Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL2	114819	broad.mit.edu	37	1	16803474	16803474	+	5'UTR	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16803474C>T	uc001ayr.3	-	1					CROCCL2_uc001ayt.2_RNA					Homo sapiens mRNA for KIAA1922 protein, partial cds.												0						CAGCATGTCCCGTTGCAGTGT	0.647													3	19	---	---	---	---	PASS
ZCCHC17	51538	broad.mit.edu	37	1	31782970	31782970	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31782970A>G	uc001bsp.1	+	2	161	c.25A>G	c.(25-27)ATG>GTG	p.M9V	ZCCHC17_uc001bsq.1_5'UTR|ZCCHC17_uc010ogf.1_Intron|ZCCHC17_uc009vtu.1_Intron|ZCCHC17_uc001bsr.1_Missense_Mutation_p.M9V|ZCCHC17_uc009vtv.1_Intron	NM_016505	NP_057589	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	9						nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		GCCTGAGACCATGGAAAACTT	0.368													40	122	---	---	---	---	PASS
TSSK3	81629	broad.mit.edu	37	1	32828550	32828550	+	Intron	SNP	G	C	C	rs139565977	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32828550G>C	uc001bvf.2	+						uc001bve.1_RNA	NM_052841	NP_443073	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3						cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				CCCTGCTCCCGCTGGCCTGGA	0.607													18	49	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55534571	55534571	+	3'UTR	SNP	C	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55534571C>G	uc001cyg.3	-	65						NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						AAAATGCTTTCCTTGAGAAAT	0.507													3	6	---	---	---	---	PASS
SARS	6301	broad.mit.edu	37	1	109778745	109778745	+	Intron	SNP	C	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109778745C>G	uc001dwu.1	+						SARS_uc001dwt.1_Silent_p.L372L|SARS_uc001dwv.1_Intron|SARS_uc001dww.1_Intron|SARS_uc001dwx.1_Intron|SARS_uc009wfa.1_Intron|SARS_uc001dwy.1_Intron|SARS_uc001dwz.1_Intron	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase						seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	GACCCAGCCTCTTCTCAGCCT	0.488													3	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713407	142713407	+	Intron	SNP	C	T	T	rs142431664	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713407C>T	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		CAGTAAGAAACTCATTCTTAT	0.318													7	23	---	---	---	---	PASS
SNX27	81609	broad.mit.edu	37	1	151611585	151611585	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151611585A>G	uc001eyn.1	+	2	549	c.533A>G	c.(532-534)GAG>GGG	p.E178G	SNX27_uc001eyo.2_Missense_Mutation_p.E85G|SNX27_uc001eyp.2_5'UTR	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27	178	PX.				cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGAATGGTGAGAAGTTTGTG	0.428													27	70	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183086460	183086460	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183086460G>T	uc001gpy.3	+	9	1827	c.1570G>T	c.(1570-1572)GAT>TAT	p.D524Y		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	524	Laminin IV type A.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGCAGATGAGGATGGGTGGCG	0.473													20	50	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201047117	201047117	+	Silent	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201047117C>A	uc001gvv.2	-	11	1736	c.1509G>T	c.(1507-1509)GTG>GTT	p.V503V		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	503	Helical; Name=S3 of repeat II; (Potential).|II.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CGCTACACACCACGAAGCAGT	0.582													28	61	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222826645	222826645	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222826645A>T	uc001hnl.2	+	15	4294	c.4285A>T	c.(4285-4287)AAT>TAT	p.N1429Y	MIA3_uc009xea.1_Missense_Mutation_p.N1206Y|MIA3_uc001hnm.2_Missense_Mutation_p.N307Y	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1429	Cytoplasmic (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		TAAAGGTGGAAATGATTCAGA	0.413													8	51	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223178702	223178702	+	Silent	SNP	T	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223178702T>C	uc001hnu.1	+	8	4110	c.3963T>C	c.(3961-3963)GCT>GCC	p.A1321A		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	1321					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		CACACCAAGCTGTCGAGGGCT	0.572													25	68	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229602504	229602504	+	Splice_Site	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229602504C>A	uc001htn.2	-	16	2169	c.2077_splice	c.e16-1	p.V693_splice		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CTTGGGATACCTGAGAGAATA	0.423													11	61	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20138069	20138069	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20138069C>T	uc002rdi.2	-	19	2161	c.2053G>A	c.(2053-2055)GAT>AAT	p.D685N	WDR35_uc002rdj.2_Missense_Mutation_p.D674N|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Missense_Mutation_p.D250N|WDR35_uc002rdk.3_Missense_Mutation_p.D250N	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	685										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGATGCATCTTTAATTCCA	0.413													36	128	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25467122	25467122	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25467122T>G	uc002rgc.2	-	15	2010	c.1753A>C	c.(1753-1755)ATG>CTG	p.M585L	DNMT3A_uc002rgd.2_Missense_Mutation_p.M585L|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.M396L	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	585	PHD-type; atypical.|Interaction with the PRC2/EED-EZH2 complex (By similarity).|ADD.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCCGCACATGTAGCAGTTC	0.612			Mis|F|N|S		AML								9	17	---	---	---	---	PASS
EMILIN1	11117	broad.mit.edu	37	2	27305157	27305157	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27305157A>T	uc002rii.3	+	4	1146	c.718A>T	c.(718-720)ATC>TTC	p.I240F	EMILIN1_uc010eyq.1_Missense_Mutation_p.I240F|EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	240	Potential.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCAATGAGATCCAGCACCA	0.657													7	23	---	---	---	---	PASS
VRK2	7444	broad.mit.edu	37	2	58313465	58313465	+	Intron	SNP	T	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58313465T>A	uc002rzo.2	+						VRK2_uc010fcb.2_Intron|VRK2_uc002rzs.2_Intron|VRK2_uc002rzr.2_Intron|VRK2_uc010fcc.2_Intron|VRK2_uc002rzv.2_Intron|VRK2_uc010fcd.2_Intron|VRK2_uc002rzp.2_Intron|VRK2_uc010ypg.1_Intron|VRK2_uc002rzq.2_Intron|VRK2_uc002rzu.2_Intron|VRK2_uc002rzt.2_Intron|VRK2_uc010yph.1_5'UTR	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2							integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						AATAAATTTGTCTTTGTAGTC	0.299													46	151	---	---	---	---	PASS
ATP6V1B1	525	broad.mit.edu	37	2	71163082	71163082	+	5'UTR	SNP	T	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71163082T>G	uc002shj.2	+	1					ATP6V1B1_uc002shi.1_5'UTR|ATP6V1B1_uc010fdv.2_5'UTR|ATP6V1B1_uc010fdw.2_RNA	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1						ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						TGGGGACTGCTCCATGGCCAT	0.637													7	20	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73651718	73651718	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73651718C>A	uc002sje.1	+	6	1039	c.928C>A	c.(928-930)CAG>AAG	p.Q310K	ALMS1_uc002sjf.1_Missense_Mutation_p.Q267K	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	309					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TGTTGGGTCTCAGTGCCCTTT	0.433													13	43	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96962717	96962717	+	Missense_Mutation	SNP	C	T	T	rs144219123		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96962717C>T	uc002svu.2	-	12	1555	c.1469G>A	c.(1468-1470)CGT>CAT	p.R490H		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	490	Helicase ATP-binding 1.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						AAGGGCAGCACGGTAGAGCTT	0.507													22	46	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101654089	101654089	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101654089C>A	uc010fiv.2	-	8	1443	c.1312G>T	c.(1312-1314)GAG>TAG	p.E438*	TBC1D8_uc010yvw.1_Nonsense_Mutation_p.E453*|TBC1D8_uc002tau.3_Nonsense_Mutation_p.E195*	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	438					blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						TCACTCTCCTCGCTATTTTGA	0.537													4	135	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160813103	160813103	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160813103A>G	uc002ube.1	-	21	3147	c.2940T>C	c.(2938-2940)AGT>AGC	p.S980S	PLA2R1_uc010zcp.1_Silent_p.S980S|PLA2R1_uc002ubf.2_Silent_p.S980S	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	980	Extracellular (Potential).|C-type lectin 6.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						AGTTCTTCCAACTGCTTGGGT	0.428													39	99	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179437617	179437617	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179437617A>G	uc010zfg.1	-	275	65762	c.65538T>C	c.(65536-65538)CCT>CCC	p.P21846P	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.P15541P|TTN_uc010zfi.1_Silent_p.P15474P|TTN_uc010zfj.1_Silent_p.P15349P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22773							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGAGTTCCAGGAACAAGGG	0.488													3	56	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179476401	179476401	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179476401G>A	uc010zfg.1	-	218	43075	c.42851C>T	c.(42850-42852)CCT>CTT	p.P14284L	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P7979L|TTN_uc010zfi.1_Missense_Mutation_p.P7912L|TTN_uc010zfj.1_Missense_Mutation_p.P7787L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15211							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTGAGGGAGGACCTGAGAA	0.418													35	94	---	---	---	---	PASS
LMCD1	29995	broad.mit.edu	37	3	8607178	8607178	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8607178G>A	uc003bqq.2	+	5	898	c.784G>A	c.(784-786)GCA>ACA	p.A262T	LMCD1_uc011atd.1_Missense_Mutation_p.A189T|LMCD1_uc011ate.1_Missense_Mutation_p.A150T	NM_014583	NP_055398	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	262	LIM zinc-binding 1.				positive regulation of calcineurin-NFAT signaling pathway|regulation of cardiac muscle hypertrophy|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	transcription corepressor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(96;0.124)		CTCGGACAGGGCAGGCTACAA	0.587													4	143	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952088	178952088	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952088A>G	uc003fjk.2	+	21	3300	c.3143A>G	c.(3142-3144)CAT>CGT	p.H1048R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1048	PI3K/PI4K.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1048R(1)|p.H1048Q(1)|p.H1048T(1)|p.H1048L(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GATGCACATCATGGTGGCTGG	0.373		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			5	76	---	---	---	---	PASS
ATP11B	23200	broad.mit.edu	37	3	182583483	182583483	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182583483A>G	uc003flb.2	+	13	1697	c.1440A>G	c.(1438-1440)GAA>GAG	p.E480E	ATP11B_uc003flc.2_Silent_p.E64E	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	480	Cytoplasmic (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ATGAAACTGAACTAGTAAGta	0.313													3	56	---	---	---	---	PASS
GALNT7	51809	broad.mit.edu	37	4	174223301	174223301	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174223301G>C	uc003isz.3	+	7	1335	c.1252G>C	c.(1252-1254)GAG>CAG	p.E418Q	GALNT7_uc011ckb.1_Missense_Mutation_p.E195Q	NM_017423	NP_059119	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	418	Catalytic subdomain B.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TGAAAACTTTGAGATCTCATA	0.418													20	303	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54581166	54581166	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54581166C>T	uc003jpx.2	-	10	1431	c.1311G>A	c.(1309-1311)CAG>CAA	p.Q437Q	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	437							ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CTCCCAGGTGCTGAGCTTGCA	0.413													3	78	---	---	---	---	PASS
TBCA	6902	broad.mit.edu	37	5	76989117	76989117	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76989117C>T	uc003kfh.1	-	3	324	c.220G>A	c.(220-222)GCA>ACA	p.A74T	TBCA_uc003kfi.1_Missense_Mutation_p.A74T	NM_004607	NP_004598	O75347	TBCA_HUMAN	tubulin-specific chaperone a	74					'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway|tubulin complex assembly	cytoplasm|microtubule	chaperone binding|unfolded protein binding			ovary(1)	1		all_lung(232;0.000511)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.02e-49)|Epithelial(54;1.05e-44)|all cancers(79;4.08e-40)		TCCAAATATGCGGCTTCCAAC	0.393													4	110	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120022177	120022177	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120022177G>A	uc003ksq.2	+	2	851	c.688G>A	c.(688-690)GAG>AAG	p.E230K	PRR16_uc003ksp.2_Missense_Mutation_p.E207K|PRR16_uc003ksr.2_Missense_Mutation_p.E160K	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	230	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		AAAAAACAGGGAGGTCCACTT	0.522													4	84	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140604554	140604554	+	Missense_Mutation	SNP	C	T	T	rs150245283	byFrequency	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140604554C>T	uc003ljb.2	+	1	1477	c.1477C>T	c.(1477-1479)CCC>TCC	p.P493S	PCDHB14_uc011dal.1_Missense_Mutation_p.P340S	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	493	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCTGCCGCCCCAGGACCG	0.657													16	81	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180047687	180047687	+	Silent	SNP	G	A	A	rs139263798		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180047687G>A	uc003mma.3	-	16	2407	c.2328C>T	c.(2326-2328)ATC>ATT	p.I776I	FLT4_uc003mlz.3_Silent_p.I776I|FLT4_uc003mmb.1_Silent_p.I309I	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	776	Helical; (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CAAGGATCACGATCTCCATGC	0.602									Congenital_Hereditary_Lymphedema				6	57	---	---	---	---	PASS
DDR1	780	broad.mit.edu	37	6	30866812	30866812	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30866812C>T	uc003nrr.2	+	18	2858	c.2599C>T	c.(2599-2601)CAG>TAG	p.Q867*	DDR1_uc010jse.2_Nonsense_Mutation_p.Q830*|DDR1_uc003nrq.2_Nonsense_Mutation_p.Q830*|DDR1_uc003nrs.2_Nonsense_Mutation_p.Q867*|DDR1_uc003nrt.2_Nonsense_Mutation_p.Q830*|DDR1_uc011dms.1_Nonsense_Mutation_p.Q848*|DDR1_uc003nru.2_Nonsense_Mutation_p.Q830*|DDR1_uc003nrv.2_Nonsense_Mutation_p.Q873*|DDR1_uc003nrz.1_Nonsense_Mutation_p.Q192*	NM_013993	NP_054699	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	867	Cytoplasmic (Potential).|Protein kinase.			QLTDEQVIENAGEFFRDQGRQ -> SAHRRAGHRERGGVLP GPGPA (in Ref. 6; CAA66871).	cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)	CCAGGGCCGGCAGGTCAGAGT	0.602													8	64	---	---	---	---	PASS
KIAA0776	23376	broad.mit.edu	37	6	96997453	96997453	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96997453A>G	uc003por.2	+	14	1734	c.1686A>G	c.(1684-1686)GCA>GCG	p.A562A	KIAA0776_uc010kck.2_RNA	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376	562					negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		AGTTTTTTGCAGGTATACTTA	0.323													46	121	---	---	---	---	PASS
STL	7955	broad.mit.edu	37	6	125233608	125233608	+	RNA	SNP	T	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125233608T>C	uc003pzq.2	-	7		c.1126A>G				NR_026876				Homo sapiens mRNA; cDNA DKFZp451I132 (from clone DKFZp451I132).												0						CTTTCTTGGCTAATATGATTT	0.368			T	ETV6	B-ALL								22	59	---	---	---	---	PASS
STXBP5	134957	broad.mit.edu	37	6	147685200	147685200	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147685200C>T	uc003qlz.2	+	25	3140	c.2979C>T	c.(2977-2979)GCC>GCT	p.A993A	STXBP5_uc010khz.1_Silent_p.A957A|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Silent_p.A648A	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	993					exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TGCGGATAGCCAGAACGTTCT	0.363													75	280	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37949276	37949276	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37949276C>A	uc003tfo.3	-	5	1184	c.798G>T	c.(796-798)ATG>ATT	p.M266I		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	266	NTR.				brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						TTTCAAGAAGCATCATCCTGA	0.274													46	141	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50595978	50595978	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50595978C>T	uc003tpf.3	-	6	657	c.571G>A	c.(571-573)GCA>ACA	p.A191T	DDC_uc010kza.2_Missense_Mutation_p.A106T|DDC_uc003tpg.3_Missense_Mutation_p.A191T	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	191					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	GAGGAGTGTGCCTGGAAAGAA	0.517													4	124	---	---	---	---	PASS
LOC643955	643955	broad.mit.edu	37	7	62752443	62752443	+	3'UTR	SNP	G	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62752443G>C	uc011kdj.1	-	3						NR_003952				Homo sapiens cDNA clone IMAGE:30377995, containing frame-shift errors.												0						CTTATGTCTAGTAAGGTTTGA	0.438													4	38	---	---	---	---	PASS
ZNF680	340252	broad.mit.edu	37	7	63981785	63981785	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63981785A>G	uc003tta.2	-	4	1520	c.1347T>C	c.(1345-1347)CTT>CTC	p.L449L	ZNF680_uc010kzr.2_Silent_p.L376L	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	449	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				TATGGTTAGTAAGGGTTGAAA	0.373													18	38	---	---	---	---	PASS
TAF6	6878	broad.mit.edu	37	7	99704862	99704862	+	3'UTR	SNP	T	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99704862T>G	uc003uti.2	-	15					AP4M1_uc003utd.2_Intron|TAF6_uc003utg.2_3'UTR|TAF6_uc003uth.2_3'UTR|TAF6_uc003utk.2_3'UTR|TAF6_uc011kji.1_3'UTR|TAF6_uc003utj.2_3'UTR|TAF6_uc003utl.2_3'UTR|TAF6_uc003utm.2_3'UTR	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha						negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCTGGCAGGTGGAGCATCAC	0.602													6	17	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107763582	107763582	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107763582G>A	uc010ljo.1	-	2	112	c.28C>T	c.(28-30)CAC>TAC	p.H10Y	LAMB4_uc003vey.2_Missense_Mutation_p.H10Y	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	10					cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TCACCAAGGTGCAAAAAAAGG	0.308													22	61	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124386620	124386620	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124386620G>A	uc003vli.2	-	2	2452	c.1801C>T	c.(1801-1803)CGT>TGT	p.R601C		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	601	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						GACATTTCACGGCGTATGGTA	0.443													5	231	---	---	---	---	PASS
LUZP6	767558	broad.mit.edu	37	7	135661852	135661852	+	5'UTR	SNP	T	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135661852T>C	uc003vte.3	-	1					LUZP6_uc010lmv.2_RNA	NM_145808	NP_665807	Q538Z0	LUZP6_HUMAN	myotrophin												0						CGCACATCACTGCAGCGGGGC	0.637													7	94	---	---	---	---	PASS
SLC18A1	6570	broad.mit.edu	37	8	20038369	20038369	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20038369A>T	uc011kyq.1	-	3	578	c.107T>A	c.(106-108)ATG>AAG	p.M36K	SLC18A1_uc003wzm.2_Missense_Mutation_p.M36K|SLC18A1_uc011kyr.1_Missense_Mutation_p.M36K|SLC18A1_uc003wzn.2_Missense_Mutation_p.M36K|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Missense_Mutation_p.M36K	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	36	Helical; (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		AGTAAACAGCATGTTGTCCAG	0.572													10	17	---	---	---	---	PASS
CHRNA6	8973	broad.mit.edu	37	8	42608268	42608268	+	3'UTR	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42608268A>G	uc003xpj.2	-	6					CHRNA6_uc011lcw.1_3'UTR	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6							cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TGTGGCAGGGAATGCAGAACA	0.413													7	20	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55539331	55539331	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55539331A>T	uc003xsd.1	+	4	3037	c.2889A>T	c.(2887-2889)AAA>AAT	p.K963N	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	963					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATTCTGGAAAAATAAGTAATT	0.328													40	92	---	---	---	---	PASS
DCAF13	25879	broad.mit.edu	37	8	104444966	104444966	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104444966A>T	uc003yln.2	+	7	1515	c.1238A>T	c.(1237-1239)TAT>TTT	p.Y413F	DCAF13_uc003ylm.1_Missense_Mutation_p.Y146F|DCAF13_uc003ylo.2_Missense_Mutation_p.Y124F	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	261	WD 5.				rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						AATGAAGATTATAAGTAAGTT	0.313													37	93	---	---	---	---	PASS
ANGPT1	284	broad.mit.edu	37	8	108296831	108296831	+	Intron	SNP	T	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108296831T>A	uc003ymn.2	-						ANGPT1_uc011lhv.1_Intron|ANGPT1_uc003ymo.2_Intron|ANGPT1_uc003ymp.3_3'UTR	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TTTTCATTTCTTTTTTTCATA	0.294													11	23	---	---	---	---	PASS
DEPDC6	64798	broad.mit.edu	37	8	120886012	120886012	+	5'UTR	SNP	T	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120886012T>C	uc003yow.3	+	1					DEPDC6_uc011lid.1_5'UTR	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GAAGCGTCTGTGAGGGCAGAC	0.647													3	7	---	---	---	---	PASS
C9orf66	157983	broad.mit.edu	37	9	214612	214612	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:214612C>A	uc003zge.3	-	1	1282	c.785G>T	c.(784-786)CGG>CTG	p.R262L	DOCK8_uc011lls.1_5'Flank|DOCK8_uc003zgf.2_5'Flank	NM_152569	NP_689782	Q5T8R8	CI066_HUMAN	hypothetical protein LOC157983	262	Arg-rich.									central_nervous_system(1)	1	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		ATGGAGCTTCCGGCCTGCGCG	0.716													11	15	---	---	---	---	PASS
ZNF782	158431	broad.mit.edu	37	9	99580322	99580322	+	Silent	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99580322G>A	uc004awp.1	-	6	2264	c.1983C>T	c.(1981-1983)CTC>CTT	p.L661L	ZNF782_uc011lup.1_Silent_p.L529L	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	661	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				GATGTACTCTGAGATTGGATT	0.413													50	137	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55569221	55569221	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55569221G>T	uc010qhs.1	-	37	4999	c.4604C>A	c.(4603-4605)CCA>CAA	p.P1535Q	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qht.1_Missense_Mutation_p.P1528Q|PCDH15_uc010qhu.1_3'UTR	NM_001142769	NP_001136241	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-1 precursor	Error:Variant_position_missing_in_Q96QU1_after_alignment					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AGCTGCTGGTGGTTTTTCGAT	0.373										HNSCC(58;0.16)			14	306	---	---	---	---	PASS
PDZD8	118987	broad.mit.edu	37	10	119049791	119049791	+	Silent	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119049791C>A	uc001lde.1	-	4	1366	c.1167G>T	c.(1165-1167)GGG>GGT	p.G389G		NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	389	PDZ.				intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)		GCCCAGCATACCCATCAGTTG	0.418													18	85	---	---	---	---	PASS
CTBP2	1488	broad.mit.edu	37	10	126715926	126715926	+	Intron	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126715926G>A	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lie.3_Missense_Mutation_p.P135S	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CTGGGGACCGGCCGGCTGACT	0.647													3	53	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20124911	20124911	+	Silent	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20124911G>A	uc001mpr.3	+	33	6898	c.6537G>A	c.(6535-6537)CTG>CTA	p.L2179L	NAV2_uc001mpp.2_Silent_p.L2112L|NAV2_uc009yhx.2_Silent_p.L1240L|NAV2_uc009yhz.2_Silent_p.L821L|NAV2_uc001mpu.2_Silent_p.L614L|NAV2_uc001mpv.2_5'Flank	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	2235						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TGAGCTCTCTGGGAGAGATCT	0.542													10	110	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21135237	21135237	+	Missense_Mutation	SNP	G	A	A	rs77273497	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21135237G>A	uc001mqe.2	+	13	1556	c.1403G>A	c.(1402-1404)CGT>CAT	p.R468H	NELL1_uc001mqf.2_Missense_Mutation_p.R468H|NELL1_uc009yid.2_Missense_Mutation_p.R496H|NELL1_uc010rdo.1_Missense_Mutation_p.R411H|NELL1_uc010rdp.1_Missense_Mutation_p.R228H	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	468	EGF-like 2; calcium-binding (Potential).				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						GGATACATTCGTGTGGATGAC	0.408													6	210	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60164109	60164109	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60164109G>C	uc001npj.2	+	1	623	c.58G>C	c.(58-60)GAA>CAA	p.E20Q	MS4A14_uc001npi.2_Intron|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.E20Q|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	20						integral to membrane	receptor activity			breast(1)	1						AAAACCAAACGAAACTGTATT	0.458													11	46	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63057715	63057715	+	Silent	SNP	C	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63057715C>G	uc009yor.2	+	1	286	c.78C>G	c.(76-78)CCC>CCG	p.P26P	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_Intron|SLC22A10_uc010rmp.1_5'Flank	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	26	Helical; (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						TTATTCTTCCCTCTCTCATGT	0.458													21	75	---	---	---	---	PASS
GDPD4	220032	broad.mit.edu	37	11	76969464	76969464	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76969464A>G	uc001oyf.2	-	10	1082	c.831T>C	c.(829-831)ACT>ACC	p.T277T		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	277	GDPD.|Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						CTGCATTCAGAGTCGATAGGA	0.443													3	139	---	---	---	---	PASS
DRD2	1813	broad.mit.edu	37	11	113295088	113295088	+	Intron	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113295088C>T	uc001pnz.2	-						DRD2_uc010rwv.1_Missense_Mutation_p.V96I|DRD2_uc001poa.3_Splice_Site_p.E95_splice|DRD2_uc001pob.3_Splice_Site_p.E95_splice|DRD2_uc009yyr.1_Splice_Site_p.E95_splice	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long						activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	GGCCCACCTACCTCCAGGTAG	0.612													6	13	---	---	---	---	PASS
UPK2	7379	broad.mit.edu	37	11	118827946	118827946	+	Silent	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118827946G>A	uc001puh.2	+	3	272	c.237G>A	c.(235-237)CCG>CCA	p.P79P		NM_006760	NP_006751	O00526	UPK2_HUMAN	uroplakin 2 precursor	79					cellular membrane organization|epithelial cell differentiation|multicellular organismal development	integral to endoplasmic reticulum membrane|integral to plasma membrane				skin(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.122)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		TGGTGCCTCCGTGCCGTGGGC	0.602											OREG0021391	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	92	---	---	---	---	PASS
SLC2A14	144195	broad.mit.edu	37	12	7967026	7967026	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7967026C>A	uc001qtk.2	-	16	2242	c.1449G>T	c.(1447-1449)GAG>GAT	p.E483D	SLC2A14_uc001qtl.2_Missense_Mutation_p.E460D|SLC2A14_uc001qtm.2_Missense_Mutation_p.E460D|SLC2A14_uc010sgg.1_Missense_Mutation_p.E374D|SLC2A14_uc001qtn.2_Missense_Mutation_p.E483D|SLC2A14_uc001qto.2_Missense_Mutation_p.E118D|SLC2A14_uc010sgh.1_Missense_Mutation_p.E498D	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	483	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		GTGTGATATCCTCAAAAGTCC	0.512													11	30	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8074123	8074123	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8074123C>A	uc001qtr.2	-	10	1639	c.1377G>T	c.(1375-1377)GAG>GAT	p.E459D		NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	459	Cytoplasmic (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGTGATATCCTCAAAAGTCC	0.498													17	207	---	---	---	---	PASS
M6PR	4074	broad.mit.edu	37	12	9098098	9098098	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9098098C>A	uc001qvf.2	-	3	429	c.259G>T	c.(259-261)GGG>TGG	p.G87W		NM_002355	NP_002346	P20645	MPRD_HUMAN	cation-dependent mannose-6-phosphate receptor	87	Lumenal (Potential).				endosome to lysosome transport|receptor-mediated endocytosis	cell surface|endosome|integral to plasma membrane|lysosomal membrane	mannose binding|mannose transmembrane transporter activity|transmembrane receptor activity				0		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)		AGGCCTGCCCCAGAAGTGTGG	0.507													52	103	---	---	---	---	PASS
PYROXD1	79912	broad.mit.edu	37	12	21623298	21623298	+	3'UTR	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21623298A>T	uc001rew.2	+	12					RECQL_uc001rex.2_Intron|RECQL_uc001rey.2_Intron|PYROXD1_uc009ziq.2_3'UTR|PYROXD1_uc009zir.2_3'UTR	NM_024854	NP_079130	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			ovary(1)	1						AAAAAAAAAAAAACAAAGCAA	0.318													5	12	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	33031955	33031955	+	Nonsense_Mutation	SNP	G	A	A	rs121434420		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33031955G>A	uc001rlj.3	-	2	350	c.235C>T	c.(235-237)CGA>TGA	p.R79*	PKP2_uc001rlk.3_Nonsense_Mutation_p.R79*|PKP2_uc010skj.1_Nonsense_Mutation_p.R79*	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	79					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CTGCTGGTTCGGTGAAGATTT	0.348													3	97	---	---	---	---	PASS
PPHLN1	51535	broad.mit.edu	37	12	42748967	42748967	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42748967A>T	uc001rng.1	+	4	347	c.242A>T	c.(241-243)GAA>GTA	p.E81V	PPHLN1_uc001rmy.2_Missense_Mutation_p.E99V|PPHLN1_uc001rna.2_Missense_Mutation_p.E33V|PPHLN1_uc001rne.2_Missense_Mutation_p.E88V|PPHLN1_uc001rnb.2_Missense_Mutation_p.E88V|PPHLN1_uc001rnd.2_Missense_Mutation_p.E33V|PPHLN1_uc001rnc.2_Missense_Mutation_p.E81V|PPHLN1_uc001rnf.2_Missense_Mutation_p.E81V|PPHLN1_uc010skq.1_Missense_Mutation_p.E26V|PPHLN1_uc010skr.1_Missense_Mutation_p.E26V|PPHLN1_uc010sks.1_Missense_Mutation_p.E26V|PPHLN1_uc010skt.1_Intron|PPHLN1_uc001rni.1_Missense_Mutation_p.E26V|PPHLN1_uc001rnh.1_RNA|PPHLN1_uc010sku.1_Missense_Mutation_p.E33V	NM_016488	NP_057572	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 1	81					keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		TTACAGGATGAATCTGGTTAT	0.348													30	109	---	---	---	---	PASS
PFKM	5213	broad.mit.edu	37	12	48516579	48516579	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48516579G>C	uc001rrc.2	+	2	192	c.22G>C	c.(22-24)GCA>CCA	p.A8P	PFKM_uc001rra.1_5'UTR|PFKM_uc001rrb.1_Missense_Mutation_p.A79P|PFKM_uc001rrd.2_5'UTR|PFKM_uc001rre.1_Missense_Mutation_p.A8P|PFKM_uc001rrg.1_Missense_Mutation_p.A8P	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle	8					fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						AGAGCACCATGCAGCCAAAAC	0.488													11	65	---	---	---	---	PASS
AMHR2	269	broad.mit.edu	37	12	53819616	53819616	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53819616C>A	uc001scx.1	+	6	843	c.765C>A	c.(763-765)GAC>GAA	p.D255E	AMHR2_uc009zmy.1_Missense_Mutation_p.D255E	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform	255	Cytoplasmic (Potential).|Protein kinase.				Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	TACAGCACGACCACATTGTCC	0.587									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				16	40	---	---	---	---	PASS
IGF1	3479	broad.mit.edu	37	12	102811706	102811706	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102811706C>T	uc001tjp.3	-	4	697	c.478G>A	c.(478-480)GAA>AAA	p.E160K	IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3	160					anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						TCCTTCTGTTCCCCTCCTGGA	0.458													7	560	---	---	---	---	PASS
DGKH	160851	broad.mit.edu	37	13	42729429	42729429	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42729429C>T	uc001uyl.1	+	4	408	c.387C>T	c.(385-387)ATC>ATT	p.I129I	DGKH_uc010tfh.1_Silent_p.I129I|DGKH_uc001uym.1_Silent_p.I129I|DGKH_uc010tfi.1_5'UTR|DGKH_uc010tfj.1_5'UTR|DGKH_uc001uyn.1_RNA|DGKH_uc001uyo.1_5'UTR|DGKH_uc001uyp.2_RNA	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2	129	PH.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		CCTTTCAGATCATCACTCCAT	0.403													10	192	---	---	---	---	PASS
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115047559C>T	uc001vup.2	+	2	308	c.271C>T	c.(271-273)CTG>TTG	p.L91L	UPF3A_uc010tkn.1_Silent_p.L91L|UPF3A_uc001vuq.2_Silent_p.L91L|UPF3A_uc001vus.2_RNA|UPF3A_uc001vur.2_RNA	NM_023011	NP_075387	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A	91	Required for interaction with UPF2.				mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation	cytoplasm|nucleus|plasma membrane	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			skin(1)	1	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731													2	6	---	---	---	---	PASS
SIVA1	10572	broad.mit.edu	37	14	105225849	105225849	+	3'UTR	SNP	C	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105225849C>G	uc001yph.2	+	4					INF2_uc010tyi.1_Intron|SIVA1_uc001ypg.1_3'UTR|SIVA1_uc001ypi.2_3'UTR	NM_006427	NP_006418	O15304	SIVA_HUMAN	CD27-binding (Siva) protein isoform 1						activation of caspase activity by cytochrome c|activation-induced cell death of T cells|apoptosis|induction of apoptosis|interspecies interaction between organisms|negative regulation of anti-apoptosis|negative regulation of NF-kappaB transcription factor activity	cytoplasm|mitochondrion|nucleoplasm|nucleus	caspase activator activity|CD27 receptor binding|metal ion binding|viral receptor activity|zinc ion binding				0		all_cancers(154;0.14)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.173)		CTGCCTTCACCGGGAGCCACG	0.602													2	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	76073205	76073205	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76073205C>T	uc010umm.1	+	6	494	c.417C>T	c.(415-417)TTC>TTT	p.F139F	uc002bba.1_5'Flank					SubName: Full=cDNA FLJ59077, highly similar to Golgin subfamily A member 6;																		CCCGACACTTCGAAGGTGGGA	0.502													38	70	---	---	---	---	PASS
TMC3	342125	broad.mit.edu	37	15	81633742	81633742	+	Silent	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81633742A>G	uc002bgo.1	-	16	1833	c.1833T>C	c.(1831-1833)TTT>TTC	p.F611F	TMC3_uc010blr.1_RNA|TMC3_uc002bgp.2_Silent_p.F611F	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	611	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						TTGAGGCTCGAAATACTTGCT	0.473													3	17	---	---	---	---	PASS
RUNDC2A	84127	broad.mit.edu	37	16	12136850	12136850	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12136850G>T	uc002dbw.1	+	5	406	c.344G>T	c.(343-345)GGT>GTT	p.G115V		NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A	115	RUN.									ovary(1)	1						GTGGGCCGGGGTCGCGCCTGG	0.652			T	CIITA	PMBL|Hodgkin Lymphona|								9	28	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58622799	58622799	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58622799C>T	uc002env.2	-	3	407	c.114G>A	c.(112-114)CGG>CGA	p.R38R	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Silent_p.R38R|CNOT1_uc002enx.2_Silent_p.R38R|CNOT1_uc002enz.1_5'UTR	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	38					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAGGACCGTGCCGATTCACAA	0.373													3	35	---	---	---	---	PASS
CMTM1	113540	broad.mit.edu	37	16	66612797	66612797	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66612797A>G	uc002epi.3	+	4	526	c.403A>G	c.(403-405)AGG>GGG	p.R135G	CMTM1_uc002epb.3_RNA|CMTM1_uc002epc.3_RNA|CMTM1_uc002epd.3_RNA|CMTM1_uc002epe.3_RNA|CMTM1_uc002epf.3_RNA|CMTM1_uc002epg.3_RNA|CMTM1_uc002eph.3_3'UTR|CMTM1_uc002epl.3_Missense_Mutation_p.R88G|CMTM1_uc002epj.3_3'UTR|CMTM1_uc002epk.3_Missense_Mutation_p.R82G|CMTM1_uc002epa.3_3'UTR|CMTM1_uc002epn.3_3'UTR|CMTM1_uc002epo.3_RNA|CMTM1_uc002epp.3_RNA|CMTM1_uc002epq.3_RNA|CMTM1_uc010cds.2_RNA|CMTM1_uc002epr.3_Missense_Mutation_p.R252G|CMTM1_uc002epm.3_RNA|CMTM1_uc002eps.2_RNA|CMTM2_uc002ept.2_5'Flank|CMTM2_uc010cdu.2_5'Flank	NM_181269	NP_851786	Q8IZ96	CKLF1_HUMAN	chemokine-like factor superfamily 1 isoform 1	135	MARVEL.				chemotaxis	extracellular space|integral to membrane	cytokine activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		CACGAAGATGAGGACCAACTT	0.562													48	125	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													3	14	---	---	---	---	PASS
ZNF821	55565	broad.mit.edu	37	16	71913827	71913827	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71913827T>C	uc010vmj.1	-	2	399	c.23A>G	c.(22-24)AAT>AGT	p.N8S	ATXN1L_uc010vmi.1_Intron|ZNF821_uc002fbe.2_5'UTR|ZNF821_uc002fbf.2_Missense_Mutation_p.N8S|ZNF821_uc002fbg.3_5'UTR|ZNF821_uc002fbh.3_Missense_Mutation_p.N8S|ZNF821_uc002fbi.3_5'UTR	NM_017530	NP_060000	O75541	ZN821_HUMAN	zinc finger protein 821	8					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTTATTTGGATTTGTCTGTTT	0.468													9	538	---	---	---	---	PASS
SERPINF2	5345	broad.mit.edu	37	17	1648687	1648687	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1648687C>T	uc002ftk.1	+	4	240	c.163C>T	c.(163-165)CAG>TAG	p.Q55*	SERPINF2_uc010vqr.1_Nonsense_Mutation_p.Q55*	NM_000934	NP_000925	P08697	A2AP_HUMAN	alpha-2-antiplasmin isoform a precursor	55					acute-phase response|fibrinolysis|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Streptokinase(DB00086)	GTTGGGCAACCAGGTACAACC	0.667													9	38	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	1964808	1964808	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1964808A>G	uc002fub.1	-	19	4293	c.4238T>C	c.(4237-4239)CTC>CCC	p.L1413P	SMG6_uc010vqv.1_Missense_Mutation_p.L505P	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	1413					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						GGCCCACGTGAGGAAGGCTGG	0.647													4	8	---	---	---	---	PASS
SLC13A2	9058	broad.mit.edu	37	17	26824212	26824212	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26824212C>A	uc002hbh.2	+	12	1771	c.1704C>A	c.(1702-1704)TTC>TTA	p.F568L	SLC13A2_uc010wam.1_Missense_Mutation_p.F524L|SLC13A2_uc010wan.1_Missense_Mutation_p.F617L|SLC13A2_uc010wao.1_Missense_Mutation_p.F525L|SLC13A2_uc002hbi.2_Missense_Mutation_p.F497L	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	568						integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	TGCACTCTTTCCCCTCCTGGG	0.632													4	135	---	---	---	---	PASS
CD300E	342510	broad.mit.edu	37	17	72613604	72613604	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72613604C>G	uc002jlb.1	-	2	82	c.41G>C	c.(40-42)GGC>GCC	p.G14A		NM_181449	NP_852114	Q496F6	CLM2_HUMAN	CD300e molecule precursor	14						integral to membrane|plasma membrane	receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						AGACAAACAGCCTGGAAAACA	0.557													7	15	---	---	---	---	PASS
COLEC12	81035	broad.mit.edu	37	18	480713	480713	+	Silent	SNP	G	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:480713G>T	uc002kkm.2	-	2	267	c.52C>A	c.(52-54)CGG>AGG	p.R18R		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	18	Cytoplasmic (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				TCACCAAACCGCTTGTAACCG	0.552													14	57	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17366335	17366335	+	Silent	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17366335G>A	uc002nfs.1	-	10	1664	c.1551C>T	c.(1549-1551)CTC>CTT	p.L517L	USHBP1_uc002nfr.1_Silent_p.L143L|USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Silent_p.L453L	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	517							PDZ domain binding			ovary(1)	1						CCAGGGCTCGGAGGGCAGCCT	0.687													13	28	---	---	---	---	PASS
ZNF708	7562	broad.mit.edu	37	19	21492050	21492050	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21492050G>A	uc002npq.1	-	3	422	c.224C>T	c.(223-225)CCA>CTA	p.P75L	ZNF708_uc002npr.1_Missense_Mutation_p.P11L|ZNF708_uc010ecs.1_Missense_Mutation_p.P11L	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708	75	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6						TCACCTACCTGGGGGTTTGGC	0.438													26	113	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35831892	35831892	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35831892G>C	uc010edt.2	+	7	1435	c.1358G>C	c.(1357-1359)CGG>CCG	p.R453P	CD22_uc010xst.1_Missense_Mutation_p.R281P|CD22_uc010edu.2_Missense_Mutation_p.R365P|CD22_uc010edv.2_Missense_Mutation_p.R453P|CD22_uc002nzb.3_Missense_Mutation_p.R276P|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	453	Extracellular (Potential).|Ig-like C2-type 4.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	AGTGTTACCCGGTATGAATGG	0.532													16	71	---	---	---	---	PASS
FCGRT	2217	broad.mit.edu	37	19	50017102	50017102	+	Intron	SNP	G	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50017102G>T	uc002poe.2	+						FCGRT_uc002pod.2_Intron|FCGRT_uc002pog.2_Intron|FCGRT_uc002pof.1_5'UTR|FCGRT_uc010yax.1_Intron|FCGRT_uc002poh.1_5'Flank	NM_001136019	NP_001129491	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha						antigen processing and presentation|female pregnancy|immune response	integral to membrane|MHC class I protein complex	IgG binding|receptor activity			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		CTAGTTCCCCGCCCGTGTGCT	0.463													69	341	---	---	---	---	PASS
TFPT	29844	broad.mit.edu	37	19	54618679	54618679	+	5'UTR	SNP	A	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54618679A>T	uc010yej.1	-	1					TFPT_uc010erd.2_5'UTR|PRPF31_uc002qdh.2_5'Flank|PRPF31_uc010yek.1_5'Flank	NM_013342	NP_037474	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner						apoptosis|DNA recombination|DNA repair|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex	DNA binding|protein binding				0	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					CCCGGGCCTCAGAGCTTCCGA	0.572			T	TCF3	pre-B ALL						OREG0003635|OREG0003633	type=REGULATORY REGION|Gene=PRPF31|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=TFPT|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	18	37	---	---	---	---	PASS
C20orf70	140683	broad.mit.edu	37	20	31760811	31760811	+	Silent	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31760811G>A	uc002wyo.1	+	3	302	c.231G>A	c.(229-231)AAG>AAA	p.K77K		NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor	77						extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						CCAAGCAGAAGGCCCAGGAAG	0.473													3	101	---	---	---	---	PASS
ADNP	23394	broad.mit.edu	37	20	49509847	49509847	+	Silent	SNP	T	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49509847T>C	uc002xvt.1	-	5	1749	c.1404A>G	c.(1402-1404)GAA>GAG	p.E468E	ADNP_uc002xvu.1_Silent_p.E468E	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector	468	C2H2-type 5; atypical.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						CAGCTTTATGTTCTTTTTCGA	0.373													5	419	---	---	---	---	PASS
KCNG1	3755	broad.mit.edu	37	20	49620775	49620775	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49620775C>T	uc002xwa.3	-	3	1638	c.1343G>A	c.(1342-1344)GGC>GAC	p.G448D		NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	448	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						GAGCAGGATGCCGCTCAGGAT	0.622													4	128	---	---	---	---	PASS
PIGP	51227	broad.mit.edu	37	21	38444809	38444809	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38444809C>A	uc002yvw.1	-	1	295	c.79G>T	c.(79-81)GAA>TAA	p.E27*	TTC3_uc002yvz.2_5'Flank|TTC3_uc011aee.1_5'Flank|PIGP_uc002yvy.1_RNA|PIGP_uc002yvx.1_Nonsense_Mutation_p.E3*|TTC3_uc011aed.1_5'Flank|TTC3_uc010gne.1_5'Flank	NM_153681	NP_710148	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	27					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)				GGTGAATTTTCCACCATTTTT	0.483													53	210	---	---	---	---	PASS
CCDC157	550631	broad.mit.edu	37	22	30766353	30766353	+	Silent	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30766353C>A	uc011aku.1	+	5	1119	c.459C>A	c.(457-459)CCC>CCA	p.P153P	CCDC157_uc011akv.1_Silent_p.P153P	NM_001017437	NP_001017437	Q569K6	CC157_HUMAN	coiled-coil domain containing 157	153										central_nervous_system(1)	1						CCTCCAAGCCCACCACCAAGG	0.567													37	120	---	---	---	---	PASS
SMCR7L	54471	broad.mit.edu	37	22	39908345	39908345	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39908345G>A	uc003axx.2	+	5	929	c.431G>A	c.(430-432)CGG>CAG	p.R144Q	SMCR7L_uc003axw.2_Missense_Mutation_p.R144Q|SMCR7L_uc010gxz.1_5'UTR|SMCR7L_uc003axy.2_5'UTR	NM_019008	NP_061881	Q9NQG6	SMC7L_HUMAN	hypothetical protein LOC54471	144						integral to membrane|mitochondrion				central_nervous_system(1)	1	Melanoma(58;0.04)					ACTTACTACCGGAACCGGGCA	0.622													20	61	---	---	---	---	PASS
ALG12	79087	broad.mit.edu	37	22	50303615	50303615	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50303615C>T	uc003biy.2	-	5	865	c.591G>A	c.(589-591)CTG>CTA	p.L197L		NM_024105	NP_077010	Q9BV10	ALG12_HUMAN	alpha-1,6-mannosyltransferase ALG12	197	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane					0		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		TGCCCAAGGCCAGCAGCAGCA	0.612													11	31	---	---	---	---	PASS
CA5BP	340591	broad.mit.edu	37	X	15706858	15706858	+	5'UTR	SNP	G	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15706858G>T	uc011mir.1	+	3						NR_026551				RecName: Full=Putative carbonic anhydrase 5B-like protein; AltName: Full=CA-VB-like protein;												0						TCGGTGGAGGGACAGTGTTTA	0.532													14	52	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19410163	19410163	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19410163C>T	uc004czk.1	-	19	2450	c.813G>A	c.(811-813)TCG>TCA	p.S271S	MAP3K15_uc004czj.1_Silent_p.S231S	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase	796	Protein kinase.						ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					CAAGACGTTTCGAGGTTCCAA	0.488													26	45	---	---	---	---	PASS
SUV39H1	6839	broad.mit.edu	37	X	48557408	48557408	+	Silent	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48557408C>A	uc004dkn.2	+	2	180	c.135C>A	c.(133-135)GTC>GTA	p.V45V	SUV39H1_uc011mmf.1_Silent_p.V56V|SUV39H1_uc011mmg.1_RNA	NM_003173	NP_003164	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1	45	Chromo.|Interaction with SIRT1.				cell cycle|cell differentiation|chromatin silencing at rDNA|interspecies interaction between organisms|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|chromosome, centromeric region|condensed nuclear chromosome|rDNA heterochromatin	chromatin binding|histone methyltransferase activity (H3-K9 specific)|protein N-terminus binding|zinc ion binding				0						ACTTTGAAGTCGAGTACCTGT	0.557													10	22	---	---	---	---	PASS
PFKFB1	5207	broad.mit.edu	37	X	54982603	54982603	+	Silent	SNP	C	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54982603C>T	uc004dty.1	-	7	692	c.621G>A	c.(619-621)TTG>TTA	p.L207L	PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Silent_p.L142L	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,	207	6-phosphofructo-2-kinase.				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						gttcctcATCCAAGGGTTGGT	0.224													53	89	---	---	---	---	PASS
TEX11	56159	broad.mit.edu	37	X	69942475	69942475	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69942475G>A	uc004dyl.2	-	14	1204	c.1042C>T	c.(1042-1044)CAT>TAT	p.H348Y	TEX11_uc004dyk.2_Missense_Mutation_p.H23Y|TEX11_uc004dym.2_Missense_Mutation_p.H333Y	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	348							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					TACCTTTCATGATCCATCAGC	0.254													8	65	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73068428	73068428	+	RNA	SNP	G	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73068428G>C	uc004ebm.1	-	1		c.4161C>G				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						CTTTCTAATGGACAGGACTCT	0.433													11	46	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133397	91133397	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133397A>G	uc004efk.1	+	2	3003	c.2158A>G	c.(2158-2160)ACA>GCA	p.T720A	PCDH11X_uc004efl.1_Missense_Mutation_p.T720A|PCDH11X_uc004efo.1_Missense_Mutation_p.T720A|PCDH11X_uc010nmv.1_Missense_Mutation_p.T720A|PCDH11X_uc004efm.1_Missense_Mutation_p.T720A|PCDH11X_uc004efn.1_Missense_Mutation_p.T720A|PCDH11X_uc004efh.1_Missense_Mutation_p.T720A|PCDH11X_uc004efj.1_Missense_Mutation_p.T720A	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	720	Cadherin 7.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						AGGAGGAAACACAAGAGATCT	0.438													3	161	---	---	---	---	PASS
LRCH2	57631	broad.mit.edu	37	X	114400841	114400841	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114400841C>A	uc010nqe.2	-	7	1094	c.1063G>T	c.(1063-1065)GAG>TAG	p.E355*	LRCH2_uc004epz.2_Nonsense_Mutation_p.E355*	NM_020871	NP_065922	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH)	355										ovary(1)	1						AATCGTTTCTCTCCATTATCA	0.338													4	37	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129063453	129063453	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129063453A>C	uc004euz.2	+	15	2213	c.2185A>C	c.(2185-2187)ATT>CTT	p.I729L	UTP14A_uc011mup.1_Missense_Mutation_p.I677L|UTP14A_uc011muq.1_Missense_Mutation_p.I675L	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	729					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						AGGCCATATCATTAACCCCAT	0.512													10	125	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1633003	1633004	+	Intron	INS	-	CG	CG			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1633003_1633004insCG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|MMP23A_uc001ahi.1_Intron|MMP23A_uc009vko.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						GGGCAGGCAGCGGGGGGGGGCT	0.733													1	5	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145706564	145706565	+	Intron	INS	-	AA	AA			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145706564_145706565insAA	uc001emp.3	+						CD160_uc001eol.1_Intron|CD160_uc001eom.1_Intron|CD160_uc010oyz.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		gagactccctcaaaaaaaaaaa	0.228													5	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													5	3	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175049103	175049104	+	Intron	INS	-	GT	GT	rs142891850	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175049103_175049104insGT	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCtgtgtgtgagtgtgtgtgtg	0.248													5	4	---	---	---	---	
HK2	3099	broad.mit.edu	37	2	75101213	75101223	+	Intron	DEL	CAGGGACTCAT	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75101213_75101223delCAGGGACTCAT	uc002snd.2	+							NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2						apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						GAGAGCCGAGCAGGGACTCATGGAGTTGGGG	0.550													6	4	---	---	---	---	
TNFAIP6	7130	broad.mit.edu	37	2	152214427	152214427	+	Intron	DEL	T	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152214427delT	uc002txk.2	+							NM_007115	NP_009046	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6						cell adhesion|cell-cell signaling|inflammatory response|signal transduction		hyaluronic acid binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		ATACATACGCTTTTTTTTTTT	0.279													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175585079	175585079	+	Intron	DEL	A	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585079delA	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																		TTTCATTCTCAAAAAAAAAAA	0.368											OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	97926080	97926080	+	IGR	DEL	T	-	-	rs5851109		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97926080delT								OR5H15 (37597 upstream) : OR5H6 (57049 downstream)																							AAATATATGATTTTTTTCCAT	0.308													2	8	---	---	---	---	
ARMC8	25852	broad.mit.edu	37	3	138007817	138007818	+	Intron	INS	-	G	G	rs149226375	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138007817_138007818insG	uc003esa.1	+						TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Intron|TXNDC6_uc003ese.1_Intron|ARMC8_uc011bmf.1_Intron|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Intron|ARMC8_uc003esb.1_Intron|ARMC8_uc003esc.1_Intron|ARMC8_uc003esf.1_Intron	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2								binding				0						TGGCTATGGTAGGTCCCCCCAA	0.243													4	3	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41699388	41699388	+	3'UTR	DEL	T	-	-	rs113753743		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41699388delT	uc003gvu.3	+	27					LIMCH1_uc003gvv.3_3'UTR|LIMCH1_uc003gvw.3_3'UTR|LIMCH1_uc003gvx.3_3'UTR|LIMCH1_uc003gwe.3_3'UTR|LIMCH1_uc003gvy.3_3'UTR|LIMCH1_uc003gwa.3_3'UTR|LIMCH1_uc003gvz.3_3'UTR|LIMCH1_uc011byu.1_3'UTR|LIMCH1_uc003gwc.3_3'UTR|LIMCH1_uc003gwd.3_3'UTR|LIMCH1_uc011byv.1_3'UTR|LIMCH1_uc011byw.1_3'UTR|LIMCH1_uc010ifv.2_RNA	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						attgttttggttttttttttt	0.294													4	4	---	---	---	---	
SLCO6A1	133482	broad.mit.edu	37	5	101774592	101774595	+	Intron	DEL	GATA	-	-	rs35402021		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101774592_101774595delGATA	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AAAGATAATTgatagatagatgat	0.211													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1228521	1228526	+	IGR	DEL	GAGGAG	-	-	rs111919793		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1228521_1228526delGAGGAG								ZFAND2A (28666 upstream) : UNCX (44128 downstream)																							agaagaggaagaggaggaagaggaag	0.000													4	2	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													4	2	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17914872	17914872	+	3'UTR	DEL	A	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17914872delA	uc003wyl.2	-	14					ASAH1_uc010ltb.1_RNA|ASAH1_uc003wym.2_3'UTR|ASAH1_uc003wyn.2_3'UTR|ASAH1_uc003wyo.2_3'UTR	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		TGATAGGGGGAAAAAAAAAAG	0.378													4	2	---	---	---	---	
UBAP2	55833	broad.mit.edu	37	9	34016285	34016286	+	Intron	INS	-	GAA	GAA	rs62558776		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34016285_34016286insGAA	uc003ztq.1	-						UBAP2_uc011loc.1_Intron|UBAP2_uc011lod.1_Intron|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Intron|UBAP2_uc011log.1_Intron|UBAP2_uc003ztr.2_Intron	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2											ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		aggaagaggaggaggaggaaga	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	78917032	78917033	+	IGR	INS	-	T	T			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78917032_78917033insT								PCSK5 (108694 upstream) : RFK (83400 downstream)																							AAACTAAACACTTTTTTTTTTA	0.228													4	2	---	---	---	---	
NXNL2	158046	broad.mit.edu	37	9	91150746	91150747	+	Intron	INS	-	C	C	rs150222723	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91150746_91150747insC	uc011ltj.1	+						NXNL2_uc004aqa.2_Intron	NM_001161625	NP_001155097	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2 isoform 1												0						TCTTTATGACGCCCCCCCCCAA	0.559													4	2	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140218010	140218010	+	Intron	DEL	C	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140218010delC	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCACCCCGGACCCACGAGGGA	0.677													3	4	---	---	---	---	
NRAP	4892	broad.mit.edu	37	10	115385975	115385976	+	Intron	DEL	CA	-	-	rs3814578	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115385975_115385976delCA	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CATGTGCCCCCACACACACACA	0.520													4	2	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109644234	109644234	+	Intron	DEL	A	-	-	rs71930325		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109644234delA	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	cgagtgtctcaaaaaaaaaaa	0.214													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145296	119145298	+	IGR	DEL	CAA	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145296_119145298delCAA								SUDS3 (289457 upstream) : SRRM4 (274098 downstream)																							gtggtgatggcaatggtggtggt	0.000													6	3	---	---	---	---	
EPSTI1	94240	broad.mit.edu	37	13	43500181	43500182	+	Intron	INS	-	AGGA	AGGA			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43500181_43500182insAGGA	uc001uyw.1	-						EPSTI1_uc001uyx.1_Intron	NM_001002264	NP_001002264	Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 isoform 1											ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		ggaaggaaggaaggtaggaagg	0.168													6	3	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64608655	64608656	+	Intron	INS	-	A	A			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64608655_64608656insA	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATTTTGTTCTTACAGCTTCAAA	0.361													40	18	---	---	---	---	
GPHN	10243	broad.mit.edu	37	14	67525732	67525732	+	Intron	DEL	A	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67525732delA	uc001xiy.2	+						GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron|GPHN_uc010tsu.1_Intron	NM_001024218	NP_001019389	Q9NQX3	GEPH_HUMAN	gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		Taaaaaaaggaaaaaaaaaaa	0.299			T	MLL	AL								6	3	---	---	---	---	
COQ6	51004	broad.mit.edu	37	14	74429617	74429617	+	Intron	DEL	T	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74429617delT	uc001xph.2	+						ENTPD5_uc001xpi.2_Intron|COQ6_uc001xpe.2_Intron|COQ6_uc001xpf.2_Intron|COQ6_uc010tuk.1_Intron|COQ6_uc001xpg.2_Intron	NM_182476	NP_872282	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 homolog isoform a						ubiquinone biosynthetic process	mitochondrion	flavin adenine dinucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TCTACAATAATTATTTTCTTC	0.303													30	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	44028129	44028129	+	IGR	DEL	T	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44028129delT								CKMT1A (36710 upstream) : CATSPER2P1 (19 downstream)																							agcccggcaattttttttttt	0.000													3	3	---	---	---	---	
SPAG7	9552	broad.mit.edu	37	17	4862631	4862632	+	3'UTR	DEL	CA	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4862631_4862632delCA	uc002gae.2	-	7					SPAG7_uc002gad.2_3'UTR|SPAG7_uc002gaf.2_3'UTR	NM_004890	NP_004881	O75391	SPAG7_HUMAN	sperm associated antigen 7							nucleus	nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2						TTCACACTCTCACACACACACA	0.475													4	2	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20254235	20254235	+	Intron	DEL	T	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20254235delT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AGAGGAATTGTTTTTTTTTTT	0.249													5	3	---	---	---	---	
ZNF98	148198	broad.mit.edu	37	19	22583906	22583906	+	Intron	DEL	A	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22583906delA	uc002nqt.2	-							NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				tggaataagtaaaaaaaaaaa	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085837	11085838	+	Intron	INS	-	TAC	TAC	rs151194290	by1000genomes	TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085837_11085838insTAC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		accatcaccatcaccaccacca	0.000													4	2	---	---	---	---	
PKNOX1	5316	broad.mit.edu	37	21	44438157	44438158	+	Intron	INS	-	AAAA	AAAA	rs60175567		TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44438157_44438158insAAAA	uc002zcq.1	+						PKNOX1_uc002zcp.1_Intron|PKNOX1_uc011aex.1_Intron|PKNOX1_uc002zcr.2_3'UTR	NM_004571	NP_004562	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1								sequence-specific DNA binding			large_intestine(2)	2						cctgtctctacaaaaaaaaaaa	0.144													9	5	---	---	---	---	
MAGEC3	139081	broad.mit.edu	37	X	140967263	140967265	+	Intron	DEL	GGT	-	-			TCGA-B0-5120-01A-01D-1421-08	TCGA-B0-5120-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140967263_140967265delGGT	uc011mwp.1	+							NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1											skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					Aggaggaaaaggtggagggatac	0.256													4	2	---	---	---	---	
