Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RPS6KA1	6195	broad.mit.edu	37	1	26883501	26883501	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26883501C>T	uc001bmr.1	+	13	1157	c.994C>T	c.(994-996)CGT>TGT	p.R332C	RPS6KA1_uc010ofe.1_Missense_Mutation_p.R240C|RPS6KA1_uc010off.1_Missense_Mutation_p.R316C|RPS6KA1_uc001bms.1_Missense_Mutation_p.R341C|RPS6KA1_uc009vsl.1_Missense_Mutation_p.R175C	NM_002953	NP_002944	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	332	AGC-kinase C-terminal.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		GCTATACCGTCGTGAGATCAA	0.597					655											0.333333	62.491925	64.25526	24	48	KEEP	---	---	---	---	14	11	31	30	-1	capture	Missense_Mutation	SNP	26883501	26883501	RPS6KA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13542	287
CLDN19	149461	broad.mit.edu	37	1	43201615	43201615	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43201615G>A	uc001cht.1	-	4	751	c.560C>T	c.(559-561)CCG>CTG	p.P187L	CLDN19_uc001chu.2_Missense_Mutation_p.P187L|CLDN19_uc010ojv.1_Missense_Mutation_p.R159W	NM_148960	NP_683763	Q8N6F1	CLD19_HUMAN	claudin 19 isoform a	187	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|response to stimulus|visual perception	basolateral plasma membrane|integral to membrane|tight junction	identical protein binding				0	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCTGGCTCCGGGCATGTGCA	0.677																0.5	18.550635	18.550635	6	6	KEEP	---	---	---	---	3	3	3	5	-1	capture	Missense_Mutation	SNP	43201615	43201615	CLDN19	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3445	287
CLCA1	1179	broad.mit.edu	37	1	86952277	86952277	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86952277G>A	uc001dlt.2	+	7	1152	c.1023G>A	c.(1021-1023)GGG>GGA	p.G341G	CLCA1_uc001dls.1_Silent_p.G280G	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	341	VWFA.				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TTGAGCTGGGGTCCTGGGTTG	0.478																0.104839	7.274919	26.545983	13	111	KEEP	---	---	---	---	7	7	66	67	-1	capture	Silent	SNP	86952277	86952277	CLCA1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	561	44	2	2	3422	287
CLCA4	22802	broad.mit.edu	37	1	87045055	87045055	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:87045055C>T	uc009wcs.2	+	13	2185	c.2141C>T	c.(2140-2142)CCG>CTG	p.P714L	CLCA4_uc009wct.2_Missense_Mutation_p.P477L|CLCA4_uc009wcu.2_Missense_Mutation_p.P534L	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	714						apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		GAAGCAAACCCGCCAAGACCT	0.428																0.260274	51.19159	54.989502	19	54	KEEP	---	---	---	---	10	11	32	33	-1	capture	Missense_Mutation	SNP	87045055	87045055	CLCA4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3424	287
SPTA1	6708	broad.mit.edu	37	1	158651339	158651339	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158651339A>G	uc001fst.1	-	4	708	c.509T>C	c.(508-510)ATC>ACC	p.I170T		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	170	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CCACTCTAAGATGTCAGCACA	0.537																0.289916	211.520791	220.908863	69	169	KEEP	---	---	---	---	39	37	89	106	-1	capture	Missense_Mutation	SNP	158651339	158651339	SPTA1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	15008	287
PTPN14	5784	broad.mit.edu	37	1	214575057	214575057	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214575057C>T	uc001hkk.1	-	7	911	c.640G>A	c.(640-642)GGA>AGA	p.G214R	PTPN14_uc010pty.1_Missense_Mutation_p.G115R	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	214	FERM.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TGTCCAAATCCATCCAAACGT	0.423	Colon(92;557 1424 24372 34121 40073)															0.189189	55.706752	69.089943	28	120	KEEP	---	---	---	---	18	16	71	73	-1	capture	Missense_Mutation	SNP	214575057	214575057	PTPN14	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	12678	287
SIPA1L2	57568	broad.mit.edu	37	1	232619633	232619633	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232619633G>A	uc001hvg.2	-	4	2044	c.1886C>T	c.(1885-1887)ACG>ATG	p.T629M		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	629	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGGTCCCGCCGTCTCATTGTT	0.448																0.267442	51.587564	55.788486	23	63	KEEP	---	---	---	---	6	18	28	47	-1	capture	Missense_Mutation	SNP	232619633	232619633	SIPA1L2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14223	287
OR2M2	391194	broad.mit.edu	37	1	248344248	248344248	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248344248T>A	uc010pzf.1	+	1	961	c.961T>A	c.(961-963)TTG>ATG	p.L321M		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	321	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACTTTATGTTTTGCTGTTTGC	0.373																0.289474	156.240736	165.309985	66	162	KEEP	---	---	---	---	42	33	85	97	-1	capture	Missense_Mutation	SNP	248344248	248344248	OR2M2	1	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	10914	287
KNDC1	85442	broad.mit.edu	37	10	135020649	135020649	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135020649C>A	uc001llz.1	+	20	3589	c.3588C>A	c.(3586-3588)TAC>TAA	p.Y1196*	KNDC1_uc001lma.1_3'UTR	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	1196					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AGGTCATGTACGCGGAACGCT	0.657																0.4	6.349036	6.392762	2	3	KEEP	---	---	---	---	2	0	1	2	-1	capture	Nonsense_Mutation	SNP	135020649	135020649	KNDC1	10	C	A	A	A	1	0	0	0	0	0	1	0	0	246	19	5	4	8346	287
MRGPRX1	259249	broad.mit.edu	37	11	18955702	18955702	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18955702C>T	uc001mpg.2	-	1	848	c.630G>A	c.(628-630)CCG>CCA	p.P210P		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	210	Cytoplasmic (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						GCCTGGTCAGCGGTATCTTCC	0.507																0.146341	15.568576	25.412089	12	70	KEEP	---	---	---	---	4	12	38	37	-1	capture	Silent	SNP	18955702	18955702	MRGPRX1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9676	287
PIK3C2G	5288	broad.mit.edu	37	12	18435195	18435195	+	Silent	SNP	A	G	G			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18435195A>G	uc001rdt.2	+	2	296	c.180A>G	c.(178-180)GAA>GAG	p.E60E	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Silent_p.E60E|PIK3C2G_uc010sic.1_5'UTR	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	60					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				AAATTGATGAAAACACCTTTT	0.398					655											0.36	89.841608	91.119838	27	48	KEEP	---	---	---	---	17	12	23	28	-1	capture	Silent	SNP	18435195	18435195	PIK3C2G	12	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	11814	287
GLI1	2735	broad.mit.edu	37	12	57864141	57864141	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57864141G>A	uc001snx.2	+	12	1696	c.1618G>A	c.(1618-1620)GAA>AAA	p.E540K	GLI1_uc009zpq.2_Missense_Mutation_p.E412K	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	540					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			AGTCTCTCTTGAACGCCGCAG	0.612	Pancreas(157;841 1936 10503 41495 50368)				277											0.275862	73.146568	78.396891	32	84	KEEP	---	---	---	---	23	12	47	48	-1	capture	Missense_Mutation	SNP	57864141	57864141	GLI1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	6373	287
UHRF1BP1L	23074	broad.mit.edu	37	12	100433500	100433500	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100433500G>A	uc001tgq.2	-	20	4378	c.4149C>T	c.(4147-4149)ACC>ACT	p.T1383T	UHRF1BP1L_uc001tgp.2_Silent_p.T1033T	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	1383										ovary(2)	2						ACTTTCCACTGGTCAGCAGCA	0.428																0.288136	47.149547	49.524955	17	42	KEEP	---	---	---	---	9	9	23	22	-1	capture	Silent	SNP	100433500	100433500	UHRF1BP1L	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	16851	287
DNAH10	196385	broad.mit.edu	37	12	124298408	124298408	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124298408A>C	uc001uft.3	+	20	3400	c.3375A>C	c.(3373-3375)AGA>AGC	p.R1125S	DNAH10_uc010tav.1_3'UTR|DNAH10_uc010taw.1_3'UTR	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1125	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGGAACTCAGATATAGGGACG	0.383																0.093023	4.268479	11.43018	4	39	KEEP	---	---	---	---	4	1	24	20	-1	capture	Missense_Mutation	SNP	124298408	124298408	DNAH10	12	A	C	C	C	1	0	0	0	0	1	0	0	0	154	12	4	4	4556	287
RB1	5925	broad.mit.edu	37	13	49039399	49039399	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49039399C>A	uc001vcb.2	+	23	2550	c.2384C>A	c.(2383-2385)TCA>TAA	p.S795*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	795	Interaction with LIMD1.|Domain C; mediates interaction with E4F1.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTCCTAGTTCACCCTTACGG	0.393			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.373832	105.062449	106.561952	40	67	KEEP	---	---	---	---	23	26	41	41	0.530612244898	capture	Nonsense_Mutation	SNP	49039399	49039399	RB1	13	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	12993	287
AHNAK2	113146	broad.mit.edu	37	14	105414185	105414185	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105414185G>A	uc010axc.1	-	7	7723	c.7603C>T	c.(7603-7605)CCC>TCC	p.P2535S	AHNAK2_uc001ypx.2_Missense_Mutation_p.P2435S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2535						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCGGAAGGGGGCTGAATGCTG	0.667																0.020921	-54.137777	7.267563	5	234	KEEP	---	---	---	---	2	3	137	125	-1	capture	Missense_Mutation	SNP	105414185	105414185	AHNAK2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	415	287
CEP152	22995	broad.mit.edu	37	15	49030645	49030645	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49030645G>A	uc001zwy.2	-	26	4800	c.4766C>T	c.(4765-4767)ACG>ATG	p.T1589M	CEP152_uc001zwz.2_Missense_Mutation_p.T1645M	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	1589					centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTCCAAATACGTGGTTTCTTC	0.383																0.042683	-24.514785	12.29512	7	157	KEEP	---	---	---	---	4	3	89	100	-1	capture	Missense_Mutation	SNP	49030645	49030645	CEP152	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3216	287
LASS3	204219	broad.mit.edu	37	15	100996164	100996164	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:100996164C>A	uc002bvz.2	-	12	1435	c.933G>T	c.(931-933)TTG>TTT	p.L311F	LASS3_uc002bwa.2_Missense_Mutation_p.L322F|LASS3_uc002bwb.2_Missense_Mutation_p.L311F	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3	311	Helical; (Potential).|TLC.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			GAAGGACCTGCAAGATCATGA	0.393	NSCLC(135;1149 2482 10680 49908)															0.234043	25.098678	28.14288	11	36	KEEP	---	---	---	---	7	6	19	20	0.461538461538	capture	Missense_Mutation	SNP	100996164	100996164	LASS3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	8560	287
ZP2	7783	broad.mit.edu	37	16	21216830	21216830	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21216830C>T	uc002dii.2	-	7	604	c.604G>A	c.(604-606)GCC>ACC	p.A202T	ZP2_uc010bwn.1_Missense_Mutation_p.A241T|ZP2_uc010bwo.2_Missense_Mutation_p.A241T	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	202	Extracellular (Potential).				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		TCCTTCATGGCCTCTGGCAGG	0.493																0.275229	73.72473	78.67085	30	79	KEEP	---	---	---	---	13	20	51	38	-1	capture	Missense_Mutation	SNP	21216830	21216830	ZP2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	18092	287
TAOK2	9344	broad.mit.edu	37	16	29990328	29990328	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29990328C>T	uc002dva.1	+	6	1169	c.386C>T	c.(385-387)GCA>GTA	p.A129V	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Missense_Mutation_p.A129V|TAOK2_uc002dvc.1_Missense_Mutation_p.A129V|TAOK2_uc010bzm.1_Missense_Mutation_p.A129V|TAOK2_uc002dvd.1_5'Flank	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	129	Protein kinase.				actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						GTAGAGATCGCAGCTGTGACC	0.577					143											0.214286	53.358554	62.858297	27	99	KEEP	---	---	---	---	20	10	64	64	-1	capture	Missense_Mutation	SNP	29990328	29990328	TAOK2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	15436	287
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	A	A	rs11540652		TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>A	uc002gim.2	-	7	937	c.743G>T	c.(742-744)CGG>CTG	p.R248L	TP53_uc002gig.1_Missense_Mutation_p.R248L|TP53_uc002gih.2_Missense_Mutation_p.R248L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116L|TP53_uc010cng.1_Missense_Mutation_p.R116L|TP53_uc002gii.1_Missense_Mutation_p.R116L|TP53_uc010cnh.1_Missense_Mutation_p.R248L|TP53_uc010cni.1_Missense_Mutation_p.R248L|TP53_uc002gij.2_Missense_Mutation_p.R248L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155L|TP53_uc002gio.2_Missense_Mutation_p.R116L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	Pancreas(47;798 1329 9957 10801)	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	p.R248L(NCIH211-Tumor)|p.R248L(NB4-Tumor)|p.R248L(PC14-Tumor)|p.R248L(KYO1-Tumor)|p.R248L(PCM6-Tumor)|p.R248L(NUDHL1-Tumor)|p.R248L(BL41-Tumor)|p.R248Q(FADU-Tumor)|p.R248L(CI1-Tumor)|p.R248L(SW1463-Tumor)|p.R248L(COLO699-Tumor)|p.R248L(HS683-Tumor)|p.R248*(DB-Tumor)|p.R248L(HCC1143-Tumor)|p.R248L(NCIN87-Tumor)|p.R248A(SF126-Tumor)|p.R248L(PANC02.03-Tumor)|p.R248L(HEC1B-Tumor)|p.R248L(PECAPJ15-Tumor)|p.R248L(LNCAPCLONEFGC-Tumor)|p.R248L(NIHOVCAR3-Tumor)|p.R248L(NUDUL1-Tumor)|p.R248L(ONCODG1-Tumor)|p.R248L(RT112-Tumor)|p.R248L(SF295-Tumor)|p.R248L(P12ICHIKAWA-Tumor)|p.R248L(DND41-Tumor)|p.R248Q(SBC5-Tumor)|p.R248L(KOPN8-Tumor)|p.R248L(KASUMI1-Tumor)|p.R248L(EM2-Tumor)|p.R248L(SKUT1-Tumor)|p.R248L(NCCSTCK140-Tumor)|p.R248L(TE6-Tumor)|p.R248L(MOLM6-Tumor)|p.R248L(SEM-Tumor)|p.R248L(NAMALWA-Tumor)|p.R248L(CA46-Tumor)|p.R248L(639V-Tumor)|p.R248L(SKM1-Tumor)|p.R248Q(NCIH1573-Tumor)|p.R248Q(NCIH1618-Tumor)|p.R248L(HCC70-Tumor)|p.R248L(WSUDLCL2-Tumor)|p.R248L(HEC1A-Tumor)|p.R248L(KYSE150-Tumor)|p.R248L(HSC4-Tumor)|p.R248L(CL40-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.095238	3.842081	17.651215	8	76	KEEP	---	---	---	---	4	6	33	57	0.6	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	16264	287
COPS3	8533	broad.mit.edu	37	17	17163668	17163668	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17163668C>A	uc002grd.2	-	8	974	c.883G>T	c.(883-885)GTG>TTG	p.V295L	COPS3_uc010vwv.1_Missense_Mutation_p.V275L|COPS3_uc010vww.1_Missense_Mutation_p.V165L	NM_003653	NP_003644	Q9UNS2	CSN3_HUMAN	COP9 constitutive photomorphogenic homolog	295	PCI.				cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding			skin(1)	1						CATTGCTTCACCAGCCCCATG	0.488																0.294118	76.505309	80.377893	30	72	KEEP	---	---	---	---	15	18	41	38	0.545454545455	capture	Missense_Mutation	SNP	17163668	17163668	COPS3	17	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	3699	287
NF1	4763	broad.mit.edu	37	17	29497003	29497003	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29497003C>T	uc002hgg.2	+	5	907	c.574C>T	c.(574-576)CGA>TGA	p.R192*	NF1_uc002hge.1_Nonsense_Mutation_p.R192*|NF1_uc002hgf.1_Nonsense_Mutation_p.R192*|NF1_uc002hgh.2_Nonsense_Mutation_p.R192*|NF1_uc010csn.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	192					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.R192*(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAAATTAAAACGACTCCTGAA	0.284				p.R192*(JHUEM1-Tumor)|p.R192*(KS1-Tumor)	847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.241379	31.222439	34.761093	14	44	KEEP	---	---	---	---	8	7	28	22	-1	capture	Nonsense_Mutation	SNP	29497003	29497003	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	10263	287
CCL4	6351	broad.mit.edu	37	17	34432024	34432024	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34432024G>A	uc002hkw.1	+	2	259	c.180G>A	c.(178-180)CAG>CAA	p.Q60Q	CCL4_uc002hkx.1_Intron	NM_002984	NP_002975	P13236	CCL4_HUMAN	chemokine C-C motif ligand 4 isoform 1	60					cell adhesion|cell-cell signaling|cellular component movement|chemotaxis|establishment or maintenance of cell polarity|immune response|inflammatory response|response to virus|viral genome replication	extracellular space	chemokine activity|receptor signaling protein tyrosine kinase activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCTGCTCCCAGCCAGCTGTGG	0.572	Colon(139;824 1752 21188 21615 24765)				69											0.083333	-1.040703	7.435906	4	44	KEEP	---	---	---	---	4	0	27	29	-1	capture	Silent	SNP	34432024	34432024	CCL4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	2875	287
GH1	2688	broad.mit.edu	37	17	61995751	61995751	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61995751G>A	uc002jdj.2	-	2	188	c.126C>T	c.(124-126)CGC>CGT	p.R42R	GH1_uc002jdi.2_Silent_p.R42R|GH1_uc002jdk.2_Silent_p.R42R|GH1_uc002jdl.2_Silent_p.R42R|GH1_uc002jdm.2_Intron|GH1_uc002jdn.2_Silent_p.R42R	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1	42			R -> C (in IGHD1B; reduced secretion).		glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						GACGATGGGCGCGGAGCATAG	0.582					99											0.289362	157.192452	166.549961	68	167	KEEP	---	---	---	---	39	34	92	94	-1	capture	Silent	SNP	61995751	61995751	GH1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6306	287
LAMA1	284217	broad.mit.edu	37	18	7009321	7009321	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7009321C>T	uc002knm.2	-	27	4012	c.3918G>A	c.(3916-3918)ACG>ACA	p.T1306T	LAMA1_uc010wzj.1_Silent_p.T782T	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1306	Laminin IV type A 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AATCCTCTCGCGTGACAGGTT	0.403					1597											0.239583	51.075502	57.021877	23	73	KEEP	---	---	---	---	14	11	37	43	-1	capture	Silent	SNP	7009321	7009321	LAMA1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8525	287
ONECUT2	9480	broad.mit.edu	37	18	55143729	55143729	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55143729G>A	uc002lgo.2	+	2	1321	c.1289G>A	c.(1288-1290)CGC>CAC	p.R430H		NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2	430	Homeobox.				organ morphogenesis	nucleus	sequence-specific DNA binding	p.R430H(1)		ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		AAGAAGTCCCGCCTGGTGTTC	0.517																0.269231	32.330508	34.827972	14	38	KEEP	---	---	---	---	10	4	24	17	-1	capture	Missense_Mutation	SNP	55143729	55143729	ONECUT2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10773	287
MATK	4145	broad.mit.edu	37	19	3779708	3779708	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3779708G>A	uc002lyt.2	-	9	1230	c.830C>T	c.(829-831)ACG>ATG	p.T277M	MATK_uc002lyv.2_Missense_Mutation_p.T278M|MATK_uc002lyu.2_Missense_Mutation_p.T236M|MATK_uc010dtq.2_Missense_Mutation_p.T277M	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	277	Protein kinase.				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGACGGCCGTCTCGTCCAG	0.677					245											0.192308	34.928389	44.159192	20	84	KEEP	---	---	---	---	8	17	48	48	-1	capture	Missense_Mutation	SNP	3779708	3779708	MATK	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9245	287
TUBB4	10382	broad.mit.edu	37	19	6495224	6495224	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6495224G>A	uc002mfg.1	-	4	1393	c.1286C>T	c.(1285-1287)ACG>ATG	p.T429M	TUBB4_uc002mff.1_Missense_Mutation_p.T357M|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	429					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		CTCCTCGGCCGTGGCGTCCTG	0.622																0.239316	61.253531	68.506146	28	89	KEEP	---	---	---	---	18	13	49	50	-1	capture	Missense_Mutation	SNP	6495224	6495224	TUBB4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16640	287
ZNF536	9745	broad.mit.edu	37	19	31039823	31039823	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:31039823C>T	uc002nsu.1	+	4	3435	c.3297C>T	c.(3295-3297)CAC>CAT	p.H1099H	ZNF536_uc010edd.1_Silent_p.H1099H	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1099					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GGACCGGCCACGTGGACCCTG	0.542																0.237624	51.64858	58.003279	24	77	KEEP	---	---	---	---	11	16	48	48	-1	capture	Silent	SNP	31039823	31039823	ZNF536	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17853	287
ZNF181	339318	broad.mit.edu	37	19	35232341	35232341	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35232341G>A	uc002nvu.3	+	4	1518	c.1055G>A	c.(1054-1056)CGT>CAT	p.R352H	ZNF181_uc010xsa.1_Missense_Mutation_p.R351H|ZNF181_uc010xsb.1_Missense_Mutation_p.R351H|ZNF181_uc010xsc.1_Missense_Mutation_p.R287H	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	352	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TATGAGTGTCGTATATGTGGA	0.373																0.28169	47.667553	50.710158	20	51	KEEP	---	---	---	---	6	18	34	28	-1	capture	Missense_Mutation	SNP	35232341	35232341	ZNF181	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17629	287
ZNF345	25850	broad.mit.edu	37	19	37367974	37367974	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37367974A>G	uc002oex.2	+	3	620	c.242A>G	c.(241-243)CAG>CGG	p.Q81R	ZNF345_uc002oey.3_Missense_Mutation_p.Q81R|ZNF345_uc002oez.2_Intron	NM_003419	NP_003410	Q14585	ZN345_HUMAN	zinc finger protein 345	81	C2H2-type 1.				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTTCGACATCAGCGAATTCAT	0.398																0.044118	-8.722874	6.395775	3	65	KEEP	---	---	---	---	1	2	29	38	-1	capture	Missense_Mutation	SNP	37367974	37367974	ZNF345	19	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	17739	287
SLC17A7	57030	broad.mit.edu	37	19	49937876	49937876	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49937876G>A	uc002pnp.2	-	5	792	c.620C>T	c.(619-621)GCG>GTG	p.A207V	SLC17A7_uc002pnq.1_Missense_Mutation_p.A140V|SLC17A7_uc002pno.2_5'UTR	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	207	Cytoplasmic (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity	p.A207A(1)		ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GGCTGTCGTCGCCAGGCGACT	0.343																0.189474	32.041176	40.580369	18	77	KEEP	---	---	---	---	5	16	40	52	-1	capture	Missense_Mutation	SNP	49937876	49937876	SLC17A7	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14315	287
PXDN	7837	broad.mit.edu	37	2	1652977	1652977	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1652977A>C	uc002qxa.2	-	17	2639	c.2575T>G	c.(2575-2577)TCT>GCT	p.S859A		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	859					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ATCATGACAGAGAAGCAGGGG	0.667					2093											0.24	10.831419	12.380792	6	19	KEEP	---	---	---	---	4	2	11	11	-1	capture	Missense_Mutation	SNP	1652977	1652977	PXDN	2	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	12742	287
TTN	7273	broad.mit.edu	37	2	179496982	179496982	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179496982C>T	uc010zfg.1	-	185	36159	c.35935G>A	c.(35935-35937)GAA>AAA	p.E11979K	TTN_uc010zfh.1_Missense_Mutation_p.E5674K|TTN_uc010zfi.1_Missense_Mutation_p.E5607K|TTN_uc010zfj.1_Missense_Mutation_p.E5482K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12906							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTCCCTTCGTCTTGCATT	0.433				p.E11979K(COLO783-Tumor)	8722											0.24	14.037509	15.580192	6	19	KEEP	---	---	---	---	5	1	12	8	-1	capture	Missense_Mutation	SNP	179496982	179496982	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16617	287
TTN	7273	broad.mit.edu	37	2	179497281	179497281	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179497281C>T	uc010zfg.1	-	184	35972	c.35748G>A	c.(35746-35748)AAG>AAA	p.K11916K	TTN_uc010zfh.1_Silent_p.K5611K|TTN_uc010zfi.1_Silent_p.K5544K|TTN_uc010zfj.1_Silent_p.K5419K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12843							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTGTGTGCTTATCTTCAG	0.328					8722											0.277108	59.086031	62.79924	23	60	KEEP	---	---	---	---	14	11	38	29	-1	capture	Silent	SNP	179497281	179497281	TTN	2	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	16617	287
TTN	7273	broad.mit.edu	37	2	179647563	179647563	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179647563C>T	uc010zfg.1	-	18	3294	c.3070G>A	c.(3070-3072)GTC>ATC	p.V1024I	TTN_uc010zfh.1_Missense_Mutation_p.V978I|TTN_uc010zfi.1_Missense_Mutation_p.V978I|TTN_uc010zfj.1_Missense_Mutation_p.V978I|TTN_uc002unb.2_Missense_Mutation_p.V1024I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1024							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGTGCTGACGGTTCCAGCC	0.498					8722											0.288462	35.509714	37.592858	15	37	KEEP	---	---	---	---	10	7	19	21	-1	capture	Missense_Mutation	SNP	179647563	179647563	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	287
MYO1B	4430	broad.mit.edu	37	2	192278803	192278803	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192278803T>C	uc010fsg.2	+	28	3158	c.2903T>C	c.(2902-2904)CTG>CCG	p.L968P	MYO1B_uc002usq.2_Missense_Mutation_p.L910P|MYO1B_uc002usr.2_Missense_Mutation_p.L968P|MYO1B_uc002usu.2_Missense_Mutation_p.L213P|MYO1B_uc002usv.2_Missense_Mutation_p.L84P	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	968						myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			GGGGCTTACCTGGAAATCAAC	0.373																0.307229	149.77165	155.266409	51	115	KEEP	---	---	---	---	33	27	76	62	-1	capture	Missense_Mutation	SNP	192278803	192278803	MYO1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9979	287
HNF4A	3172	broad.mit.edu	37	20	43034798	43034798	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43034798C>T	uc002xma.2	+	2	305	c.216C>T	c.(214-216)TAC>TAT	p.Y72Y	HNF4A_uc010zwo.1_Missense_Mutation_p.T63M|HNF4A_uc002xlt.2_Silent_p.Y50Y|HNF4A_uc002xlu.2_Silent_p.Y50Y|HNF4A_uc002xlv.2_Silent_p.Y50Y|HNF4A_uc002xly.2_Silent_p.Y72Y|HNF4A_uc002xlz.2_Silent_p.Y72Y|HNF4A_uc010ggq.2_Silent_p.Y65Y	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	72	Nuclear receptor.|NR C4-type.				blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCAAACACTACGGTGCCTCGA	0.572	Colon(79;2 1269 8820 14841 52347)															0.314286	81.337808	84.560023	33	72	KEEP	---	---	---	---	17	20	40	47	-1	capture	Silent	SNP	43034798	43034798	HNF4A	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7178	287
ABCG1	9619	broad.mit.edu	37	21	43716431	43716431	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43716431G>A	uc002zaq.2	+	15	2072	c.1966G>A	c.(1966-1968)GGG>AGG	p.G656R	ABCG1_uc002zan.2_Missense_Mutation_p.G646R|ABCG1_uc002zam.2_Missense_Mutation_p.G622R|ABCG1_uc002zao.2_Missense_Mutation_p.G641R|ABCG1_uc002zap.2_Missense_Mutation_p.G644R|ABCG1_uc002zar.2_Missense_Mutation_p.G655R|ABCG1_uc011aev.1_Missense_Mutation_p.G667R|uc002zau.2_5'Flank	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	656	ABC transmembrane type-2.|Helical; (Potential).				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	CATCGTACTCGGGATTTTCTT	0.522																0.294872	62.055765	64.957744	23	55	KEEP	---	---	---	---	14	14	39	29	-1	capture	Missense_Mutation	SNP	43716431	43716431	ABCG1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	68	287
HPS4	89781	broad.mit.edu	37	22	26860320	26860320	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26860320G>A	uc003acl.2	-	11	1935	c.1276C>T	c.(1276-1278)CGC>TGC	p.R426C	HPS4_uc003aci.2_Missense_Mutation_p.R421C|HPS4_uc003acj.2_Missense_Mutation_p.R290C|HPS4_uc003ack.2_Missense_Mutation_p.R217C|HPS4_uc003acn.2_Missense_Mutation_p.R272C|HPS4_uc010gvd.1_Missense_Mutation_p.R444C|HPS4_uc003ach.2_Missense_Mutation_p.R161C	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a	426					lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						GAGGGAGGGCGCAAGCTGCTG	0.622												Hermansky-Pudlak_syndrome				0.037736	-17.973971	6.526082	4	102	KEEP	---	---	---	---	3	1	56	54	-1	capture	Missense_Mutation	SNP	26860320	26860320	HPS4	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7266	287
PANX2	56666	broad.mit.edu	37	22	50617533	50617533	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50617533G>A	uc003bjn.3	+	3	1861	c.1861G>A	c.(1861-1863)GCC>ACC	p.A621T	PANX2_uc003bjp.3_Missense_Mutation_p.A487T|PANX2_uc003bjo.3_Missense_Mutation_p.A621T	NM_052839	NP_443071	Q96RD6	PANX2_HUMAN	pannexin 2 isoform 1	621	Cytoplasmic (Potential).				protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GAGCCGAAACGCCACACACCC	0.711																0.32	20.391141	21.110862	8	17	KEEP	---	---	---	---	6	3	10	8	-1	capture	Missense_Mutation	SNP	50617533	50617533	PANX2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11325	287
QARS	5859	broad.mit.edu	37	3	49136953	49136953	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49136953C>A	uc003cvx.2	-	16	1521	c.1516G>T	c.(1516-1518)GGT>TGT	p.G506C	QARS_uc011bcc.1_5'Flank|QARS_uc011bcd.1_Missense_Mutation_p.G361C|QARS_uc003cvy.2_Missense_Mutation_p.G361C|QARS_uc011bce.1_Missense_Mutation_p.G495C	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	506					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CGCACAGCACCAGTTGCTACA	0.527																0.031008	-24.304939	6.776676	4	125	KEEP	---	---	---	---	2	2	81	60	0.5	capture	Missense_Mutation	SNP	49136953	49136953	QARS	3	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	12766	287
EPHA6	285220	broad.mit.edu	37	3	96945145	96945145	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:96945145C>A	uc010how.1	+	4	1195	c.1152C>A	c.(1150-1152)AAC>AAA	p.N384K	EPHA6_uc003drp.1_Missense_Mutation_p.N384K	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	289	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						TTGCTGGGAACACAAAATGTT	0.358					480											0.26087	62.654815	67.419314	24	68	KEEP	---	---	---	---	17	11	33	40	0.392857142857	capture	Missense_Mutation	SNP	96945145	96945145	EPHA6	3	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	5126	287
HCN1	348980	broad.mit.edu	37	5	45262329	45262329	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262329C>T	uc003jok.2	-	8	2392	c.2367G>A	c.(2365-2367)TCG>TCA	p.S789S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	789	Cytoplasmic (Potential).			S -> W (in Ref. 2; AAC39759).		integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GCGAGGGCTGCGAGGCGGAGA	0.627																0.233333	27.811241	31.725798	14	46	KEEP	---	---	---	---	7	8	28	27	-1	capture	Silent	SNP	45262329	45262329	HCN1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6922	287
GPR98	84059	broad.mit.edu	37	5	89986756	89986756	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89986756C>T	uc003kju.2	+	31	6945	c.6849C>T	c.(6847-6849)GGC>GGT	p.G2283G	GPR98_uc003kjt.2_Missense_Mutation_p.A17V|GPR98_uc003kjv.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2283	Calx-beta 16.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGCTACTGGCGACCTGCGAG	0.493																0.288889	30.452123	32.253247	13	32	KEEP	---	---	---	---	6	7	16	19	-1	capture	Silent	SNP	89986756	89986756	GPR98	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6654	287
PCDHA11	56138	broad.mit.edu	37	5	140249736	140249736	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140249736G>A	uc003lia.2	+	1	1906	c.1048G>A	c.(1048-1050)GCC>ACC	p.A350T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.A350T	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	350	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGAAGTCGCCGTGACTTC	0.547																0.296875	44.095494	46.459894	19	45	KEEP	---	---	---	---	11	10	28	23	-1	capture	Missense_Mutation	SNP	140249736	140249736	PCDHA11	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11424	287
PCDHB4	56131	broad.mit.edu	37	5	140503426	140503426	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140503426G>A	uc003lip.1	+	1	1846	c.1846G>A	c.(1846-1848)GTG>ATG	p.V616M		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	616	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGTTCGGCGTGTGGGCGCA	0.677																0.333333	102.232264	105.320171	42	84	KEEP	---	---	---	---	24	21	57	40	-1	capture	Missense_Mutation	SNP	140503426	140503426	PCDHB4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11447	287
PDGFRB	5159	broad.mit.edu	37	5	149504343	149504343	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149504343T>A	uc003lro.2	-	13	2328	c.1859A>T	c.(1858-1860)CAT>CTT	p.H620L	PDGFRB_uc010jhd.2_Missense_Mutation_p.H459L	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	620	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCTCAGGCCATGAGCCGTGGC	0.597					880	T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								0.129032	6.099344	10.23573	4	27	KEEP	---	---	---	---	2	2	15	15	-1	capture	Missense_Mutation	SNP	149504343	149504343	PDGFRB	5	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	11565	287
MSX2	4488	broad.mit.edu	37	5	174152030	174152030	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:174152030C>T	uc003mcy.2	+	1	456	c.368C>T	c.(367-369)TCG>TTG	p.S123L		NM_002449	NP_002440	P35548	MSX2_HUMAN	msh homeobox 2	123					cranial suture morphogenesis|negative regulation of transcription, DNA-dependent|osteoblast differentiation	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGCCGATATTCGCCGCCGCCA	0.677																0.111111	3.811959	10.481976	5	40	KEEP	---	---	---	---	4	2	24	28	-1	capture	Missense_Mutation	SNP	174152030	174152030	MSX2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9806	287
F13A1	2162	broad.mit.edu	37	6	6174842	6174842	+	Missense_Mutation	SNP	G	A	A	rs113599940		TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:6174842G>A	uc003mwv.2	-	12	1841	c.1718C>T	c.(1717-1719)ACG>ATG	p.T573M	F13A1_uc011dib.1_Missense_Mutation_p.T510M	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	573					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CACGTCGAACGTCTCCTTCTT	0.527																0.269231	95.974924	103.478159	42	114	KEEP	---	---	---	---	25	31	67	62	-1	capture	Missense_Mutation	SNP	6174842	6174842	F13A1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5294	287
FTSJD2	23070	broad.mit.edu	37	6	37438827	37438827	+	Silent	SNP	G	A	A	rs146308234		TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:37438827G>A	uc003ons.2	+	14	1789	c.1536G>A	c.(1534-1536)GCG>GCA	p.A512A		NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2	512					mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AAGCTCTGGCGAAAATCCATG	0.418																0.22619	41.982945	47.76553	19	65	KEEP	---	---	---	---	8	17	40	39	-1	capture	Silent	SNP	37438827	37438827	FTSJD2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	6033	287
SNAP91	9892	broad.mit.edu	37	6	84302667	84302667	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84302667G>T	uc011dze.1	-	19	2161	c.1844C>A	c.(1843-1845)TCT>TAT	p.S615Y	SNAP91_uc011dzd.1_Missense_Mutation_p.S118Y|SNAP91_uc003pkb.2_Missense_Mutation_p.S552Y|SNAP91_uc003pkc.2_Missense_Mutation_p.S613Y|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Missense_Mutation_p.S613Y	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	615					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GCACTCACCAGATAAGAGGTC	0.448																0.25	6.518127	7.200829	3	9	KEEP	---	---	---	---	0	3	4	7	-1	capture	Missense_Mutation	SNP	84302667	84302667	SNAP91	6	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	14725	287
GPRC6A	222545	broad.mit.edu	37	6	117113591	117113591	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117113591G>T	uc003pxj.1	-	6	2517	c.2495C>A	c.(2494-2496)CCC>CAC	p.P832H	GPRC6A_uc003pxk.1_Missense_Mutation_p.P657H|GPRC6A_uc003pxl.1_Missense_Mutation_p.P761H	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	832	Cytoplasmic (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		ATAGCATTTGGGGATGAATGT	0.368																0.2375	41.381623	46.421665	19	61	KEEP	---	---	---	---	10	11	38	32	0.47619047619	capture	Missense_Mutation	SNP	117113591	117113591	GPRC6A	6	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	6661	287
INTS1	26173	broad.mit.edu	37	7	1538054	1538054	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1538054C>T	uc003skn.2	-	10	1520	c.1419G>A	c.(1417-1419)GCG>GCA	p.A473A	INTS1_uc003skq.2_Silent_p.A473A	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	473					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CTACCTTGGGCGCCAGCTCTG	0.642																0.261905	24.911319	27.06265	11	31	KEEP	---	---	---	---	7	5	17	17	-1	capture	Silent	SNP	1538054	1538054	INTS1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7698	287
ESRP1	54845	broad.mit.edu	37	8	95683852	95683852	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95683852G>A	uc003ygq.3	+	11	1588	c.1405G>A	c.(1405-1407)GCC>ACC	p.A469T	ESRP1_uc003ygr.3_Missense_Mutation_p.A469T|ESRP1_uc003ygs.3_Missense_Mutation_p.A469T|ESRP1_uc003ygt.3_Missense_Mutation_p.A469T|ESRP1_uc003ygu.3_Missense_Mutation_p.A469T|ESRP1_uc003ygv.2_Missense_Mutation_p.A309T|ESRP1_uc003ygw.2_Missense_Mutation_p.A309T	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1	469	RRM 3.				mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						GGGGGAGTTCGCCACAGATAT	0.438																0.276596	31.152878	33.265763	13	34	KEEP	---	---	---	---	6	8	16	27	-1	capture	Missense_Mutation	SNP	95683852	95683852	ESRP1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5213	287
BNC2	54796	broad.mit.edu	37	9	16435990	16435990	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:16435990G>A	uc003zml.2	-	6	2342	c.2202C>T	c.(2200-2202)GGC>GGT	p.G734G	BNC2_uc011lmw.1_Silent_p.G639G|BNC2_uc003zmm.2_Silent_p.G692G|BNC2_uc003zmq.1_Silent_p.G748G|BNC2_uc003zmr.1_Silent_p.G771G|BNC2_uc003zmp.1_Silent_p.G762G|BNC2_uc010mij.1_Silent_p.G656G|BNC2_uc011lmv.1_Silent_p.G560G|BNC2_uc003zmo.1_Silent_p.G656G|BNC2_uc003zmj.2_Silent_p.G499G|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Silent_p.G499G|BNC2_uc003zmn.1_Silent_p.G499G	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	734					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		TGGATTCCTCGCCCAGTTTGG	0.517																0.597561	144.787278	145.471011	49	33	KEEP	---	---	---	---	25	28	17	21	-1	capture	Silent	SNP	16435990	16435990	BNC2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1463	287
LINGO2	158038	broad.mit.edu	37	9	27948963	27948963	+	Silent	SNP	C	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27948963C>A	uc003zqu.1	-	2	1901	c.1707G>T	c.(1705-1707)GGG>GGT	p.G569G	LINGO2_uc010mjf.1_Silent_p.G569G|LINGO2_uc003zqv.1_Silent_p.G569G	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	569	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GCTTGCCTTTCCCTCGGCTCC	0.463																0.421053	61.655661	61.972318	24	33	KEEP	---	---	---	---	9	16	13	22	0.64	capture	Silent	SNP	27948963	27948963	LINGO2	9	C	A	A	A	1	0	0	0	0	0	0	0	1	379	30	4	4	8735	287
PHF2	5253	broad.mit.edu	37	9	96408031	96408031	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96408031G>A	uc004aub.2	+	4	567	c.420G>A	c.(418-420)CCG>CCA	p.P140P	PHF2_uc011lug.1_Silent_p.P23P	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	140					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TGGCTGTCCCGGCCCCCACGT	0.627																0.327586	51.366274	52.864508	19	39	KEEP	---	---	---	---	9	16	24	23	-1	capture	Silent	SNP	96408031	96408031	PHF2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11733	287
OR13C8	138802	broad.mit.edu	37	9	107331658	107331658	+	Silent	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107331658C>T	uc011lvo.1	+	1	210	c.210C>T	c.(208-210)GAC>GAT	p.D70D		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCTTCCTCGACGTTTGCTACA	0.423																0.093117	5.342507	46.480054	23	224	KEEP	---	---	---	---	9	15	113	144	-1	capture	Silent	SNP	107331658	107331658	OR13C8	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10842	287
ZNF79	7633	broad.mit.edu	37	9	130207274	130207274	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130207274T>C	uc004bqw.3	+	5	1709	c.1295T>C	c.(1294-1296)CTC>CCC	p.L432P	ZNF79_uc011maf.1_Missense_Mutation_p.L408P|ZNF79_uc011mag.1_Missense_Mutation_p.L408P	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	432	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						AGCTCAGCCCTCATTCGGCAT	0.443																0.022059	-28.082479	6.577349	3	133	KEEP	---	---	---	---	1	4	83	73	-1	capture	Missense_Mutation	SNP	130207274	130207274	ZNF79	9	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	18037	287
MXRA5	25878	broad.mit.edu	37	X	3241682	3241682	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3241682G>A	uc004crg.3	-	5	2201	c.2044C>T	c.(2044-2046)CGC>TGC	p.R682C		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	682						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCACCTGGGCGTCTGCCTCTT	0.532																0.086957	-0.409932	19.432454	10	105	KEEP	---	---	---	---	8	5	69	61	-1	capture	Missense_Mutation	SNP	3241682	3241682	MXRA5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9913	287
FRMPD4	9758	broad.mit.edu	37	X	12712508	12712508	+	Missense_Mutation	SNP	G	A	A	rs148666498		TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12712508G>A	uc004cuz.1	+	9	1374	c.868G>A	c.(868-870)GTC>ATC	p.V290I	FRMPD4_uc011mij.1_Missense_Mutation_p.V282I	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	290	FERM.				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						AATTAGCTTCGTCCCAAAAGA	0.413																0.307018	84.874501	88.664868	35	79	KEEP	---	---	---	---	16	21	35	55	-1	capture	Missense_Mutation	SNP	12712508	12712508	FRMPD4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6002	287
YY2	404281	broad.mit.edu	37	X	21875300	21875300	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21875300A>G	uc011mjp.1	+	1	698	c.698A>G	c.(697-699)AAA>AGA	p.K233R	MBTPS2_uc004dae.2_Intron|MBTPS2_uc010nfr.2_Intron|YY2_uc010nfq.2_Missense_Mutation_p.K451R|MBTPS2_uc004dab.2_Intron	NM_206923	NP_996806	O15391	TYY2_HUMAN	YY2 transcription factor	233					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	DNA binding|zinc ion binding			breast(1)|skin(1)	2						TCAGATCCTAAACAGCTGGCA	0.488																0.013378	-74.233405	6.516388	4	295	KEEP	---	---	---	---	4	1	167	171	-1	capture	Missense_Mutation	SNP	21875300	21875300	YY2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	17390	287
ACRC	93953	broad.mit.edu	37	X	70824283	70824283	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70824283C>T	uc004eae.2	+	8	1657	c.1156C>T	c.(1156-1158)CCT>TCT	p.P386S	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	386						nucleus				ovary(3)	3	Renal(35;0.156)					ACCAAGTGATCCTGAGGCTAA	0.498																0.153846	6.78181	9.761935	4	22	KEEP	---	---	---	---	1	3	14	13	-1	capture	Missense_Mutation	SNP	70824283	70824283	ACRC	23	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	171	287
DRP2	1821	broad.mit.edu	37	X	100490945	100490945	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100490945G>C	uc004egz.2	+	4	583	c.214G>C	c.(214-216)GGA>CGA	p.G72R	DRP2_uc011mrh.1_5'UTR	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	72					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						TGGTGCCTCTGGACCCCTGGA	0.522																0.022599	-38.145037	6.825436	4	173	KEEP	---	---	---	---	1	3	97	100	-1	capture	Missense_Mutation	SNP	100490945	100490945	DRP2	23	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	4719	287
MID2	11043	broad.mit.edu	37	X	107160962	107160962	+	Silent	SNP	G	A	A			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107160962G>A	uc004enl.2	+	7	2001	c.1428G>A	c.(1426-1428)GCG>GCA	p.A476A	MID2_uc004enk.2_Intron	NM_012216	NP_036348	Q9UJV3	TRIM1_HUMAN	midline 2 isoform 1	476	Fibronectin type-III.					centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1						TGGCCGGGGCGCCACGAGGCA	0.483																0.284091	58.031304	61.719569	25	63	KEEP	---	---	---	---	8	19	30	36	-1	capture	Silent	SNP	107160962	107160962	MID2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9490	287
ZNF75D	7626	broad.mit.edu	37	X	134428042	134428042	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134428042C>T	uc004eyp.2	-	3	2680	c.25G>A	c.(25-27)GAT>AAT	p.D9N	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_5'Flank|ZNF75D_uc004eyo.2_Missense_Mutation_p.D9N	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	9					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GAGCATGAATCCGCGTTCAGC	0.478																0.259928	178.463767	192.927231	72	205	KEEP	---	---	---	---	47	40	98	145	-1	capture	Missense_Mutation	SNP	134428042	134428042	ZNF75D	23	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	18011	287
PDZD4	57595	broad.mit.edu	37	X	153069697	153069697	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153069697C>G	uc004fiz.1	-	8	1671	c.1421G>C	c.(1420-1422)GGG>GCG	p.G474A	PDZD4_uc004fiy.1_Missense_Mutation_p.G399A|PDZD4_uc004fix.2_Missense_Mutation_p.G378A|PDZD4_uc004fja.1_Missense_Mutation_p.G480A|PDZD4_uc011mze.1_Missense_Mutation_p.G365A	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	474						cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGCTCTCCCCAGTGTTGTA	0.682																0.277778	12.666279	13.466766	5	13	KEEP	---	---	---	---	3	5	3	12	-1	capture	Missense_Mutation	SNP	153069697	153069697	PDZD4	23	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	11606	287
SFPQ	6421	broad.mit.edu	37	1	35656550	35656550	+	Frame_Shift_Del	DEL	G	-	-			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35656550delG	uc001bys.2	-	3	1157	c.1064delC	c.(1063-1065)ACAfs	p.T355fs	SFPQ_uc001byr.2_5'Flank	NM_005066	NP_005057	P23246	SFPQ_HUMAN	splicing factor proline/glutamine rich	355	RRM 1.				alternative nuclear mRNA splicing, via spliceosome|DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|nucleotide binding|protein binding|protein binding|RNA binding		SFPQ/TFE3(6)	kidney(4)|soft_tissue(2)|ovary(1)|skin(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TCTCATGGGTGTATCATCCAG	0.438					895	T	TFE3	papillary renal cell								0.18			9	40		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	35656550	35656550	SFPQ	1	G	-	-	-	1	0	1	0	1	0	0	0	0	624	48	5	5	14053	287
C6orf223	221416	broad.mit.edu	37	6	43970503	43970504	+	In_Frame_Ins	INS	-	GCG	GCG	rs72369323		TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43970503_43970504insGCG	uc003own.2	+	4	387_388	c.369_370insGCG	c.(367-372)insGCG	p.132_133insA	uc003owm.1_Intron|C6orf223_uc003owo.2_In_Frame_Ins_p.112_113insA	NM_153246	NP_694978	Q8N319	CF223_HUMAN	hypothetical protein LOC221416	132_133	Ala-rich.										0	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			CGGTAGAGCGCgcggcggcggc	0.639																0.38			5	8		---	---	---	---						capture_indel	In_Frame_Ins	INS	43970503	43970504	C6orf223	6	-	GCG	GCG	GCG	1	0	1	1	0	0	0	0	0	340	27	5	5	2334	287
MED12	9968	broad.mit.edu	37	X	70341522	70341523	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70341522_70341523delTA	uc004dyy.2	+	7	1156_1157	c.957_958delTA	c.(955-960)GTTATAfs	p.V319fs	MED12_uc011mpq.1_Frame_Shift_Del_p.V319fs|MED12_uc004dyz.2_Frame_Shift_Del_p.V319fs|MED12_uc004dza.2_Frame_Shift_Del_p.V166fs	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	319_320					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CATCTCATGTTATATCTGCTCA	0.554																0.08			9	105		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	70341522	70341523	MED12	23	TA	-	-	-	1	0	1	0	1	0	0	0	0	782	61	5	5	9341	287
TBC1D8B	54885	broad.mit.edu	37	X	106066520	106066521	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-76-6663-01	TCGA-76-6663-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:106066520_106066521delAG	uc004emo.2	+	5	816_817	c.651_652delAG	c.(649-654)ACAGAGfs	p.T217fs	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emm.2_Frame_Shift_Del_p.T217fs|TBC1D8B_uc004emn.2_Frame_Shift_Del_p.T217fs	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	217_218						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TCATACTGACAGAGAGTATTCA	0.361																0.35			40	73		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	106066520	106066521	TBC1D8B	23	AG	-	-	-	1	0	1	0	1	0	0	0	0	80	7	5	5	15513	287
