Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC2A5	6518	broad.mit.edu	37	1	9098034	9098034	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9098034C>T	uc001apo.2	-	11	1516	c.1224G>A	c.(1222-1224)CGG>CGA	p.R408R	SLC2A5_uc010nzy.1_Silent_p.R349R|SLC2A5_uc010nzz.1_Silent_p.R293R|SLC2A5_uc010oaa.1_Silent_p.R364R|SLC2A5_uc010oab.1_Silent_p.R408R	NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated	408	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCAGATGGCCGAGAGGACT	0.642													3	105	---	---	---	---	PASS
FAM131C	348487	broad.mit.edu	37	1	16361919	16361919	+	Silent	SNP	G	A	A	rs148785270	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16361919G>A	uc010obz.1	-	7	787	c.597C>T	c.(595-597)CCC>CCT	p.P199P	CLCNKB_uc001axw.3_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	199											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGGCCGCTGGGAAGGCTGT	0.647													7	21	---	---	---	---	PASS
MRPS15	64960	broad.mit.edu	37	1	36921501	36921501	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36921501T>C	uc001cas.2	-	8	826	c.662A>G	c.(661-663)AAG>AGG	p.K221R		NM_031280	NP_112570	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15 precursor	221					translation	mitochondrial small ribosomal subunit|nuclear membrane	structural constituent of ribosome			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCTTCGCTTCTTCAGCTTTTG	0.493													6	497	---	---	---	---	PASS
PPIE	10450	broad.mit.edu	37	1	40207040	40207040	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40207040A>G	uc001cds.1	+	3	176	c.133A>G	c.(133-135)AAG>GAG	p.K45E	PPIE_uc001cdt.1_5'UTR|PPIE_uc010oiy.1_5'UTR|PPIE_uc001cdu.1_RNA|PPIE_uc001cdv.2_Missense_Mutation_p.K45E|PPIE_uc001cdw.2_Missense_Mutation_p.K45E|PPIE_uc001cdx.1_5'Flank	NM_006112	NP_006103	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E isoform 1	45	RRM.				protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TTTTGTAGAAAAGCACCGAGG	0.383													8	841	---	---	---	---	PASS
BTBD8	284697	broad.mit.edu	37	1	92604911	92604911	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92604911A>G	uc001doo.2	+	6	1024	c.757A>G	c.(757-759)AGC>GGC	p.S253G	BTBD8_uc010otc.1_RNA	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	253	BTB 2.					nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		TTTCAGTATAAGCCATGTAGA	0.299													6	572	---	---	---	---	PASS
DDX20	11218	broad.mit.edu	37	1	112304651	112304651	+	Intron	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112304651C>T	uc001ebs.2	+						DDX20_uc010owf.1_Intron|DDX20_uc001ebt.2_5'UTR	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20						assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGGCCTGATCACTATTTAGG	0.299													62	31	---	---	---	---	PASS
MAGI3	260425	broad.mit.edu	37	1	114137127	114137127	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114137127G>C	uc001edk.2	+	6	1144	c.963G>C	c.(961-963)TGG>TGC	p.W321C	MAGI3_uc001edh.3_Missense_Mutation_p.W321C|MAGI3_uc001edi.3_Missense_Mutation_p.W321C|MAGI3_uc010owm.1_Missense_Mutation_p.W321C|MAGI3_uc001edj.2_Missense_Mutation_p.W42C	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	321	WW 1.				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAACCACCTGGTTGGATCCTC	0.343													12	296	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144621522	144621522	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144621522A>C	uc009wig.1	+	9	930	c.854A>C	c.(853-855)GAG>GCG	p.E285A	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.E285A|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.E216A|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.E216A|NBPF9_uc010oyg.1_Missense_Mutation_p.E250A|NBPF9_uc009wii.1_Missense_Mutation_p.E14A	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	285						cytoplasm					0						GAGAAGGCAGAGATGAACATT	0.488													6	86	---	---	---	---	PASS
PSMD4	5710	broad.mit.edu	37	1	151237991	151237991	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151237991C>T	uc001exl.2	+	6	622	c.560C>T	c.(559-561)CCG>CTG	p.P187L	PSMD4_uc001exn.2_Missense_Mutation_p.P187L	NM_002810	NP_002801	P55036	PSMD4_HUMAN	proteasome 26S non-ATPase subunit 4	187	VWFA.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding				0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ATCAGTTCTCCGATTTTGGCT	0.527													4	108	---	---	---	---	PASS
SPRR2E	6704	broad.mit.edu	37	1	153065957	153065957	+	3'UTR	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153065957A>C	uc001fbh.2	-	2					SPRR2D_uc009wnz.2_Intron|SPRR2A_uc001fbf.2_Intron|SPRR2A_uc009woa.2_Intron	NM_001024209	NP_001019380	P22531	SPR2E_HUMAN	small proline-rich protein 2E						keratinization	cornified envelope|cytoplasm	protein binding|structural molecule activity			ovary(1)	1	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGTGGAACAAGGTGAGCCAA	0.483													15	479	---	---	---	---	PASS
S100A1	6271	broad.mit.edu	37	1	153604353	153604353	+	3'UTR	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153604353A>C	uc001fck.1	+	3					C1orf77_uc001fcm.1_5'Flank|C1orf77_uc001fcn.1_5'Flank|S100A13_uc001fcj.2_Intron|S100A1_uc001fcl.1_RNA|C1orf77_uc009woi.1_5'Flank|C1orf77_uc009woj.1_5'Flank	NM_006271	NP_006262	P23297	S10A1_HUMAN	S100 calcium binding protein A1						intracellular signal transduction|regulation of heart contraction	nucleus|protein complex|sarcoplasmic reticulum	ATPase binding|calcium ion binding|protein homodimerization activity|S100 alpha binding|S100 beta binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	CTTCCTCTCCACCCTCCCAGA	0.403													15	187	---	---	---	---	PASS
RHBG	57127	broad.mit.edu	37	1	156347143	156347143	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156347143T>C	uc010pho.1	+	2	277	c.239T>C	c.(238-240)GTC>GCC	p.V80A	RHBG_uc010phm.1_Intron|RHBG_uc010phn.1_RNA|RHBG_uc001fos.2_Missense_Mutation_p.V11A|RHBG_uc009wrz.2_Missense_Mutation_p.V11A|RHBG_uc001for.2_Missense_Mutation_p.V50A	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein	80	Helical; (Potential).				transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					TTCCTCATGGTCTTCCTGCAG	0.632													4	110	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175323627	175323627	+	Silent	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175323627A>T	uc001gkp.1	-	16	3363	c.3282T>A	c.(3280-3282)ATT>ATA	p.I1094I	TNR_uc009wwu.1_Silent_p.I1094I	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1094	Fibronectin type-III 9.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CCTCCAGTCGAATCCAGGTGT	0.547													195	61	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179460828	179460828	+	Silent	SNP	T	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179460828T>A	uc001gmo.2	+	19	2374	c.2247T>A	c.(2245-2247)ATT>ATA	p.I749I	C1orf125_uc009wxg.2_RNA|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Silent_p.I749I|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	749											0						TAGATGCGATTGAACTGACAA	0.418													7	296	---	---	---	---	PASS
ZBTB41	360023	broad.mit.edu	37	1	197150232	197150232	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197150232T>C	uc001gtx.1	-	5	1631	c.1562A>G	c.(1561-1563)GAT>GGT	p.D521G	ZBTB41_uc009wyz.1_RNA	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	521	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						ACCACATATATCACATGGAAA	0.328													6	427	---	---	---	---	PASS
OPTC	26254	broad.mit.edu	37	1	203472837	203472837	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203472837C>T	uc001gzu.1	+	7	1104	c.988C>T	c.(988-990)CGC>TGC	p.R330C		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	330						proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCCCATCGGCCGCTTCACGTA	0.612													3	42	---	---	---	---	PASS
RAB4A	5867	broad.mit.edu	37	1	229424521	229424521	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229424521A>G	uc001hth.2	+	3	366	c.158A>G	c.(157-159)AAG>AGG	p.K53R	RAB4A_uc001hti.2_RNA|RAB4A_uc001htj.2_Intron	NM_004578	NP_004569	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	48							GDP binding|GTP binding|GTPase activity			ovary(1)	1	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				TTTGGTTCAAAGATAATAAAT	0.284													7	346	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525734	248525734	+	Silent	SNP	T	C	C	rs138844789		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525734T>C	uc001ieh.1	+	1	852	c.852T>C	c.(850-852)TAT>TAC	p.Y284Y		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	284	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCTCTTCTATGGGGCTGCCA	0.547													40	182	---	---	---	---	PASS
FAM110C	642273	broad.mit.edu	37	2	45667	45667	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45667C>T	uc010yim.1	-	1	719	c.719G>A	c.(718-720)GGG>GAG	p.G240E		NM_001077710	NP_001071178	Q1W6H9	F110C_HUMAN	hypothetical protein LOC642273	240						microtubule|microtubule organizing center|spindle pole					0	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		ACAGTCCGACCCCGCGGTGAA	0.692													15	7	---	---	---	---	PASS
RPS7	6201	broad.mit.edu	37	2	3624313	3624313	+	Intron	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3624313C>G	uc002qxw.2	+						RPS7_uc002qxx.2_3'UTR|RPS7_uc002qxy.2_5'Flank	NM_001011	NP_001002	P62081	RS7_HUMAN	ribosomal protein S7						endocrine pancreas development|ribosomal small subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	90S preribosome|cytosolic small ribosomal subunit|nucleolus|small-subunit processome	protein binding|RNA binding|structural constituent of ribosome				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0963)|Epithelial(75;0.208)		GTCATGAAAACAATCCTTTTA	0.254													47	107	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37284512	37284512	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37284512A>G	uc002rpp.1	-	15	2267	c.2171T>C	c.(2170-2172)GTT>GCT	p.V724A		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	724							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				ACCAAGAAGAACACTATCATC	0.388													8	693	---	---	---	---	PASS
SRBD1	55133	broad.mit.edu	37	2	45620107	45620107	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45620107G>T	uc002rus.2	-	20	2751	c.2675C>A	c.(2674-2676)CCT>CAT	p.P892H	SRBD1_uc010yoc.1_Missense_Mutation_p.P411H	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	892					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAAGCTTTCAGGCTGGCTGAG	0.274													166	443	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50780062	50780062	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50780062C>T	uc010fbq.2	-	9	3019	c.1542G>A	c.(1540-1542)GAG>GAA	p.E514E	NRXN1_uc002rxb.3_Silent_p.E146E|NRXN1_uc002rxe.3_Silent_p.E474E|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTGCAACATTCTCACATTTAA	0.383													5	356	---	---	---	---	PASS
C2orf63	130162	broad.mit.edu	37	2	55449486	55449486	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55449486T>C	uc002ryi.2	-	3	408	c.62A>G	c.(61-63)AAG>AGG	p.K21R	C2orf63_uc002ryh.2_5'UTR|C2orf63_uc002ryj.2_Intron	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	21							binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			CAAAAATTCCTTGTCACTTCT	0.373													7	667	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71738941	71738941	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71738941C>G	uc002sie.2	+	5	723	c.347C>G	c.(346-348)TCG>TGG	p.S116W	DYSF_uc010feg.2_Missense_Mutation_p.S116W|DYSF_uc010feh.2_Missense_Mutation_p.S116W|DYSF_uc002sig.3_Missense_Mutation_p.S116W|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.S116W|DYSF_uc010fef.2_Missense_Mutation_p.S116W|DYSF_uc010fei.2_Missense_Mutation_p.S116W|DYSF_uc010fek.2_Missense_Mutation_p.S117W|DYSF_uc010fej.2_Missense_Mutation_p.S117W|DYSF_uc010fel.2_Missense_Mutation_p.S117W|DYSF_uc010feo.2_Missense_Mutation_p.S117W|DYSF_uc010fem.2_Missense_Mutation_p.S117W|DYSF_uc010fen.2_Missense_Mutation_p.S117W|DYSF_uc002sif.2_Missense_Mutation_p.S117W	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	116	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						TTCCAGGCCTCGCTGGTCCTG	0.642													18	38	---	---	---	---	PASS
LOC285074	285074	broad.mit.edu	37	2	87261325	87261325	+	Missense_Mutation	SNP	T	C	C	rs141380794	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87261325T>C	uc002ssg.1	-	5	1646	c.946A>G	c.(946-948)AAG>GAG	p.K316E	RMND5A_uc002srs.3_Intron|LOC285074_uc010fgw.2_Missense_Mutation_p.K277E|LOC285074_uc002ssf.3_Missense_Mutation_p.K277E					SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;												0						GAGTATGACTTTCTGTCAGTG	0.458													3	7	---	---	---	---	PASS
STARD7	56910	broad.mit.edu	37	2	96859005	96859005	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96859005A>G	uc002svm.3	-	4	1036	c.635T>C	c.(634-636)GTT>GCT	p.V212A	STARD7_uc002svl.2_Intron	NM_020151	NP_064536	Q9NQZ5	STAR7_HUMAN	START domain containing 7 precursor	212	START.					mitochondrion					0						CCAGTGAAGAACCTCGGAACC	0.428													5	205	---	---	---	---	PASS
MKI67IP	84365	broad.mit.edu	37	2	122488643	122488643	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122488643G>A	uc002tnk.2	-	4	467	c.390C>T	c.(388-390)CTC>CTT	p.L130L	MKI67IP_uc010fls.2_Silent_p.L130L	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN	MKI67 interacting nucleolar phosphoprotein	130					protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						AGTCTTTAAAGAGTTCTTTAT	0.353													118	295	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128747203	128747203	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128747203T>C	uc002tpp.2	-	13	1925	c.1793A>G	c.(1792-1794)AAC>AGC	p.N598S	SAP130_uc002tpn.2_Missense_Mutation_p.N359S|SAP130_uc002tpo.2_Missense_Mutation_p.N343S|SAP130_uc010fmd.2_Missense_Mutation_p.N598S|SAP130_uc002tpq.1_Missense_Mutation_p.N571S	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	598					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		CCCTTGTGTGTTGATTGGGGT	0.527													7	451	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145161556	145161556	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145161556A>G	uc002tvu.2	-	6	1214	c.734T>C	c.(733-735)CTC>CCC	p.L245P	ZEB2_uc002tvv.2_Missense_Mutation_p.L239P|ZEB2_uc010zbm.1_Missense_Mutation_p.L216P|ZEB2_uc010fnp.2_Missense_Mutation_p.L153P|ZEB2_uc010fnq.1_Missense_Mutation_p.L274P	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	245	C2H2-type 2.					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GTAGCTACAGAGAGGGCAGGA	0.512													7	377	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179414804	179414804	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179414804T>C	uc010zfg.1	-	286	84281	c.84057A>G	c.(84055-84057)AGA>AGG	p.R28019R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.R21714R|TTN_uc010zfi.1_Silent_p.R21647R|TTN_uc010zfj.1_Silent_p.R21522R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28946							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTAGCATCTCTAACAAATA	0.418													5	285	---	---	---	---	PASS
DUSP19	142679	broad.mit.edu	37	2	183960309	183960309	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183960309T>C	uc002upd.2	+	4	952	c.577T>C	c.(577-579)TTC>CTC	p.F193L	DUSP19_uc010frp.2_Missense_Mutation_p.F142L|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_3'UTR	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1	193	Tyrosine-protein phosphatase.				JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						AAATTCTGGCTTCATGGAGCA	0.388													6	275	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207431951	207431951	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207431951T>C	uc002vbq.2	+	15	1622	c.1399T>C	c.(1399-1401)TCC>CCC	p.S467P	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	467	Peptidase M12B.|Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CCTCAGGGTGTCCCATTCTCG	0.363													6	336	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216230258	216230258	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216230258T>C	uc002vfa.2	-	43	7380	c.7114A>G	c.(7114-7116)AAC>GAC	p.N2372D	FN1_uc002vfb.2_Missense_Mutation_p.N2160D|FN1_uc002vfc.2_Missense_Mutation_p.N2135D|FN1_uc002vfd.2_Missense_Mutation_p.N2316D|FN1_uc002vfe.2_Missense_Mutation_p.N2250D|FN1_uc002vff.2_Missense_Mutation_p.N2225D|FN1_uc002vfg.2_Missense_Mutation_p.N2191D|FN1_uc002vfh.2_Missense_Mutation_p.N2071D|FN1_uc002vfi.2_Missense_Mutation_p.N2341D|FN1_uc002vfj.2_Missense_Mutation_p.N2162D|FN1_uc002vez.2_Missense_Mutation_p.N535D|FN1_uc010zjp.1_Missense_Mutation_p.N909D|FN1_uc002vfk.1_RNA|FN1_uc010fva.1_RNA|FN1_uc010fvb.1_RNA	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	2281	Fibrin-binding 2.|Fibronectin type-I 11.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCTTTTCCGTTCCCAAGACAT	0.443													5	355	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217285020	217285020	+	Splice_Site	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217285020A>T	uc002vgc.3	+	5	1193	c.863_splice	c.e5-2	p.M288_splice	SMARCAL1_uc010fvf.2_Splice_Site|SMARCAL1_uc002vgd.3_Splice_Site_p.M288_splice|SMARCAL1_uc010fvg.2_Splice_Site_p.M288_splice	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated						chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CTTCTTTGGCAGTGAAAGCAG	0.557									Schimke_Immuno-Osseous_Dysplasia				82	37	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228855999	228855999	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228855999T>C	uc002vpq.2	-	10	4812	c.4765A>G	c.(4765-4767)AGC>GGC	p.S1589G	SPHKAP_uc002vpp.2_Missense_Mutation_p.S1560G|SPHKAP_uc010zlx.1_Intron	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1589						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCCTCTGTGCTTTCTGACTGT	0.403													7	559	---	---	---	---	PASS
MAP4	4134	broad.mit.edu	37	3	47951596	47951596	+	Intron	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47951596C>T	uc003csb.2	-						MAP4_uc003csc.3_Intron|MAP4_uc011bbf.1_Intron|MAP4_uc003cry.2_Missense_Mutation_p.A46T|MAP4_uc003csa.3_Missense_Mutation_p.A46T|MAP4_uc003crz.3_RNA|MAP4_uc003csd.2_Missense_Mutation_p.A46T	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1						negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)		TTTTCACAGGCTGCTGATTCC	0.438													4	269	---	---	---	---	PASS
VPRBP	9730	broad.mit.edu	37	3	51455599	51455599	+	Silent	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51455599A>C	uc003dbe.1	-	16	3657	c.3489T>G	c.(3487-3489)CTT>CTG	p.L1163L	VPRBP_uc003dbf.1_Silent_p.L439L	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	1163	WD 2.|WD repeat-like region.				interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TCATTCCCCAAAGTGCAGACA	0.423													63	153	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52439164	52439164	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52439164A>G	uc003ddx.2	-	11	1193	c.1078T>C	c.(1078-1080)TTT>CTT	p.F360L	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	360					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TTGTCTAGAAAGGCCGGCAGC	0.562			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								6	162	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52649385	52649385	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649385A>G	uc003des.2	-	15	1918	c.1906T>C	c.(1906-1908)TCT>CCT	p.S636P	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.S636P|PBRM1_uc003der.2_Missense_Mutation_p.S604P|PBRM1_uc003det.2_Missense_Mutation_p.S651P|PBRM1_uc003deu.2_Missense_Mutation_p.S651P|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.S636P|PBRM1_uc010hmk.1_Missense_Mutation_p.S636P|PBRM1_uc003dey.2_Missense_Mutation_p.S636P|PBRM1_uc003dez.1_Missense_Mutation_p.S636P|PBRM1_uc003dfb.1_Missense_Mutation_p.S549P|PBRM1_uc003dfc.2_Missense_Mutation_p.S3P	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	636					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGTTTGGGAGAAGCCATGTCA	0.373			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								5	274	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53820920	53820920	+	Missense_Mutation	SNP	C	T	T	rs145414503		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53820920C>T	uc003dgv.3	+	40	5027	c.4864C>T	c.(4864-4866)CGG>TGG	p.R1622W	CACNA1D_uc003dgu.3_Missense_Mutation_p.R1642W|CACNA1D_uc003dgy.3_Missense_Mutation_p.R1607W|CACNA1D_uc003dgw.3_Missense_Mutation_p.R1289W|CACNA1D_uc003dgx.1_Missense_Mutation_p.R798W	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1622	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	ATTCAAGAAACGGAAAGAACA	0.443													7	251	---	---	---	---	PASS
GPR15	2838	broad.mit.edu	37	3	98251797	98251797	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251797G>T	uc011bgy.1	+	1	920	c.920G>T	c.(919-921)AGC>ATC	p.S307I		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	307	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		ATCTTCGACAGCTACATCCGC	0.478													108	26	---	---	---	---	PASS
RAB6B	51560	broad.mit.edu	37	3	133558406	133558406	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133558406C>G	uc003epy.2	-	5	726	c.345G>C	c.(343-345)AGG>AGC	p.R115S	RAB6B_uc011blu.1_Missense_Mutation_p.R102S	NM_016577	NP_057661	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	115					protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding			pancreas(1)	1						CATCACTGCCCCTCTCTGTCC	0.557													13	147	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506315	195506315	+	Missense_Mutation	SNP	T	C	C	rs62282465		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506315T>C	uc011bto.1	-	3	12212	c.11752A>G	c.(11752-11754)ACC>GCC	p.T3918A	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	818	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTCACCTGTG	0.587													9	24	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509563	195509563	+	Missense_Mutation	SNP	A	T	T	rs28605870		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509563A>T	uc011bto.1	-	3	8964	c.8504T>A	c.(8503-8505)GTC>GAC	p.V2835D	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGA	0.587													8	16	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509939	195509939	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509939G>T	uc011bto.1	-	3	8588	c.8128C>A	c.(8128-8130)CCT>ACT	p.P2710T	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGATGGTGACA	0.592													17	30	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509941	195509941	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509941A>C	uc011bto.1	-	3	8586	c.8126T>G	c.(8125-8127)ATC>AGC	p.I2709S	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGGGATGGTGACAGG	0.592													14	29	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510133	195510133	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510133T>C	uc011bto.1	-	3	8394	c.7934A>G	c.(7933-7935)AAC>AGC	p.N2645S	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTTGGTGACAGG	0.582													5	4	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195510146	195510146	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195510146G>C	uc011bto.1	-	3	8381	c.7921C>G	c.(7921-7923)CTT>GTT	p.L2641V	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGCG	0.577													5	4	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195512214	195512214	+	Silent	SNP	G	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195512214G>C	uc011bto.1	-	2	6697	c.6237C>G	c.(6235-6237)ACC>ACG	p.T2079T	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	850	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAAGAAGAGGGGTGGCGTGAC	0.572													8	71	---	---	---	---	PASS
ZNF141	7700	broad.mit.edu	37	4	367075	367075	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:367075C>T	uc003gaa.2	+	5	1027	c.849C>T	c.(847-849)ATC>ATT	p.I283I	ZNF141_uc003gab.2_Intron	NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141	283	C2H2-type 5.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						AGAAACCCATCACATGTGAAG	0.378													8	95	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111430821	111430821	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111430821T>C	uc003iab.3	+	5	1394	c.1052T>C	c.(1051-1053)ATT>ACT	p.I351T		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	351	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	AAAATCGCTATTCCAGATTTT	0.388													5	251	---	---	---	---	PASS
PDE5A	8654	broad.mit.edu	37	4	120422381	120422381	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120422381T>A	uc003idh.2	-	20	2589	c.2434A>T	c.(2434-2436)AAA>TAA	p.K812*	uc003ide.3_Intron|PDE5A_uc003idf.2_Nonsense_Mutation_p.K770*|PDE5A_uc003idg.2_Nonsense_Mutation_p.K760*	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1	812	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)	CTTGGGATTTTGTTTTTCTTC	0.313													12	383	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121957408	121957408	+	3'UTR	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121957408T>C	uc003idq.1	-	4						NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor												0						TATATCTCTATAAGAAGGTAA	0.383													64	50	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177100620	177100620	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177100620T>C	uc003iuj.2	+	31	4015	c.3859T>C	c.(3859-3861)TTT>CTT	p.F1287L	WDR17_uc003iuk.2_Missense_Mutation_p.F1263L|WDR17_uc003ium.3_Missense_Mutation_p.F1248L|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.F498L	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	1287										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GGGCCCTGTGTTTTTCCTTGA	0.388													6	329	---	---	---	---	PASS
ACSL1	2180	broad.mit.edu	37	4	185689586	185689586	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185689586C>T	uc003iww.2	-	12	1306	c.1012G>A	c.(1012-1014)GGA>AGA	p.G338R	ACSL1_uc011ckm.1_Missense_Mutation_p.G167R|ACSL1_uc003iwt.1_Missense_Mutation_p.G338R|ACSL1_uc003iwu.1_Missense_Mutation_p.G338R|ACSL1_uc011ckn.1_Missense_Mutation_p.G304R|ACSL1_uc003iwv.1_Missense_Mutation_p.G338R|ACSL1_uc003iws.1_5'Flank|ACSL1_uc010ise.1_RNA	NM_001995	NP_001986	P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	338	Cytoplasmic (Potential).				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATTTTAGCTCCATGACACAGC	0.438													4	168	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40972593	40972593	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40972593T>C	uc003jmh.2	+	15	2085	c.1971T>C	c.(1969-1971)GTT>GTC	p.V657V	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	657	Sushi 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AGGTGACTGTTTCCTGTTCAG	0.458													6	588	---	---	---	---	PASS
CD180	4064	broad.mit.edu	37	5	66478939	66478939	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66478939G>T	uc003juy.2	-	3	1880	c.1732C>A	c.(1732-1734)CCC>ACC	p.P578T		NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor	578	Extracellular (Potential).|LRRCT.				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		CAGTCCAGGGGGTTATGACTT	0.483													101	81	---	---	---	---	PASS
CRHBP	1393	broad.mit.edu	37	5	76249464	76249464	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76249464C>T	uc003ker.2	+	2	400	c.120C>T	c.(118-120)TTC>TTT	p.F40F	CRHBP_uc010izx.2_Silent_p.F40F	NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	40					female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TCCTGCTCTTCAGCGCCAACC	0.647													3	51	---	---	---	---	PASS
PAM	5066	broad.mit.edu	37	5	102364720	102364720	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102364720A>G	uc003knw.2	+	25	3246	c.2873A>G	c.(2872-2874)GAA>GGA	p.E958G	PAM_uc003kns.2_Missense_Mutation_p.E851G|PAM_uc003knt.2_Missense_Mutation_p.E959G|PAM_uc003knu.2_Missense_Mutation_p.E890G|PAM_uc003knv.2_Missense_Mutation_p.E872G|PAM_uc011cuz.1_Missense_Mutation_p.E860G|PAM_uc003knz.2_Missense_Mutation_p.E180G	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	958	Cytoplasmic (Potential).				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	AGTGAATCAGAAGAGGAGTAT	0.468													4	164	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140236094	140236094	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140236094A>G	uc003lhx.2	+	1	461	c.461A>G	c.(460-462)GAA>GGA	p.E154G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.E154G|PCDHA10_uc011dad.1_Missense_Mutation_p.E154G	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	154	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCCACTAGAAGGCGCATCT	0.413													29	66	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140798186	140798186	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140798186G>C	uc003lkn.1	+	1	905	c.760G>C	c.(760-762)GAC>CAC	p.D254H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.D254H|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	254	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCGGGAAGACGTGCCTCC	0.537													21	20	---	---	---	---	PASS
FBXO38	81545	broad.mit.edu	37	5	147819274	147819274	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147819274T>C	uc003lpf.1	+	19	3209	c.3089T>C	c.(3088-3090)ATC>ACC	p.I1030T	FBXO38_uc003lpg.1_Missense_Mutation_p.I955T|FBXO38_uc003lph.2_Missense_Mutation_p.I785T	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	1030						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTGTATTATCCATGAATTC	0.438													4	128	---	---	---	---	PASS
SLC34A1	6569	broad.mit.edu	37	5	176813484	176813484	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176813484T>C	uc003mgk.3	+	5	550	c.449T>C	c.(448-450)CTG>CCG	p.L150P		NM_003052	NP_003043	Q06495	NPT2A_HUMAN	solute carrier family 34 (sodium phosphate),	150	Helical; Name=M2; (Potential).				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGGCCGGGCTGGTGGTGGGG	0.617													4	67	---	---	---	---	PASS
CNOT6	57472	broad.mit.edu	37	5	179956356	179956356	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179956356A>G	uc003mlx.2	+	2	429	c.80A>G	c.(79-81)AAG>AGG	p.K27R	CNOT6_uc010jld.2_Missense_Mutation_p.K27R|CNOT6_uc010jle.2_Missense_Mutation_p.K27R	NM_015455	NP_056270	Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	27					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		GCAAATGGAAAGAAATCCCAC	0.398													6	229	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51915062	51915062	+	Silent	SNP	T	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51915062T>G	uc003pah.1	-	22	2448	c.2172A>C	c.(2170-2172)CCA>CCC	p.P724P	PKHD1_uc003pai.2_Silent_p.P724P	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	724	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GATTGCCCCCTGGGCGAGCCG	0.547											OREG0017493	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	53	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	65655781	65655781	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65655781A>C	uc011dxu.1	-	15	2824	c.2286T>G	c.(2284-2286)GAT>GAG	p.D762E		NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	762	EGF-like 9; calcium-binding (Potential).				response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						TTCCTTCCCAATCAGATAGGC	0.348													69	391	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152809562	152809562	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152809562A>G	uc010kiw.2	-	12	1618	c.1016T>C	c.(1015-1017)ATG>ACG	p.M339T	SYNE1_uc003qot.3_Missense_Mutation_p.M346T|SYNE1_uc003qou.3_Missense_Mutation_p.M339T|SYNE1_uc010kjb.1_Missense_Mutation_p.M322T|SYNE1_uc003qpa.1_Missense_Mutation_p.M339T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	339	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGATTCCACCATCTGTGCTCT	0.294										HNSCC(10;0.0054)			390	415	---	---	---	---	PASS
OPRM1	4988	broad.mit.edu	37	6	154412287	154412287	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154412287A>G	uc003qpr.2	+	3	1081	c.844A>G	c.(844-846)AGG>GGG	p.R282G	OPRM1_uc011efc.1_Missense_Mutation_p.R201G|OPRM1_uc011efd.1_Missense_Mutation_p.R182G|OPRM1_uc011efe.1_Missense_Mutation_p.R375G|OPRM1_uc003qpn.2_Missense_Mutation_p.R282G|OPRM1_uc003qpo.1_Missense_Mutation_p.R282G|OPRM1_uc011eff.1_Missense_Mutation_p.R282G|OPRM1_uc011efg.1_Missense_Mutation_p.R282G|OPRM1_uc011efh.1_Missense_Mutation_p.R282G|OPRM1_uc003qpq.1_Missense_Mutation_p.R282G|OPRM1_uc003qpt.1_Missense_Mutation_p.R282G|OPRM1_uc011efi.1_Missense_Mutation_p.R282G|OPRM1_uc003qpp.2_RNA|OPRM1_uc003qps.2_RNA|OPRM1_uc010kjg.2_Missense_Mutation_p.R182G|OPRM1_uc003qpu.2_Missense_Mutation_p.R182G	NM_000914	NP_000905	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1	282	Cytoplasmic (Potential).				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	AAGGATCACCAGGATGGTGCT	0.488													7	460	---	---	---	---	PASS
HGC6.3	100128124	broad.mit.edu	37	6	168377052	168377052	+	Missense_Mutation	SNP	G	T	T	rs111332561		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168377052G>T	uc010kks.1	-	1	568	c.281C>A	c.(280-282)CCC>CAC	p.P94H		NM_001129895	NP_001123367	Q9UM08	Q9UM08_HUMAN	hypothetical protein LOC100128124	94											0						TGCAGTGTGGGGGGAGGAGAA	0.632													4	58	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6180577	6180577	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6180577A>G	uc011jwo.1	+	7	880	c.757A>G	c.(757-759)ACT>GCT	p.T253A	USP42_uc011jwn.1_Missense_Mutation_p.T98A|USP42_uc010kth.1_Missense_Mutation_p.T186A|USP42_uc011jwp.1_Missense_Mutation_p.T253A|USP42_uc011jwq.1_Missense_Mutation_p.T60A|USP42_uc011jwr.1_Missense_Mutation_p.T98A	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	253					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CGTTTCAGATACTTTTGATCC	0.264													6	427	---	---	---	---	PASS
KLHL7	55975	broad.mit.edu	37	7	23207478	23207478	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23207478G>A	uc003svs.3	+	9	1494	c.1201G>A	c.(1201-1203)GAG>AAG	p.E401K	KLHL7_uc003svr.3_Missense_Mutation_p.E379K|KLHL7_uc011jys.1_Missense_Mutation_p.E325K|KLHL7_uc011jyt.1_Missense_Mutation_p.E176K|KLHL7_uc003svt.2_Missense_Mutation_p.E353K|KLHL7_uc011jyv.1_Missense_Mutation_p.E176K	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	401	Kelch 3.					Golgi apparatus|nucleolus|plasma membrane					0						GTATTTATTTGAGTGCTATGA	0.463													63	210	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32956881	32956881	+	Intron	SNP	A	G	G	rs116875310	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32956881A>G	uc011kai.1	+						RP9P_uc003tdc.2_RNA|RP9P_uc003tdd.2_RNA|RP9P_uc011kaj.1_RNA	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						CTATCCTGCTACTTTCTCTGA	0.507													10	27	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43590178	43590178	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43590178C>T	uc003tid.1	+	27	4988	c.4383C>T	c.(4381-4383)CGC>CGT	p.R1461R	HECW1_uc011kbi.1_Silent_p.R1427R	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1461	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CGCTGGTGCGCGGCTTCTACG	0.647													3	118	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65226641	65226641	+	Intron	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226641G>T	uc003tud.1	-						CCT6P1_uc003tug.2_RNA|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		AGGTTCTTGCGCAGAATTCTG	0.299													7	111	---	---	---	---	PASS
NCF1	653361	broad.mit.edu	37	7	74191683	74191683	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74191683A>G	uc003ubb.2	+	2	213	c.143A>G	c.(142-144)TAC>TGC	p.Y48C	NCF1_uc010lbs.1_Missense_Mutation_p.Y48C|NCF1_uc011kfh.1_Missense_Mutation_p.Y48C	NM_000265	NP_000256	P14598	NCF1_HUMAN	neutrophil cytosolic factor 1	48	PX.				cell communication|cellular defense response|innate immune response|protein targeting to membrane|respiratory burst|superoxide anion generation	cytosol|NADPH oxidase complex|soluble fraction	electron carrier activity|GTP binding|GTPase activity|phosphatidylinositol binding|SH3 domain binding|superoxide-generating NADPH oxidase activity			skin(1)	1						ACCGAGATCTACGAGTTCCAT	0.602													49	14	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98574329	98574329	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98574329T>G	uc003upp.2	+	54	8371	c.8162T>G	c.(8161-8163)CTT>CGT	p.L2721R	TRRAP_uc011kis.1_Missense_Mutation_p.L2703R|TRRAP_uc003upr.2_Missense_Mutation_p.L2420R	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	2721	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGTCTGAGTCTTCAGATTAAG	0.537													9	21	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100463346	100463346	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100463346A>C	uc003uwp.2	+	14	2006	c.1864A>C	c.(1864-1866)ATG>CTG	p.M622L	SLC12A9_uc011kki.1_Missense_Mutation_p.M153L|SLC12A9_uc003uwr.2_Missense_Mutation_p.M358L|SLC12A9_uc003uws.2_Missense_Mutation_p.M153L|SLC12A9_uc003uwt.2_Missense_Mutation_p.M358L|SLC12A9_uc003uwv.2_Missense_Mutation_p.M153L|TRIP6_uc010lhk.1_5'Flank|TRIP6_uc003uww.2_5'Flank	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	622	Extracellular (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCAGGTGGCATGAAGCCCAA	0.592													25	13	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100682094	100682094	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100682094C>T	uc003uxp.1	+	3	7450	c.7397C>T	c.(7396-7398)ACG>ATG	p.T2466M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2466	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|39.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGCACCACGCCGGTGGTC	0.522													5	208	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103179687	103179687	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103179687C>G	uc003vca.2	-	45	7178	c.7018G>C	c.(7018-7020)GGA>CGA	p.G2340R	RELN_uc010liz.2_Missense_Mutation_p.G2340R	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2340					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTGGTGCCTCCTGGGTGAAGC	0.473													14	185	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122774537	122774537	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122774537A>G	uc003vkm.2	-	8	884	c.859T>C	c.(859-861)TTT>CTT	p.F287L	SLC13A1_uc010lks.2_Missense_Mutation_p.F163L	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	287						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	GGGAAGGAAAACGTAAACCAT	0.438													5	314	---	---	---	---	PASS
CALD1	800	broad.mit.edu	37	7	134645241	134645241	+	Intron	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134645241T>C	uc003vrz.2	+						CALD1_uc003vry.2_3'UTR|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron|CALD1_uc011kpu.1_Intron|CALD1_uc011kpv.1_Intron|CALD1_uc003vse.2_Intron|CALD1_uc010lmn.2_Intron	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						CCAGGTAAAGTTTACTTCATT	0.328													19	229	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151970836	151970836	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151970836G>A	uc003wla.2	-	7	1185	c.966C>T	c.(964-966)CAC>CAT	p.H322H		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	322					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GCAGGAAGATGTGACTGAAAT	0.413			N		medulloblastoma								24	725	---	---	---	---	PASS
STAR	6770	broad.mit.edu	37	8	38001871	38001871	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38001871G>T	uc003xkv.1	-	8	988	c.724C>A	c.(724-726)CTG>ATG	p.L242M	STAR_uc010lwc.1_Missense_Mutation_p.L222M	NM_001007243	NP_001007244	P49675	STAR_HUMAN	steroidogenic acute regulatory protein isoform	260	START.				C21-steroid hormone biosynthetic process	mitochondrial intermembrane space	cholesterol transporter activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		GTCTGGGACAGGACCTGGTTG	0.582													66	36	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144992443	144992443	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144992443G>T	uc003zaf.1	-	32	12127	c.11957C>A	c.(11956-11958)CCG>CAG	p.P3986Q	PLEC_uc003zab.1_Missense_Mutation_p.P3849Q|PLEC_uc003zac.1_Missense_Mutation_p.P3853Q|PLEC_uc003zad.2_Missense_Mutation_p.P3849Q|PLEC_uc003zae.1_Missense_Mutation_p.P3817Q|PLEC_uc003zag.1_Missense_Mutation_p.P3827Q|PLEC_uc003zah.2_Missense_Mutation_p.P3835Q|PLEC_uc003zaj.2_Missense_Mutation_p.P3876Q	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3986	Plectin 21.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GTCGGTGGACGGGTCCACGTA	0.672													17	6	---	---	---	---	PASS
DMRT2	10655	broad.mit.edu	37	9	1056689	1056689	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1056689C>G	uc003zha.2	+	4	1302	c.1102C>G	c.(1102-1104)CAA>GAA	p.Q368E	DMRT2_uc003zgx.3_Missense_Mutation_p.Q135E|DMRT2_uc010mgz.2_Missense_Mutation_p.Q135E|DMRT2_uc003zgy.3_Missense_Mutation_p.Q212E|DMRT2_uc003zhb.3_3'UTR|DMRT2_uc011llt.1_3'UTR|DMRT2_uc011llu.1_3'UTR|DMRT2_uc011llv.1_Missense_Mutation_p.Q368E	NM_181872	NP_870987	Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor	368					male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		CACCTCAGTTCAAGCCCTGAA	0.542													46	95	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14748599	14748599	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14748599G>T	uc003zlm.2	-	31	6186	c.5596C>A	c.(5596-5598)CAC>AAC	p.H1866N	FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_Intron|FREM1_uc003zll.2_Missense_Mutation_p.H402N	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1866					cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		CATGTGCTGTGCTTGCTTTGG	0.493													91	243	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414379	20414379	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414379G>A	uc003zoe.2	-	5	724	c.465C>T	c.(463-465)AGC>AGT	p.S155S	MLLT3_uc011lne.1_Silent_p.S123S|MLLT3_uc011lnf.1_Silent_p.S152S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Silent_p.S123S	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	155	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.149			T	MLL	ALL								13	108	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32635220	32635220	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32635220T>C	uc003zrg.1	-	1	448	c.358A>G	c.(358-360)AGC>GGC	p.S120G	uc003zrh.1_Intron	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	120					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGTCTTTGGCTTTCATCTTCT	0.468													7	702	---	---	---	---	PASS
TMC1	117531	broad.mit.edu	37	9	75445375	75445375	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75445375T>C	uc004aiz.1	+	22	2678	c.2138T>C	c.(2137-2139)ATC>ACC	p.I713T	TMC1_uc010moz.1_Missense_Mutation_p.I671T|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.I567T|TMC1_uc010mpa.1_Missense_Mutation_p.I567T	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	713	Helical; (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						AGTTTGGCCATCTATTATCTC	0.284													5	220	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	84675927	84675927	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84675927G>A	uc010mpu.1	-	3	501	c.498C>T	c.(496-498)CTC>CTT	p.L166L		NM_001164339	NP_001157811			hypothetical protein LOC404770																		GGAGGAGGAGGAGAGCAGGCC	0.587													13	303	---	---	---	---	PASS
KIF27	55582	broad.mit.edu	37	9	86495397	86495397	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86495397T>C	uc004ana.2	-	11	2602	c.2458A>G	c.(2458-2460)AAG>GAG	p.K820E	KIF27_uc010mpw.2_Intron|KIF27_uc010mpx.2_Missense_Mutation_p.K820E	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	820	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						TCTTGTTGCTTCTTCTGCAAG	0.338													7	617	---	---	---	---	PASS
TBC1D2	55357	broad.mit.edu	37	9	100963824	100963824	+	Silent	SNP	C	T	T	rs145936813	byFrequency	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100963824C>T	uc011lvb.1	-	11	2574	c.2394G>A	c.(2392-2394)GCG>GCA	p.A798A	TBC1D2_uc004ayp.2_Silent_p.A338A|TBC1D2_uc004ayq.2_Silent_p.A798A|TBC1D2_uc004ayr.2_Silent_p.A580A|TBC1D2_uc004ayo.3_Silent_p.A798A	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	798	Rab-GAP TBC.					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TGAGACTGTCCGCAAAGACCA	0.597													29	53	---	---	---	---	PASS
C5	727	broad.mit.edu	37	9	123745015	123745015	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123745015G>A	uc004bkv.2	-	26	3338	c.3308C>T	c.(3307-3309)TCT>TTT	p.S1103F		NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein	1103					activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	CCACAATAAAGAATTACAAAT	0.289													72	314	---	---	---	---	PASS
ENTPD8	377841	broad.mit.edu	37	9	140331534	140331534	+	Intron	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140331534A>C	uc004cmw.2	-						C9orf167_uc011mew.1_Intron|ENTPD8_uc004cmx.2_Intron|ENTPD8_uc004cmy.2_3'UTR	NM_001033113	NP_001028285	Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8							integral to membrane|plasma membrane	ATP binding			skin(1)	1	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		GCCCGGCCCCACCCTGCCTGC	0.672													4	36	---	---	---	---	PASS
AKR1E2	83592	broad.mit.edu	37	10	4884625	4884625	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4884625T>C	uc001ihi.2	+	8	881	c.766T>C	c.(766-768)TTT>CTT	p.F256L	AKR1E2_uc001ihl.1_RNA|AKR1E2_uc010qam.1_Missense_Mutation_p.F160L|AKR1E2_uc001ihh.1_Missense_Mutation_p.F199L|AKR1E2_uc009xhw.2_Missense_Mutation_p.F158L|AKR1E2_uc001ihj.2_RNA|AKR1E2_uc001ihk.2_Missense_Mutation_p.F199L	NM_001040177	NP_001035267	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	256						cytoplasm	1,5-anhydro-D-fructose reductase activity				0						TTTGATCCGATTTCAAATCCA	0.383													5	360	---	---	---	---	PASS
AKR1C4	1109	broad.mit.edu	37	10	5246355	5246355	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5246355T>C	uc001ihw.2	+	3	301	c.268T>C	c.(268-270)TTT>CTT	p.F90L		NM_001818	NP_001809	P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	90					androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity			ovary(1)	1					NADH(DB00157)	GTGCACTTTCTTTCAACCACA	0.358													6	234	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5800947	5800947	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5800947A>T	uc001iij.2	+	18	7609	c.6984A>T	c.(6982-6984)GAA>GAT	p.E2328D	C10orf18_uc001iik.2_Missense_Mutation_p.E1172D	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	2328										ovary(1)|central_nervous_system(1)	2						AGCTAAAAGAAGATGAAAGGT	0.433													30	238	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49386082	49386082	+	Intron	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49386082A>T	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron|FRMPD2L1_uc001jgf.2_5'Flank|FRMPD2_uc001jgg.2_5'Flank|FRMPD2_uc001jgk.2_5'UTR	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		TCTCCTAAAAACTCTTACAGT	0.448													12	283	---	---	---	---	PASS
ZMYND17	118490	broad.mit.edu	37	10	75184156	75184156	+	3'UTR	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75184156A>G	uc001jud.2	-	7					ZMYND17_uc001juc.2_3'UTR|ZMYND17_uc009xrh.2_3'UTR|ZMYND17_uc009xrg.2_3'UTR	NM_001024593	NP_001019764	Q4VC12	ZMY17_HUMAN	zinc finger, MYND domain containing 17								zinc ion binding			ovary(1)	1	Prostate(51;0.0119)					gaaaCCAGTTATGTTATACAG	0.169													4	86	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95147582	95147582	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95147582A>G	uc001kin.2	-	19	1793	c.1670T>C	c.(1669-1671)ATT>ACT	p.I557T	MYOF_uc001kio.2_Missense_Mutation_p.I544T	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	557	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						ATCATTTGAAATGGGCTCAAG	0.463													7	492	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121563704	121563704	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121563704A>G	uc001leo.2	+	10	1302	c.1136A>G	c.(1135-1137)GAC>GGC	p.D379G		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	379	SAC.						phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		AACTTGGTAGACCAGGCAGGA	0.338													6	372	---	---	---	---	PASS
LRRC56	115399	broad.mit.edu	37	11	551241	551241	+	Silent	SNP	G	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:551241G>C	uc010qvz.1	+	9	1240	c.735G>C	c.(733-735)CTG>CTC	p.L245L		NM_198075	NP_932341	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	245	LRRCT.									skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCCGCGGCTGAGCCAGGACT	0.687													9	28	---	---	---	---	PASS
OR2AG1	144125	broad.mit.edu	37	11	6806389	6806389	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806389A>G	uc001mer.1	+	1	121	c.121A>G	c.(121-123)AGC>GGC	p.S41G		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	41	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GGCCCTGATCAGCAATGGCCT	0.527													103	247	---	---	---	---	PASS
TRIM66	9866	broad.mit.edu	37	11	8662083	8662083	+	Silent	SNP	T	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8662083T>G	uc010rbo.1	-	9	1599	c.1404A>C	c.(1402-1404)CCA>CCC	p.P468P		NM_014818	NP_055633	O15016	TRI66_HUMAN	tripartite motif-containing 66	468	Gln-rich.|Pro-rich.					aggresome|nucleus	zinc ion binding				0						gaaggggaggtgggggatggg	0.328													11	92	---	---	---	---	PASS
GALNTL4	374378	broad.mit.edu	37	11	11454268	11454268	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11454268T>C	uc001mjo.2	-	3	916	c.495A>G	c.(493-495)GAA>GAG	p.E165E		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	165	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		CTGAAAGCGCTTCATTGACGA	0.537													5	133	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14880674	14880674	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14880674A>G	uc001mln.2	+	13	2959	c.2606A>G	c.(2605-2607)AAC>AGC	p.N869S	PDE3B_uc010rcr.1_Missense_Mutation_p.N818S	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	869	Catalytic (By similarity).				cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						CCAGAATACAACTTCCTTCTT	0.358													7	633	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18725908	18725908	+	3'UTR	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18725908A>G	uc009yht.2	-	23					IGSF22_uc001mpa.2_RNA|TMEM86A_uc001moz.1_3'UTR	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22											ovary(4)|large_intestine(2)|kidney(1)	7						TGTTTACATTAACAAACACCA	0.502													5	83	---	---	---	---	PASS
OR4A5	81318	broad.mit.edu	37	11	51412339	51412339	+	Silent	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51412339A>T	uc001nhi.1	-	1	57	c.57T>A	c.(55-57)CCT>CCA	p.P19P		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	19	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				TTTGCACACCAGGATCCTGAG	0.423													10	80	---	---	---	---	PASS
OR8H1	219469	broad.mit.edu	37	11	56057618	56057618	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56057618T>C	uc010rje.1	-	1	921	c.921A>G	c.(919-921)AGA>AGG	p.R307R		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	307	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					TGGAGTCCTGTCTTCTCTGCA	0.333													22	176	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57982325	57982325	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57982325C>A	uc010rkc.1	+	1	109	c.109C>A	c.(109-111)CAA>AAA	p.Q37K		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	37	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				GGATGAGCATCAAAACCTCCT	0.433													178	607	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62782257	62782257	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62782257C>T	uc001nwo.2	-	2	310	c.174G>A	c.(172-174)GGG>GGA	p.G58G	SLC22A8_uc001nwp.2_Silent_p.G58G|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Silent_p.G58G	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	58	Extracellular (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						GCACCCAAGGCCCTGTGGAGG	0.632													5	441	---	---	---	---	PASS
SLC22A12	116085	broad.mit.edu	37	11	64367191	64367191	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64367191C>T	uc001oam.1	+	7	1861	c.1114C>T	c.(1114-1116)CAG>TAG	p.Q372*	SLC22A12_uc001oal.1_Nonsense_Mutation_p.Q151*|SLC22A12_uc009yps.1_Nonsense_Mutation_p.Q338*|SLC22A12_uc001oan.1_Nonsense_Mutation_p.Q264*|SLC22A12_uc009ypt.2_Nonsense_Mutation_p.Q190*	NM_144585	NP_653186	Q96S37	S22AC_HUMAN	urate anion exchanger 1 isoform a	372					cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity			ovary(1)	1						CCTGGACCTGCAGGCCCTGGG	0.453													3	44	---	---	---	---	PASS
NAALADL1	10004	broad.mit.edu	37	11	64822097	64822097	+	Silent	SNP	C	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64822097C>A	uc001ocn.2	-	5	733	c.717G>T	c.(715-717)CTG>CTT	p.L239L	NAALADL1_uc010rnw.1_5'UTR	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	239	Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						CTGAGGGGGGCAGGTACCAGG	0.612											OREG0032001	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	71	30	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73814219	73814219	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73814219A>G	uc001ouu.2	-	14	2764	c.2537T>C	c.(2536-2538)GTC>GCC	p.V846A		NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	846				V -> A (in Ref. 4; AAI10509).		centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					CCATGCGATGACAGATCTGGT	0.393													5	261	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95825362	95825362	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95825362C>T	uc001pfw.1	-	2	3118	c.1833G>A	c.(1831-1833)CAG>CAA	p.Q611Q		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	611					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgctgctgctgct	0.075			T	MECT1|CRTC3	salivary gland mucoepidermoid								21	442	---	---	---	---	PASS
CCDC82	79780	broad.mit.edu	37	11	96117475	96117475	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96117475T>C	uc009ywp.2	-	1	680	c.437A>G	c.(436-438)GAG>GGG	p.E146G	CCDC82_uc009ywq.2_Missense_Mutation_p.E146G|CCDC82_uc001pfx.3_Missense_Mutation_p.E146G|CCDC82_uc009ywr.2_Missense_Mutation_p.E146G|CCDC82_uc009yws.2_Missense_Mutation_p.E146G	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	146							protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		CTGATCATCCTCTATTATTTG	0.318													8	868	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909632	123909632	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909632A>T	uc001pzq.1	-	1	77	c.77T>A	c.(76-78)TTT>TAT	p.F26Y		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	26	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GAAGATTCCAAAGAGGGGGGC	0.572													104	31	---	---	---	---	PASS
TPI1	7167	broad.mit.edu	37	12	6978316	6978316	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6978316A>G	uc001qrk.2	+	3	331	c.293A>G	c.(292-294)GAG>GGG	p.E98G	TPI1_uc010sfo.1_Missense_Mutation_p.E16G	NM_000365	NP_000356	P60174	TPIS_HUMAN	triosephosphate isomerase 1 isoform 1	98					fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0						GGGCACTCAGAGAGAAGGCAT	0.522											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	249	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13761600	13761600	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13761600G>T	uc001rbt.2	-	9	2126	c.1947C>A	c.(1945-1947)AAC>AAA	p.N649K		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	649	Helical; (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	AGGCAGCTAAGTTGGCAGTGT	0.507													132	181	---	---	---	---	PASS
SYT10	341359	broad.mit.edu	37	12	33579206	33579206	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579206C>A	uc001rll.1	-	2	673	c.376G>T	c.(376-378)GCT>TCT	p.A126S	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	126	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GGCTCAATAGCTTTTACGGCT	0.398													17	492	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64823928	64823928	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64823928A>G	uc001ssb.2	+	17	2263	c.1837A>G	c.(1837-1839)AAA>GAA	p.K613E		NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	613	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		GGCAGAAAGGAAACAAGCCTT	0.413													5	305	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66800073	66800073	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66800073T>C	uc001stk.2	-	15	2059	c.1818A>G	c.(1816-1818)GAA>GAG	p.E606E	GRIP1_uc010sta.1_Silent_p.E550E|GRIP1_uc001stj.2_Silent_p.E388E|GRIP1_uc001stl.1_Silent_p.E498E|GRIP1_uc001stm.2_Silent_p.E606E	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	658	PDZ 5.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CTGAATTATCTTCATCTTTGC	0.398													6	351	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80645862	80645862	+	IGR	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80645862A>G								PPP1R12A (316627 upstream) : PTPRQ (192264 downstream)																							TTAGCTGATAAATGTGATGAT	0.328													5	323	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94975869	94975869	+	Missense_Mutation	SNP	C	T	T	rs144591334		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94975869C>T	uc001tdj.2	-	2	642	c.524G>A	c.(523-525)CGA>CAA	p.R175Q	TMCC3_uc001tdi.2_Missense_Mutation_p.R144Q	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	175						integral to membrane				ovary(1)|skin(1)	2						GGGGGCAGTTCGAGATTTCAC	0.498													3	75	---	---	---	---	PASS
PRDM4	11108	broad.mit.edu	37	12	108128129	108128129	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108128129G>A	uc001tmp.2	-	12	2701	c.2264C>T	c.(2263-2265)CCC>CTC	p.P755L	PRDM4_uc010sww.1_Missense_Mutation_p.P162L|PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	755					cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						ACTGGAGGTGGGCCCTTTGCA	0.463													5	802	---	---	---	---	PASS
OAS3	4940	broad.mit.edu	37	12	113384563	113384563	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113384563T>C	uc001tug.2	+	4	739	c.652T>C	c.(652-654)TTG>CTG	p.L218L		NM_006187	NP_006178	Q9Y6K5	OAS3_HUMAN	2'-5'oligoadenylate synthetase 3	218	OAS domain 1.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	microsome	ATP binding|nucleotidyltransferase activity|RNA binding			central_nervous_system(1)	1						CCTACAGGGGTTGTGGAAGGA	0.587													4	63	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	A	A	rs12366766		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547087G>A	uc001ujn.2	+	46	8210	c.8175G>A	c.(8173-8175)CAG>CAA	p.Q2725Q	EP400_uc001ujl.2_Silent_p.Q2724Q|EP400_uc001ujm.2_Silent_p.Q2644Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.289													6	91	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547141	132547141	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547141G>A	uc001ujn.2	+	46	8264	c.8229G>A	c.(8227-8229)CAG>CAA	p.Q2743Q	EP400_uc001ujl.2_Silent_p.Q2742Q|EP400_uc001ujm.2_Silent_p.Q2662Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2779	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacagcagcagcagc	0.323													9	85	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	30062042	30062042	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30062042A>T	uc001usl.3	+	9	3493	c.3435A>T	c.(3433-3435)GAA>GAT	p.E1145D	MTUS2_uc001usm.3_Missense_Mutation_p.E114D|MTUS2_uc010aau.2_Missense_Mutation_p.E24D|uc001usn.2_5'Flank	NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	1135	Localization to the growing distal tip of microtubules.|Potential.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						TCCAGGTGGAAGATCTCACCG	0.507													38	26	---	---	---	---	PASS
RB1	5925	broad.mit.edu	37	13	49030485	49030485	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49030485G>A	uc001vcb.2	+	19	2126	c.1960G>A	c.(1960-1962)GTG>ATG	p.V654M		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	654	Pocket; binds T and E1A.|Domain B.		V -> E (in RB).		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)|p.V654fs*4(1)|p.V654fs*6(1)|p.V654L(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTATAAAAAAGGTTAGTAGAT	0.229		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			55	49	---	---	---	---	PASS
LOC220429	220429	broad.mit.edu	37	13	50466815	50466815	+	Missense_Mutation	SNP	C	T	T	rs56215346	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50466815C>T	uc001vdk.2	+	1	2271	c.2089C>T	c.(2089-2091)CCA>TCA	p.P697S		NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						ACCTCTTGCTCCAATCAGAGG	0.502													11	26	---	---	---	---	PASS
DNAJC3	5611	broad.mit.edu	37	13	96361587	96361587	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96361587C>T	uc001vmq.2	+	2	297	c.189C>T	c.(187-189)GCC>GCT	p.A63A	DNAJC3_uc001vmp.2_Silent_p.A63A|DNAJC3_uc001vmr.2_Silent_p.A63A	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	63	TPR 1.				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			TTCATGCTGCCGTAGGTTTGT	0.328													4	282	---	---	---	---	PASS
DOCK9	23348	broad.mit.edu	37	13	99461719	99461719	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99461719T>C	uc001vnt.2	-	48	5312	c.5257A>G	c.(5257-5259)AGG>GGG	p.R1753G	DOCK9_uc001vnw.2_Missense_Mutation_p.R1752G|DOCK9_uc001vnv.1_RNA|DOCK9_uc010tir.1_Missense_Mutation_p.R1730G|DOCK9_uc001vnq.2_Missense_Mutation_p.R302G|DOCK9_uc001vnr.2_Missense_Mutation_p.R396G|DOCK9_uc010tin.1_Missense_Mutation_p.R373G|DOCK9_uc001vns.2_Missense_Mutation_p.R302G|DOCK9_uc010tio.1_Missense_Mutation_p.R422G|DOCK9_uc010tip.1_Missense_Mutation_p.R463G|DOCK9_uc001vnu.1_Missense_Mutation_p.R302G|DOCK9_uc010tiq.1_Missense_Mutation_p.R708G	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a	1753	DHR-2.				blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGGGCCAGCCTCTGGAAAGCA	0.507													4	55	---	---	---	---	PASS
LOC643677	643677	broad.mit.edu	37	13	103396498	103396498	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103396498T>C	uc001vpm.2	-	4	6689	c.6549A>G	c.(6547-6549)AAA>AAG	p.K2183K		NM_001146197	NP_001139669			hypothetical protein LOC643677												0						GGTGTTGCTTTTTCTTTCTGT	0.358													6	608	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19553434	19553434	+	Silent	SNP	T	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19553434T>G	uc001vuz.1	+	1	70	c.18T>G	c.(16-18)GGT>GGG	p.G6G	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	6										ovary(1)	1						CTGAGGCTGGTTCAATGCCGG	0.582													14	177	---	---	---	---	PASS
P704P	641455	broad.mit.edu	37	14	20019957	20019957	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20019957G>A	uc001vwc.3	-	1	316	c.264C>T	c.(262-264)GAC>GAT	p.D88D	P704P_uc001vwb.3_RNA	NM_001145442	NP_001138914	A6NI47	POTEM_HUMAN	prostate-specific P704P	88											0						TCATAGCAGAGTCGTCGTGGT	0.627													6	217	---	---	---	---	PASS
RPGRIP1	57096	broad.mit.edu	37	14	21793025	21793025	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21793025G>T	uc001wag.2	+	14	2011	c.2011G>T	c.(2011-2013)GGG>TGG	p.G671W	RPGRIP1_uc001wah.2_Missense_Mutation_p.G313W|RPGRIP1_uc001wai.2_Intron|RPGRIP1_uc001waj.1_Missense_Mutation_p.G136W|RPGRIP1_uc001wak.2_Missense_Mutation_p.G146W|RPGRIP1_uc010aim.2_Missense_Mutation_p.G54W|RPGRIP1_uc001wal.2_Intron|RPGRIP1_uc001wam.2_5'UTR	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	671					response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		ATTATCTGTGGGGCCACAGCC	0.507													17	186	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21993061	21993061	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21993061T>C	uc001wbe.2	-	2	1083	c.801A>G	c.(799-801)GCA>GCG	p.A267A	SALL2_uc010tly.1_Silent_p.A265A|SALL2_uc010tlz.1_Silent_p.A130A|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Silent_p.A132A|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	267							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		TGGGCGTTTCTGCCCCTgaag	0.512													4	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22933179	22933179	+	Intron	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22933179T>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdx.3_Intron|uc010tms.1_Intron|uc010aju.1_3'UTR|uc001wea.3_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GAAGCCACCCTCTTCACTCTT	0.488													5	210	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58563699	58563699	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58563699T>C	uc001xdc.2	-	5	1943	c.1832A>G	c.(1831-1833)GAG>GGG	p.E611G	C14orf37_uc010tro.1_Missense_Mutation_p.E649G|C14orf37_uc001xdd.2_Missense_Mutation_p.E611G	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	611	Extracellular (Potential).|Glu-rich.					integral to membrane	binding				0						ttcttGTCCCTCTAGGCAAAA	0.214													117	308	---	---	---	---	PASS
RGS6	9628	broad.mit.edu	37	14	72976891	72976891	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72976891G>T	uc001xna.3	+	14	1518	c.995G>T	c.(994-996)AGA>ATA	p.R332I	RGS6_uc010ttn.1_Missense_Mutation_p.R332I|RGS6_uc001xmx.3_Missense_Mutation_p.R332I|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.R332I|RGS6_uc010ttp.1_Missense_Mutation_p.R263I|RGS6_uc001xmz.1_Missense_Mutation_p.R193I	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	332					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CGAGTAAAAAGATGGGGCTTC	0.458													115	191	---	---	---	---	PASS
RPS6KL1	83694	broad.mit.edu	37	14	75376810	75376810	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75376810G>A	uc010tux.1	-	7	1234	c.706C>T	c.(706-708)CGA>TGA	p.R236*	RPS6KL1_uc001xqx.1_5'UTR|RPS6KL1_uc001xqw.2_Nonsense_Mutation_p.R205*|RPS6KL1_uc010asd.1_RNA	NM_031464	NP_113652	Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	236	Protein kinase.					ribosome	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00658)		CCAGAATGTCGGGAGTGCGCC	0.632													3	57	---	---	---	---	PASS
SPATA7	55812	broad.mit.edu	37	14	88904214	88904214	+	Silent	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88904214A>G	uc001xwq.2	+	12	1399	c.1248A>G	c.(1246-1248)AAA>AAG	p.K416K	SPATA7_uc001xwr.2_Silent_p.K384K|SPATA7_uc001xws.2_Silent_p.K352K|SPATA7_uc001xwt.2_Silent_p.K310K|SPATA7_uc001xwu.2_Silent_p.K72K	NM_018418	NP_060888	Q9P0W8	SPAT7_HUMAN	spermatogenesis-associated protein 7 isoform a	416					response to stimulus|visual perception					ovary(1)	1						ATGTCCTGAAAGTAGACTTAG	0.368													5	198	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89161750	89161750	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89161750A>G	uc001xxg.2	-	17	2579	c.2393T>C	c.(2392-2394)GTT>GCT	p.V798A	EML5_uc001xxh.1_5'UTR	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	798	WD 12.					cytoplasm|microtubule				ovary(3)	3						CCAGAGCACAACAGTATGGCT	0.373													6	450	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94069647	94069647	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94069647A>G	uc001ybv.1	+	23	3189	c.3106A>G	c.(3106-3108)AGA>GGA	p.R1036G	KIAA1409_uc001ybs.1_Missense_Mutation_p.R1036G	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1213						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		GAAGATCAAGAGAGCTCGCTT	0.512													16	274	---	---	---	---	PASS
SERPINA3	12	broad.mit.edu	37	14	95080851	95080851	+	Missense_Mutation	SNP	C	A	A	rs144060757		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95080851C>A	uc001ydp.2	+	2	152	c.73C>A	c.(73-75)CCT>ACT	p.P25T	SERPINA3_uc001ydo.3_Missense_Mutation_p.P50T|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.P25T|SERPINA3_uc001yds.2_Missense_Mutation_p.P25T|SERPINA3_uc010avg.2_Missense_Mutation_p.P25T	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	25					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		CCTCTGCCACCCTAACAGCCC	0.562													67	29	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31369136	31369136	+	5'UTR	SNP	C	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31369136C>A	uc001zfm.2	-	2					TRPM1_uc001zfn.3_5'UTR	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTAGGAATTACAAAGATACAT	0.388													6	676	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54556433	54556433	+	Silent	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54556433A>G	uc002ack.2	+	7	3516	c.3516A>G	c.(3514-3516)AAA>AAG	p.K1172K	UNC13C_uc002acl.2_Silent_p.K2K	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1172					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAGCAATGAAAGAAAGAATGA	0.383													6	393	---	---	---	---	PASS
FAM63B	54629	broad.mit.edu	37	15	59144098	59144098	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59144098T>C	uc002afj.2	+	8	1873	c.1671T>C	c.(1669-1671)GCT>GCC	p.A557A	FAM63B_uc002afi.2_Silent_p.A557A|FAM63B_uc002afk.2_RNA|FAM63B_uc002afl.2_RNA	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	557	Gln-rich.									central_nervous_system(1)	1						ACAGACGGGCTTCTCAATACT	0.453													4	242	---	---	---	---	PASS
NARG2	79664	broad.mit.edu	37	15	60770238	60770238	+	5'UTR	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60770238A>C	uc002agp.2	-	2					uc002ags.1_5'Flank|NARG2_uc002ago.2_5'UTR|NARG2_uc010bgk.2_5'UTR|NARG2_uc002agr.1_5'UTR	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a							nucleus				ovary(1)|lung(1)	2						CGAAGGCTCCAAGAGGCAGGA	0.483													159	77	---	---	---	---	PASS
SENP8	123228	broad.mit.edu	37	15	72432578	72432578	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72432578T>C	uc002atp.2	+	2	713	c.614T>C	c.(613-615)CTC>CCC	p.L205P		NM_145204	NP_660205	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	205					proteolysis		cysteine-type peptidase activity|protein binding			ovary(1)|skin(1)	2						TGGAAAGATCTCATTACCACA	0.448													4	117	---	---	---	---	PASS
ULK3	25989	broad.mit.edu	37	15	75134629	75134629	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75134629C>G	uc010bkf.1	-	2	341	c.235G>C	c.(235-237)GAC>CAC	p.D79H	ULK3_uc010ulp.1_5'UTR|ULK3_uc010ulq.1_Missense_Mutation_p.D90H|ULK3_uc010ulr.1_5'UTR|ULK3_uc002ayv.2_Missense_Mutation_p.D79H|ULK3_uc010uls.1_5'UTR|ULK3_uc010ult.1_5'UTR|ULK3_uc010ulu.1_5'UTR	NM_001099436	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51-like kinase 3	79	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			breast(2)	2						ACCTGAAAGTCTTTCAGCTGC	0.562													217	68	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85659326	85659326	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85659326A>T	uc002blh.2	+	16	1700	c.1511A>T	c.(1510-1512)GAA>GTA	p.E504V	PDE8A_uc002bli.2_Missense_Mutation_p.E458V|PDE8A_uc010bnc.2_Missense_Mutation_p.E257V|PDE8A_uc010bnd.2_Missense_Mutation_p.E257V|PDE8A_uc002blj.2_Missense_Mutation_p.E124V|PDE8A_uc002blk.2_Missense_Mutation_p.E124V	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	504					cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			GATATTTTTGAACTGGAGGCT	0.502													162	56	---	---	---	---	PASS
TEKT5	146279	broad.mit.edu	37	16	10788637	10788637	+	Missense_Mutation	SNP	T	C	C	rs145065368		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10788637T>C	uc002czz.1	-	1	166	c.94A>G	c.(94-96)ATC>GTC	p.I32V		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	32					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						CATTCCTGGATCACTGGCGCC	0.557													14	29	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	16465246	16465246	+	5'UTR	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16465246A>G	uc002dey.2	+	1										SubName: Full=cDNA FLJ42525 fis, clone BRACE3001391, highly similar to Polycystin;																		CTCTTTGGCTATATCAGCAAC	0.622													6	3	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19033105	19033105	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19033105T>C	uc002dfq.2	+	4	745	c.615T>C	c.(613-615)CCT>CCC	p.P205P	TMC7_uc010vao.1_Silent_p.P205P|TMC7_uc002dfp.2_Silent_p.P205P|TMC7_uc010vap.1_Silent_p.P95P	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	205	Cytoplasmic (Potential).					integral to membrane				skin(2)|ovary(1)	3						TGCTCATTCCTTTCAAAGACA	0.403													5	234	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	32070612	32070612	+	RNA	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32070612A>C	uc002ecv.1	+	1		c.65A>C								Homo sapiens IGH mRNA for immunoglobulin heavy chain VHDJ region, partial cds, clone:TRH1-22.																		GGTCTCCTGCAAGGCTTCTGG	0.552													4	58	---	---	---	---	PASS
MMP2	4313	broad.mit.edu	37	16	55539451	55539451	+	3'UTR	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55539451C>T	uc002ehz.3	+	13					MMP2_uc010vhd.1_3'UTR|MMP2_uc010ccc.2_3'UTR|MMP2_uc002eia.3_3'UTR	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a						angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	GGCAGCCGTGCCTTCAGCTCT	0.577													3	28	---	---	---	---	PASS
SPEM1	374768	broad.mit.edu	37	17	7324820	7324820	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7324820C>T	uc002ggv.2	+	3	851	c.826C>T	c.(826-828)CGG>TGG	p.R276W	FGF11_uc010vtw.1_Missense_Mutation_p.R10W	NM_199339	NP_955371	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	276	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|integral to membrane					0		Prostate(122;0.173)				GGAACTGACCCGGGAGGTGGA	0.622													6	31	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577498	7577498	+	Splice_Site	SNP	C	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577498C>A	uc002gim.2	-	7	976	c.782_splice	c.e7+1	p.S261_splice	TP53_uc002gig.1_Splice_Site_p.R261_splice|TP53_uc002gih.2_Splice_Site_p.S261_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.S129_splice|TP53_uc010cng.1_Splice_Site_p.S129_splice|TP53_uc002gii.1_Splice_Site_p.S129_splice|TP53_uc010cnh.1_Splice_Site_p.S261_splice|TP53_uc010cni.1_Splice_Site_p.S261_splice|TP53_uc002gij.2_Splice_Site_p.S261_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(25)|p.0?(7)|p.E258fs*71(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGGCTCCTGACCTGGAGTCTT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			68	28	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7721629	7721629	+	Splice_Site	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7721629G>A	uc002giu.1	+	68	10402	c.10388_splice	c.e68-1	p.G3463_splice	DNAH2_uc010cnm.1_Splice_Site_p.G401_splice	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CGTGGATGCAGGTGGTCGGCT	0.567													7	214	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9830062	9830062	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9830062G>A	uc002gmg.1	-	10	1071	c.910C>T	c.(910-912)CTG>TTG	p.L304L	GAS7_uc010vvc.1_Silent_p.L118L|GAS7_uc002gmh.1_Silent_p.L164L|GAS7_uc010vvd.1_Silent_p.L256L|GAS7_uc002gmi.2_Silent_p.L240L|GAS7_uc002gmj.1_Silent_p.L244L|GAS7_uc010coh.1_Silent_p.L244L	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	304					cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						AAGTTCATCAGGGGCTTCTCC	0.577			T	MLL	AML*								4	159	---	---	---	---	PASS
WNK4	65266	broad.mit.edu	37	17	40945664	40945664	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40945664C>T	uc002ibj.2	+	12	2233	c.2212C>T	c.(2212-2214)CGG>TGG	p.R738W	WNK4_uc010wgx.1_Missense_Mutation_p.R402W|WNK4_uc002ibk.1_Missense_Mutation_p.R510W|WNK4_uc010wgy.1_Missense_Mutation_p.R82W	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	738					intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CAGACGGATTCGGGAGATTAT	0.547													125	35	---	---	---	---	PASS
PRR15L	79170	broad.mit.edu	37	17	46030228	46030228	+	3'UTR	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46030228T>C	uc002imp.2	-	2						NM_024320	NP_077296	Q9BU68	PR15L_HUMAN	ATPase family, AAA domain containing 4											ovary(1)	1						CGTGGCAAGGTCCTGTCTCAG	0.537													4	95	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49054510	49054510	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49054510C>T	uc002itc.2	-	27	3691	c.3482G>A	c.(3481-3483)GGG>GAG	p.G1161E	SPAG9_uc002itb.2_Missense_Mutation_p.G1147E|SPAG9_uc002itd.2_Missense_Mutation_p.G1151E|SPAG9_uc002ita.2_Missense_Mutation_p.G1004E	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	1161					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			ATTTCCTGTCCCCACCCACAA	0.378													5	351	---	---	---	---	PASS
BRIP1	83990	broad.mit.edu	37	17	59761302	59761302	+	Silent	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59761302A>G	uc002izk.1	-	20	3246	c.3105T>C	c.(3103-3105)CGT>CGC	p.R1035R		NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1035	Interaction with BRCA1.				DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						CTGTTTTGAAACGGGGAGGAC	0.423			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	306	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60782826	60782826	+	Intron	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60782826G>A	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_3'UTR|uc002jaj.1_5'Flank|uc002jak.2_5'Flank	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190								ligase activity|zinc ion binding				0						ATGGCATTTGGTTCCACACAG	0.488													7	187	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66925795	66925795	+	Silent	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66925795A>G	uc002jhp.2	-	7	1025	c.846T>C	c.(844-846)CTT>CTC	p.L282L	ABCA8_uc002jhq.2_Silent_p.L282L|ABCA8_uc010wqq.1_Silent_p.L282L|ABCA8_uc010wqr.1_Silent_p.L221L|ABCA8_uc002jhr.2_Silent_p.L282L	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	282	Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					GTGCCAAGAAAAGGGCCATAA	0.378													6	293	---	---	---	---	PASS
UNC13D	201294	broad.mit.edu	37	17	73830529	73830529	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73830529C>T	uc002jpp.2	-	23	2555	c.2175G>A	c.(2173-2175)GAG>GAA	p.E725E	UNC13D_uc010wsk.1_Silent_p.E725E|UNC13D_uc002jpq.1_Silent_p.E375E	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	725					positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTACCCGCTGCTCCAGGGCCT	0.672									Familial_Hemophagocytic_Lymphohistiocytosis				17	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	109336	109336	+	RNA	SNP	G	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:109336G>T	uc002kke.2	+	1		c.272G>T								Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		tcttgcctaggctttgcctac	0.000													3	32	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7033091	7033091	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7033091C>T	uc002knm.2	-	15	2149	c.2055G>A	c.(2053-2055)TTG>TTA	p.L685L	LAMA1_uc010wzj.1_Silent_p.L161L	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	685	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGACGGACTCCAACCTACAAA	0.468													3	73	---	---	---	---	PASS
LOXHD1	125336	broad.mit.edu	37	18	44098173	44098173	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44098173C>T	uc010xcw.1	-	33	5132	c.5132G>A	c.(5131-5133)GGC>GAC	p.G1711D	LOXHD1_uc002lcg.1_Missense_Mutation_p.G1433D|LOXHD1_uc002lcd.3_Missense_Mutation_p.G12D|LOXHD1_uc002lce.3_Missense_Mutation_p.G566D|LOXHD1_uc002lcf.3_Missense_Mutation_p.G662D|LOXHD1_uc010xcv.1_Missense_Mutation_p.G644D|LOXHD1_uc010xcu.1_Missense_Mutation_p.G12D	NM_144612	NP_653213	Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1 isoform 1	1460	PLAT 10.				sensory perception of sound	stereocilium	protein binding				0						GGAGTCAGTGCCCCCGCCAAC	0.547													38	221	---	---	---	---	PASS
SERPINB13	5275	broad.mit.edu	37	18	61255920	61255920	+	Missense_Mutation	SNP	G	A	A	rs139825462		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61255920G>A	uc002ljc.2	+	2	187	c.19G>A	c.(19-21)GTC>ATC	p.V7I	SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Missense_Mutation_p.V7I|SERPINB13_uc010xeq.1_5'UTR|SERPINB13_uc010xer.1_5'UTR	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	7					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						ACTTGGCGCCGTCAGCACTCG	0.418													101	134	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9047434	9047434	+	Silent	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9047434A>G	uc002mkp.2	-	5	34401	c.34197T>C	c.(34195-34197)GAT>GAC	p.D11399D		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11401	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TATCTGGTACATCAGGTGAGA	0.453													354	215	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9074345	9074345	+	Silent	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9074345T>C	uc002mkp.2	-	3	13305	c.13101A>G	c.(13099-13101)ACA>ACG	p.T4367T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4369	Thr-rich.|Extracellular (Potential).|Ser-rich.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGCTCACATCTGTAAATGTGT	0.478													164	88	---	---	---	---	PASS
PRKACA	5566	broad.mit.edu	37	19	14213667	14213667	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14213667G>A	uc002myc.2	-	4	497	c.297C>T	c.(295-297)GTC>GTT	p.V99V	PRKACA_uc002myb.2_Silent_p.V91V|PRKACA_uc010xnm.1_Silent_p.V41V|PRKACA_uc002myd.2_Silent_p.V41V	NM_002730	NP_002721	P17612	KAPCA_HUMAN	cAMP-dependent protein kinase catalytic subunit	99	Protein kinase.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|regulation of insulin secretion|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|cAMP-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1						ACGGAAAGTTGACAGCTTGCA	0.587													21	325	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989682	15989682	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989682G>A	uc002nbs.1	-	13	1512	c.1462C>T	c.(1462-1464)CGC>TGC	p.R488C	CYP4F2_uc010xot.1_Missense_Mutation_p.R339C	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	488					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						ACGCGGAAGCGCAGCAGCGTG	0.682													21	16	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940439	22940439	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940439C>G	uc010xrh.1	-	5	1999	c.1999G>C	c.(1999-2001)GAG>CAG	p.E667Q		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CAGGGTTTCTCTGCAGTATGA	0.353													12	17	---	---	---	---	PASS
SLC7A9	11136	broad.mit.edu	37	19	33324141	33324141	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33324141A>G	uc002ntv.3	-	12	1430	c.1313T>C	c.(1312-1314)CTC>CCC	p.L438P	SLC7A9_uc002ntt.3_RNA|SLC7A9_uc002ntu.3_Missense_Mutation_p.L438P|SLC7A9_uc002ntw.3_Missense_Mutation_p.L229P	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9	438	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	CACACAGTAGAGGTACTCCCA	0.453													9	267	---	---	---	---	PASS
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34710315T>G	uc002nvb.3	+	7	997	c.801T>G	c.(799-801)GCT>GCG	p.A267A	LSM14A_uc002nva.3_Silent_p.A267A|LSM14A_uc010xru.1_Silent_p.A226A|LSM14A_uc002nvc.3_Silent_p.A73A	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a	267					cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438													4	149	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36211503	36211503	+	Silent	SNP	A	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36211503A>C	uc010eei.2	+	3	1254	c.1254A>C	c.(1252-1254)CCA>CCC	p.P418P		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	418	Pro-rich.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			cacccctcccacccccttcga	0.169													7	71	---	---	---	---	PASS
IL28B	282617	broad.mit.edu	37	19	39735134	39735134	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39735134C>T	uc010xut.1	-	2	185	c.181G>A	c.(181-183)GAA>AAA	p.E61K	IL28B_uc010xuu.1_Missense_Mutation_p.E61K	NM_172139	NP_742151	Q8IZI9	IL28B_HUMAN	interleukin 28B	61					response to virus	extracellular space	cytokine activity				0	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			AGCGACTCTTCCTAGACAGCA	0.602													58	31	---	---	---	---	PASS
ALDH16A1	126133	broad.mit.edu	37	19	49972161	49972161	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49972161T>A	uc002pnt.2	+	16	2281	c.2165T>A	c.(2164-2166)GTG>GAG	p.V722E	ALDH16A1_uc010yar.1_Missense_Mutation_p.V671E|ALDH16A1_uc010yas.1_Missense_Mutation_p.V557E|ALDH16A1_uc010yat.1_Missense_Mutation_p.V559E	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	722							oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		GCCAACGTGGTGACAGGAGAC	0.612													109	58	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53856702	53856702	+	Missense_Mutation	SNP	G	A	A	rs150688663	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53856702G>A	uc010ydv.1	+	4	2891	c.2774G>A	c.(2773-2775)CGT>CAT	p.R925H	ZNF845_uc010ydw.1_Missense_Mutation_p.R925H	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	925	C2H2-type 26.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAACCTTCCGTCACAATTCA	0.363													8	79	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53856730	53856730	+	Silent	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53856730G>A	uc010ydv.1	+	4	2919	c.2802G>A	c.(2800-2802)AAG>AAA	p.K934K	ZNF845_uc010ydw.1_Silent_p.K934K	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	934	C2H2-type 26.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAATTCATAAGACAATTCATA	0.368													7	66	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53856761	53856761	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53856761T>C	uc010ydv.1	+	4	2950	c.2833T>C	c.(2833-2835)TGT>CGT	p.C945R	ZNF845_uc010ydw.1_Missense_Mutation_p.C945R	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	945	C2H2-type 27.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACCTTACAAGTGTAATGAATG	0.348													7	70	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	20	31549395	31549395	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31549395A>G	uc010zub.1	+	27	3941	c.3847A>G	c.(3847-3849)AGC>GGC	p.S1283G		NM_001143967	NP_001137439			EF-hand calcium binding domain 8																		TGTGAAGGGGAGCTCCCATGT	0.607													5	71	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31688236	31688236	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31688236C>T	uc010zue.1	+	12	1589	c.1574C>T	c.(1573-1575)ACA>ATA	p.T525I		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	525						cytoplasm|extracellular region	lipid binding				0						CTCCAGGACACAGAATTCTTG	0.522													5	327	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47863849	47863849	+	Silent	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47863849C>T	uc002xui.2	-	14	5959	c.5712G>A	c.(5710-5712)ACG>ACA	p.T1904T		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1904							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGTTGTTGGCCGTGTCAGACC	0.517													4	185	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11058207	11058207	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058207G>A	uc002yit.1	-	3	441	c.233C>T	c.(232-234)ACA>ATA	p.T78I	BAGE_uc002yiw.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCAGGAAGATGTGACTGAAAT	0.408													7	284	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30414367	30414367	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30414367T>C	uc002ymy.2	+	11	1266	c.1064T>C	c.(1063-1065)GTT>GCT	p.V355A	USP16_uc002ymx.2_Missense_Mutation_p.V354A|USP16_uc002ymw.2_Missense_Mutation_p.V355A|USP16_uc011acm.1_Missense_Mutation_p.V340A|USP16_uc011acn.1_Intron|USP16_uc011aco.1_Missense_Mutation_p.V45A	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	355					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						CCAAGTTTTGTTGACCGCATC	0.308													5	268	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47976336	47976336	+	Intron	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47976336C>T	uc002zjo.2	+						DIP2A_uc011afy.1_Silent_p.R1109R|DIP2A_uc011afz.1_Intron|DIP2A_uc002zjr.2_Intron	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		gtggctcacgcctgtaatccc	0.154													4	218	---	---	---	---	PASS
SNAP29	9342	broad.mit.edu	37	22	21242127	21242127	+	3'UTR	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21242127A>G	uc011ahw.1	+	5						NM_004782	NP_004773	O95721	SNP29_HUMAN	synaptosomal-associated protein 29						cellular membrane fusion|exocytosis|protein transport|vesicle targeting	cell junction|cytoplasm|nucleus|synapse|synaptosome	SNAP receptor activity				0	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			AACTCTGAAGACAGACGGATT	0.338													5	254	---	---	---	---	PASS
BCR	613	broad.mit.edu	37	22	23615958	23615958	+	Silent	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23615958A>G	uc002zww.2	+	8	2708	c.2112A>G	c.(2110-2112)GGA>GGG	p.G704G	BCR_uc002zwx.2_Silent_p.G704G|BCR_uc011aiy.1_Silent_p.G293G|BCR_uc010gtx.1_Silent_p.G171G	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1	704					regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						TGAAGAAGGGAGAGGTGAGTG	0.622			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								4	89	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26743741	26743741	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26743741A>G	uc003acb.2	+	11	2425	c.2269A>G	c.(2269-2271)ACC>GCC	p.T757A	SEZ6L_uc003acc.2_Missense_Mutation_p.T757A|SEZ6L_uc011akc.1_Missense_Mutation_p.T757A|SEZ6L_uc003acd.2_Missense_Mutation_p.T757A|SEZ6L_uc011akd.1_Missense_Mutation_p.T757A|SEZ6L_uc003ace.2_Missense_Mutation_p.T757A|SEZ6L_uc003acf.1_Missense_Mutation_p.T530A|SEZ6L_uc010gvc.1_Missense_Mutation_p.T530A|SEZ6L_uc011ake.1_RNA	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	757	Sushi 3.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						TGGCTGGAAAACCACTTCTCA	0.532													5	199	---	---	---	---	PASS
SERHL2	253190	broad.mit.edu	37	22	42951997	42951997	+	Intron	SNP	T	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42951997T>G	uc003bcr.2	+						SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Intron|SERHL2_uc010gyz.2_Intron|SERHL2_uc010gyy.2_Intron|SERHL2_uc011apo.1_Intron|RRP7B_uc003bcs.2_RNA	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2							perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						CCCCAACTGGTGGGAAGAAGC	0.592													8	58	---	---	---	---	PASS
TIMM17B	10245	broad.mit.edu	37	X	48751506	48751506	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48751506T>C	uc004dlc.1	-	5	342	c.193A>G	c.(193-195)AGC>GGC	p.S65G	TIMM17B_uc004dla.1_Missense_Mutation_p.S115G|TIMM17B_uc004dlb.1_Missense_Mutation_p.S85G	NM_005834	NP_005825	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17	65	Helical; (Potential).				protein targeting to mitochondrion	integral to membrane|microtubule cytoskeleton|mitochondrial inner membrane presequence translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1						ACTGCGAAGCTACCTGTAGTG	0.552													27	79	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49089789	49089789	+	5'UTR	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49089789A>G	uc004dnb.2	-	1					CACNA1F_uc010nip.2_5'UTR|CCDC22_uc011mna.1_5'Flank|CCDC22_uc004dnc.1_5'Flank|CCDC22_uc004dnd.1_5'Flank	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	TCGAGATTGAAGGGCCATCTG	0.577													6	359	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63410157	63410157	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63410157A>G	uc004dvo.2	-	2	3283	c.3010T>C	c.(3010-3012)TCA>CCA	p.S1004P		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	1004	Pro-rich.				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						ACTGATAGTGATATTGACATG	0.552													5	81	---	---	---	---	PASS
TAF9B	51616	broad.mit.edu	37	X	77387181	77387181	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77387181A>G	uc004eda.2	-	7	753	c.682T>C	c.(682-684)TCA>CCA	p.S228P		NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B	228					negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0						GTGTTCTGTGACGAAACCATG	0.363													7	700	---	---	---	---	PASS
GPC3	2719	broad.mit.edu	37	X	132730618	132730618	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132730618T>C	uc004exe.1	-	7	1613	c.1423A>G	c.(1423-1425)ACC>GCC	p.T475A	GPC3_uc004exd.1_Missense_Mutation_p.T347A|GPC3_uc010nrn.1_Missense_Mutation_p.T498A|GPC3_uc011mvh.1_Missense_Mutation_p.T459A|GPC3_uc010nro.1_Missense_Mutation_p.T421A	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor	475						extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					ATAGACATGGTTCTCAGGAGC	0.438			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				6	391	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6573	6573	+	5'UTR	SNP	G	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6573G>A	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		TCGACCCCGCCGGAGGAGGAG	0.483													45	322	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7810	7810	+	RNA	SNP	C	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7810C>T	uc004cou.3	+	1		c.225C>T			uc011mfi.1_5'Flank|uc004cov.3_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP42.																		ATCCTAGTCCTCATCGCCCTC	0.463													107	170	---	---	---	---	PASS
AGRN	375790	broad.mit.edu	37	1	985444	985444	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:985444delG	uc001ack.1	+							NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor						axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCTCGGGGCAGGGGGGGGGGG	0.657													9	6	---	---	---	---	
C1orf159	54991	broad.mit.edu	37	1	1050654	1050655	+	Intron	INS	-	A	A	rs140546317	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1050654_1050655insA	uc001act.2	-						C1orf159_uc001acu.2_Intron|C1orf159_uc001acr.2_Intron|C1orf159_uc001acs.2_Intron	NM_017891	NP_060361	Q96HA4	CA159_HUMAN	hypothetical protein LOC54991							integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		GCCACCGGAACACGCGCTCCCG	0.530													0	6	---	---	---	---	
MORN1	79906	broad.mit.edu	37	1	2304199	2304199	+	Intron	DEL	A	-	-	rs149731938	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2304199delA	uc001ajb.1	-						MORN1_uc009vld.2_Intron|MORN1_uc001ajd.1_Intron	NM_024848	NP_079124	Q5T089	MORN1_HUMAN	MORN repeat containing 1											ovary(2)|central_nervous_system(1)	3	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CAGAGCAGCGACCTGGGCAGT	0.652													1	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2765903	2765903	+	IGR	DEL	T	-	-	rs60587734		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2765903delT								MMEL1 (201422 upstream) : ACTRT2 (172143 downstream)																							GAGCCCTGTGTCCTGGGTGGG	0.627													10	7	---	---	---	---	
DFFA	1676	broad.mit.edu	37	1	10521380	10521380	+	3'UTR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10521380delA	uc001arj.2	-	6					DFFA_uc001ark.2_3'UTR	NM_004401	NP_004392	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		TGGTGGGGCTAAAAAAAAAAT	0.433													5	3	---	---	---	---	
IGSF21	84966	broad.mit.edu	37	1	18679639	18679640	+	Intron	INS	-	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18679639_18679640insT	uc001bau.1	+							NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		TTTGTTGTTGCTTTTTTTTTTC	0.431													6	3	---	---	---	---	
CDA	978	broad.mit.edu	37	1	20940784	20940785	+	Intron	INS	-	A	A	rs139921363	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20940784_20940785insA	uc001bdk.2	+						CDA_uc001bdl.2_Intron|CDA_uc009vpv.2_Intron	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase						cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	acaaaatgcagaaaaaaaaaag	0.000													5	3	---	---	---	---	
SPOCD1	90853	broad.mit.edu	37	1	32276520	32276521	+	Intron	DEL	CA	-	-	rs61779652	byFrequency	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32276520_32276521delCA	uc001bts.1	-						SPOCD1_uc001btu.2_Intron|SPOCD1_uc001btv.2_Intron	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1						transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		AGAGTTGCCCCACACACACACA	0.599													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38538454	38538454	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38538454delC								POU3F1 (26004 upstream) : RRAGC (766561 downstream)																							tcagctatagccccaccccta	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39152859	39152859	+	IGR	DEL	T	-	-	rs4147131	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39152859delT								POU3F1 (640409 upstream) : RRAGC (152156 downstream)																							tagtaaaaaattcccttcctt	0.000													4	2	---	---	---	---	
TMEM48	55706	broad.mit.edu	37	1	54266763	54266763	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54266763delA	uc001cvs.2	-						TMEM48_uc010onu.1_Intron|TMEM48_uc001cvt.2_Intron|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Intron	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						CACACATACCAAAAAAAAAAA	0.348													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59096307	59096308	+	IGR	DEL	AC	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59096307_59096308delAC								TACSTD2 (53141 upstream) : MYSM1 (29282 downstream)																							tttttCCCTTACACTTTAAAAA	0.371													18	8	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62307807	62307807	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62307807delA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						ACTGACTTCCAAAAACCTCAG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	79132403	79132403	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79132403delA								IFI44 (2642 upstream) : ELTD1 (223048 downstream)																							TATTTGTGTTAAAAAAAAAAA	0.378													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	91512693	91512694	+	IGR	INS	-	T	T	rs67116804		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91512693_91512694insT								ZNF644 (25022 upstream) : HFM1 (213630 downstream)																							ccttctttctgttttttttttt	0.094													10	6	---	---	---	---	
TGFBR3	7049	broad.mit.edu	37	1	92181546	92181546	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92181546delT	uc001doh.2	-						TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CACTTGCCAATTTTTTTTTTT	0.343													9	4	---	---	---	---	
GSTM2	2946	broad.mit.edu	37	1	110209358	110209358	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110209358delT	uc001dyi.2	+						GSTM2_uc001dyj.2_5'Flank|GSTM2_uc010ovt.1_5'Flank|GSTM2_uc009wfk.2_5'Flank	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1						glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	tttctttttcttttttttgag	0.239													4	2	---	---	---	---	
SPAG17	200162	broad.mit.edu	37	1	118614492	118614492	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118614492delA	uc001ehk.2	-							NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		agatttccagaaaaaaaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120665943	120665944	+	IGR	DEL	AT	-	-	rs71890761		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120665943_120665944delAT								NOTCH2 (53667 upstream) : FAM72B (173061 downstream)																							aaatatgcacatagtttaaaga	0.129													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143423460	143423461	+	IGR	INS	-	G	G	rs113197697		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143423460_143423461insG								None (None upstream) : LOC100286793 (224178 downstream)																							ccagtgcaacacacacacagca	0.000													5	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145012806	145012806	+	Intron	DEL	T	-	-	rs58323921		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145012806delT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_5'Flank	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAACATAAATGATAATTGTC	0.343			T	PDGFRB	MPD								12	10	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145012913	145012914	+	Intron	INS	-	T	T	rs67707497		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145012913_145012914insT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_5'Flank	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATCAAAGAGCCTTTTTTCTCTA	0.317			T	PDGFRB	MPD								10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149273583	149273583	+	IGR	DEL	A	-	-	rs145342820		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149273583delA								LOC645166 (320529 upstream) : LOC388692 (5893 downstream)																							GAGATCCGTCACCCCCTCCTG	0.483													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153767371	153767372	+	IGR	DEL	GT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153767371_153767372delGT								SLC27A3 (14739 upstream) : GATAD2B (9832 downstream)																							TTTAATCCAAgtgtgtgtgtgt	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154350594	154350594	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154350594delT								ATP8B2 (26815 upstream) : IL6R (27075 downstream)																							TCTTTTTTTCTTTTTTTTTTT	0.338													4	4	---	---	---	---	
CADM3	57863	broad.mit.edu	37	1	159172281	159172281	+	3'UTR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159172281delT	uc001ftl.2	+	9					CADM3_uc001ftk.2_3'UTR|uc001ftm.1_5'Flank|DARC_uc001fto.2_5'Flank|DARC_uc001ftp.3_5'Flank	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2						adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					CCACCACCTATTTTTTCCCAT	0.542													4	2	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	172223084	172223084	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172223084delT	uc001gie.2	+						DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						TCTTCATCCAttttttttttc	0.144													5	4	---	---	---	---	
ACBD6	84320	broad.mit.edu	37	1	180471054	180471054	+	Intron	DEL	C	-	-	rs12723183	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180471054delC	uc001gog.2	-							NM_032360	NP_115736	Q9BR61	ACBD6_HUMAN	acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1						AAAAAAAAAACAAAACAAAAT	0.403													7	4	---	---	---	---	
RGS8	85397	broad.mit.edu	37	1	182635791	182635791	+	Intron	DEL	A	-	-	rs72174385		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182635791delA	uc010pnw.1	-						RGS8_uc001gpn.1_Intron|RGS8_uc001gpm.1_Intron	NM_001102450	NP_001095920	P57771	RGS8_HUMAN	regulator of G-protein signalling 8 isoform 2						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)	1						CTTACTTAGGAAAAAAAAAAA	0.358													9	5	---	---	---	---	
RGL1	23179	broad.mit.edu	37	1	183849500	183849501	+	Intron	INS	-	AAAC	AAAC	rs113953745		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183849500_183849501insAAAC	uc001gqo.2	+						RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Intron	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						TAGCCTCCTTAAAACAAACAAA	0.337													2	7	---	---	---	---	
PTGS2	5743	broad.mit.edu	37	1	186646587	186646588	+	Intron	DEL	TG	-	-	rs4648272		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186646587_186646588delTG	uc001gsb.2	-						PTGS2_uc009wyo.2_Intron	NM_000963	NP_000954	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 precursor						cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	tgtgcatgtctgtgtgtgtgtA	0.178													5	10	---	---	---	---	
CACNA1S	779	broad.mit.edu	37	1	201076818	201076819	+	Intron	DEL	AG	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201076818_201076819delAG	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CAATAGGGCAAGAGAGAGAGTG	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213570078	213570078	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213570078delC								RPS6KC1 (123271 upstream) : PROX1 (591208 downstream)																							TTTGTTTGTTCCATACGCGTT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226539738	226539738	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226539738delT								LIN9 (42168 upstream) : PARP1 (8655 downstream)																							TTAGCTCTAATTTTTTTTACC	0.398													4	2	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	971333	971334	+	Intron	INS	-	A	A	rs150179332	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:971333_971334insA	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TAATGTTTGACAAAAAATACCT	0.332													1	6	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9597276	9597277	+	Intron	INS	-	TG	TG	rs144741867	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9597276_9597277insTG	uc002qzo.1	+						CPSF3_uc010ewx.1_Intron|CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TGGAAAgtatatgtgtgtgtgt	0.218													16	7	---	---	---	---	
RBKS	64080	broad.mit.edu	37	2	28065746	28065746	+	Intron	DEL	T	-	-	rs78190424		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28065746delT	uc002rlo.1	-						RBKS_uc010ezi.1_Intron|RBKS_uc010ymg.1_Intron	NM_022128	NP_071411	Q9H477	RBSK_HUMAN	ribokinase						D-ribose metabolic process		ATP binding|ribokinase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					GCTACTCATGTTTTTTTTTTT	0.303													9	5	---	---	---	---	
DNAH6	1768	broad.mit.edu	37	2	84832316	84832316	+	Intron	DEL	A	-	-	rs148514310		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84832316delA	uc010fgb.2	+							NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						ttaaaaatacaaaaaaaaaaa	0.000													5	4	---	---	---	---	
SNRNP200	23020	broad.mit.edu	37	2	96950487	96950488	+	Intron	INS	-	T	T	rs150751016		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96950487_96950488insT	uc002svu.2	-						SNRNP200_uc002svt.2_5'Flank|SNRNP200_uc010yuj.1_Intron|SNRNP200_uc002svv.1_5'UTR	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						GCAGCtttttcttttttttttt	0.243													8	6	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97817315	97817315	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97817315delT	uc010yva.1	+						ANKRD36_uc010yuz.1_Intron|ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						AAATTACATATGAGTACATTT	0.249													12	8	---	---	---	---	
LONRF2	164832	broad.mit.edu	37	2	100916481	100916482	+	Intron	INS	-	GG	GG	rs139033934	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100916481_100916482insGG	uc002tal.3	-						LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						GGAAAAAAAAAGGGGGGGGCAT	0.337													12	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	111395198	111395199	+	IGR	INS	-	G	G	rs35425666		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111395198_111395199insG								LOC151009 (253085 upstream) : BUB1 (212 downstream)																							tgtgtgtgtgtTTACACAGACA	0.297													3	3	---	---	---	---	
PAX8	7849	broad.mit.edu	37	2	114004578	114004579	+	Intron	DEL	GT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114004578_114004579delGT	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						ACAGGTGCTGGTGTGTGTGTGT	0.569			T	PPARG	follicular thyroid		Thyroid dysgenesis 						6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131578081	131578081	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131578081delC								FAM123C (52374 upstream) : ARHGEF4 (94705 downstream)																							GAAACACGCACCCCACGCAGA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133054043	133054043	+	IGR	DEL	A	-	-	rs112881670		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133054043delA								NCRNA00164 (38501 upstream) : GPR39 (120104 downstream)																							tcaacttaggaacttggttaa	0.000													3	4	---	---	---	---	
CCDC148	130940	broad.mit.edu	37	2	159161554	159161555	+	Intron	DEL	AA	-	-	rs76409668		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159161554_159161555delAA	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148											ovary(2)	2						gagtgctcacaaaaaaaatatc	0.144													4	2	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171207846	171207846	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171207846delT	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002uga.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						AGGGGAGAGGTTATGTGATCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201043520	201043520	+	IGR	DEL	A	-	-	rs35608644		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201043520delA								C2orf47 (214675 upstream) : SPATS2L (127084 downstream)																							cagcattcatacctccatggc	0.000													0	8	---	---	---	---	
CREB1	1385	broad.mit.edu	37	2	208439936	208439945	+	Intron	DEL	AATGTTTTAA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208439936_208439945delAATGTTTTAA	uc002vcc.2	+						CREB1_uc010ziz.1_Intron|CREB1_uc002vcd.2_Intron|CREB1_uc010zja.1_Intron	NM_134442	NP_604391	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1						activation of phospholipase C activity|axon guidance|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein dimerization activity|transcription cofactor activity		EWSR1/CREB1(42)	soft_tissue(42)|breast(1)|central_nervous_system(1)	44				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Bromocriptine(DB01200)|Naloxone(DB01183)	CATTGGATGTAATGTTTTAAAAGTCTTATA	0.343			T	EWSR1	clear cell sarcoma|angiomatoid fibrous histiocytoma								21	36	---	---	---	---	
SRGAP3	9901	broad.mit.edu	37	3	9209250	9209250	+	Intron	DEL	G	-	-	rs73019366	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9209250delG	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TCAACGCCTAGGGGGGGAGCA	0.542			T	RAF1	pilocytic astrocytoma								4	2	---	---	---	---	
UBE2E2	7325	broad.mit.edu	37	3	23624385	23624385	+	Intron	DEL	T	-	-	rs78400541	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23624385delT	uc003ccg.2	+						UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2						ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0						tgtgtgtgtgttgtgtgtttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	34154781	34154781	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34154781delT								PDCD6IP (243587 upstream) : None (None downstream)																							AAGGTGTTTGTTTTTTTTTTC	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	36226702	36226703	+	IGR	DEL	CA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36226702_36226703delCA								ARPP21 (390715 upstream) : STAC (195394 downstream)																							tctaggccttcaacgggcctcc	0.104													4	2	---	---	---	---	
CX3CR1	1524	broad.mit.edu	37	3	39308292	39308293	+	Intron	DEL	TA	-	-	rs4271863	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39308292_39308293delTA	uc003cjl.2	-							NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1						cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		tttttttttttaaatggagtct	0.000													4	4	---	---	---	---	
TKT	7086	broad.mit.edu	37	3	53261822	53261823	+	Intron	INS	-	G	G	rs139358615	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53261822_53261823insG	uc003dgo.2	-						TKT_uc003dgp.2_Intron|TKT_uc011beo.1_Intron|TKT_uc003dgq.2_Intron|TKT_uc011beq.1_Intron|TKT_uc011ber.1_Intron|TKT_uc011bep.1_Intron	NM_001135055	NP_001128527	P29401	TKT_HUMAN	transketolase isoform 1						energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|transketolase activity			ovary(2)	2		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)	Thiamine(DB00152)	gccaccatgctGGGGGGGTCTC	0.277													0	8	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57431275	57431276	+	Intron	INS	-	T	T	rs143948220	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57431275_57431276insT	uc003dit.2	-							NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						CTAAACTCTAATTTTTTTTAGT	0.277													6	13	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65806725	65806726	+	Intron	INS	-	GGT	GGT	rs146925983	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65806725_65806726insGGT	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GCAAAGGAAAGGGTGGTGGTAG	0.257													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	73236064	73236065	+	IGR	DEL	AA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73236064_73236065delAA								PPP4R2 (121053 upstream) : PDZRN3 (195587 downstream)																							TAATTCAGTTAAAAAAAAAAAA	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75150380	75150380	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75150380delT								CNTN3 (580037 upstream) : FAM86D (320325 downstream)																							ctataacctattttttgaggg	0.000													4	2	---	---	---	---	
HEG1	57493	broad.mit.edu	37	3	124710007	124710008	+	Intron	INS	-	C	C	rs76523041		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124710007_124710008insC	uc003ehs.3	-						HEG1_uc003ehr.3_Intron|HEG1_uc011bke.1_Intron	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor							extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						tttttttttttttctgagatag	0.188													23	11	---	---	---	---	
EEFSEC	60678	broad.mit.edu	37	3	127965305	127965305	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127965305delT	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						AGTACGAAACTTTTTTTTTTC	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186416388	186416389	+	IGR	INS	-	AT	AT			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186416388_186416389insAT								HRG (20366 upstream) : KNG1 (18731 downstream)																							GCTGTTTTCAGATGTCCATCTG	0.426													3	19	---	---	---	---	
LEPREL1	55214	broad.mit.edu	37	3	189772217	189772217	+	Intron	DEL	A	-	-	rs78282785		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189772217delA	uc011bsk.1	-						LEPREL1_uc003fsg.2_Intron	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a						collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TGGTAGAGAGAAAAAAAAAAG	0.259													3	3	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	57746	57746	+	Intron	DEL	A	-	-	rs111852468		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57746delA	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CTGGAAAAACAAAAGGGTTTT	0.303													4	6	---	---	---	---	
WHSC1	7468	broad.mit.edu	37	4	1926476	1926476	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1926476delA	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gdy.1_Intron|WHSC1_uc010icd.1_Intron|WHSC1_uc003gea.1_Intron|WHSC1_uc010ice.1_Intron|WHSC1_uc003geh.1_Intron	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		tcatctctacaaaaaaaaaaa	0.000			T	IGH@	MM								4	2	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3364206	3364209	+	Intron	DEL	TGTA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3364206_3364209delTGTA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		tgagggtgtgtgtatgtgagggtg	0.000													4	3	---	---	---	---	
LAP3	51056	broad.mit.edu	37	4	17600384	17600385	+	Intron	INS	-	T	T	rs138457020	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17600384_17600385insT	uc003gph.1	+							NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3						proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0						CCAAGCTGTACtttttttttga	0.178													6	12	---	---	---	---	
FLJ13197	79667	broad.mit.edu	37	4	38645166	38645167	+	Intron	INS	-	ATGG	ATGG	rs140459474	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38645166_38645167insATGG	uc003gte.1	-						FLJ13197_uc003gtf.2_Intron	NR_026804				Homo sapiens clone pp6414 unknown mRNA.												0						ttagatAGCTAatggatggatg	0.153													4	3	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39230425	39230425	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39230425delT	uc003gtv.2	+						WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						CTTGCAAGAATtttttttttt	0.129													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49533889	49533889	+	IGR	DEL	T	-	-	rs56205126	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49533889delT								CWH43 (469796 upstream) : None (None downstream)																							gaaaaaaaaattagcgggtgt	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53715623	53715624	+	IGR	INS	-	T	T	rs145374941	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53715623_53715624insT								KIAA0114 (135318 upstream) : RASL11B (12871 downstream)																							TTTCTGCCCAATTCCTCCAGCT	0.436													0	10	---	---	---	---	
CSN1S1	1446	broad.mit.edu	37	4	70812163	70812163	+	3'UTR	DEL	T	-	-	rs139563918		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70812163delT	uc003hep.1	+	16					CSN1S1_uc003heq.1_3'UTR	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0						GTTTACTAAGTTTTCTAGTGG	0.328													2	12	---	---	---	---	
MRPL1	65008	broad.mit.edu	37	4	78815073	78815073	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78815073delT	uc003hku.2	+						MRPL1_uc010iji.1_Intron	NM_020236	NP_064621	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1 precursor								RNA binding				0						AAACCATTAATTTTTTTTTTT	0.323													5	3	---	---	---	---	
SCD5	79966	broad.mit.edu	37	4	83552278	83552279	+	3'UTR	INS	-	A	A	rs139259208		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83552278_83552279insA	uc003hna.2	-	5						NM_001037582	NP_001032671	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				acaaaacaaacaaaaaaaaaaa	0.144													2	4	---	---	---	---	
HELQ	113510	broad.mit.edu	37	4	84339020	84339020	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84339020delT	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TCCTGTTATGTTTTTTTTTTC	0.398								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	92774643	92774644	+	IGR	DEL	AA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92774643_92774644delAA								FAM190A (251274 upstream) : GRID2 (450906 downstream)																							ttgaaattgcaaaaaaaaaaaA	0.178													4	2	---	---	---	---	
LEF1	51176	broad.mit.edu	37	4	108991632	108991632	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108991632delA	uc003hyt.1	-						LEF1_uc011cfj.1_Intron|LEF1_uc011cfk.1_Intron|LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_Intron|LEF1_uc003hys.1_Intron|LEF1_uc010ima.1_Intron	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1						canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		cacccatagcaaaaaaaaaaa	0.134													15	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	121182103	121182104	+	IGR	INS	-	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121182103_121182104insA								MAD2L1 (194090 upstream) : PRDM5 (433826 downstream)																							CTCTGAATCAGAAAAAAAAAAA	0.243													3	3	---	---	---	---	
CPE	1363	broad.mit.edu	37	4	166398882	166398882	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166398882delA	uc003irg.3	+							NM_001873	NP_001864	P16870	CBPE_HUMAN	carboxypeptidase E preproprotein						cardiac left ventricle morphogenesis|neuropeptide signaling pathway|protein modification process	extracellular region|nucleus|plasma membrane	metallocarboxypeptidase activity|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	Glucagon recombinant(DB00040)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TAGCTGTGAGAAAAAAAAAAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185500599	185500600	+	IGR	INS	-	A	A	rs56024521		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185500599_185500600insA								IRF2 (104873 upstream) : CASP3 (48252 downstream)																							gactccgtctcaaaaaaaaaaa	0.000													2	6	---	---	---	---	
ZDHHC11	79844	broad.mit.edu	37	5	845557	845557	+	Intron	DEL	C	-	-	rs11347292		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:845557delC	uc011cma.1	-						ZDHHC11_uc003jbj.2_Intron|ZDHHC11_uc010itd.1_5'Flank|ZDHHC11_uc003jbk.2_5'Flank	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CTCCCCGCAGCCACCCAGGGA	0.607													14	7	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10405429	10405429	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10405429delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CCAATGAATGTTTTTTTTTTC	0.358													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29037130	29037131	+	IGR	INS	-	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29037130_29037131insT								None (None upstream) : None (None downstream)																							gaaatactttatttaccttgta	0.000													4	2	---	---	---	---	
ADAMTS12	81792	broad.mit.edu	37	5	33546481	33546481	+	Intron	DEL	A	-	-	rs74463306		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33546481delA	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CTCACTATTTAAAAAAAAAAA	0.318										HNSCC(64;0.19)			9	6	---	---	---	---	
ARHGEF37	389337	broad.mit.edu	37	5	148995699	148995700	+	Intron	DEL	GA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148995699_148995700delGA	uc003lra.1	+							NM_001001669	NP_001001669	A1IGU5	ARH37_HUMAN	hypothetical protein LOC389337						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0						agagaaagtggagagagaggga	0.000													4	2	---	---	---	---	
GLRA1	2741	broad.mit.edu	37	5	151228719	151228719	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151228719delT	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ctttcttttcttttcttttct	0.025													3	3	---	---	---	---	
UBTD2	92181	broad.mit.edu	37	5	171662296	171662296	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171662296delA	uc003mbp.1	-							NM_152277	NP_689490	Q8WUN7	UBTD2_HUMAN	dendritic cell-derived ubiquitin-like protein							cytoplasm					0	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCAAAGAGGTAAAAGATTGCT	0.438													4	2	---	---	---	---	
RNF130	55819	broad.mit.edu	37	5	179442619	179442619	+	Intron	DEL	G	-	-	rs66616765		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442619delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gaaaggagtagggaaaggagt	0.000													14	9	---	---	---	---	
GMPR	2766	broad.mit.edu	37	6	16239046	16239046	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16239046delT	uc003nbs.2	+							NM_006877	NP_006868	P36959	GMPR1_HUMAN	guanosine monophosphate reductase						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				TGGGGTGGGATTTTTTTTTCC	0.637													6	3	---	---	---	---	
HLA-H	3136	broad.mit.edu	37	6	29856941	29856941	+	3'UTR	DEL	A	-	-	rs147655138		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29856941delA	uc010jro.2	+	3					HLA-G_uc011dmb.1_Intron|HLA-H_uc003nod.2_Intron					SubName: Full=cDNA FLJ52667, highly similar to HLA class I histocompatibility antigen, alpha chain H;												0						TTTTCCACGGAATAGGAGATT	0.567													12	7	---	---	---	---	
C6orf134	79969	broad.mit.edu	37	6	30599567	30599567	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30599567delA	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0						acaaacaaacaaaaaaaaaga	0.000													4	2	---	---	---	---	
FRS3	10817	broad.mit.edu	37	6	41744363	41744363	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41744363delA	uc003orc.1	-							NM_006653	NP_006644	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3						fibroblast growth factor receptor signaling pathway	plasma membrane	fibroblast growth factor receptor binding|insulin receptor binding			ovary(2)	2	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGTTTTCTCTAAAAAAAAAAG	0.080													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57226699	57226700	+	Intron	INS	-	A	A	rs140726189	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57226699_57226700insA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GTTATAGGGGGAAAAAAAAGTG	0.401													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57392834	57392836	+	Intron	DEL	AAC	-	-	rs33971467		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57392834_57392836delAAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTGAACTTTAACAACAACTTGG	0.325													8	4	---	---	---	---	
KIAA0776	23376	broad.mit.edu	37	6	96972949	96972949	+	Intron	DEL	T	-	-	rs71904342		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96972949delT	uc003por.2	+						KIAA0776_uc010kck.2_Intron	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376						negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TCTTTCtttcttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	103440709	103440709	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103440709delA								GRIK2 (922752 upstream) : None (None downstream)																							ggccatttggaaatctaaaag	0.000													4	2	---	---	---	---	
RTN4IP1	84816	broad.mit.edu	37	6	107077061	107077063	+	5'UTR	DEL	AAG	-	-	rs28366042		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107077061_107077063delAAG	uc003prj.2	-	1					QRSL1_uc003prl.2_5'Flank|QRSL1_uc003prm.2_5'Flank|RTN4IP1_uc010kdd.2_5'UTR|RTN4IP1_uc003prk.2_Intron	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor							mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		GAGAAACTGAAAGAAGAATACGG	0.419													6	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130193436	130193436	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130193436delT								C6orf191 (11020 upstream) : L3MBTL3 (146298 downstream)																							AATTCTCAGATTTTTTTTTTA	0.353													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156045295	156045295	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156045295delA								NOX3 (268258 upstream) : MIR1202 (222636 downstream)																							AGCTGAAGACAAAAAATTTTC	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157691609	157691610	+	IGR	INS	-	CAC	CAC			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157691609_157691610insCAC								ARID1B (161208 upstream) : C6orf35 (18445 downstream)																							actatcactgtcaccaccacca	0.015													6	3	---	---	---	---	
PACRG	135138	broad.mit.edu	37	6	163212339	163212340	+	Intron	INS	-	T	T	rs141410582	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163212339_163212340insT	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		TAGTTTGTTTGTTTGTTTTTTT	0.297													4	2	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	1950163	1950163	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1950163delG	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GCACTGCCCTGGGGGCTGAGC	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15025626	15025626	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15025626delT								DGKB (83076 upstream) : TMEM195 (214317 downstream)																							TGTGGGATTCTTTTTTTTTTT	0.308													16	8	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18693610	18693611	+	Intron	DEL	TG	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18693610_18693611delTG	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc011jya.1_Intron|HDAC9_uc003sua.1_Intron|HDAC9_uc011jyb.1_Intron|HDAC9_uc003sud.1_Intron|HDAC9_uc011jyc.1_Intron|HDAC9_uc003suf.1_Intron|HDAC9_uc010kud.1_Intron|HDAC9_uc011jye.1_Intron|HDAC9_uc011jyf.1_Intron|HDAC9_uc010kue.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	CATGCATGCCTGTGTGTGTGTT	0.401													4	2	---	---	---	---	
TRA2A	29896	broad.mit.edu	37	7	23546747	23546748	+	Intron	INS	-	T	T	rs145916394	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23546747_23546748insT	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						CCCTACTTATGttttttttctt	0.124													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25704881	25704881	+	5'Flank	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25704881delT	uc003sxp.1	-											Homo sapiens cDNA FLJ32817 fis, clone TESTI2002877.																		aggagtttggttttttttttc	0.000													5	3	---	---	---	---	
C7orf71	285941	broad.mit.edu	37	7	26685356	26685357	+	Intron	INS	-	GAC	GAC	rs150421574	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26685356_26685357insGAC	uc003syb.2	+						C7orf71_uc011jzh.1_Intron	NM_001145531	NP_001139003	A4D174	CG071_HUMAN	hypothetical protein LOC285941												0						atcttgctggtgactgtggcaa	0.074													4	8	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32675073	32675073	+	Intron	DEL	A	-	-	rs10707407		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32675073delA	uc011kai.1	+						uc003tcw.2_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						GTTATAACACAAACCTAAACA	0.299													1	5	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33989031	33989032	+	Intron	DEL	CT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33989031_33989032delCT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CCTCTGCATACTCTCTCTCTCT	0.431													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34097443	34097444	+	Intron	INS	-	AC	AC	rs142818103	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34097443_34097444insAC	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CAGGAGGGGGAacacacacaca	0.317													13	9	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48655196	48655197	+	Intron	INS	-	T	T	rs138589769	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48655196_48655197insT	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc010kyt.1_Intron|ABCA13_uc010kyu.1_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						AGACATTTTGCTTTTCTCTTGC	0.446													6	18	---	---	---	---	
ZPBP	11055	broad.mit.edu	37	7	50025569	50025569	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50025569delT	uc003tou.2	-						ZPBP_uc011kci.1_Intron|ZPBP_uc010kyw.2_Intron	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1						binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					gcagaaccccttttttttcac	0.000													3	3	---	---	---	---	
FKBP9L	360132	broad.mit.edu	37	7	55774665	55774676	+	5'Flank	DEL	AGGAAGGAAGGG	-	-	rs72285105		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55774665_55774676delAGGAAGGAAGGG	uc010kzl.2	-							NR_003949				SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);												0						gaaggaaggaaggaaggaagggaggaaggaag	0.108													4	18	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89908833	89908833	+	Intron	DEL	G	-	-	rs71526681		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89908833delG	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_5'Flank	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						AATTTTTGGTGTTTTTTTTTT	0.219											OREG0003793	type=REGULATORY REGION|Gene=AK024715|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108633768	108633768	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108633768delT								C7orf66 (109131 upstream) : EIF3IP1 (965516 downstream)																							CGAATTTACGTTTTTTTTTTA	0.398													4	3	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127325960	127325961	+	Intron	DEL	TT	-	-	rs76373905		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127325960_127325961delTT	uc003vmi.2	+							NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						tctttttttgtttgagcagagt	0.223													0	7	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133229480	133229480	+	Intron	DEL	A	-	-	rs11330976		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133229480delA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				CGAGGGAATTAAAGCAATAAC	0.328													3	7	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146741293	146741294	+	Intron	INS	-	AT	AT	rs148378854	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146741293_146741294insAT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			tgcatagatacatatatatata	0.198										HNSCC(39;0.1)			11	8	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151937015	151937016	+	Intron	INS	-	TGAC	TGAC	rs145605274	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151937015_151937016insTGAC	uc003wla.2	-						MLL3_uc003wkz.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AAATAAGAATGTGACTACTCTT	0.213			N		medulloblastoma								2	4	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157934498	157934498	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157934498delA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TAAAGGCCTGAACGTCCATGA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8308247	8308248	+	IGR	DEL	GA	-	-	rs145148563		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8308247_8308248delGA								SGK223 (68990 upstream) : CLDN23 (251418 downstream)																							TGGAATGGATGAGAGTTTTGAA	0.436													7	4	---	---	---	---	
EFHA2	286097	broad.mit.edu	37	8	16971336	16971336	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16971336delT	uc003wxd.2	+							NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN	EF-hand domain family, member A2							integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)		TTATTGGAGCTTTTTTTTTGG	0.289													4	3	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17882706	17882707	+	Intron	INS	-	A	A	rs146647405	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17882706_17882707insA	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		ACAGCTGTGATTGTAGCTTTTC	0.317			T	RET|JAK2	papillary thyroid|CML|MPD								3	15	---	---	---	---	
DOK2	9046	broad.mit.edu	37	8	21740509	21740509	+	Intron	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21740509delC	uc003wzx.1	-							NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		gatctaccttccgagtagatc	0.000													4	2	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32616602	32616602	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32616602delT	uc003xiv.2	+						NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc011lbg.1_Intron|NRG1_uc011lbh.1_Intron|NRG1_uc003xja.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCAGAGAGTATTTTTTTTTTT	0.343													13	6	---	---	---	---	
POLB	5423	broad.mit.edu	37	8	42228944	42228944	+	Intron	DEL	T	-	-	rs79893094		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42228944delT	uc003xoz.1	+						POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Intron	NM_002690	NP_002681	P06746	DPOLB_HUMAN	DNA-directed DNA polymerase beta						DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	tccgCCGGTCTTTTTTTTTTT	0.179								DNA_polymerases_(catalytic_subunits)					10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58321187	58321195	+	IGR	DEL	AGCAAGGGC	-	-	rs141331529		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58321187_58321195delAGCAAGGGC								C8orf71 (123899 upstream) : FAM110B (585918 downstream)																							TGGGTTGTCTAGCAAGGGCAGCAAGGGCA	0.354													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	68695178	68695178	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68695178delT								CPA6 (36558 upstream) : PREX2 (169170 downstream)																							tttttttctcttttttttttt	0.343													5	6	---	---	---	---	
C8orf34	116328	broad.mit.edu	37	8	69449700	69449700	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69449700delT	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TTTTATTTTCTTTTTTTTTTT	0.279													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	104090243	104090244	+	IGR	INS	-	T	T	rs138664736		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104090243_104090244insT								ATP6V1C1 (4959 upstream) : C8orf56 (54948 downstream)																							AGAACTCAGACTTTTTTCTTCT	0.475													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109395909	109395909	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109395909delT								EIF3E (134950 upstream) : TTC35 (59944 downstream)																							TTTCCAGCAAtttttttttta	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126900451	126900451	+	IGR	DEL	G	-	-	rs150070495		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126900451delG								TRIB1 (449809 upstream) : FAM84B (664236 downstream)																							caatgtgggtggcccttgaca	0.159													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134901956	134901956	+	IGR	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134901956delG								ST3GAL1 (317773 upstream) : ZFAT (588077 downstream)																							AAATAGGCATGGTGAGTACAG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138311226	138311227	+	IGR	INS	-	G	G	rs137997336	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138311226_138311227insG								None (None upstream) : FAM135B (831041 downstream)																							AGAATACCCAAGGGGGGTCTCA	0.510													4	4	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141076358	141076360	+	Intron	DEL	ACT	-	-	rs35235033		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141076358_141076360delACT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						GAAATCCACCACTGATGAACAGG	0.365													3	3	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	415120	415121	+	Intron	INS	-	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:415120_415121insA	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		gttaaaaaaacaaaaaaagtca	0.099													27	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	13725306	13725307	+	IGR	INS	-	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13725306_13725307insA								MPDZ (445743 upstream) : NFIB (356541 downstream)																							atatttatttgaaaaaattttt	0.079													4	2	---	---	---	---	
ZDHHC21	340481	broad.mit.edu	37	9	14619881	14619882	+	Intron	INS	-	AA	AA	rs140070007	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14619881_14619882insAA	uc003zli.2	-						ZDHHC21_uc003zlg.1_Intron	NM_178566	NP_848661	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21						nitric oxide metabolic process|regulation of nitric-oxide synthase activity	Golgi membrane|integral to membrane	palmitoyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(50;4.31e-06)		TTATACTATGCAAAAAAAAACC	0.248													3	3	---	---	---	---	
CNTLN	54875	broad.mit.edu	37	9	17409709	17409710	+	Intron	INS	-	A	A	rs149701915	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17409709_17409710insA	uc003zmz.2	+						CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		TATATCTCAGCAAAAAAGTGGT	0.238													7	6	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18674996	18674997	+	Intron	INS	-	AGTAGT	AGTAGT	rs140946745	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18674996_18674997insAGTAGT	uc003zne.3	+						ADAMTSL1_uc003znb.2_Intron|ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		AAGTAGGTCAGAGTAGTTTATT	0.450													12	7	---	---	---	---	
MLLT3	4300	broad.mit.edu	37	9	20451274	20451274	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20451274delA	uc003zoe.2	-						MLLT3_uc011lne.1_Intron|MLLT3_uc011lnf.1_Intron|MLLT3_uc003zof.2_Intron|MLLT3_uc011lng.1_Intron	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		AAATGTAGTCAAAAGACTAAA	0.323			T	MLL	ALL								4	2	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36583452	36583452	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36583452delA	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TATCATGGTTAAAAAAAAAAA	0.284													13	7	---	---	---	---	
CNTNAP3	79937	broad.mit.edu	37	9	39154059	39154059	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39154059delA	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron|CNTNAP3_uc011lqs.1_Intron|CNTNAP3_uc004abl.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CATTAAATAGAAAAAAAAAAA	0.428													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43401525	43401526	+	IGR	INS	-	A	A			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43401525_43401526insA								LOC642929 (256041 upstream) : FAM75A6 (222978 downstream)																							cacaaataaataaaaaaaaatt	0.045													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68417570	68417571	+	IGR	INS	-	AA	AA	rs111263548		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68417570_68417571insAA								FAM27B (623381 upstream) : MIR1299 (584668 downstream)																							AGGATAGGAATAAAACATCAGT	0.243													29	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68421071	68421072	+	IGR	INS	-	TTTG	TTTG	rs144603656		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68421071_68421072insTTTG								FAM27B (626882 upstream) : MIR1299 (581167 downstream)																							ATATCTAAACCTTTGTTTTTTA	0.337													10	7	---	---	---	---	
PGM5P2	595135	broad.mit.edu	37	9	69137850	69137851	+	Intron	DEL	TG	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69137850_69137851delTG	uc004aff.3	-							NR_002836				Homo sapiens phosphoglucomutase 5 pseudogene 2, mRNA (cDNA clone IMAGE:4121651), with apparent retained intron.												0						AGAGTGTGCATGTGTGTGTGTG	0.515													6	3	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	96068757	96068757	+	Intron	DEL	C	-	-	rs10761207	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96068757delC	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						tttcttttttcttttcttttt	0.443													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103392617	103392617	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103392617delC								MURC (42446 upstream) : LPPR1 (398414 downstream)																							CATATCCACTCCTTTGAAAAT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110207615	110207616	+	IGR	INS	-	A	A	rs148665106	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110207615_110207616insA								RAD23B (113146 upstream) : KLF4 (39519 downstream)																							gactccatctgaaaaaaaaaga	0.188													3	3	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	115974032	115974033	+	Intron	INS	-	A	A	rs111510294		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115974032_115974033insA	uc004bgs.2	-						FKBP15_uc010muu.1_Intron|FKBP15_uc011lxd.1_Intron|FKBP15_uc010mut.1_Intron|FKBP15_uc004bgt.2_Intron	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						atttaaaaattaaaaaaaaaaa	0.332													18	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	121166290	121166291	+	IGR	INS	-	A	A	rs145875458	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121166290_121166291insA								TLR4 (686526 upstream) : DBC1 (762617 downstream)																							ggagcatgttcagggcacgttt	0.000													2	5	---	---	---	---	
TTLL11	158135	broad.mit.edu	37	9	124657278	124657278	+	Intron	DEL	A	-	-	rs59825468		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124657278delA	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						AGCGGGGGTCAGGGGAGGTGG	0.398													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	125513472	125513472	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125513472delT								OR1L6 (412 upstream) : OR5C1 (37740 downstream)																							TGTGCGTGGCttttttttttt	0.224													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	130366436	130366437	+	IGR	DEL	CA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130366436_130366437delCA								FAM129B (25168 upstream) : STXBP1 (8049 downstream)																							tagctgttttcacactgttcac	0.005													4	2	---	---	---	---	
CELF2	10659	broad.mit.edu	37	10	11326465	11326466	+	Intron	INS	-	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11326465_11326466insT	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						TGTGTGGTGGGGGATGAGGGAT	0.198													4	6	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18104819	18104819	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18104819delT	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						ttttcttttcttttttttttg	0.129													9	4	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27421036	27421036	+	Intron	DEL	T	-	-	rs113682414		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27421036delT	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						tctgGAtttctttttttttct	0.005													7	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33746545	33746546	+	IGR	DEL	GT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33746545_33746546delGT								NRP1 (122539 upstream) : PARD3 (653552 downstream)																							atgtgtctacgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
LOC441666	441666	broad.mit.edu	37	10	42850914	42850915	+	Intron	DEL	AC	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42850914_42850915delAC	uc010qey.1	-							NR_024380				Homo sapiens noncoding mRNA sequence.												0						GTCCCTGAAAACACACACACAC	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44161591	44161591	+	Intron	DEL	T	-	-	rs72405891		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44161591delT	uc001jba.2	+											Homo sapiens chromosome 10 open reading frame 44, mRNA (cDNA clone IMAGE:4837462).																		ctggtgagcatttttttttgc	0.000													3	3	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	52751071	52751079	+	5'UTR	DEL	GCCGCCGCC	-	-	rs66567258		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52751071_52751079delGCCGCCGCC	uc001jjm.2	+	1					PRKG1_uc010qhp.1_5'UTR	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		tgccgtcccagccgccgccgccgccgccg	0.435													6	4	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	56345284	56345284	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56345284delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CAATTTTTAATTTTTTTTAAC	0.308										HNSCC(58;0.16)			4	2	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75867308	75867309	+	Intron	DEL	TG	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75867308_75867309delTG	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					ATGCATGGGTTGTGTGTGTGTG	0.475													6	3	---	---	---	---	
DUPD1	338599	broad.mit.edu	37	10	76813556	76813557	+	Intron	INS	-	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76813556_76813557insC	uc001jwq.1	-							NM_001003892	NP_001003892	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase							cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)	2	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					cttcttttTTTCCCCCGCAGCT	0.109													4	2	---	---	---	---	
LOC283050	283050	broad.mit.edu	37	10	80745414	80745414	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80745414delA	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0						GAGAAGGGACAAGGCTACTCA	0.582													4	2	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	84652040	84652040	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84652040delA	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron|NRG3_uc001kcr.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CAGTGTAGCCAAAAAAAAAGG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115690679	115690679	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115690679delT								NHLRC2 (22227 upstream) : ADRB1 (113127 downstream)																							CCAGGTTTTGTTCTGGAATCT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125730969	125730969	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125730969delC								CPXM2 (31190 upstream) : CHST15 (36217 downstream)																							taaacacccacccccaacaca	0.040													3	4	---	---	---	---	
IFITM1	8519	broad.mit.edu	37	11	314534	314534	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:314534delT	uc001loy.3	+							NM_003641	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1						negative regulation of cell proliferation|regulation of immune response|response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding|receptor signaling protein activity				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGTGTGTGGCTTTGGGGAATC	0.567													4	4	---	---	---	---	
KCNQ1	3784	broad.mit.edu	37	11	2486033	2486034	+	Intron	INS	-	C	C	rs140211902	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2486033_2486034insC	uc001lwn.2	+						KCNQ1_uc009ydo.1_Intron|KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Intron	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like						blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GGCGGATCCCACTGTGGGGAGC	0.599													3	6	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9493098	9493099	+	Intron	INS	-	T	T	rs149381506	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9493098_9493099insT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AGGTGTTTTGGTGttttttttt	0.139													26	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	10439468	10439468	+	IGR	DEL	T	-	-	rs113427603		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10439468delT								ADM (110545 upstream) : AMPD3 (32400 downstream)																							aaactgattgttttttttttt	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11657458	11657458	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11657458delA								GALNTL4 (13897 upstream) : USP47 (205512 downstream)																							AAAAAAAAAGAAAAAAAATGG	0.423													3	4	---	---	---	---	
PRR5L	79899	broad.mit.edu	37	11	36397896	36397898	+	Intron	DEL	GAG	-	-	rs60234626		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36397896_36397898delGAG	uc001mwo.3	+						PRR5L_uc001mwp.2_Intron|PRR5L_uc009ykk.2_Intron	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a											ovary(1)	1						ggaggaggaagaggaggaggagg	0.365													13	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	36916567	36916567	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36916567delA								C11orf74 (220177 upstream) : None (None downstream)																							tgattatgagaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45818432	45818432	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45818432delC								DKFZp779M0652 (24524 upstream) : SLC35C1 (7191 downstream)																							gccatgtgtgcccactctgcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48818001	48818002	+	IGR	INS	-	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48818001_48818002insC								OR4A47 (306729 upstream) : FOLH1 (350186 downstream)																							gaatgcttctgtctagttttta	0.000													67	43	---	---	---	---	
CTNND1	1500	broad.mit.edu	37	11	57563859	57563859	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57563859delA	uc001nmc.3	+						CTNND1_uc001nlf.1_Intron|CTNND1_uc001nlh.1_Intron|CTNND1_uc001nlu.3_Intron|CTNND1_uc001nlt.3_Intron|CTNND1_uc001nls.3_Intron|CTNND1_uc001nlw.3_Intron|CTNND1_uc001nmf.3_Intron|CTNND1_uc001nmd.3_Intron|CTNND1_uc001nlk.3_Intron|CTNND1_uc001nme.3_Intron|CTNND1_uc001nll.3_Intron|CTNND1_uc001nmg.3_Intron|CTNND1_uc001nlj.3_Intron|CTNND1_uc001nlr.3_Intron|CTNND1_uc001nlp.3_Intron|CTNND1_uc001nlx.3_Intron|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Intron|CTNND1_uc001nly.3_Intron|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Intron|CTNND1_uc001nmi.3_Intron|CTNND1_uc001nmh.3_Intron|CTNND1_uc001nlq.3_Intron|CTNND1_uc001nln.3_Intron|CTNND1_uc001nli.3_Intron|CTNND1_uc001nlo.3_Intron|CTNND1_uc001nlv.3_Intron	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC						adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				actccatctcaaaaaaaaaaa	0.144													8	5	---	---	---	---	
DCUN1D5	84259	broad.mit.edu	37	11	102959128	102959128	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102959128delA	uc001phm.2	-						DCUN1D5_uc010ruw.1_Intron	NM_032299	NP_115675	Q9BTE7	DCNL5_HUMAN	DCN1, defective in cullin neddylation 1, domain												0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.00032)|Epithelial(105;0.0689)|all cancers(92;0.186)		TTCTAAGGGGAAAAAAATTCC	0.090													4	2	---	---	---	---	
RAD52	5893	broad.mit.edu	37	12	1034996	1034997	+	Intron	DEL	AG	-	-	rs151270981		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1034996_1034997delAG	uc001qis.1	-						RAD52_uc001qit.1_Intron|RAD52_uc010sdt.1_Intron|RAD52_uc001qiu.1_Intron|RAD52_uc001qiv.1_Intron|RAD52_uc001qiw.1_Intron|RAD52_uc010sdu.1_Intron|RAD52_uc001qix.1_Intron	NM_134424	NP_602296	P43351	RAD52_HUMAN	RAD52 homolog						DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			AACAAACTGCAGAGAGTTTTTC	0.446								Homologous_recombination					4	5	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26492947	26492948	+	Intron	INS	-	GGTTCTACAGTACA	GGTTCTACAGTACA			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26492947_26492948insGGTTCTACAGTACA	uc001rhg.2	-							NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CCGTTTGCTGGGATGTGGTTCT	0.500													14	8	---	---	---	---	
AQP5	362	broad.mit.edu	37	12	50356237	50356238	+	Intron	INS	-	A	A	rs146758293	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50356237_50356238insA	uc001rvo.2	+							NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5						carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0						ACCCCACCTGGAAAAAAGGGGT	0.668													3	5	---	---	---	---	
GPD1	2819	broad.mit.edu	37	12	50499103	50499103	+	Intron	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50499103delC	uc001rvz.2	+						GPD1_uc010smp.1_Intron|GPD1_uc001rwa.2_Intron	NM_005276	NP_005267	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)						glycerol-3-phosphate catabolic process|triglyceride biosynthetic process	cytosol|glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|protein homodimerization activity				0					NADH(DB00157)	GATGAGGTTTCCAGGAGTCCT	0.537													4	2	---	---	---	---	
BIN2	51411	broad.mit.edu	37	12	51712655	51712656	+	Intron	INS	-	T	T			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51712655_51712656insT	uc001ryg.2	-						BIN2_uc009zlz.2_Intron|BIN2_uc001ryh.2_Intron|BIN2_uc010sng.1_Intron	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2							cytoplasm	protein binding			ovary(1)	1						TTTAGTTTTGCTCCCTTGCCTG	0.238													4	2	---	---	---	---	
KRT85	3891	broad.mit.edu	37	12	52760461	52760462	+	Intron	DEL	AC	-	-	rs35299438		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52760461_52760462delAC	uc001sag.2	-							NM_002283	NP_002274	P78386	KRT85_HUMAN	keratin 85						epidermis development	keratin filament	protein binding|structural molecule activity			ovary(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		acacacatgtacacacacacat	0.089													3	3	---	---	---	---	
PTPRR	5801	broad.mit.edu	37	12	71089965	71089966	+	Intron	INS	-	C	C			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71089965_71089966insC	uc001swi.1	-						PTPRR_uc001swh.1_Intron|PTPRR_uc009zrs.2_Intron|PTPRR_uc010stq.1_Intron|PTPRR_uc010str.1_Intron	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		CCATTTTTTTTTTTTTGCCTAA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	72429357	72429357	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72429357delT								TPH2 (3136 upstream) : LOC283392 (226971 downstream)																							agggttagggttttctgagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	85838773	85838773	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85838773delA								ALX1 (143214 upstream) : RASSF9 (359558 downstream)																							AATTTATAAGAAAAAAAAAAA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	102956416	102956416	+	IGR	DEL	A	-	-	rs75181494		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102956416delA								IGF1 (82038 upstream) : PAH (275688 downstream)																							ggaagagtccaaaaaaaaaag	0.055													2	4	---	---	---	---	
RPH3A	22895	broad.mit.edu	37	12	113263909	113263909	+	Intron	DEL	G	-	-	rs140443852		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113263909delG	uc010syl.1	+						RPH3A_uc001ttz.2_Intron|RPH3A_uc001tty.2_Intron|RPH3A_uc009zwe.1_Intron|RPH3A_uc010sym.1_Intron	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1						intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		caccgaccccgctgtgggagc	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114023120	114023120	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114023120delT								LHX5 (113243 upstream) : RBM19 (231423 downstream)																							CTCCATTCAGTAGGTCCTAGG	0.279													4	2	---	---	---	---	
PSMD9	5715	broad.mit.edu	37	12	122332959	122332959	+	Intron	DEL	T	-	-	rs75734597		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122332959delT	uc001ubl.2	+						PSMD9_uc009zxj.2_Intron|PSMD9_uc001ubm.2_Intron	NM_002813	NP_002804	O00233	PSMD9_HUMAN	proteasome 26S non-ATPase subunit 9						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of insulin secretion|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of insulin secretion|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|proteasome regulatory particle assembly|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	nucleus|proteasome regulatory particle	bHLH transcription factor binding|transcription coactivator activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		tctctctctcttttttttttg	0.174													6	3	---	---	---	---	
GPR133	283383	broad.mit.edu	37	12	131490305	131490306	+	Intron	DEL	AG	-	-	rs111808973		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131490305_131490306delAG	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GAGCTGGCTCAGGGGATGGAGC	0.619													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132103940	132103940	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132103940delT								LOC116437 (406465 upstream) : SFRS8 (91695 downstream)																							CTCCTGGCCCTCAGGGGGACT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132914384	132914402	+	IGR	DEL	TGGCGACCTGCAGGTGACG	-	-	rs28719937		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132914384_132914402delTGGCGACCTGCAGGTGACG								GALNT9 (8479 upstream) : FBRSL1 (152755 downstream)																							gcgggtgacatggcgacctgcaggtgacgtggcgACCTG	0.292													6	3	---	---	---	---	
DCLK1	9201	broad.mit.edu	37	13	36481054	36481054	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36481054delA	uc001uvf.2	-							NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		gtcaggtggtaagcactcagg	0.045													4	2	---	---	---	---	
RBM26	64062	broad.mit.edu	37	13	79945699	79945699	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79945699delA	uc001vkz.2	-						RBM26_uc001vky.2_Intron|RBM26_uc001vla.2_Intron|RBM26_uc001vkx.2_5'Flank|RBM26_uc001vlb.1_5'Flank	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26						mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		AACAGCAGGCAAAAAAAAAAC	0.279													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19010496	19010497	+	IGR	DEL	AA	-	-	rs148364645	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19010496_19010497delAA								None (None upstream) : OR11H12 (367097 downstream)																							cagattctacaaaaagagtgtt	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20480147	20480148	+	IGR	DEL	AC	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20480147_20480148delAC								OR4K15 (35425 upstream) : OR4K14 (2273 downstream)																							CCTATGCTAAACACACACACGC	0.252													4	2	---	---	---	---	
TEP1	7011	broad.mit.edu	37	14	20865052	20865052	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20865052delA	uc001vxe.2	-						TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		agactgtctcaaaaaaaaaaa	0.199													18	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28188824	28188824	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28188824delT								None (None upstream) : None (None downstream)																							GCCAGAATACTTTTTTTTCCC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56899595	56899595	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56899595delT								PELI2 (131565 upstream) : C14orf101 (146743 downstream)																							aaagctctgcttttttgcatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	58156146	58156146	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58156146delT								SLC35F4 (92531 upstream) : C14orf37 (314663 downstream)																							GCTAAACTGCTTTTAGGAATG	0.194													4	2	---	---	---	---	
MAP3K9	4293	broad.mit.edu	37	14	71249204	71249204	+	Intron	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71249204delC	uc001xmm.2	-						MAP3K9_uc010ttk.1_Intron|MAP3K9_uc001xmk.2_Intron|MAP3K9_uc001xml.2_Intron	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CATCCCATCACCTTGCAGGCA	0.517													4	2	---	---	---	---	
FLVCR2	55640	broad.mit.edu	37	14	76114227	76114228	+	3'UTR	DEL	TG	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76114227_76114228delTG	uc001xrs.2	+	10					FLVCR2_uc010tvd.1_3'UTR	NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular						transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)		tgtgtctgcatgtgtgtgtgtg	0.426													6	3	---	---	---	---	
SPTLC2	9517	broad.mit.edu	37	14	78021964	78021964	+	Intron	DEL	T	-	-	rs151267420	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78021964delT	uc001xub.2	-							NM_004863	NP_004854	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base							integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TTACTGCttcttttttttttc	0.134													9	4	---	---	---	---	
RPS6KA5	9252	broad.mit.edu	37	14	91503220	91503220	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91503220delT	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		cacctgtaccttctgctgggt	0.000													4	2	---	---	---	---	
SERPINA13	388007	broad.mit.edu	37	14	95110260	95110260	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95110260delT	uc001ydt.2	+							NR_015340				RecName: Full=Serpin A13; Flags: Precursor;											lung(1)|skin(1)	2						CAGGATGCTGTTACATCACCC	0.532													4	2	---	---	---	---	
PWRN1	791114	broad.mit.edu	37	15	24776645	24776646	+	5'Flank	INS	-	T	T	rs141502741	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24776645_24776646insT	uc001ywm.2	+											Homo sapiens cDNA FLJ25418 fis, clone TST03512.												0						GGGCGAAACTCTGCACAGAACT	0.089													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	35307819	35307819	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35307819delA								ZNF770 (27365 upstream) : LOC723972 (221708 downstream)																							aagacaagagaagggcagaag	0.000													4	2	---	---	---	---	
MYO5C	55930	broad.mit.edu	37	15	52524531	52524532	+	Intron	DEL	AA	-	-	rs56101752		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52524531_52524532delAA	uc010bff.2	-						MYO5C_uc010uga.1_Intron|MYO5C_uc010ugb.1_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		ggaaggagagaaagaaagaaga	0.134													11	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	64167150	64167151	+	IGR	INS	-	AAAT	AAAT	rs150352139	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64167150_64167151insAAAT								MIR422A (3932 upstream) : DAPK2 (32085 downstream)																							ACACCAGGCCCAAATGATGAAT	0.342													3	4	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66236793	66236793	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66236793delG	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						cacgtgggttggggggctgca	0.124													4	2	---	---	---	---	
MAP2K1	5604	broad.mit.edu	37	15	66781299	66781302	+	Intron	DEL	AAGT	-	-	rs146679173		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66781299_66781302delAAGT	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						atcacccgacaagtgagtggACTT	0.216									Cardiofaciocutaneous_syndrome				4	15	---	---	---	---	
AAGAB	79719	broad.mit.edu	37	15	67524926	67524927	+	Intron	DEL	AC	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67524926_67524927delAC	uc002aqk.3	-						AAGAB_uc002aql.2_Intron|AAGAB_uc010uju.1_Intron	NM_024666	NP_078942	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0						GCCAAAATGTACAAGACCACAC	0.416													4	2	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78328343	78328343	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78328343delG	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						TGGTGCAAGTGGGCCTCATGA	0.522													4	2	---	---	---	---	
UBE2Q2P1	388165	broad.mit.edu	37	15	85112481	85112481	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85112481delA	uc002bkn.1	-						uc002bko.1_5'Flank	NR_003661				Homo sapiens cDNA FLJ43276 fis, clone KIDNE2011532, moderately similar to Homo sapiens melanoma-associated chondroitin sulfate proteoglycan 4.												0						CTGCCATCATAAAAAAAAAAT	0.323													4	2	---	---	---	---	
LASS3	204219	broad.mit.edu	37	15	100973929	100973930	+	Intron	DEL	CA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100973929_100973930delCA	uc002bvz.2	-						LASS3_uc002bwa.2_Intron|LASS3_uc002bwb.2_Intron	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			cacacatgtgcacacacacaca	0.188													4	2	---	---	---	---	
WDR24	84219	broad.mit.edu	37	16	736402	736402	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:736402delG	uc002ciz.1	-						JMJD8_uc002ciw.1_5'Flank|JMJD8_uc002cix.1_5'Flank|JMJD8_uc002ciy.1_5'Flank	NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24											ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)				ATTGGGCAGTGGGGACTTGCG	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55879957	55879957	+	IGR	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55879957delG								CES1 (12882 upstream) : CES7 (109 downstream)																							GGTTGGGGTTGGGGGACTTGC	0.512													4	2	---	---	---	---	
CA7	766	broad.mit.edu	37	16	66884344	66884344	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66884344delA	uc002eqi.2	+						uc002eqh.2_Intron|CA7_uc002eqj.2_Intron	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		accctgactcaaaaaaaaaaa	0.279													9	4	---	---	---	---	
ZDHHC1	29800	broad.mit.edu	37	16	67433125	67433125	+	Intron	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67433125delC	uc010vjm.1	-							NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1							integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CTGGGCAGCACCCCCGCATAA	0.637													4	2	---	---	---	---	
FAM38A	9780	broad.mit.edu	37	16	88800546	88800551	+	Intron	DEL	GCTTCT	-	-	rs66935855		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88800546_88800551delGCTTCT	uc010vpb.1	-						FAM38A_uc002flr.3_Intron|FAM38A_uc010cib.2_Intron|uc010vpc.1_Intron	NM_001142864	NP_001136336	Q92508	PIEZ1_HUMAN	family with sequence similarity 38, member A							endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane	ion channel activity				0						TGTCGGCACCGCTTCTGCTGCAGCTG	0.592													1	5	---	---	---	---	
PELP1	27043	broad.mit.edu	37	17	4583089	4583090	+	Intron	DEL	TT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4583089_4583090delTT	uc002fyi.3	-						PELP1_uc010vsf.1_Intron	NM_014389	NP_055204	Q8IZL8	PELP1_HUMAN	proline, glutamic acid and leucine rich protein						transcription, DNA-dependent	cytoplasm|MLL1 complex	protein binding			ovary(1)|central_nervous_system(1)	2						AAAGATTCTATTAGCTGTGATT	0.421													4	2	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21196637	21196637	+	Intron	DEL	T	-	-	rs68015508		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21196637delT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TCCTTCCCTCTCCAGCGAGGC	0.657													5	5	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAGTTCTGTCTGTGTGACCATTCG	0.417													5	3	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21312637	21312638	+	Intron	INS	-	TGT	TGT	rs143247012		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21312637_21312638insTGT	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	aggagACTTGGTGTGGGGCATC	0.312										Prostate(3;0.18)			5	6	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21317371	21317397	+	Intron	DEL	GGCATGTGGGTGGACACTGTAGAGTGG	-	-	rs34293041		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21317371_21317397delGGCATGTGGGTGGACACTGTAGAGTGG	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CTGCAAGCATGGCATGTGGGTGGACACTGTAGAGTGGGGCATGTGGG	0.626										Prostate(3;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25268241	25268241	+	IGR	DEL	A	-	-	rs111490235		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25268241delA								None (None upstream) : WSB1 (352865 downstream)																							AAAACAATGTAAAAACTTTAC	0.358													7	7	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29554199	29554208	+	Intron	DEL	AAGTGCAGTA	-	-	rs141082540	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29554199_29554208delAAGTGCAGTA	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc010csn.1_Intron|NF1_uc002hgi.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(5)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCAGGGCTCTAAGTGCAGTAACTTGATTTG	0.462			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			60	40	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31843351	31843352	+	Intron	DEL	GT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31843351_31843352delGT	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	CAGCGTATGAgtgtgtgtgttt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32699426	32699426	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32699426delC								CCL1 (9174 upstream) : C17orf102 (201716 downstream)																							ctggcctctgccccctgctac	0.095													4	2	---	---	---	---	
GRB7	2886	broad.mit.edu	37	17	37902870	37902870	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37902870delA	uc002hsr.2	+						GRB7_uc002hss.2_Intron|GRB7_uc010cwc.2_Intron|GRB7_uc002hst.2_Intron	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7						blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			aaactgtctcaaaaaaaaaaa	0.184													9	6	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39789174	39789175	+	Intron	DEL	GT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39789174_39789175delGT	uc010wfs.1	-						uc010cxq.1_Intron|uc002hxi.1_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		tgtgtggtgagtgtgtgtgtga	0.000													4	2	---	---	---	---	
DHX58	79132	broad.mit.edu	37	17	40258179	40258179	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40258179delA	uc002hyw.3	-						DHX58_uc002hyv.3_Intron|DHX58_uc010wgf.1_Intron	NM_024119	NP_077024	Q96C10	DHX58_HUMAN	RNA helicase LGP2						innate immune response	cytoplasm	ATP binding|DNA binding|helicase activity|protein binding|RNA binding|zinc ion binding				0		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		tctgtctgggaaaaaaaaaaa	0.010													16	8	---	---	---	---	
CDC27	996	broad.mit.edu	37	17	45234955	45234956	+	Intron	INS	-	TTA	TTA	rs10636944		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234955_45234956insTTA	uc002ild.3	-						CDC27_uc002ile.3_Intron|CDC27_uc002ilf.3_Intron|CDC27_uc010wkp.1_Intron|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AAGCTGTAAATGAAAATAAACT	0.282													2	10	---	---	---	---	
B4GALNT2	124872	broad.mit.edu	37	17	47236696	47236697	+	Intron	INS	-	TTTGT	TTTGT	rs139717167	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47236696_47236697insTTTGT	uc002ion.2	+						B4GALNT2_uc010wlt.1_Intron|B4GALNT2_uc010wlu.1_Intron	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2						lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			gtgtgtgtttgtttgttttgtt	0.188													17	9	---	---	---	---	
HSF5	124535	broad.mit.edu	37	17	56554230	56554230	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56554230delT	uc002iwi.1	-							NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTTCTTGCTGTTTTTTTTTTC	0.428													7	4	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80510411	80510411	+	Intron	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80510411delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gtgtggccatcctcagccttt	0.000													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15167567	15167567	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15167567delC								ANKRD30B (314830 upstream) : LOC644669 (145988 downstream)																							ACTAAATAATCCTTATTGCTT	0.438													10	5	---	---	---	---	
ROCK1	6093	broad.mit.edu	37	18	18540521	18540521	+	Intron	DEL	A	-	-	rs3838904		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18540521delA	uc002kte.2	-							NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein						actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					AATAATCAGCAAAAAAAAAGA	0.328													4	2	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22642387	22642387	+	3'UTR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22642387delT	uc002kvk.2	-	8					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_3'UTR|ZNF521_uc002kvl.2_3'UTR	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGTCATAGTCTTTTTTTTTTT	0.308			T	PAX5	ALL								8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33506998	33506999	+	IGR	DEL	GG	-	-	rs113539329		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33506998_33506999delGG								MIR187 (22109 upstream) : C18orf21 (45589 downstream)																							agccattcacggacggaaggga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33507001	33507007	+	IGR	DEL	CGGAAGG	-	-	rs77123562		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33507001_33507007delCGGAAGG								MIR187 (22112 upstream) : C18orf21 (45581 downstream)																							cattcacggacggaagggacggaaggc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39038277	39038277	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39038277delT								None (None upstream) : KC6 (21961 downstream)																							TTGAATTATCTTTTTTTTTTC	0.348													4	2	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	55948540	55948541	+	Intron	INS	-	T	T	rs113081403		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55948540_55948541insT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron|NEDD4L_uc010dpl.1_Intron|NEDD4L_uc002lhg.2_Intron|NEDD4L_uc002lhh.2_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						AGTCTCTCTCCTTTTTTTTTTT	0.262													4	3	---	---	---	---	
CD226	10666	broad.mit.edu	37	18	67540720	67540720	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67540720delA	uc010dqo.2	-						CD226_uc002lkm.3_Intron	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				TACACATTACAAAAAAAAAAA	0.259													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	67938128	67938128	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67938128delA								RTTN (65166 upstream) : SOCS6 (18009 downstream)																							TTCTAGATTTAAAAAAAATAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6562770	6562770	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6562770delT								TNFSF9 (26831 upstream) : CD70 (20365 downstream)																							GTTTTTGCAGtttttttttta	0.169													10	5	---	---	---	---	
FCER2	2208	broad.mit.edu	37	19	7764364	7764368	+	Intron	DEL	TTTTT	-	-	rs74174902		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7764364_7764368delTTTTT	uc002mhn.2	-						FCER2_uc010xjs.1_Intron|FCER2_uc010xjt.1_Intron|FCER2_uc002mhm.2_Intron|FCER2_uc010dvo.2_Intron	NM_002002	NP_001993	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor						positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0						GCTGAAGCCGttttttttttttttt	0.444													6	6	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17799246	17799247	+	Frame_Shift_Ins	INS	-	G	G	rs140985715	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17799246_17799247insG	uc002nhd.2	-	1	155_156	c.155_156insC	c.(154-156)CCAfs	p.P52fs		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	Error:Variant_position_missing_in_Q9UPW8_after_alignment					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						CGCTGCGGGCTGGGGGGGCGTT	0.757													3	5	---	---	---	---	
FXYD3	5349	broad.mit.edu	37	19	35610585	35610586	+	Intron	INS	-	T	T	rs113413131		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35610585_35610586insT	uc010xsn.1	+						FXYD3_uc010xsj.1_Intron|FXYD3_uc010xsk.1_Intron|FXYD3_uc010xsl.1_Intron|FXYD3_uc010xsm.1_Intron|FXYD3_uc002nxw.2_Intron|FXYD3_uc002nxv.2_Intron|FXYD3_uc010xso.1_Intron	NM_001136011	NP_001129483	Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3							chloride channel complex|integral to plasma membrane	chloride channel activity				0	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			ttttgtttttgtttttgttttt	0.183													1	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35872480	35872480	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35872480delT								FFAR3 (21093 upstream) : FFAR2 (66723 downstream)																							cattcattcCttttttttttt	0.020													3	5	---	---	---	---	
SPRED3	399473	broad.mit.edu	37	19	38885936	38885936	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38885936delG	uc002oim.2	+							NM_001042522	NP_001035987	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3						multicellular organismal development					central_nervous_system(2)|lung(1)|skin(1)	4	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTTAAAGGTGTGGGGTTGGT	0.557													10	7	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41071177	41071178	+	Intron	INS	-	AAAAG	AAAAG	rs112419378		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41071177_41071178insAAAAG	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			tctcaaaaaaaaaaagaaaaga	0.193													5	6	---	---	---	---	
SLC17A7	57030	broad.mit.edu	37	19	49934715	49934716	+	Intron	INS	-	G	G	rs74182054		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49934715_49934716insG	uc002pnp.2	-						SLC17A7_uc002pno.2_Intron	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7						glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CCTAcgggggcggggggggccc	0.584													9	4	---	---	---	---	
CPT1C	126129	broad.mit.edu	37	19	50204228	50204229	+	Intron	INS	-	G	G			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50204228_50204229insG	uc002ppj.2	+						CPT1C_uc002ppl.3_Intron|CPT1C_uc002ppi.2_Intron|CPT1C_uc002ppk.2_Intron|CPT1C_uc010eng.2_Intron|CPT1C_uc010enh.2_Intron|CPT1C_uc010ybc.1_Intron	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2						fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		tctgggtctcttccccctctct	0.149													15	9	---	---	---	---	
SHANK1	50944	broad.mit.edu	37	19	51214439	51214440	+	Intron	INS	-	TGGA	TGGA	rs151216048	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51214439_51214440insTGGA	uc002psx.1	-							NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1						cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		taaatatctgttggatggatgg	0.064													7	12	---	---	---	---	
SEC23B	10483	broad.mit.edu	37	20	18491958	18491958	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18491958delT	uc002wqz.1	+						SEC23B_uc002wra.1_Intron|SEC23B_uc002wrb.1_Intron|SEC23B_uc010zsb.1_Intron|SEC23B_uc002wrc.1_Intron	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B						ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						TGTAATTCACTTTTTTTTTGG	0.363													4	2	---	---	---	---	
PLK1S1	55857	broad.mit.edu	37	20	21146805	21146805	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21146805delG	uc002wsb.2	+						PLK1S1_uc010zsh.1_Intron|PLK1S1_uc010zsi.1_Intron|PLK1S1_uc010zsj.1_Intron|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_Intron	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1						spindle organization	centrosome	protein kinase binding				0						TTTTTTTTTTGTCCATGAGGC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25854719	25854719	+	IGR	DEL	T	-	-	rs113136799		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25854719delT								FAM182B (5933 upstream) : LOC100134868 (135716 downstream)																							ttttaatttcttttttttttt	0.000													12	8	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33209344	33209344	+	Intron	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33209344delG	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						GTGGGATGCTGGGACAGGTGT	0.542													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41284374	41284375	+	Intron	INS	-	TT	TT	rs141478732	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41284374_41284375insTT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGACTCTCAGGTTTCTGATCTG	0.416													2	6	---	---	---	---	
ARFGEF2	10564	broad.mit.edu	37	20	47605027	47605027	+	Splice_Site	DEL	G	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47605027delG	uc002xtx.3	+	18	2514	c.2362_splice	c.e18-1	p.V788_splice	ARFGEF2_uc010zyf.1_Splice_Site_p.V81_splice	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TTTAATTACAGGTAAAAAATA	0.289													28	50	---	---	---	---	
ARFGEF2	10564	broad.mit.edu	37	20	47605030	47605030	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47605030delA	uc002xtx.3	+	18	2516	c.2364delA	c.(2362-2364)GTAfs	p.V788fs	ARFGEF2_uc010zyf.1_Frame_Shift_Del_p.V81fs	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	788					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AATTACAGGTAAAAAATAAAA	0.294													53	23	---	---	---	---	
ARFGEF2	10564	broad.mit.edu	37	20	47605033	47605057	+	Frame_Shift_Del	DEL	AAATAAAATGACGAAAGAGCAGTAT	-	-	rs148252934		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47605033_47605057delAAATAAAATGACGAAAGAGCAGTAT	uc002xtx.3	+	18	2519_2543	c.2367_2391delAAATAAAATGACGAAAGAGCAGTAT	c.(2365-2391)AAAAATAAAATGACGAAAGAGCAGTATfs	p.K789fs	ARFGEF2_uc010zyf.1_Frame_Shift_Del_p.K82fs	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	789_797					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity	p.K794E(2)		breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TACAGGTAAAAAATAAAATGACGAAAGAGCAGTATATTAAAATGA	0.293													48	24	---	---	---	---	
BMP7	655	broad.mit.edu	37	20	55793802	55793805	+	Intron	DEL	CATT	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55793802_55793805delCATT	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Intron	NM_001719	NP_001710	P18075	BMP7_HUMAN	bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			TGGTAGCTGGCATTTGTTCGGTGG	0.309													4	2	---	---	---	---	
ARFGAP1	55738	broad.mit.edu	37	20	61909773	61909774	+	Intron	INS	-	G	G	rs142622083	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61909773_61909774insG	uc002yem.2	+						ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_Intron|ARFGAP1_uc002yel.2_Intron|ARFGAP1_uc002yen.2_Intron	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating						COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					AGGTGTGAATTGGGGGGTCTTA	0.594													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9830196	9830196	+	IGR	DEL	C	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9830196delC								None (None upstream) : None (None downstream)																							CACAACTTTACTTTTCCCTTT	0.463													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9833296	9833297	+	IGR	INS	-	A	A	rs35467692		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9833296_9833297insA								None (None upstream) : None (None downstream)																							agtaaaagtataaagcaaagga	0.149													7	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10784358	10784372	+	IGR	DEL	GGAATGGAATGGAAA	-	-	rs112644951		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10784358_10784372delGGAATGGAATGGAAA								None (None upstream) : TPTE (122371 downstream)																							ggagtggaacggaatggaatggaaaggaatggaat	0.000													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11022216	11022218	+	Intron	DEL	AGA	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11022216_11022218delAGA	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGAAGTTGTAGAAGAAGACAAG	0.335													9	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11052792	11052794	+	Intron	DEL	TAC	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11052792_11052794delTAC	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaacttctgttacataatcattt	0.000													5	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071214	11071215	+	Intron	INS	-	C	C	rs140937252		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071214_11071215insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gcagaccaattagggcttcagg	0.000													11	9	---	---	---	---	
KCNJ6	3763	broad.mit.edu	37	21	39092769	39092770	+	Intron	INS	-	AGTC	AGTC	rs150946936	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39092769_39092770insAGTC	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	AGGACAAGTCGAGTCAGCTATC	0.520													4	3	---	---	---	---	
BRWD1	54014	broad.mit.edu	37	21	40584804	40584804	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40584804delA	uc002yxk.1	-						BRWD1_uc010goc.1_Intron|BRWD1_uc002yxl.2_Intron|BRWD1_uc010god.1_Intron	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CCCAGGCTTGAAAAAAAAAAA	0.294													16	7	---	---	---	---	
CLTCL1	8218	broad.mit.edu	37	22	19263545	19263546	+	Intron	INS	-	AG	AG	rs362005		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19263545_19263546insAG	uc002zpb.2	-						CLTCL1_uc011agv.1_Intron|CLTCL1_uc011agw.1_Intron	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1						anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					ACTCTCCTTGAGAGATTACCAG	0.450			T	?	ALCL								5	3	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26736200	26736200	+	Intron	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26736200delA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						actctgtctcaaaaaaaaaaT	0.194													4	4	---	---	---	---	
BPIL2	254240	broad.mit.edu	37	22	32853547	32853558	+	5'Flank	DEL	TCCATCCATCCA	-	-	rs71320927	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32853547_32853558delTCCATCCATCCA	uc003amn.2	-						BPIL2_uc010gwo.2_5'Flank|BPIL2_uc011amb.1_Intron|BPIL2_uc003amo.3_Intron	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						catccatccgtccatccatccatccatccatc	0.057											OREG0003513	type=REGULATORY REGION|Gene=BPIL2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	14	11	---	---	---	---	
ANKRD54	129138	broad.mit.edu	37	22	38228344	38228344	+	Intron	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38228344delT	uc003auc.2	-						ANKRD54_uc003aud.2_Intron	NM_138797	NP_620152	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54												0	Melanoma(58;0.045)					CTTGCTCTGGTTTTTTTTTTT	0.294													6	4	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42128781	42128781	+	Intron	DEL	T	-	-	rs34396284		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42128781delT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						gattgaaaaattttttttttt	0.000													9	4	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46136560	46136571	+	Intron	DEL	ACACACACACAC	-	-	rs66503440		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136560_46136571delACACACACACAC	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		ttatatgaatacacacacacacacacacacac	0.160													5	7	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47172296	47172297	+	Intron	INS	-	T	T	rs146225660	by1000genomes	TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47172296_47172297insT	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		TTGTGGCTGTGTGGTGGGGTGG	0.594													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3771053	3771054	+	IGR	INS	-	TT	TT	rs140591220		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3771053_3771054insTT								PRKX (139392 upstream) : None (None downstream)																							TACTTTCATTGTTttttttttt	0.158													4	2	---	---	---	---	
CXorf36	79742	broad.mit.edu	37	X	45013523	45013524	+	Intron	INS	-	CTAT	CTAT	rs72059118		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45013523_45013524insCTAT	uc004dgg.2	-							NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN	hypothetical protein LOC79742 isoform 1							extracellular region				lung(1)	1						tatctatctccctatctatcta	0.188													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	109012079	109012079	+	IGR	DEL	A	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109012079delA								ACSL4 (35458 upstream) : TMEM164 (233784 downstream)																							agactccattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DOCK11	139818	broad.mit.edu	37	X	117761212	117761226	+	Intron	DEL	CTGTACCAGTTGCAG	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117761212_117761226delCTGTACCAGTTGCAG	uc004eqp.2	+						DOCK11_uc004eqq.2_Intron	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						acaaaaaaGACTGTACCAGTTGCAGCTGTACCAGT	0.209													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	134809846	134809846	+	IGR	DEL	T	-	-			TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134809846delT								DDX26B (93387 upstream) : CT45A1 (37339 downstream)																							GCTCACTTGCTAGGAAATTAT	0.433													4	2	---	---	---	---	
FMR1	2332	broad.mit.edu	37	X	147026280	147026281	+	Intron	INS	-	TGGG	TGGG	rs72233179		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147026280_147026281insTGGG	uc010nst.2	+						FMR1_uc004fcj.2_Intron|FMR1_uc004fck.3_Intron|FMR1_uc004fcl.3_Intron|FMR1_uc011mxa.1_Intron	NM_002024	NP_002015	Q06787	FMR1_HUMAN	fragile X mental retardation 1						mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGCTTATAAATTGGGAAGAGTT	0.312									Fragile_X_syndrome				2	12	---	---	---	---	
HSFX2	100130086	broad.mit.edu	37	X	148685933	148685948	+	Intron	DEL	CTGCTGCCTTGCCCCT	-	-	rs72102447		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148685933_148685948delCTGCTGCCTTGCCCCT	uc004fdl.2	-						HSFX1_uc004fdm.2_Intron|TMEM185A_uc011mxp.1_Intron|TMEM185A_uc004fdo.2_Intron|TMEM185A_uc011mxq.1_Intron|TMEM185A_uc004fdp.3_Intron	NM_016153	NP_057237	Q9UBD0	HSFX1_HUMAN	heat shock transcription factor family, X linked							cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGGGCTCAGCCTGCTGCCTTGCCCCTCTGCTGCCTT	0.528													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13285655	13285656	+	IGR	INS	-	GA	GA	rs113499634		TCGA-BP-4770-01A-01D-1501-10	TCGA-BP-4770-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13285655_13285656insGA								None (None upstream) : None (None downstream)																							caataccacgggggggtgtata	0.000													6	3	---	---	---	---	
