Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CELA3B	23436	broad.mit.edu	37	1	22332332	22332332	+	3'UTR	SNP	T	C	C	rs74922245	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22332332T>C	uc009vqf.2	+	4					CELA3A_uc001bfl.2_Intron			P08861	CEL3B_HUMAN	SubName: Full=Elastase 3A, pancreatic;						cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						CTCCTCTACTTGTCCCTCCAT	0.498													4	22	---	---	---	---	PASS
CELA3B	23436	broad.mit.edu	37	1	22332333	22332333	+	3'UTR	SNP	G	A	A	rs76102053	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22332333G>A	uc009vqf.2	+	4					CELA3A_uc001bfl.2_Intron			P08861	CEL3B_HUMAN	SubName: Full=Elastase 3A, pancreatic;						cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						TCCTCTACTTGTCCCTCCATG	0.498													5	20	---	---	---	---	PASS
C1orf91	56063	broad.mit.edu	37	1	32682463	32682463	+	3'UTR	SNP	A	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32682463A>T	uc009vub.1	-	4					C1orf91_uc001buo.3_Intron|C1orf91_uc001bup.3_Intron|C1orf91_uc010oha.1_Intron|C1orf91_uc001buq.3_Silent_p.S138S			Q8WY98	TM234_HUMAN	RecName: Full=UPF0546 membrane protein C1orf91;							integral to membrane					0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTCAAAGGGTAGACTGTTGCC	0.542													22	41	---	---	---	---	PASS
USP1	7398	broad.mit.edu	37	1	62913040	62913040	+	Silent	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62913040G>T	uc001daj.1	+	7	1606	c.1278G>T	c.(1276-1278)GTG>GTT	p.V426V	USP1_uc001dak.1_Silent_p.V426V|USP1_uc001dal.1_Silent_p.V426V	NM_001017415	NP_001017415	O94782	UBP1_HUMAN	ubiquitin specific protease 1	426					DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		TTGAGCTAGTGGAGAAATTAT	0.343													10	731	---	---	---	---	PASS
C1orf114	57821	broad.mit.edu	37	1	169388166	169388166	+	Intron	SNP	T	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169388166T>G	uc001gga.1	-						C1orf114_uc001gfz.1_Intron|C1orf114_uc009wvq.1_Intron|C1orf114_uc001ggb.2_3'UTR	NM_021179	NP_067002	Q5TID7	CA114_HUMAN	hypothetical protein LOC57821												0	all_hematologic(923;0.208)					CCATAGGCTGTTAGTCTGATA	0.343													25	118	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169483492	169483492	+	3'UTR	SNP	C	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169483492C>T	uc001ggg.1	-	25						NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ATACATTGCCCATTCTAAATG	0.323													4	146	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181688913	181688913	+	Silent	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181688913G>T	uc001gow.2	+	13	1830	c.1665G>T	c.(1663-1665)GTG>GTT	p.V555V	CACNA1E_uc009wxs.2_Silent_p.V462V	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	555	Helical; Name=S3 of repeat II.|II.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TCTTTGAAGTGGTCTGGGCAA	0.498													5	267	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186287579	186287579	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186287579C>A	uc001grv.2	-	48	7118	c.6821G>T	c.(6820-6822)GGT>GTT	p.G2274V		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2274					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AAACTTTTACCCTTCAGATTC	0.363			T	NTRK1	papillary thyroid								6	193	---	---	---	---	PASS
CYB5R1	51706	broad.mit.edu	37	1	202932810	202932810	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202932810G>C	uc001gyt.2	-	7	676	c.605C>G	c.(604-606)CCT>CGT	p.P202R	CYB5R1_uc010pqe.1_RNA	NM_016243	NP_057327	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	202	FAD (By similarity).				sterol biosynthetic process	integral to membrane	cytochrome-b5 reductase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(75;0.141)			TGGATCTTCAGGGACTTTCAG	0.512													64	143	---	---	---	---	PASS
PLXNA2	5362	broad.mit.edu	37	1	208215470	208215470	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208215470T>C	uc001hgz.2	-	22	5017	c.4259A>G	c.(4258-4260)AAG>AGG	p.K1420R		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	1420	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGGGTGGTTCTTGTTCTCCAG	0.587													22	51	---	---	---	---	PASS
EPHX1	2052	broad.mit.edu	37	1	226032308	226032308	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226032308A>G	uc001hpk.2	+	8	1230	c.1150A>G	c.(1150-1152)ACC>GCC	p.T384A	EPHX1_uc001hpl.2_Missense_Mutation_p.T384A	NM_001136018	NP_001129490	P07099	HYEP_HUMAN	epoxide hydrolase 1	384					aromatic compound catabolic process|response to toxin	endoplasmic reticulum membrane|integral to membrane|microsome	cis-stilbene-oxide hydrolase activity|epoxide hydrolase activity			ovary(3)|lung(1)	4	Breast(184;0.197)					GGGCTGGATGACCCAGAAGCA	0.622													7	15	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236740185	236740185	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236740185C>A	uc001hyd.1	-	21	2945	c.2820G>T	c.(2818-2820)CAG>CAT	p.Q940H	HEATR1_uc009xgh.1_Missense_Mutation_p.Q183H	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	940					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CCTGGAGACACTGAATGGCAG	0.403													28	68	---	---	---	---	PASS
C2orf39	92749	broad.mit.edu	37	2	26647271	26647271	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26647271C>A	uc002rhg.2	+	4	563	c.489C>A	c.(487-489)CAC>CAA	p.H163Q	C2orf39_uc010eym.1_Intron	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	163	Potential.										0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACAGCTGCACTGTGCTGGAC	0.527													31	77	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32718669	32718669	+	Silent	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32718669T>C	uc010ezu.2	+	45	8537	c.8403T>C	c.(8401-8403)TCT>TCC	p.S2801S		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2801					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TGCATCTTTCTTCAACATGTC	0.333													8	644	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97871700	97871700	+	Silent	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97871700T>C	uc010yva.1	+	51	3329	c.3085T>C	c.(3085-3087)TTG>CTG	p.L1029L		NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1029											0						ACCACCAACCTTGAAGGTAAT	0.299													5	147	---	---	---	---	PASS
ACVR2A	92	broad.mit.edu	37	2	148680653	148680653	+	Silent	SNP	C	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148680653C>T	uc002twg.2	+	10	1458	c.1189C>T	c.(1189-1191)CTG>TTG	p.L397L	ACVR2A_uc010zbn.1_Silent_p.L289L|ACVR2A_uc002twh.2_Silent_p.L397L	NM_001616	NP_001607	P27037	AVR2A_HUMAN	activin A receptor, type IIA precursor	397	Cytoplasmic (Potential).|Protein kinase.				activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)		CCTATGGGAACTGGCTTCTCG	0.393													4	208	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152355874	152355874	+	Intron	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152355874T>C	uc010fnx.2	-						NEB_uc002txr.2_Intron|RIF1_uc002txp.2_RNA|NEB_uc010zbz.1_5'Flank|NEB_uc002txq.2_Intron|NEB_uc010zca.1_Intron|NEB_uc010zcb.1_Intron|NEB_uc002txt.3_Intron	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGGATTGGAATCCCTTTTCCA	0.338													6	343	---	---	---	---	PASS
WDR69	164781	broad.mit.edu	37	2	228767717	228767717	+	Splice_Site	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228767717G>T	uc002vpn.1	+	7	620	c.541_splice	c.e7-1	p.V181_splice	WDR69_uc010zlw.1_Splice_Site_p.V166_splice|WDR69_uc002vpo.1_Splice_Site	NM_178821	NP_849143	Q8N136	WDR69_HUMAN	WD repeat domain 69											breast(1)	1		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)		ATGTAATTTAGGTGTGTTTAT	0.373													6	415	---	---	---	---	PASS
PRSS45	377047	broad.mit.edu	37	3	46783933	46783933	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46783933C>A	uc010hjl.2	-	4	594	c.594G>T	c.(592-594)AAG>AAT	p.K198N	PRSS45_uc011bam.1_RNA	NM_199183	NP_954652	Q7RTY3	PRS45_HUMAN	testis serine protease 5	230	Peptidase S1.				proteolysis		serine-type endopeptidase activity				0						TCATTTGCTTCTTGATCCATT	0.567													48	70	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510108	195510108	+	Silent	SNP	G	A	A	rs142152945	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510108G>A	uc011bto.1	-	3	8419	c.7959C>T	c.(7957-7959)CAC>CAT	p.H2653H	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.592													5	29	---	---	---	---	PASS
STIM2	57620	broad.mit.edu	37	4	26921181	26921181	+	Silent	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26921181G>T	uc003gsh.3	+	2	684	c.468G>T	c.(466-468)CTG>CTT	p.L156L	STIM2_uc003gsg.3_Silent_p.L156L|STIM2_uc010iex.2_Silent_p.L156L	NM_020860	NP_065911	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	69	EF-hand.|Extracellular (Potential).				activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)				GATTTAGTCTGGAAGCTCTTC	0.388													6	387	---	---	---	---	PASS
RPL34	6164	broad.mit.edu	37	4	109543328	109543328	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109543328G>A	uc003hyz.2	+	3	177	c.133G>A	c.(133-135)GCA>ACA	p.A45T	LOC285456_uc003hyy.2_5'Flank|LOC285456_uc011cfl.1_5'Flank|RPL34_uc003hza.2_Missense_Mutation_p.A45T	NM_000995	NP_000986	P49207	RL34_HUMAN	ribosomal protein L34	45					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000286)		ACCAAAATCTGCATGTGGTGT	0.453													37	133	---	---	---	---	PASS
ELL2	22936	broad.mit.edu	37	5	95242241	95242241	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95242241C>A	uc003klr.3	-	5	1077	c.727G>T	c.(727-729)GCA>TCA	p.A243S		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	243					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGCAGAATTGCTCCCAGGGAG	0.428													30	78	---	---	---	---	PASS
TIGD6	81789	broad.mit.edu	37	5	149375454	149375454	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149375454T>C	uc003lri.2	-	2	1220	c.458A>G	c.(457-459)GAT>GGT	p.D153G	TIGD6_uc003lrj.2_Missense_Mutation_p.D153G	NM_030953	NP_112215	Q17RP2	TIGD6_HUMAN	hypothetical protein LOC81789	153					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ATTAATCTTATCTATTCCTAG	0.413													50	181	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180374669	180374669	+	Intron	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180374669T>C	uc003mmp.2	+						BTNL8_uc003mmq.2_Silent_p.V277V|BTNL8_uc011dhg.1_Intron|BTNL8_uc010jll.2_Silent_p.V277V|BTNL8_uc010jlm.2_Intron|BTNL8_uc011dhh.1_Intron	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor							integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TATTCATGGTTCCAGCAGGGA	0.498													40	166	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180377117	180377117	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180377117G>A	uc003mmp.2	+	8	1310	c.1076G>A	c.(1075-1077)CGG>CAG	p.R359Q	BTNL8_uc003mmq.2_3'UTR|BTNL8_uc011dhg.1_Missense_Mutation_p.R234Q|BTNL8_uc010jll.2_3'UTR|BTNL8_uc010jlm.2_Missense_Mutation_p.R243Q|BTNL8_uc011dhh.1_Missense_Mutation_p.R175Q	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor	359	B30.2/SPRY.|Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAGTGTGCCGGGATGATGTG	0.498													100	130	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87966832	87966832	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87966832A>G	uc003plm.3	+	8	3526	c.3485A>G	c.(3484-3486)AAC>AGC	p.N1162S		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	1162					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TCACCGGTGAACAGCTCAAAT	0.403													4	61	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136882731	136882731	+	Silent	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136882731T>C	uc003qhc.2	-	28	4288	c.3927A>G	c.(3925-3927)GAA>GAG	p.E1309E	MAP3K5_uc011edj.1_Silent_p.E556E	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	1309					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTTCAGAATCTTCAGTATTTG	0.368													6	276	---	---	---	---	PASS
SLC13A4	26266	broad.mit.edu	37	7	135370372	135370372	+	Silent	SNP	C	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135370372C>T	uc003vta.2	-	14	2192	c.1503G>A	c.(1501-1503)CCG>CCA	p.P501P	SLC13A4_uc003vtb.2_Silent_p.P502P|PL-5283_uc003vsz.3_Intron	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate	501	Helical; (Potential).					integral to plasma membrane	sodium:sulfate symporter activity				0						TGACAGCCCACGGTGGGAGGC	0.542													11	26	---	---	---	---	PASS
WWP1	11059	broad.mit.edu	37	8	87479162	87479162	+	3'UTR	SNP	A	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87479162A>C	uc003ydt.2	+	25						NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase						central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						GCATTTAAATACCCCAGCCAA	0.373													17	76	---	---	---	---	PASS
PLIN2	123	broad.mit.edu	37	9	19116637	19116637	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19116637G>A	uc003zno.2	-	8	1102	c.923C>T	c.(922-924)TCA>TTA	p.S308L	PLIN2_uc011lna.1_Missense_Mutation_p.S280L	NM_001122	NP_001113	Q99541	PLIN2_HUMAN	adipose differentiation-related protein	308					cellular lipid metabolic process	endoplasmic reticulum|extracellular region|lipid particle				ovary(2)	2						AAGAGTACGTGACTCAATGTG	0.453													29	79	---	---	---	---	PASS
UBE2R2	54926	broad.mit.edu	37	9	33817901	33817901	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33817901C>T	uc003ztm.2	+	1	720	c.146C>T	c.(145-147)CCC>CTC	p.P49L	uc003ztk.1_Intron	NM_017811	NP_060281	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme UBC3B	49					protein K48-linked ubiquitination|protein monoubiquitination		ATP binding|ubiquitin-protein ligase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		TTCGGACCCCCCAACACCCTC	0.657													3	27	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104449136	104449136	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104449136G>A	uc004bbp.1	-	2	1647	c.1046C>T	c.(1045-1047)CCC>CTC	p.P349L	GRIN3A_uc004bbq.1_Missense_Mutation_p.P349L	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	349	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	AAGTTCAGGGGGCATGACCCC	0.507													5	92	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127781416	127781416	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127781416C>A	uc004bpe.2	-	8	759	c.678G>T	c.(676-678)TTG>TTT	p.L226F	SCAI_uc004bpd.2_Missense_Mutation_p.L249F|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	226					negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						CTTGAAGCACCAAGTTCCATT	0.294													6	338	---	---	---	---	PASS
GTF3C4	9329	broad.mit.edu	37	9	135555166	135555166	+	Silent	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135555166A>G	uc010mzv.2	+	2	2418	c.2160A>G	c.(2158-2160)GAA>GAG	p.E720E	GTF3C4_uc010mzw.2_RNA	NM_012204	NP_036336	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC 4	720					transcription initiation from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|enzyme activator activity|histone acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		TGTCTGATGAAGAGTATGATG	0.408													5	56	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49420118	49420118	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49420118T>A	uc001jgi.2	-	13	1597	c.1490A>T	c.(1489-1491)GAT>GTT	p.D497V	FRMPD2_uc001jgh.2_Missense_Mutation_p.D465V|FRMPD2_uc001jgj.2_Missense_Mutation_p.D475V	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	497	FERM.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		TGGGATGTAATCTTCAACGTG	0.542													18	35	---	---	---	---	PASS
DHX32	55760	broad.mit.edu	37	10	127548395	127548395	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127548395G>T	uc001ljf.1	-	3	1117	c.626C>A	c.(625-627)CCA>CAA	p.P209Q	DHX32_uc001ljg.1_Missense_Mutation_p.P209Q|DHX32_uc009yam.1_Missense_Mutation_p.P45Q	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	209	Helicase ATP-binding.		P -> R (in a breast cancer sample; somatic mutation).			mitochondrion|nucleus	ATP binding|helicase activity	p.P209R(2)		breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CTTCAGTTCTGGTCTTGCTAG	0.378													6	415	---	---	---	---	PASS
PTPRCAP	5790	broad.mit.edu	37	11	67203476	67203476	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67203476G>T	uc001oli.1	-	2	412	c.349C>A	c.(349-351)CAC>AAC	p.H117N		NM_005608	NP_005599	Q14761	PTCA_HUMAN	protein tyrosine phosphatase, receptor type,	117					defense response	integral to membrane|plasma membrane					0			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			TCCGCGACGTGGTCATAGTCT	0.667													3	19	---	---	---	---	PASS
BTG4	54766	broad.mit.edu	37	11	111368759	111368759	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111368759A>G	uc001plj.2	-	3	460	c.275T>C	c.(274-276)ATG>ACG	p.M92T	BTG4_uc001plk.2_Missense_Mutation_p.M92T	NM_017589	NP_060059	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	92					cell cycle arrest|negative regulation of cell proliferation|neuron differentiation						0		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		CCATATGGTCATCTCCTTCGG	0.398													133	337	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965721	111965721	+	3'UTR	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965721T>C	uc001pmz.2	+	4						NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	CTTTGAAGAATTGATGTATGC	0.418			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				4	12	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965729	111965729	+	3'UTR	SNP	T	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965729T>A	uc001pmz.2	+	4						NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	AATTGATGTATGCCTCTTTGC	0.408			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				4	11	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113701632	113701632	+	Silent	SNP	C	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113701632C>A	uc001poh.2	-	9	900	c.867G>T	c.(865-867)GTG>GTT	p.V289V	USP28_uc001pog.2_5'Flank|USP28_uc010rwy.1_Silent_p.V164V|USP28_uc001poi.2_5'UTR|USP28_uc001poj.3_Silent_p.V289V|USP28_uc010rwz.1_3'UTR	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	289				VQLFYGTFLTEGVRE -> IVIVMSFLKSLSLCL (in Ref. 4; BAA96039).	cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		AGAACAGCTGCACCATTGGAT	0.373													130	428	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10124190	10124190	+	5'UTR	SNP	T	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10124190T>A	uc001qwr.3	+	1					CLEC12A_uc001qwq.2_Missense_Mutation_p.S9T|CLEC12A_uc001qws.3_5'UTR|CLEC12A_uc001qwt.2_5'UTR	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor							integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						CTTTACATATTCATCAATGTC	0.323													140	354	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94673352	94673352	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94673352A>C	uc001tdc.2	+	22	3951	c.3702A>C	c.(3700-3702)AAA>AAC	p.K1234N	PLXNC1_uc010sut.1_Missense_Mutation_p.K281N|PLXNC1_uc009zsv.2_5'UTR	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1234	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						GCCAAGCCAAAGAAAAGATTT	0.433													49	133	---	---	---	---	PASS
SPG20	23111	broad.mit.edu	37	13	36878743	36878743	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36878743G>T	uc001uvn.2	-	10	2030	c.1760C>A	c.(1759-1761)ACC>AAC	p.T587N	SPG20_uc010ten.1_Missense_Mutation_p.T577N|SPG20_uc001uvm.2_Missense_Mutation_p.T587N|SPG20_uc001uvo.2_Missense_Mutation_p.T587N|SPG20_uc001uvq.2_Missense_Mutation_p.T587N	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	587					cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CGCATGGTGGGTAGCTTCTCC	0.348													12	188	---	---	---	---	PASS
ADCK1	57143	broad.mit.edu	37	14	78365584	78365584	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78365584C>G	uc001xui.2	+	6	823	c.724C>G	c.(724-726)CAT>GAT	p.H242D	ADCK1_uc010tvo.1_RNA|ADCK1_uc001xuj.2_Missense_Mutation_p.H174D|ADCK1_uc001xuk.1_Missense_Mutation_p.H116D	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	249	Protein kinase.					extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GATGCTCAGGCATTTTGACTT	0.512													32	72	---	---	---	---	PASS
TCL6	27004	broad.mit.edu	37	14	96129842	96129842	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96129842T>C	uc001yeq.2	+	4	1530	c.61T>C	c.(61-63)TGC>CGC	p.C21R	TCL6_uc001yep.1_RNA|TCL6_uc001yes.2_5'UTR|TCL6_uc001yet.1_5'UTR|TCL6_uc001yeu.2_5'UTR|TCL6_uc001yev.2_5'UTR|TCL1B_uc001yew.2_RNA|TCL1B_uc001yex.2_RNA|TCL1B_uc010avj.2_RNA	NM_020554	NP_065579			SubName: Full=T-cell leukemia/lymphoma 6 ORF163;												0		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		ccaggtttcctgccccagtgc	0.139			T	TRA@	T-ALL								41	71	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107099545	107099545	+	RNA	SNP	C	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107099545C>T	uc010tyt.1	-	95		c.4319G>A								Parts of antibodies, mostly variable regions.												0						TGAATCACCTCTTAAAATAGC	0.463													6	75	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28515959	28515959	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28515959G>A	uc001zbj.2	-	10	1245	c.1139C>T	c.(1138-1140)CCA>CTA	p.P380L	HERC2_uc001zbl.1_Missense_Mutation_p.P75L	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	380					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTTGTCTTGTGGAAGGGTGAG	0.493													11	38	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33920703	33920703	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33920703G>T	uc001zhi.2	+	21	2676	c.2606G>T	c.(2605-2607)CGA>CTA	p.R869L	RYR3_uc010bar.2_Missense_Mutation_p.R869L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	869	4 X approximate repeats.|1.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAAAAGATCCGAGACAGACTA	0.418													5	306	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50223318	50223318	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50223318A>G	uc001zxu.2	-	16	1782	c.1640T>C	c.(1639-1641)ATA>ACA	p.I547T	ATP8B4_uc010ber.2_Missense_Mutation_p.I420T|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	547	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		AACCATACCTATGACAGACAT	0.363													9	302	---	---	---	---	PASS
CCDC144A	9720	broad.mit.edu	37	17	16664760	16664760	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16664760G>A	uc002gqk.1	+	13	3470	c.3394G>A	c.(3394-3396)GAA>AAA	p.E1132K	CCDC144A_uc002gql.1_Missense_Mutation_p.E648K|LOC162632_uc010cpj.1_RNA	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1132											0						AGAAGCACAGGAAACTGTACC	0.333													13	61	---	---	---	---	PASS
TOM1L1	10040	broad.mit.edu	37	17	53007458	53007458	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53007458A>G	uc002iud.2	+	8	920	c.745A>G	c.(745-747)ATG>GTG	p.M249V	TOM1L1_uc002iuc.2_Missense_Mutation_p.M249V|TOM1L1_uc010dca.1_Missense_Mutation_p.M249V|TOM1L1_uc010wnb.1_Missense_Mutation_p.M242V|TOM1L1_uc010wnc.1_Missense_Mutation_p.M172V|TOM1L1_uc010dbz.2_Missense_Mutation_p.M172V|TOM1L1_uc010wnd.1_Missense_Mutation_p.M137V|TOM1L1_uc010dcb.1_RNA	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1	249	GAT.				intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						AGGTCGGGAGATGCAGGAGAG	0.428													7	346	---	---	---	---	PASS
RIOK3	8780	broad.mit.edu	37	18	21043937	21043937	+	Silent	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21043937T>C	uc002kui.3	+	3	803	c.186T>C	c.(184-186)GCT>GCC	p.A62A	RIOK3_uc010dls.2_Silent_p.A62A|RIOK3_uc010xas.1_Intron|RIOK3_uc010xat.1_5'Flank	NM_003831	NP_003822	O14730	RIOK3_HUMAN	sudD suppressor of bimD6 homolog	62					chromosome segregation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATAGTGTTGCTGAAGGACCAT	0.373													111	334	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806932	22806932	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806932T>C	uc002kvk.2	-	4	1197	c.950A>G	c.(949-951)GAG>GGG	p.E317G	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.E317G|ZNF521_uc002kvl.2_Missense_Mutation_p.E97G	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	317	C2H2-type 8.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTGGAAACTCTCAGAACAAAT	0.542			T	PAX5	ALL								5	133	---	---	---	---	PASS
CNDP1	84735	broad.mit.edu	37	18	72234669	72234669	+	Splice_Site	SNP	G	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72234669G>T	uc002llq.2	+	6	967	c.756_splice	c.e6+1	p.E252_splice	CNDP1_uc002lls.2_Splice_Site_p.E55_splice	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor						proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		CATGGTGGAGGTATCCACAGA	0.502													7	37	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12502161	12502161	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12502161A>T	uc010dyt.2	-	4	1201	c.1051T>A	c.(1051-1053)TCA>ACA	p.S351T	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	351	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						CTTTTCAGTGAACTAGGACAA	0.413													8	174	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533104	41533104	+	Intron	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533104G>A	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CATCATGTCCGCACAGCACCA	0.632													3	9	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50213594	50213594	+	Silent	SNP	T	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50213594T>C	uc002ppj.2	+	14	1789	c.1584T>C	c.(1582-1584)TCT>TCC	p.S528S	CPT1C_uc002ppl.3_Silent_p.S494S|CPT1C_uc002ppi.2_Silent_p.S445S|CPT1C_uc002ppk.2_Silent_p.S517S|CPT1C_uc010eng.2_Silent_p.S528S|CPT1C_uc010enh.2_Silent_p.S528S|CPT1C_uc010ybc.1_Silent_p.S399S|CPT1C_uc010eni.1_Silent_p.S185S	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	528	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		CCTCCATCTCTCTAGCCCTGA	0.547													5	108	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54760837	54760837	+	Silent	SNP	G	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54760837G>A	uc002qex.2	-	2	168	c.57C>T	c.(55-57)ACC>ACT	p.T19T	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.T19T|LILRB5_uc002qey.2_Silent_p.T19T|LILRB5_uc002qez.2_Silent_p.T19T|LILRB5_uc002qfa.1_5'UTR|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	19					cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTGCACGCAGGTCCTGGGGC	0.637													3	37	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57329187	57329187	+	Intron	SNP	G	A	A	rs142177720	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57329187G>A	uc002qnr.2	-						ZIM2_uc010ygq.1_Translation_Start_Site|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Intron|PEG3_uc002qnu.2_Silent_p.D263D|PEG3_uc002qnv.2_Silent_p.D263D|PEG3_uc002qnw.2_Silent_p.D139D|PEG3_uc002qnx.2_Silent_p.D137D|PEG3_uc010etr.2_Silent_p.D263D	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		AGTGGCCATCGTCTTCAGCAA	0.502													33	49	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29623218	29623218	+	5'Flank	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29623218A>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TGCACTCGACAATGGTCTTTT	0.408													8	215	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53244975	53244975	+	Splice_Site	SNP	A	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53244975A>G	uc004drz.2	-	7	1496	c.963_splice	c.e7+1	p.F321_splice	KDM5C_uc011moc.1_Splice_Site|KDM5C_uc011mod.1_Splice_Site_p.F254_splice|KDM5C_uc004dsa.2_Splice_Site_p.F320_splice	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						CTGGGTCCTTACAAACTGGGC	0.532			N|F|S		clear cell renal carcinoma								58	57	---	---	---	---	PASS
AMOT	154796	broad.mit.edu	37	X	112048309	112048309	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112048309G>C	uc004epr.2	-	5	1642	c.1642C>G	c.(1642-1644)CAG>GAG	p.Q548E	AMOT_uc004eps.2_Missense_Mutation_p.Q139E	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	548	Potential.				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						TTCTCACGCTGGCTTTCTTTA	0.493													34	14	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	6927321	6927321	+	Intron	DEL	A	-	-	rs78898097	byFrequency	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6927321delA	uc001aoi.2	+						CAMTA1_uc001aoh.2_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GTTTTTAGGGAAAAAAAAAGT	0.189													4	3	---	---	---	---	
PRAMEF2	65122	broad.mit.edu	37	1	12920822	12920823	+	Intron	INS	-	A	A	rs151087650	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12920822_12920823insA	uc001aum.1	+							NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCTAAAAGATGAAAAACAAAAA	0.470													4	3	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16900067	16900068	+	Intron	INS	-	G	G	rs5772689		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16900067_16900068insG	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ACATGAAACACACATGATAGAT	0.243													6	3	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16900070	16900070	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16900070delA	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGAAACACACATGATAGATAA	0.234													6	3	---	---	---	---	
PAX7	5081	broad.mit.edu	37	1	18957988	18957988	+	5'UTR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18957988delA	uc001bay.2	+	1					PAX7_uc001baz.2_5'UTR|PAX7_uc010oct.1_5'UTR	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1						anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		AGAAGAGGTTAAAAAAAAGAA	0.597			T	FOXO1A	alveolar rhabdomyosarcoma								4	2	---	---	---	---	
EPB41	2035	broad.mit.edu	37	1	29355890	29355892	+	Intron	DEL	GTT	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29355890_29355892delGTT	uc001brm.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc009vtk.1_Intron|EPB41_uc001brk.2_Intron|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		TATTTTGGTGGTTGTTGTTCCAA	0.399													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35681420	35681420	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35681420delT								SFPQ (22677 upstream) : ZMYM4 (53148 downstream)																							TTTGGGGTGATTTTTTTTTTT	0.189													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39169845	39169845	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39169845delA								POU3F1 (657395 upstream) : RRAGC (135170 downstream)																							tcctcagcagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
GLIS1	148979	broad.mit.edu	37	1	54050078	54050078	+	Intron	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54050078delG	uc001cvr.1	-							NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						tccctgcaatgggtcttctca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	92109883	92109883	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92109883delA								HSP90B3P (549 upstream) : TGFBR3 (36019 downstream)																							TCATGTGTATAAAAAAAAAAG	0.318													6	3	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149956177	149956178	+	Intron	INS	-	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149956177_149956178insA	uc001etn.2	-							NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			ctacttcacagaaaaaaAAAAT	0.218													3	3	---	---	---	---	
FDPS	2224	broad.mit.edu	37	1	155287476	155287476	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155287476delA	uc001fkc.2	+						RAG1AP1_uc010pey.1_Intron|FDPS_uc001fkd.2_Intron|FDPS_uc001fke.2_Intron|FDPS_uc001fkf.2_Intron|C1orf104_uc001fkh.1_RNA	NM_002004	NP_001995	P14324	FPPS_HUMAN	farnesyl diphosphate synthase isoform a						cholesterol biosynthetic process|interspecies interaction between organisms|isoprenoid biosynthetic process	cytosol|nucleus	dimethylallyltranstransferase activity|geranyltranstransferase activity|metal ion binding				0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	aaaataaattaaaaaaaaaaa	0.000													6	3	---	---	---	---	
ARHGEF2	9181	broad.mit.edu	37	1	155924927	155924927	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155924927delT	uc001fmt.2	-						ARHGEF2_uc001fmr.2_Intron|ARHGEF2_uc001fms.2_Intron|ARHGEF2_uc001fmu.2_Intron	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2						actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					Cttttctttcttttttttttg	0.219													7	4	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201773567	201773567	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201773567delT	uc001gwu.2	+						NAV1_uc001gwx.2_Intron	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						GTGTTGATTCTTTTTTTTTTT	0.418													4	3	---	---	---	---	
CAPN2	824	broad.mit.edu	37	1	223949705	223949705	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223949705delA	uc001hob.3	+						CAPN2_uc010puy.1_Intron|CAPN2_uc001hoc.2_Intron	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1						proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		TTTTAATTAGAAAAAAAAAAC	0.373													6	4	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241190924	241190924	+	Intron	DEL	G	-	-	rs59155388		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241190924delG	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			ttcttctagtgacagaaccaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13389226	13389227	+	IGR	INS	-	TAATA	TAATA	rs143021169	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13389226_13389227insTAATA								TRIB2 (506370 upstream) : None (None downstream)																							gctgaatgcgttagtagtttgt	0.000													4	2	---	---	---	---	
PUM2	23369	broad.mit.edu	37	2	20508488	20508488	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20508488delT	uc002rds.1	-						PUM2_uc002rdt.1_Intron|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Intron|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTTATCACATTTTTTTCTAT	0.289													4	2	---	---	---	---	
C2orf43	60526	broad.mit.edu	37	2	21000848	21000849	+	Intron	DEL	AC	-	-	rs111544765		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21000848_21000849delAC	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744	Q9H6V9	CB043_HUMAN	hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGacacaaacacacacacac	0.252													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28315913	28315913	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28315913delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					TAAAATGTACTTTTCCCCTAT	0.264													4	2	---	---	---	---	
MEMO1	51072	broad.mit.edu	37	2	32108809	32108809	+	Intron	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32108809delC	uc002rnx.2	-						MEMO1_uc010ymu.1_Intron|MEMO1_uc010ezq.2_Intron|MEMO1_uc002rny.2_Intron|MEMO1_uc002rnz.2_Intron	NM_015955	NP_057039	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1 isoform 1						regulation of microtubule-based process	cytosol|nucleus				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					AACAAAATAGCTTAAAAGTTA	0.254													4	3	---	---	---	---	
LTBP1	4052	broad.mit.edu	37	2	33471547	33471548	+	Intron	DEL	CA	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33471547_33471548delCA	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				cacgcacacgcacacacacaca	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45099596	45099597	+	IGR	DEL	TG	-	-	rs149295213		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45099596_45099597delTG								C2orf34 (99867 upstream) : SIX3 (69440 downstream)																							CCATTTACTTtgtgtgtgtgtg	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78121832	78121833	+	IGR	INS	-	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78121832_78121833insA								LRRTM4 (372330 upstream) : SNAR-H (60200 downstream)																							AATTGTATTTTAAAAAAATCTG	0.351													4	2	---	---	---	---	
DNAH6	1768	broad.mit.edu	37	2	84775054	84775054	+	Intron	DEL	G	-	-	rs75480292		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84775054delG	uc010fgb.2	+						DNAH6_uc002soo.2_Intron|DNAH6_uc002sop.2_Intron	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						CAATAGGTTTGTTAAAATTAA	0.368													5	5	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107075910	107075910	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107075910delT	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						CACTTAAAAGTTTTTTTTAAA	0.209													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108842594	108842594	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108842594delT								SLC5A7 (212155 upstream) : SULT1C3 (21057 downstream)																							ATTGCTCAGGTTTTTTTTTTA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128957360	128957360	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128957360delA								UGGT1 (4113 upstream) : HS6ST1 (65695 downstream)																							aaattgctttaaaaaaaAAGG	0.303													6	3	---	---	---	---	
GTDC1	79712	broad.mit.edu	37	2	144808348	144808349	+	Intron	INS	-	CA	CA	rs143689340	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144808348_144808349insCA	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron|GTDC1_uc002tvt.1_Intron	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		CTTTCAGTCAGcacacacacac	0.158													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	150904522	150904526	+	IGR	DEL	AGATG	-	-	rs111567832		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150904522_150904526delAGATG								MMADHC (460192 upstream) : RND3 (420186 downstream)																							TGAACTTCCAAGATGAAAAAGGTGA	0.351													4	2	---	---	---	---	
NMI	9111	broad.mit.edu	37	2	152128436	152128436	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152128436delA	uc002txi.2	-							NM_004688	NP_004679	Q13287	NMI_HUMAN	N-myc and STAT interactor						inflammatory response|JAK-STAT cascade|transcription from RNA polymerase II promoter	cytoplasm|nucleus	nucleotide binding|protein binding|transcription cofactor activity				0				BRCA - Breast invasive adenocarcinoma(221;0.0571)		ACCAAACAATAATGAGGTTTA	0.318													22	13	---	---	---	---	
MARCH7	64844	broad.mit.edu	37	2	160570000	160570000	+	Intron	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160570000delC	uc002uax.2	+						BAZ2B_uc002uau.1_5'Flank|uc002uaw.2_5'Flank|MARCH7_uc010foq.2_Intron|MARCH7_uc010zcn.1_Intron	NM_022826	NP_073737	Q9H992	MARH7_HUMAN	axotrophin								ligase activity|zinc ion binding				0						GAGGTTTTCTCCCCCATTTTG	0.323													4	2	---	---	---	---	
FAM126B	285172	broad.mit.edu	37	2	201873462	201873462	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201873462delA	uc002uws.3	-						FAM126B_uc002uwu.2_Intron|FAM126B_uc002uwv.2_Intron|FAM126B_uc002uww.1_Intron	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172							intracellular				ovary(1)	1						tacaaaaaataaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	215593261	215593262	+	IGR	INS	-	T	T	rs33960630		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215593261_215593262insT								VWC2L (152608 upstream) : BARD1 (13 downstream)																							TGGCATTAGACTTTTTTTTTTT	0.292													3	3	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866695	224866695	+	Intron	DEL	T	-	-	rs10706128		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866695delT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ACTTTACTACttttttttttt	0.184													4	4	---	---	---	---	
SP110	3431	broad.mit.edu	37	2	231080501	231080502	+	Intron	DEL	GA	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231080501_231080502delGA	uc002vqh.3	-						SP110_uc002vqg.3_Intron|SP110_uc002vqi.3_Intron|SP110_uc010fxk.2_Intron	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		ctgtcaagtggagaagatgagc	0.000													4	2	---	---	---	---	
ATG16L1	55054	broad.mit.edu	37	2	234181379	234181379	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234181379delT	uc002vty.2	+						ATG16L1_uc002vtx.1_Intron|ATG16L1_uc002vua.2_Intron|ATG16L1_uc002vub.2_Intron|ATG16L1_uc002vtz.2_Intron|ATG16L1_uc002vud.3_Intron|SCARNA5_uc002vue.1_5'Flank	NM_030803	NP_110430	Q676U5	A16L1_HUMAN	APG16 autophagy 16-like isoform 1						autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding				0		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		AAAAGCTCACTTTTAAATTTA	0.343													4	2	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776114	234776115	+	Intron	INS	-	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776114_234776115insG	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						TACGAAtttctttctttctttc	0.243													8	5	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776125	234776126	+	Intron	INS	-	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776125_234776126insA	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						ttctttctttctttcttttttt	0.213													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241246562	241246562	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241246562delT								OTOS (166489 upstream) : GPC1 (128553 downstream)																							tagtcccagctactcgggagg	0.000													4	3	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188203	10188205	+	In_Frame_Del	DEL	CTT	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188203_10188205delCTT	uc003bvc.2	+	2	559_561	c.346_348delCTT	c.(346-348)CTTdel	p.L116del	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	116	Involved in binding to CCT complex.		L -> V (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(3)|p.L116V(1)|p.W117fs*14(1)|p.W117fs*40(1)|p.W117fs*42(1)|p.L116fs*43(1)|p.H115fs*41(1)|p.H115fs*42(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GATAGGTCACCTTTGGCTCTTCA	0.345		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				87	49	---	---	---	---	
NEK10	152110	broad.mit.edu	37	3	27325880	27325881	+	Intron	INS	-	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27325880_27325881insA	uc003cdt.1	-						NEK10_uc003cds.1_Intron	NM_199347	NP_955379	Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10 isoform 3								ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						ctgtctcgaagaaaaaaaaatt	0.000													4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52620525	52620525	+	Frame_Shift_Del	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52620525delA	uc003des.2	-	20	3315	c.3303delT	c.(3301-3303)TTTfs	p.F1101fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.F1101fs|PBRM1_uc003der.2_Frame_Shift_Del_p.F1069fs|PBRM1_uc003det.2_Frame_Shift_Del_p.F1116fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.F1116fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.F1101fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.F1076fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.F1076fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.F1100fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.F1013fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.F447fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1101					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTGCATTTGCAAATACAGAGG	0.438			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								172	136	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99516859	99516859	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99516859delT								COL8A1 (1701 upstream) : C3orf26 (19822 downstream)																							ATCTTGTATATTTTTGTCAAA	0.373													4	2	---	---	---	---	
POLQ	10721	broad.mit.edu	37	3	121177953	121177953	+	Intron	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121177953delC	uc003eee.3	-						POLQ_uc003eed.2_Intron	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TTACTCTTTGCCTAATAGTTA	0.403								DNA_polymerases_(catalytic_subunits)					4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131913716	131913716	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131913716delA	uc003eom.2	-							NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						atggaattccaaaatcatatt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140294410	140294410	+	IGR	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140294410delG								CLSTN2 (7493 upstream) : TRIM42 (102471 downstream)																							TGGACAGGGTGGGCAGGAGGT	0.423													4	2	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	150881496	150881496	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150881496delT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|MED12L_uc003eyn.2_Intron|MED12L_uc003eyo.2_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCCTTTCAACTTAATAATTTT	0.333													5	3	---	---	---	---	
GPR149	344758	broad.mit.edu	37	3	154147611	154147611	+	5'Flank	DEL	A	-	-	rs35893155		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154147611delA	uc003faa.2	-							NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTCAAGCATAAAAAAAAAAA	0.348													4	2	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160944639	160944639	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160944639delT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			CTAATGTACCTTTTTTTTGTG	0.294													4	2	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170372145	170372145	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170372145delT	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AAGGCGACTATTTTTTTTTTA	0.433													4	2	---	---	---	---	
SDHAP2	727956	broad.mit.edu	37	3	195400918	195400919	+	Intron	INS	-	T	T	rs138187538	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195400918_195400919insT	uc003fuw.2	+						SDHAP2_uc011btc.1_Intron|SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AGTCttttttctttttttttga	0.252													15	13	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	58909	58910	+	Intron	DEL	CA	-	-	rs138350342		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58909_58910delCA	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ACTCTCAGCCCAGTCTTCCAGT	0.342													12	7	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16540038	16540039	+	Intron	INS	-	A	A	rs145082268	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16540038_16540039insA	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc003goy.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						GTCCAACAAGCAAaaaaacaaa	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49266212	49266213	+	IGR	DEL	TC	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49266212_49266213delTC								CWH43 (202119 upstream) : None (None downstream)																							gcacagagcttctcaagctctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49553374	49553375	+	IGR	INS	-	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49553374_49553375insT								CWH43 (489281 upstream) : None (None downstream)																							CTCTCCTCTCATTTTTTTTTTG	0.262													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	68265657	68265657	+	IGR	DEL	G	-	-	rs75980594		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68265657delG								None (None upstream) : CENPC1 (72332 downstream)																							ataagttactgagaattcttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	70650958	70650958	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70650958delA								SULT1B1 (24528 upstream) : SULT1E1 (55973 downstream)																							ATTGCAAAGCAACAAGAACAT	0.418													4	2	---	---	---	---	
MTHFD2L	441024	broad.mit.edu	37	4	75167250	75167251	+	Intron	DEL	GT	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75167250_75167251delGT	uc011cbk.1	+						MTHFD2L_uc003hhu.2_Intron|uc003hhv.1_Intron	NM_001144978	NP_001138450	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase 2-like						folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)			gagtgtgagcgtgtgtgtgtgt	0.218													6	3	---	---	---	---	
TMEM150C	441027	broad.mit.edu	37	4	83484478	83484478	+	5'Flank	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83484478delT	uc003hmy.1	-						TMEM150C_uc011ccj.1_5'Flank	NM_001080506	NP_001073975	B9EJG8	T150C_HUMAN	transmembrane protein 150C							integral to membrane				ovary(1)	1						ATATTGATTCTTTTTTTTTTT	0.189													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	101220973	101220973	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101220973delT								DDIT4L (109360 upstream) : EMCN (95527 downstream)																							GCTTTTCATCTTTTTTTTTTG	0.388													4	2	---	---	---	---	
SPATA5	166378	broad.mit.edu	37	4	124218873	124218874	+	Intron	INS	-	A	A	rs35052439		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124218873_124218874insA	uc003iez.3	+							NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						gactccatctcaaaaaaaaaaa	0.188													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	160419679	160419680	+	IGR	DEL	TG	-	-	rs35279909		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160419679_160419680delTG								RAPGEF2 (138380 upstream) : None (None downstream)																							CCTTTCTCTCtgtgtgtgtgtg	0.386													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190107602	190107619	+	IGR	DEL	ATATTAAAATATAATTGT	-	-	rs60366169		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190107602_190107619delATATTAAAATATAATTGT								None (None upstream) : FRG1 (754355 downstream)																							TAGACCGGGAATATTAAAATATAATTGTACCATAAAGT	0.202													6	3	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1321591	1321591	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1321591delT	uc003jch.2	-						CLPTM1L_uc003jcg.2_Intron	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		AGCTCTTCGCTTTTTTTTTTA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1560679	1560679	+	IGR	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1560679delC								LPCAT1 (36603 upstream) : SDHAP3 (7958 downstream)																							atgcatgcagcccccagtcac	0.000													4	2	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14798600	14798601	+	Intron	INS	-	T	T	rs78753908		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14798600_14798601insT	uc003jfm.3	-							NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						CGCGGTCTCtattttttttttt	0.356													5	4	---	---	---	---	
RAI14	26064	broad.mit.edu	37	5	34815050	34815050	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34815050delA	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					TTCTTCATTTAAAAAAAAAAG	0.119													5	3	---	---	---	---	
IL7R	3575	broad.mit.edu	37	5	35860711	35860711	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35860711delT	uc003jjs.2	+						IL7R_uc011coo.1_Intron|IL7R_uc011cop.1_Intron	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor						immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TTATGATGGATTTTTTTTTTC	0.318													4	4	---	---	---	---	
OSMR	9180	broad.mit.edu	37	5	38924980	38924980	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38924980delT	uc003jln.1	+						OSMR_uc011cpj.1_Intron	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor						cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					AACTTTCCTCTTTTTTTTTTC	0.284													4	2	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66196082	66196083	+	Intron	INS	-	AA	AA			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66196082_66196083insAA	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GCAAAAACATTATTTGGTTAGG	0.292													6	8	---	---	---	---	
VCAN	1462	broad.mit.edu	37	5	82779845	82779845	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82779845delA	uc003kii.3	+						VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kih.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor						cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TTTCTTTTTTAAAAAAGCAGT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98348364	98348365	+	IGR	INS	-	AGA	AGA	rs149165542	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98348364_98348365insAGA								CHD1 (86126 upstream) : None (None downstream)																							gtggccagatgaggagaaaaac	0.000													4	2	---	---	---	---	
YTHDC2	64848	broad.mit.edu	37	5	112899982	112899983	+	Intron	INS	-	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112899982_112899983insG	uc003kqn.2	+							NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		AAATATCTTCTTGCTGTTGTTA	0.228													3	3	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115803579	115803590	+	Intron	DEL	GTGGTGGTGGTG	-	-	rs10551961		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115803579_115803590delGTGGTGGTGGTG	uc010jck.2	-						SEMA6A_uc003krx.3_Intron|SEMA6A_uc003krv.3_5'UTR|SEMA6A_uc003krw.3_Intron|SEMA6A_uc010jcj.2_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		ACACGGCTTAgtggtggtggtggtggtggtgg	0.269													14	7	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121681386	121681388	+	Intron	DEL	TTG	-	-	rs113536975		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121681386_121681388delTTG	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc010jct.2_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GTCAGGGGATttgttgttgttgt	0.256													2	5	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132225028	132225028	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132225028delA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGTAAACTTTAAAAAAAAAAA	0.169													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152057658	152057659	+	Intron	DEL	AA	-	-	rs76010623		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152057658_152057659delAA	uc003luw.1	-						uc003lux.1_Intron					Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		ccaaaaccataaagtcacctga	0.000													13	10	---	---	---	---	
THG1L	54974	broad.mit.edu	37	5	157161948	157161948	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157161948delT	uc003lxd.2	+						THG1L_uc011ddu.1_Intron	NM_017872	NP_060342	Q9NWX6	THG1_HUMAN	interphase cytoplasmic foci protein 45						protein homotetramerization|tRNA modification	mitochondrion	GTP binding|metal ion binding|tRNA guanylyltransferase activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			cttatctctattttttttttt	0.040													6	4	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170345407	170345408	+	Intron	INS	-	ACACACACAC	ACACACACAC	rs146839214	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170345407_170345408insACACACACAC	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TAAACCACAGTacacacacaca	0.297			T	TRD@	ALL								5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174383243	174383244	+	IGR	INS	-	CA	CA	rs142168344	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174383243_174383244insCA								MSX2 (225342 upstream) : DRD1 (484432 downstream)																							GACAGGACAAGCACTCCGGCAA	0.480													4	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177479420	177479420	+	IGR	DEL	A	-	-	rs34713283		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177479420delA								FAM153C (3332 upstream) : N4BP3 (61136 downstream)																							GGCCTGCTTTATTTTTTTCTT	0.229													3	4	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	646317	646320	+	Intron	DEL	AGAC	-	-	rs148282285		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:646317_646320delAGAC	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		acaaaaacatagacagacagatgg	0.059													4	2	---	---	---	---	
SERPINB9	5272	broad.mit.edu	37	6	2896157	2896157	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2896157delA	uc003mug.2	-						uc003mue.2_Intron	NM_004155	NP_004146	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B, member 9						anti-apoptosis|cellular response to estrogen stimulus|immune response|mast cell mediated immunity|regulation of proteolysis	cytosol|extracellular space|nucleus	caspase inhibitor activity|protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.108)				cccatcttagaaaaaaaaaTA	0.149													9	4	---	---	---	---	
NRN1	51299	broad.mit.edu	37	6	5999153	5999153	+	3'UTR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5999153delT	uc003mwu.2	-	3					NRN1_uc003mwt.2_3'UTR	NM_016588	NP_057672	Q9NPD7	NRN1_HUMAN	neuritin precursor							anchored to membrane|plasma membrane					0	Ovarian(93;0.0816)	all_hematologic(90;0.151)		OV - Ovarian serous cystadenocarcinoma(45;0.00415)		TTCCTCTCGATTTCCGGGAGC	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	21386970	21386973	+	IGR	DEL	GAGA	-	-	rs71731827		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21386970_21386973delGAGA								CDKAL1 (154338 upstream) : SOX4 (206999 downstream)																							GAGGGGATTGGAGAGAGAAAGTAG	0.520													3	3	---	---	---	---	
KIAA0319	9856	broad.mit.edu	37	6	24576991	24576991	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24576991delA	uc011djo.1	-						KIAA0319_uc011djp.1_Intron|KIAA0319_uc003neh.1_Intron|KIAA0319_uc011djq.1_Intron|KIAA0319_uc011djr.1_Intron|KIAA0319_uc010jpt.1_Intron	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor						negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						ctatttaattaaaaaaaaaaa	0.000													6	3	---	---	---	---	
ZNF311	282890	broad.mit.edu	37	6	28967220	28967220	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28967220delA	uc003nlu.2	-						ZNF311_uc011dlk.1_Intron|ZNF311_uc003nlv.2_Intron	NM_001010877	NP_001010877	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						attaaataataaaaaaaGAAG	0.303													6	3	---	---	---	---	
SPATS1	221409	broad.mit.edu	37	6	44311616	44311616	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44311616delA	uc003oxk.2	+						SPATS1_uc003oxg.2_Intron|SPATS1_uc010jzb.2_Intron	NM_145026	NP_659463	Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1											skin(1)	1	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGAGTGCTGCAAAAAGGGGTT	0.498													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57389262	57389262	+	Intron	DEL	G	-	-	rs5876591		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57389262delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGAGGGAAAAGTTCCTCAGGT	0.284													4	2	---	---	---	---	
MED23	9439	broad.mit.edu	37	6	131948297	131948297	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131948297delT	uc003qcs.1	-						ENPP3_uc010kfn.1_5'Flank|ENPP3_uc003qcu.3_5'Flank|MED23_uc003qcq.2_Intron|MED23_uc003qct.1_Intron|MED23_uc011ecb.1_Intron	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		ATAGGGGAGGTTTTTTTTTTT	0.318													5	3	---	---	---	---	
PEX3	8504	broad.mit.edu	37	6	143798573	143798574	+	Intron	INS	-	A	A	rs150029541	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143798573_143798574insA	uc003qjl.2	+							NM_003630	NP_003621	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3						protein import into peroxisome membrane|transmembrane transport	integral to peroxisomal membrane	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		tgtagaaaagctcattaatttt	0.000													2	11	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152751018	152751020	+	Intron	DEL	TAT	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152751018_152751020delTAT	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qow.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGAGAAATGTATTTGAAATGAA	0.276										HNSCC(10;0.0054)			5	3	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	5966407	5966408	+	Intron	INS	-	A	A	rs67958518		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5966407_5966408insA	uc003sph.1	-						RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						tcgagacagacagagtttcgct	0.149													4	2	---	---	---	---	
SCIN	85477	broad.mit.edu	37	7	12688587	12688587	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12688587delT	uc003ssn.3	+						SCIN_uc010ktt.2_Intron|SCIN_uc003sso.3_Intron	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1						actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		gattatgtaattttttatata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	42535290	42535290	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42535290delT								GLI3 (258672 upstream) : C7orf25 (413584 downstream)																							tgtcattctcttttttttctc	0.025													4	2	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48353580	48353581	+	Intron	INS	-	TG	TG	rs71865389		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48353580_48353581insTG	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc003tos.1_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						gtgtgtgtgtatgtgtgtgtgt	0.277													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61824012	61824012	+	IGR	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61824012delG								None (None upstream) : LOC643955 (927660 downstream)																							GGAGAGAAAAGGACCTGTGTT	0.204													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75804673	75804673	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75804673delA								MDH2 (108745 upstream) : SRRM3 (26543 downstream)																							atctcgaaccaaaaaaaaaag	0.234													4	2	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48799931	48799931	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48799931delT	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TATTCCGTTCTTTTTTTTTTT	0.323								NHEJ					8	4	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131093835	131093836	+	Intron	INS	-	A	A	rs148122017	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131093835_131093836insA	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GGGCAGGGCTGAAAAAAAACTA	0.510													3	3	---	---	---	---	
KIAA2026	158358	broad.mit.edu	37	9	5988755	5988755	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5988755delA	uc003zjq.3	-							NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358											ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCCCTGCATTAAAAAAAAAAA	0.299													7	6	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395917	33395917	+	Intron	DEL	C	-	-	rs33962618		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395917delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'Flank|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		agtagatgtgcaataagtatt	0.085													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38380505	38380505	+	IGR	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38380505delC								SHB (311295 upstream) : ALDH1B1 (12197 downstream)																							gtctcagtatccccacctgta	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67912095	67912095	+	IGR	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67912095delG								FAM27B (117906 upstream) : None (None downstream)																							caatggttttgtttttaaaag	0.149													4	2	---	---	---	---	
OGN	4969	broad.mit.edu	37	9	95147593	95147593	+	3'UTR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95147593delA	uc004asa.2	-	7					CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|OGN_uc004asb.2_3'UTR|OGN_uc011ltx.1_3'UTR	NM_014057	NP_054776	P20774	MIME_HUMAN	osteoglycin preproprotein							extracellular space|proteinaceous extracellular matrix	growth factor activity				0						CATCATTAGTAATAGGAATAA	0.308													4	2	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127288844	127288844	+	Intron	DEL	A	-	-	rs111378093		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127288844delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						CAGTTTGAAGAAAAAAAAAAA	0.418													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	128172013	128172014	+	IGR	DEL	CA	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128172013_128172014delCA								GAPVD1 (44724 upstream) : MAPKAP1 (27660 downstream)																							caccatacaccacacacacacc	0.064													4	2	---	---	---	---	
ZNF33B	7582	broad.mit.edu	37	10	43136511	43136512	+	5'Flank	INS	-	A	A	rs139714440	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43136511_43136512insA	uc001jaf.1	-						ZNF33B_uc009xmg.1_5'Flank|ZNF33B_uc001jae.1_5'Flank|ZNF33B_uc001jag.1_5'Flank	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						gcaaaggcgggaaggttgttta	0.000													1	5	---	---	---	---	
ZNF32	7580	broad.mit.edu	37	10	44141116	44141116	+	Intron	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44141116delC	uc001jbb.2	-						uc001jba.2_Intron|ZNF32_uc001jbc.2_Intron	NM_001005368	NP_001005368	P17041	ZNF32_HUMAN	zinc finger protein 32						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		CAGATATTGACTTTTTTTTTT	0.299													4	2	---	---	---	---	
KIF11	3832	broad.mit.edu	37	10	94392827	94392828	+	Intron	INS	-	G	G	rs78401816		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94392827_94392828insG	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						CAACTTTTTTTGGGGGGGGCAT	0.351													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	96790999	96790999	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96790999delT								CYP2C9 (41852 upstream) : CYP2C8 (5531 downstream)																							ccttcagtgatttttttttta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	107418977	107418977	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107418977delA								SORCS3 (393984 upstream) : SORCS1 (914445 downstream)																							tagactgttcaaatctgtaaa	0.224													4	2	---	---	---	---	
SIGIRR	59307	broad.mit.edu	37	11	414531	414532	+	Intron	DEL	CC	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:414531_414532delCC	uc001lpd.2	-						SIGIRR_uc001lpf.2_Intron|SIGIRR_uc001lpe.1_Intron	NM_001135054	NP_001128526	Q6IA17	SIGIR_HUMAN	single Ig IL-1R-related molecule						acute-phase response|innate immune response|negative regulation of chemokine biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity	integral to membrane	protein binding|transmembrane receptor activity				0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACCACACACACCTCCCATTACC	0.545													4	2	---	---	---	---	
RNH1	6050	broad.mit.edu	37	11	496051	496051	+	Intron	DEL	C	-	-	rs71462085		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:496051delC	uc001lpk.1	-						RNH1_uc001lpl.1_Intron|RNH1_uc001lpm.1_Intron|RNH1_uc001lpn.1_Intron|RNH1_uc001lpo.1_Intron|RNH1_uc009ybw.1_Intron|RNH1_uc001lpp.1_Intron|RNH1_uc001lpt.1_Intron|RNH1_uc001lpq.1_Intron|RNH1_uc001lpr.1_Intron|RNH1_uc001lps.1_Intron	NM_203389	NP_976323	P13489	RINI_HUMAN	ribonuclease/angiogenin inhibitor						mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity				0		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		cacaagacatcaggacaggct	0.000													3	5	---	---	---	---	
HBE1	3046	broad.mit.edu	37	11	5292071	5292071	+	5'Flank	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5292071delT	uc001mal.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTAGTGTCCTTTTTTTTTTC	0.343													5	3	---	---	---	---	
DNHD1	144132	broad.mit.edu	37	11	6550533	6550533	+	Intron	DEL	A	-	-	rs71470015		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6550533delA	uc001mdw.3	+							NM_144666	NP_653267	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 1						microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGCTCACTGCAAAGGCCGGCC	0.517													4	4	---	---	---	---	
TTC17	55761	broad.mit.edu	37	11	43488070	43488070	+	Intron	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43488070delC	uc001mxi.2	+						TTC17_uc010rfj.1_Intron|TTC17_uc001mxl.2_Intron	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17								binding			ovary(5)	5						ACAATAAAGACAAAGGATTTG	0.428													4	2	---	---	---	---	
C11orf70	85016	broad.mit.edu	37	11	101943065	101943065	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101943065delT	uc001pgp.2	+						C11orf70_uc001pgo.2_Intron|C11orf70_uc001pgq.2_Intron	NM_032930	NP_116319	Q9BRQ4	CK070_HUMAN	hypothetical protein LOC85016											skin(1)	1	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		tgtttggtgctttttaatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	103731003	103731003	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103731003delA								DYNC2H1 (380412 upstream) : PDGFD (46912 downstream)																							AACGTTACTTAAACTGTATGT	0.338													4	2	---	---	---	---	
CD3G	917	broad.mit.edu	37	11	118221975	118221975	+	Intron	DEL	A	-	-	rs140190149		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118221975delA	uc001psu.2	+						CD3G_uc009zaa.1_Intron	NM_000073	NP_000064	P09693	CD3G_HUMAN	CD3G antigen, gamma polypeptide precursor						establishment or maintenance of cell polarity|protein complex assembly|protein transport|regulation of apoptosis|T cell activation|T cell costimulation|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	protein heterodimerization activity|receptor signaling complex scaffold activity|T cell receptor binding|transmembrane receptor activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		catacagctcaaaaaaaaaat	0.025													4	2	---	---	---	---	
DYRK4	8798	broad.mit.edu	37	12	4711043	4711046	+	Intron	DEL	TGTG	-	-	rs138761457		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4711043_4711046delTGTG	uc001qmx.2	+						DYRK4_uc009zeh.1_Intron|DYRK4_uc001qmy.1_Intron|DYRK4_uc001qmz.1_5'Flank	NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation							Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			CTGTAGGGTTtgtgtgtgtgtgtg	0.221													3	3	---	---	---	---	
CLEC6A	93978	broad.mit.edu	37	12	8608460	8608461	+	5'Flank	INS	-	AT	AT	rs36184247		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8608460_8608461insAT	uc001qum.1	+							NM_001007033	NP_001007034	Q6EIG7	CLC6A_HUMAN	dectin-2						defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding			breast(1)	1	Lung SC(5;0.184)					AATGGTTTTCAATGTTTCTCAA	0.322													7	6	---	---	---	---	
LOC642846	642846	broad.mit.edu	37	12	9465424	9465425	+	Intron	INS	-	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9465424_9465425insG	uc010sgp.1	+							NR_024374				Homo sapiens cDNA FLJ60280 complete cds, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-).												0						AATGTGCTGTAGGGGAGGCAGG	0.594													4	2	---	---	---	---	
MGP	4256	broad.mit.edu	37	12	15035612	15035612	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15035612delA	uc001rcn.1	-							NM_000900	NP_000891	P08493	MGP_HUMAN	matrix Gla protein precursor						cartilage condensation|cell differentiation|ossification|regulation of bone mineralization	proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent|structural constituent of bone			ovary(1)	1						CCAACCAACCAAAAAAAAAAC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32101808	32101808	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32101808delA								H3F3C (156633 upstream) : C12orf35 (10545 downstream)																							TGACAACTAGAAAAAAAAAAA	0.194													5	3	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32520461	32520461	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32520461delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ATTCAAGAAGAAAAAAAAAAA	0.343													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	48566450	48566450	+	IGR	DEL	T	-	-	rs67037631		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48566450delT								ASB8 (15073 upstream) : C12orf68 (10916 downstream)																							GATGGAAttcttttttttttt	0.134													2	4	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62919264	62919264	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62919264delA	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srf.2_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TCTTCATTTTAAAAGAACCTT	0.353													4	2	---	---	---	---	
BEST3	144453	broad.mit.edu	37	12	70044665	70044665	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70044665delA	uc001svd.1	-						BEST3_uc001sve.1_Intron	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform							chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			ATATGAAAGGAAAAAAAAACC	0.343													4	2	---	---	---	---	
CNOT2	4848	broad.mit.edu	37	12	70731597	70731597	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70731597delT	uc001svv.2	+						CNOT2_uc009zro.2_Intron|CNOT2_uc009zrp.2_Intron|CNOT2_uc009zrq.2_Intron|CNOT2_uc001svw.1_Intron	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TGTGTTTTTCTTGAGTAAGTT	0.328													4	2	---	---	---	---	
TMTC2	160335	broad.mit.edu	37	12	83488998	83488998	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83488998delT	uc001szt.2	+						TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						aatttcatggttttttttttt	0.040													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114165298	114165298	+	IGR	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114165298delG								LHX5 (255421 upstream) : RBM19 (89245 downstream)																							tgaggaacatgggctctggac	0.080													4	2	---	---	---	---	
FBXO21	23014	broad.mit.edu	37	12	117612801	117612801	+	Intron	DEL	A	-	-	rs138433024		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117612801delA	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		CTTTAACTTTAAAAAAAAAAA	0.363													6	3	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	131181074	131181074	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131181074delA	uc001uim.2	-									O15034	RIMB2_HUMAN	RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		aggttgttttaaaaagcagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28690544	28690545	+	IGR	INS	-	A	A	rs146093418	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28690544_28690545insA								FLT3 (15815 upstream) : PAN3 (22098 downstream)																							AATACCCGTCCAATCGTCTACC	0.416													1	6	---	---	---	---	
NUFIP1	26747	broad.mit.edu	37	13	45546047	45546047	+	Intron	DEL	T	-	-	rs75685539		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45546047delT	uc001uzp.2	-							NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein						box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		CCTGGATTTATTTTTTTTTTA	0.478													3	4	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74557085	74557085	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74557085delT	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		TCTTTAACACTTTTTTTCCAA	0.284													4	2	---	---	---	---	
FGF14	2259	broad.mit.edu	37	13	102543276	102543276	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102543276delT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCAAGAGCCTTTTTTTTTTC	0.458													4	2	---	---	---	---	
ARHGEF7	8874	broad.mit.edu	37	13	111877426	111877426	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111877426delT	uc001vrs.2	+						ARHGEF7_uc001vrr.2_Intron|ARHGEF7_uc001vrt.2_Intron|ARHGEF7_uc010tjn.1_Intron|ARHGEF7_uc001vru.1_Intron|ARHGEF7_uc001vrv.3_Intron|ARHGEF7_uc001vrw.3_Intron|ARHGEF7_uc001vrx.3_Intron|ARHGEF7_uc010tjo.1_Intron	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c						apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			AAAGTGAATATTTTCCTAGAT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20529340	20529341	+	IGR	DEL	AT	-	-	rs146303872		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20529340_20529341delAT								OR4L1 (198 upstream) : OR4K17 (56225 downstream)																							aaaaatagacataaataaacat	0.134													2	5	---	---	---	---	
MAP4K5	11183	broad.mit.edu	37	14	50922988	50922988	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50922988delT	uc001wya.2	-						MAP4K5_uc001wyb.2_Intron|MAP4K5_uc010anv.1_Intron	NM_006575	NP_006566	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(1)	1	all_epithelial(31;0.000415)|Breast(41;0.0102)					taattttctcttttttttctt	0.070													4	3	---	---	---	---	
KTN1	3895	broad.mit.edu	37	14	56085631	56085631	+	Intron	DEL	T	-	-	rs34967000		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56085631delT	uc001xcb.2	+						KTN1_uc001xce.2_Intron|KTN1_uc001xcc.2_Intron|KTN1_uc001xcd.2_Intron|KTN1_uc010trb.1_Intron|KTN1_uc001xcf.1_Intron	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a						microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						ACCTAAGTGATTTTTTTTTAA	0.299			T	RET	papillary thryoid								5	4	---	---	---	---	
PRKCH	5583	broad.mit.edu	37	14	61858314	61858315	+	Intron	INS	-	TACTT	TACTT	rs141143597	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61858314_61858315insTACTT	uc001xfn.2	+						PRKCH_uc010tsa.1_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTGTGGAACTCTACGTCTTTGG	0.361													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62381337	62381338	+	IGR	INS	-	G	G	rs141397731	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62381337_62381338insG								SNAPC1 (118192 upstream) : SYT16 (72465 downstream)																							ccaaaaaccttggggttatctt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	83845649	83845649	+	IGR	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83845649delC								None (None upstream) : None (None downstream)																							CAGCTTCTCACCCATGTCCTA	0.398													4	2	---	---	---	---	
SMEK1	55671	broad.mit.edu	37	14	91925455	91925455	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91925455delT	uc001xzn.2	-						SMEK1_uc001xzm.2_Intron|SMEK1_uc001xzo.2_Intron|SMEK1_uc010atz.2_Intron	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		AAAGCAAAAAttttttttttc	0.030													5	3	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176586	92176586	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176586delA	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TATTTGGGTTAAAAAAAAAGA	0.313													4	2	---	---	---	---	
UBE3A	7337	broad.mit.edu	37	15	25650315	25650319	+	Intron	DEL	AACTC	-	-	rs138698137		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25650315_25650319delAACTC	uc001zaq.2	-						UBE3A_uc001zar.2_Intron|UBE3A_uc001zas.2_Intron|UBE3A_uc001zat.2_Intron	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2						brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		GAGACTGTTAAACTCAACTCTTTCC	0.224													5	6	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40325257	40325258	+	Intron	INS	-	T	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40325257_40325258insT	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron|EIF2AK4_uc001zko.1_Intron|EIF2AK4_uc010bbk.1_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		AAAAACacatatactgctttta	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	58674007	58674007	+	IGR	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58674007delG								ALDH1A2 (102545 upstream) : LIPC (28768 downstream)																							atggaaataaggaaagtgcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	61563354	61563355	+	IGR	DEL	AA	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61563354_61563355delAA								RORA (41852 upstream) : VPS13C (581237 downstream)																							AGTTTTTTTTAAAGAACCAAGA	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62607996	62607996	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62607996delT								C2CD4B (150514 upstream) : MGC15885 (321375 downstream)																							CAAATGAGGGTTTTTTTTTAA	0.274													4	2	---	---	---	---	
TLE3	7090	broad.mit.edu	37	15	70386691	70386691	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70386691delA	uc002asm.2	-						TLE3_uc002ask.2_Intron|TLE3_uc002asl.2_Intron|TLE3_uc010ukd.1_Intron|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Intron|TLE3_uc002asn.2_Intron|TLE3_uc002asp.2_Intron|TLE3_uc002aso.2_Intron	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a						organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						CAACATGTCTAAAAAAAAATC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76079339	76079339	+	5'Flank	DEL	A	-	-	rs77222978		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76079339delA	uc002bbb.1	-						uc002bbc.1_5'Flank					DQ577530																		TCAAGAAATTAAAAAAAAAAA	0.388													6	6	---	---	---	---	
SCAPER	49855	broad.mit.edu	37	15	77025927	77025928	+	Intron	INS	-	A	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77025927_77025928insA	uc002bby.2	-						SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron|SCAPER_uc002bca.1_Intron|SCAPER_uc002bcb.1_Intron	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						ccatctctactaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84831732	84831732	+	IGR	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84831732delA								ADAMTSL3 (123141 upstream) : LOC388152 (35868 downstream)																							acagttaactaaaaaaaaacc	0.000													4	3	---	---	---	---	
NTRK3	4916	broad.mit.edu	37	15	88455853	88455854	+	Intron	DEL	CT	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88455853_88455854delCT	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			gggacatctgctctctctctct	0.025			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			4	2	---	---	---	---	
FANCI	55215	broad.mit.edu	37	15	89816983	89816985	+	Intron	DEL	GGA	-	-	rs35917409		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89816983_89816985delGGA	uc010bnp.1	+						FANCI_uc002bnm.1_Intron|FANCI_uc002bnn.1_Intron|FANCI_uc002bnp.1_Intron	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I isoform						cell cycle|DNA repair	nucleoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					AGCCCCAGTTGGAGGAAGGGACA	0.404								Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89958914	89958914	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89958914delT								LOC254559 (17196 upstream) : RHCG (55724 downstream)																							GTTTGCATACTTTTTTTTTAA	0.433													4	2	---	---	---	---	
CHD2	1106	broad.mit.edu	37	15	93545255	93545257	+	Intron	DEL	CTT	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93545255_93545257delCTT	uc002bsp.2	+						CHD2_uc002bso.1_Intron	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAAGTTTAGACTTCTCTGAGTCC	0.236													23	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98782056	98782057	+	IGR	INS	-	T	T	rs141132730	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98782056_98782057insT								ARRDC4 (264989 upstream) : FAM169B (198334 downstream)																							gaaagtcctgatctcatcgttt	0.218													4	4	---	---	---	---	
NLRC3	197358	broad.mit.edu	37	16	3601981	3601982	+	Intron	INS	-	CACC	CACC	rs144315468	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3601981_3601982insCACC	uc010btn.2	-						NLRC3_uc010bto.1_Intron	NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein						I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						atcccttcattcatccatccat	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5878696	5878696	+	IGR	DEL	G	-	-	rs7201801	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5878696delG								FAM86A (730907 upstream) : A2BP1 (190436 downstream)																							ctccAAaaaagaaaagaaaag	0.199													4	3	---	---	---	---	
LOC81691	81691	broad.mit.edu	37	16	20856755	20856755	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20856755delT	uc002dhv.2	+						ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Intron|LOC81691_uc002dhw.2_Intron|LOC81691_uc002dhy.3_Intron	NM_030941	NP_112203	Q96IC2	REXON_HUMAN	exonuclease NEF-sp isoform 1							nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2						CTAAACTTAGTTTTTTAGTCT	0.458													4	2	---	---	---	---	
ZNF267	10308	broad.mit.edu	37	16	31896214	31896214	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31896214delT	uc002ecs.3	+							NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						TAAAATCCAATTTTTTTTGTT	0.169													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33976952	33976953	+	IGR	DEL	AC	-	-	rs145169111		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33976952_33976953delAC								MIR1826 (11360 upstream) : UBE2MP1 (426849 downstream)																							taaaaactagacagaggcattc	0.000													4	2	---	---	---	---	
SIAH1	6477	broad.mit.edu	37	16	48395279	48395279	+	3'UTR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48395279delT	uc002efo.1	-	2					uc002efk.1_Intron|SIAH1_uc002efl.2_Intron|SIAH1_uc002efn.1_3'UTR	NM_003031	NP_003022	Q8IUQ4	SIAH1_HUMAN	seven in absentia homolog 1 isoform a						axon guidance|cell cycle|neuron apoptosis|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	beta-catenin destruction complex|cytosol|nucleus	protein C-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				TATACATATATTTTTTCAGTG	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88195320	88195321	+	IGR	INS	-	A	A	rs7201322	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88195320_88195321insA								BANP (84397 upstream) : ZNF469 (298558 downstream)																							tttgtaaggggaaaaaaaaagc	0.000													4	2	---	---	---	---	
ZNF276	92822	broad.mit.edu	37	16	89807045	89807046	+	3'UTR	DEL	AA	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89807045_89807046delAA	uc002fos.3	+	11					ZNF276_uc010ciq.2_3'UTR|ZNF276_uc002foq.3_3'UTR|ZNF276_uc010cir.2_RNA|ZNF276_uc002for.3_3'UTR|ZNF276_uc010cis.2_3'UTR|ZNF276_uc002fot.3_RNA|ZNF276_uc010vpm.1_3'UTR|FANCA_uc002fou.1_Intron|FANCA_uc010vpn.1_Intron|FANCA_uc010vpo.1_Intron	NM_001113525	NP_001106997	Q8N554	ZN276_HUMAN	zinc finger protein 276 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		cccccatctcaaaaaaaaaaaa	0.238													4	2	---	---	---	---	
GABARAP	11337	broad.mit.edu	37	17	7145230	7145233	+	Intron	DEL	AATC	-	-	rs75210172		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7145230_7145233delAATC	uc002gfb.2	-						PHF23_uc002gfa.2_5'Flank|PHF23_uc010vtt.1_5'Flank|PHF23_uc010cma.2_5'Flank	NM_007278	NP_009209	O95166	GBRAP_HUMAN	GABA(A) receptor-associated protein						protein targeting|synaptic transmission	autophagic vacuole membrane|Golgi membrane|microtubule|plasma membrane	beta-tubulin binding|GABA receptor binding				0						CAACTATCTTAATCAGACGGAGGT	0.480													8	5	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21216528	21216528	+	Intron	DEL	G	-	-	rs5819746		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21216528delG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GAGCATTGCAGCCCCATTTTG	0.463													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21565001	21565001	+	IGR	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21565001delC								C17orf51 (87270 upstream) : FAM27L (260369 downstream)																							tttccccttgcccttttataa	0.000													4	2	---	---	---	---	
KSR1	8844	broad.mit.edu	37	17	25938896	25938896	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25938896delT	uc010crg.2	+						KSR1_uc002gzm.2_Intron|KSR1_uc002gzn.2_Intron	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras						Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CCTTTCAGTCTTTTTTTTTTC	0.328													6	3	---	---	---	---	
ITGA2B	3674	broad.mit.edu	37	17	42453970	42453970	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42453970delT	uc002igt.1	-						ITGA2B_uc002igu.1_Intron	NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein						axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)	TTCAAAGACCttttttttttt	0.239													4	4	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49353502	49353503	+	Intron	DEL	AG	-	-	rs146867897		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49353502_49353503delAG	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			CAGAAGTGACAGAGTTCATTTA	0.406													6	7	---	---	---	---	
TEX2	55852	broad.mit.edu	37	17	62271891	62271891	+	Intron	DEL	T	-	-	rs11352763		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62271891delT	uc002jec.2	-						TEX2_uc002jed.2_Intron|TEX2_uc002jee.2_Intron	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2						signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TACCGCAGAATCACCACACAT	0.279													6	5	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77310730	77310731	+	Intron	INS	-	T	T	rs140905387	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77310730_77310731insT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			taaaaggaacgtatcagaaaca	0.000													6	10	---	---	---	---	
MIB1	57534	broad.mit.edu	37	18	19433474	19433475	+	Intron	INS	-	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19433474_19433475insG	uc002ktq.2	+						MIB1_uc002ktp.2_Intron	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1						Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			TTTGAAAAATAAATGTTGAAAC	0.356													7	4	---	---	---	---	
KIAA1012	22878	broad.mit.edu	37	18	29454189	29454189	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29454189delT	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron|KIAA1012_uc002kxe.2_3'UTR	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						CTGTGGAATCTTTTTTTTTTT	0.328													4	2	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43528825	43528825	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43528825delA	uc002lbm.2	-						KIAA1632_uc002lbo.1_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						AAACAAAAACAAAAAAAATCC	0.388													4	2	---	---	---	---	
MALT1	10892	broad.mit.edu	37	18	56401284	56401284	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56401284delT	uc002lhm.1	+						MALT1_uc002lhn.1_Intron	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma						activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						AGATTTACTATTTTTTTGCTT	0.393			T	BIRC3	MALT								4	2	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7513558	7513558	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7513558delA	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_Intron	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				aaaaaaatacaaaaaaaaaaa	0.244													4	3	---	---	---	---	
ZNF709	163051	broad.mit.edu	37	19	12595378	12595379	+	Intron	INS	-	G	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12595378_12595379insG	uc002mtv.3	-						ZNF709_uc002mtw.3_Intron|ZNF709_uc002mtx.3_Intron	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGACAACGGCGGGGAGGCCTG	0.698													3	3	---	---	---	---	
AP1M1	8907	broad.mit.edu	37	19	16317073	16317074	+	Intron	DEL	GG	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16317073_16317074delGG	uc002ndu.2	+						AP1M1_uc002ndv.2_Intron|AP1M1_uc010xpd.1_Intron	NM_032493	NP_115882	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit						cellular membrane organization|endosome to melanosome transport|interspecies interaction between organisms|intracellular protein transport|melanosome organization|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(3)|breast(1)	4						GTGAGGGTTAGGGGGTCCCTCC	0.584													16	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24013910	24013910	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24013910delT								RPSAP58 (2993 upstream) : ZNF254 (202337 downstream)																							GCTCTACCACTTTTTTTTTTG	0.378													4	2	---	---	---	---	
ADCK4	79934	broad.mit.edu	37	19	41219782	41219783	+	Intron	DEL	AA	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41219782_41219783delAA	uc002oor.2	-						ADCK4_uc002ooq.1_Intron|ADCK4_uc002oos.2_Intron	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a							integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			actctgtctcaaaaaaaaaaaa	0.173													6	3	---	---	---	---	
RTN2	6253	broad.mit.edu	37	19	45992401	45992401	+	Intron	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45992401delG	uc002pcb.2	-						RTN2_uc002pcc.2_Intron|RTN2_uc002pcd.2_Intron	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A							integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		gctggggtcagggtcagggtc	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	1235306	1235306	+	IGR	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1235306delT								RAD21L1 (161 upstream) : SNPH (11654 downstream)																							TTCTGTTTTGTTTTtttttgt	0.169													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26208693	26208694	+	IGR	INS	-	T	T	rs144075905		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26208693_26208694insT								MIR663 (19779 upstream) : None (None downstream)																							TTCTTATACCATTTTTATAAGT	0.342													3	5	---	---	---	---	
MYLK2	85366	broad.mit.edu	37	20	30414936	30414936	+	Intron	DEL	G	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30414936delG	uc002wwq.2	+						MYLK2_uc002wws.2_Intron	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase						cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			aagagagagagggggggaaaa	0.114													4	3	---	---	---	---	
DHX35	60625	broad.mit.edu	37	20	37631822	37631822	+	Intron	DEL	C	-	-	rs73622053		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37631822delC	uc002xjh.2	+						DHX35_uc010zwa.1_Intron|DHX35_uc010zwb.1_Intron|DHX35_uc010zwc.1_Intron	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35							catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				AGGTCCATGTCCTGCACACAT	0.388													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10705685	10705685	+	IGR	DEL	C	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10705685delC								None (None upstream) : TPTE (201058 downstream)																							cacaaaaaaactagacagaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10757223	10757223	+	IGR	DEL	G	-	-	rs111801808		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10757223delG								None (None upstream) : TPTE (149520 downstream)																							tttctaacatgggccacaagg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10875237	10875238	+	IGR	DEL	TT	-	-	rs75885645		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10875237_10875238delTT								None (None upstream) : TPTE (31505 downstream)																							TGCTGATTTCttttttttttta	0.193													5	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11060026	11060026	+	Intron	DEL	G	-	-	rs146956675		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11060026delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGAAACACAGAAAAAATATT	0.259													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11062343	11062344	+	Intron	INS	-	AG	AG	rs148978863		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11062343_11062344insAG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGTAAAAGACAGCAACTTTCA	0.208													4	2	---	---	---	---	
TTC3	7267	broad.mit.edu	37	21	38467437	38467438	+	Intron	INS	-	TGTGTGTGTGTGTG	TGTGTGTGTGTGTG	rs34140397	by1000genomes	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38467437_38467438insTGTGTGTGTGTGTG	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc011aed.1_Intron|TTC3_uc010gne.1_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				ctctaaaaaTAtgtgtgtgtgt	0.064													5	4	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45674711	45674713	+	Intron	DEL	TTG	-	-	rs137985892		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45674711_45674713delTTG	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		CTGTATAtttttgttgttgttgt	0.271													5	4	---	---	---	---	
APOBEC3G	60489	broad.mit.edu	37	22	39474726	39474726	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39474726delT	uc003awx.2	+						APOBEC3G_uc003awy.2_5'Flank	NM_021822	NP_068594	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2	Melanoma(58;0.04)					tctctctctctttttttttga	0.199													4	2	---	---	---	---	
PPEF1	5475	broad.mit.edu	37	X	18841807	18841807	+	Intron	DEL	A	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18841807delA	uc004cyq.2	+						PPEF1_uc004cyp.2_Intron|PPEF1_uc004cyr.2_Intron|PPEF1_uc004cys.2_Intron|PPEF1_uc011mja.1_Intron|PPEF1_uc011mjb.1_Intron	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding						detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					AAAAAAAAGGAAAAAAAAAAT	0.249													4	2	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133528164	133528164	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133528164delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCTGAACttcttttttttttt	0.139													7	5	---	---	---	---	
GPR112	139378	broad.mit.edu	37	X	135433831	135433831	+	Intron	DEL	T	-	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135433831delT	uc004ezu.1	+						GPR112_uc010nsb.1_Intron|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AGCTAAGTAGTTTTTTTTTTT	0.249													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59021805	59021806	+	IGR	DEL	TA	-	-	rs150313998		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59021805_59021806delTA								None (None upstream) : None (None downstream)																							gactgaaaactatgagcaaaat	0.104													8	5	---	---	---	---	
