation	SNP	156634553	156634553	GUCY1A3	4	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	6823	272
NAF1	92345	broad.mit.edu	37	4	164050120	164050120	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164050120G>A	uc003iqj.2	-	8	1608	c.1414C>T	c.(1414-1416)CCT>TCT	p.P472S	NAF1_uc010iqw.1_Intron	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	472	Pro-rich.				rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				ggagggggagggggtgggggt	0.254																0.483871	48.923478	48.930518	15	16	KEEP	---	---	---	---	5	10	7	9	-1	capture	Missense_Mutation	SNP	164050120	164050120	NAF1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10050	272
SLC6A3	6531	broad.mit.edu	37	5	1422074	1422074	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1422074G>A	uc003jck.2	-	5	830	c.709C>T	c.(709-711)CGG>TGG	p.R237W		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	237	Extracellular (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	AGCTGCCACCGCGGAGGCCCC	0.657																0.388601	203.806409	205.894309	75	118	KEEP	---	---	---	---	37	50	71	61	-1	capture	Missense_Mutation	SNP	1422074	1422074	SLC6A3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	14577	272
NPR3	4883	broad.mit.edu	37	5	32724903	32724903	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32724903A>G	uc003jhv.2	+	2	1087	c.869A>G	c.(868-870)GAG>GGG	p.E290G	NPR3_uc010iuo.2_Missense_Mutation_p.E74G|NPR3_uc011cnz.1_Missense_Mutation_p.E74G|NPR3_uc003jhu.2_Missense_Mutation_p.E290G	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase	290	Extracellular (Potential).				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	TTCAACATTGAGCTCTTCAAC	0.473																0.021898	-28.199689	6.767266	3	134	KEEP	---	---	---	---	1	3	69	78	-1	capture	Missense_Mutation	SNP	32724903	32724903	NPR3	5	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10503	272
LYSMD3	116068	broad.mit.edu	37	5	89815175	89815175	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89815175G>C	uc003kjr.2	-	3	530	c.382C>G	c.(382-384)CAG>GAG	p.Q128E	LYSMD3_uc010jaz.1_Intron|LYSMD3_uc003kjs.1_Missense_Mutation_p.T108R	NM_198273	NP_938014	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain	128	Extracellular (Potential).				cell wall macromolecule catabolic process	integral to membrane					0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		CGTGAAGTCTGTCTTCCTTTT	0.393																0.435897	379.523038	380.360628	102	132	KEEP	---	---	---	---	53	55	65	75	-1	capture	Missense_Mutation	SNP	89815175	89815175	LYSMD3	5	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	9041	272
DTWD2	285605	broad.mit.edu	37	5	118324199	118324199	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:118324199G>T	uc003ksa.2	-	1	42	c.8C>A	c.(7-9)TCG>TAG	p.S3*		NM_173666	NP_775937	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2	3											0		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)		CTCTTTCTGCGACTCCATGGC	0.706														OREG0016736	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.263158	22.244828	24.16601	10	28	KEEP	---	---	---	---	5	5	16	16	0.5	capture	Nonsense_Mutation	SNP	118324199	118324199	DTWD2	5	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	4747	272
PCDHA5	56143	broad.mit.edu	37	5	140202968	140202968	+	Silent	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140202968G>A	uc003lhl.2	+	1	1608	c.1608G>A	c.(1606-1608)GCG>GCA	p.A536A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.A536A|PCDHA5_uc003lhj.1_Silent_p.A536A	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	536	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGAGCGCGCGCGACGCGG	0.677																0.382166	161.562276	163.47267	60	97	KEEP	---	---	---	---	27	39	52	71	-1	capture	Silent	SNP	140202968	140202968	PCDHA5	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11430	272
KIF4B	285643	broad.mit.edu	37	5	154393566	154393566	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154393566C>G	uc010jih.1	+	1	307	c.147C>G	c.(145-147)TTC>TTG	p.F49L		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	49	Kinesin-motor.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATAAATCCTTCACCTACGATT	0.488																0.318182	167.814473	172.342877	49	105	KEEP	---	---	---	---	28	25	51	62	-1	capture	Missense_Mutation	SNP	154393566	154393566	KIF4B	5	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	8226	272
STK10	6793	broad.mit.edu	37	5	171510086	171510086	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:171510086C>T	uc003mbo.1	-	11	1988	c.1688G>A	c.(1687-1689)CGC>CAC	p.R563H		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	563							ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAGTTCCTGGCGCCTGAAAGG	0.468					570											0.723577	291.523947	297.060122	89	34	KEEP	---	---	---	---	47	57	22	16	-1	capture	Missense_Mutation	SNP	171510086	171510086	STK10	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15176	272
CAGE1	285782	broad.mit.edu	37	6	7370288	7370288	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7370288G>A	uc003mxi.2	-	5	2070	c.1349C>T	c.(1348-1350)ACG>ATG	p.T450M	CAGE1_uc003mxh.2_RNA|CAGE1_uc003mxj.2_Missense_Mutation_p.T341M|CAGE1_uc003mxk.1_Missense_Mutation_p.T341M	NM_205864	NP_995586	Q8TC20	CAGE1_HUMAN	cancer antigen 1	586											0	Ovarian(93;0.0418)					AGAATGTGTCGTTTTTGTATC	0.378																0.397727	102.604957	103.410748	35	53	KEEP	---	---	---	---	22	17	33	27	-1	capture	Missense_Mutation	SNP	7370288	7370288	CAGE1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2548	272
TJAP1	93643	broad.mit.edu	37	6	43472961	43472961	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43472961C>T	uc003ovd.2	+	11	1418	c.1042C>T	c.(1042-1044)CCC>TCC	p.P348S	TJAP1_uc003ovf.2_Missense_Mutation_p.P338S|TJAP1_uc003ove.2_Missense_Mutation_p.P338S|TJAP1_uc003ovc.2_Missense_Mutation_p.P338S|TJAP1_uc010jyp.2_Missense_Mutation_p.P307S|TJAP1_uc011dvh.1_Missense_Mutation_p.P338S|TJAP1_uc003ovg.2_Missense_Mutation_p.P214S|TJAP1_uc011dvi.1_Missense_Mutation_p.P348S|TJAP1_uc011dvj.1_Missense_Mutation_p.P148S|TJAP1_uc003ovi.2_Missense_Mutation_p.P214S	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a	348						Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CAGCCCCCTGCCCAACTGCAC	0.512																0.344633	159.389152	163.177125	61	116	KEEP	---	---	---	---	30	37	61	68	-1	capture	Missense_Mutation	SNP	43472961	43472961	TJAP1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15813	272
POM121C	100101267	broad.mit.edu	37	7	75048122	75048122	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75048122C>A	uc003udk.3	-	15	3806	c.2921G>T	c.(2920-2922)CGA>CTA	p.R974L		NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like	1216	Pore side (Potential).				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						CAGTCGCTGTCGAGCCCCTGG	0.592																0.555556	111.128715	111.297746	35	28	KEEP	---	---	---	---	52	25	50	46	0.324675324675	capture	Missense_Mutation	SNP	75048122	75048122	POM121C	7	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	12142	272
COL1A2	1278	broad.mit.edu	37	7	94040399	94040399	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94040399C>T	uc003ung.1	+	23	1754	c.1283C>T	c.(1282-1284)CCT>CTT	p.P428L	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	428					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GCAAGTGGCCCTGCTGGAGTC	0.507													HNSCC(75;0.22)			0.194444	17.503021	20.638701	7	29	KEEP	---	---	---	---	2	6	18	14	-1	capture	Missense_Mutation	SNP	94040399	94040399	COL1A2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	3643	272
FEZF1	389549	broad.mit.edu	37	7	121943310	121943310	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121943310C>T	uc003vkd.2	-	2	931	c.857G>A	c.(856-858)AGA>AAA	p.R286K	FEZF1_uc003vkc.2_Missense_Mutation_p.R236K|uc010lko.1_5'Flank|uc003vkf.1_5'Flank	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1 isoform 1	286					cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)	3						AACGAAGGGTCTGGCTCCTGT	0.468																0.410891	266.187613	267.5891	83	119	KEEP	---	---	---	---	35	58	62	72	-1	capture	Missense_Mutation	SNP	121943310	121943310	FEZF1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5771	272
FGL1	2267	broad.mit.edu	37	8	17726236	17726236	+	Silent	SNP	G	A	A	rs142240316		TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17726236G>A	uc003wxx.2	-	8	924	c.600C>T	c.(598-600)TAC>TAT	p.Y200Y	FGL1_uc003wxy.2_Silent_p.Y200Y|FGL1_uc003wxz.2_Silent_p.Y199Y|FGL1_uc003wya.2_Silent_p.Y200Y|FGL1_uc003wyb.2_Silent_p.Y200Y|FGL1_uc003wyc.2_Silent_p.Y200Y|FGL1_uc003wyd.2_RNA|FGL1_uc003wye.2_Silent_p.Y250Y|FGL1_uc003wyf.2_Silent_p.Y170Y	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor	200	Fibrinogen C-terminal.				signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		TATTCAACTCGTAGAAATTCT	0.383																0.25	70.242301	76.607896	28	84	KEEP	---	---	---	---	13	15	39	47	-1	capture	Silent	SNP	17726236	17726236	FGL1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5818	272
DCAF4L2	138009	broad.mit.edu	37	8	88886046	88886046	+	Missense_Mutation	SNP	T	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:88886046T>A	uc003ydz.2	-	1	251	c.154A>T	c.(154-156)AGC>TGC	p.S52C		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	52										ovary(1)	1						TGCATGCAGCTTACACGCAGC	0.507																0.595376	314.73279	316.103941	103	70	KEEP	---	---	---	---	46	60	42	37	-1	capture	Missense_Mutation	SNP	88886046	88886046	DCAF4L2	8	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	4231	272
LRRC24	441381	broad.mit.edu	37	8	145749853	145749853	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145749853A>G	uc003zdm.2	-	3	542	c.410T>C	c.(409-411)CTG>CCG	p.L137P	LRRC24_uc003zdn.2_Missense_Mutation_p.L137P|LRRC14_uc003zdk.1_3'UTR|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_RNA	NM_001024678	NP_001019849	Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24 precursor	137	LRR 4.					integral to membrane					0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GAAATCCAGCAGCCGCGCCAG	0.662																0.1	2.60225	7.397336	3	27	KEEP	---	---	---	---	1	2	18	28	-1	capture	Missense_Mutation	SNP	145749853	145749853	LRRC24	8	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	8895	272
NUP188	23511	broad.mit.edu	37	9	131752466	131752466	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131752466G>T	uc004bws.1	+	25	2623	c.2601G>T	c.(2599-2601)TTG>TTT	p.L867F	NUP188_uc004bwu.2_Missense_Mutation_p.L210F	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	867					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						ACCCTGCTTTGCCACGTCTTG	0.448																0.010724	-194.208114	11.155044	8	738	KEEP	---	---	---	---	5	5	493	488	0.5	capture	Missense_Mutation	SNP	131752466	131752466	NUP188	9	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	10665	272
BRD3	8019	broad.mit.edu	37	9	136913570	136913570	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136913570C>T	uc004cew.2	-	6	909	c.721G>A	c.(721-723)GGC>AGC	p.G241S	BRD3_uc004cex.2_Missense_Mutation_p.G241S	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3	241						nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		CGCTTCACGCCCTTTTTCTGC	0.627					497	T	NUT|C15orf55	lethal midline carcinoma of young people								0.40404	234.016486	235.590114	80	118	KEEP	---	---	---	---	39	43	70	56	-1	capture	Missense_Mutation	SNP	136913570	136913570	BRD3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	1491	272
ARSE	415	broad.mit.edu	37	X	2867360	2867360	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2867360G>A	uc004crc.3	-	6	1089	c.839C>T	c.(838-840)GCG>GTG	p.A280V	ARSE_uc011mhi.1_Missense_Mutation_p.A226V|ARSE_uc011mhh.1_Missense_Mutation_p.A305V	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	280					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAGAAAGGACGCAACCTCCTG	0.453																0.207547	75.8883	88.486033	33	126	KEEP	---	---	---	---	21	16	59	85	-1	capture	Missense_Mutation	SNP	2867360	2867360	ARSE	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	983	272
CACNA1F	778	broad.mit.edu	37	X	49065814	49065814	+	Silent	SNP	G	T	T			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49065814G>T	uc004dnb.2	-	42	4956	c.4894C>A	c.(4894-4896)CGG>AGG	p.R1632R	CACNA1F_uc010nip.2_Silent_p.R1621R	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	1632	Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	AGGGCCTGCCGCATCTCAGGA	0.423					279											0.047619	-6.518951	7.195748	3	60	KEEP	---	---	---	---	1	3	45	31	0.25	capture	Silent	SNP	49065814	49065814	CACNA1F	23	G	T	T	T	1	0	0	0	0	0	0	0	1	493	38	4	4	2519	272
STARD8	9754	broad.mit.edu	37	X	67937331	67937331	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67937331G>A	uc004dxa.2	+	5	707	c.335G>A	c.(334-336)GGC>GAC	p.G112D	STARD8_uc004dxb.2_Missense_Mutation_p.G192D|STARD8_uc004dxc.3_Missense_Mutation_p.G112D	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	112					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						CCCACCCAGGGCCAGGAGGGT	0.637																0.513043	179.046322	179.064562	59	56	KEEP	---	---	---	---	34	32	31	31	-1	capture	Missense_Mutation	SNP	67937331	67937331	STARD8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15153	272
CXorf57	55086	broad.mit.edu	37	X	105855563	105855563	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105855563G>A	uc004emi.3	+	1	404	c.253G>A	c.(253-255)GAC>AAC	p.D85N	CXorf57_uc004emj.3_Missense_Mutation_p.D85N|CXorf57_uc004emh.2_Missense_Mutation_p.D85N	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	85										ovary(1)|lung(1)|breast(1)	3						TGAGCCACGCGACACGGTGCC	0.572																0.250774	197.429214	215.659419	81	242	KEEP	---	---	---	---	45	38	117	146	-1	capture	Missense_Mutation	SNP	105855563	105855563	CXorf57	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4073	272
ZNF280C	55609	broad.mit.edu	37	X	129354388	129354388	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129354388G>A	uc004evm.2	-	13	1616	c.1462C>T	c.(1462-1464)CAT>TAT	p.H488Y	ZNF280C_uc010nrf.1_Missense_Mutation_p.H439Y	NM_017666	NP_060136	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	488	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)	3						TGCGCCTTATGTTCAGCTTTC	0.383																0.437126	425.387348	426.540847	146	188	KEEP	---	---	---	---	80	79	117	93	-1	capture	Missense_Mutation	SNP	129354388	129354388	ZNF280C	23	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17696	272
TDRD10	126668	broad.mit.edu	37	1	154493902	154493902	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154493902delA	uc009wow.2	+	6	1154	c.316delA	c.(316-318)AAAfs	p.K106fs	TDRD10_uc001ffd.2_Frame_Shift_Del_p.K106fs|TDRD10_uc001ffe.2_Frame_Shift_Del_p.K27fs	NM_001098475	NP_001091945	Q5VZ19	TDR10_HUMAN	tudor domain containing 10 isoform a	106	RRM.						nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GAATACAAGCAAAAGGCCCCC	0.517																0.01			7	631		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	154493902	154493902	TDRD10	1	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	15616	272
C10orf140	387640	broad.mit.edu	37	10	21805467	21805469	+	In_Frame_Del	DEL	CCT	-	-			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21805467_21805469delCCT	uc009xkd.2	-	4	3536_3538	c.1283_1285delAGG	c.(1282-1287)GAGGGG>GGG	p.E428del	uc001iqp.1_RNA	NM_207371	NP_997254	Q1XH10	DLN1_HUMAN	hypothetical protein LOC387640	347	Ser-rich.|Glu-rich.			E -> EEE (in Ref. 2; BAD18601 and 4; CAD39106).		nucleus	nucleotide binding			ovary(1)	1						CCGCTGCccccctcctcctcctc	0.438																0.57			4	3		---	---	---	---						capture_indel	In_Frame_Del	DEL	21805467	21805469	C10orf140	10	CCT	-	-	-	1	0	1	0	1	0	0	0	0	286	22	5	5	1583	272
GPATCH1	55094	broad.mit.edu	37	19	33579113	33579113	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33579113delC	uc002nug.1	+	2	461	c.147delC	c.(145-147)TTCfs	p.F49fs		NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	49						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					ATAAACGATTCCACGGGGCCT	0.353	Pancreas(67;88 1713 4567 18227)															0.44			81	105		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	33579113	33579113	GPATCH1	19	C	-	-	-	1	0	1	0	1	0	0	0	0	389	30	5	5	6524	272
TRIOBP	11078	broad.mit.edu	37	22	38119882	38119884	+	In_Frame_Del	DEL	CCT	-	-			TCGA-76-4934-01	TCGA-76-4934-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38119882_38119884delCCT	uc003atr.2	+	7	1590_1592	c.1319_1321delCCT	c.(1318-1323)GCCTCC>GCC	p.S442del	TRIOBP_uc003atu.2_In_Frame_Del_p.S270del|TRIOBP_uc003atq.1_In_Frame_Del_p.S442del|TRIOBP_uc003ats.1_In_Frame_Del_p.S270del	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	442					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					AATCCCAGAGCCTCCTCTCCCAG	0.601																0.06			9	150		---	---	---	---						capture_indel	In_Frame_Del	DEL	38119882	38119884	TRIOBP	22	CCT	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	16436	272
