Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SAMD11	148398	broad.mit.edu	37	1	878409	878409	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:878409C>T	uc001abw.1	+	11	1615	c.1535C>T	c.(1534-1536)CCT>CTT	p.P512L	SAMD11_uc001abx.1_Missense_Mutation_p.P375L	NM_152486	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11	512						nucleus					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CTGGGCTTCCCTTATGCCGTC	0.677													3	14	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54605450	54605450	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54605450C>T	uc001cwv.1	-	4	1941	c.1093G>A	c.(1093-1095)GGC>AGC	p.G365S		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	365	CUB 3.					extracellular region				ovary(1)	1						ACAGAGAAGCCCCTGCGGGTG	0.622													12	47	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118581935	118581935	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118581935T>G	uc001ehk.2	-	23	3367	c.3299A>C	c.(3298-3300)GAG>GCG	p.E1100A		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1100						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ACTTTGTTCCTCATCTCCTTC	0.373													36	121	---	---	---	---	PASS
RUSC1	23623	broad.mit.edu	37	1	155291906	155291906	+	Silent	SNP	C	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155291906C>A	uc001fkj.2	+	2	571	c.342C>A	c.(340-342)CCC>CCA	p.P114P	RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_5'Flank|C1orf104_uc001fki.2_Intron|RUSC1_uc001fkk.2_Silent_p.P114P|RUSC1_uc009wqn.1_RNA|RUSC1_uc009wqo.1_5'Flank|RUSC1_uc001fkl.2_5'Flank|RUSC1_uc001fkp.2_5'Flank|RUSC1_uc001fkq.2_5'Flank|RUSC1_uc010pgb.1_5'Flank|RUSC1_uc009wqp.1_5'Flank|RUSC1_uc001fkn.2_5'Flank|RUSC1_uc001fko.2_5'Flank|RUSC1_uc001fkr.2_5'Flank	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a	114						cytoplasm|nucleolus	SH3/SH2 adaptor activity	p.V114G(1)		ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			ATCTTAGCCCCGATGAGTCCC	0.627													14	56	---	---	---	---	PASS
LBR	3930	broad.mit.edu	37	1	225599096	225599096	+	Silent	SNP	T	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225599096T>A	uc001hoy.2	-	9	1274	c.1131A>T	c.(1129-1131)CGA>CGT	p.R377R	LBR_uc001hoz.2_Silent_p.R377R|LBR_uc001hpa.1_Silent_p.R377R	NM_002296	NP_002287	Q14739	LBR_HUMAN	lamin B receptor	377					cholesterol biosynthetic process	integral to nuclear inner membrane	chromo shadow domain binding|delta14-sterol reductase activity|DNA binding|lamin binding|receptor activity			ovary(1)|skin(1)	2	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AAGTACCAATTCGAGGGTTTA	0.393													36	143	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													2	7	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152548582	152548582	+	Silent	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152548582T>C	uc010fnx.2	-	22	2288	c.2097A>G	c.(2095-2097)CAA>CAG	p.Q699Q	NEB_uc010fny.1_Silent_p.Q253Q	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	699	Nebulin 16.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATCACTGTTTTGAGCTGCAA	0.373													50	163	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179643760	179643760	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179643760C>T	uc010zfg.1	-	24	4273	c.4049G>A	c.(4048-4050)CGT>CAT	p.R1350H	TTN_uc010zfh.1_Missense_Mutation_p.R1304H|TTN_uc010zfi.1_Missense_Mutation_p.R1304H|TTN_uc010zfj.1_Missense_Mutation_p.R1304H|TTN_uc002unb.2_Missense_Mutation_p.R1350H|uc002unc.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1350							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.R1304H(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACAGGTATACGCAGACTAGC	0.413													29	90	---	---	---	---	PASS
UGT1A6	54578	broad.mit.edu	37	2	234602164	234602164	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234602164A>G	uc002vuv.3	+	1	653	c.514A>G	c.(514-516)AGG>GGG	p.R172G	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Missense_Mutation_p.R172G	NM_001072	NP_001063	P19224	UD16_HUMAN	UDP glycosyltransferase 1 family, polypeptide A6	172					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity				0		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)		GTACCTCTTCAGGGGTTTTCC	0.498													74	190	---	---	---	---	PASS
RAMP1	10267	broad.mit.edu	37	2	238820196	238820196	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238820196C>T	uc002vxj.2	+	3	350	c.218C>T	c.(217-219)ACC>ATC	p.T73I		NM_005855	NP_005846	O60894	RAMP1_HUMAN	receptor activity-modifying protein 1 precursor	73	Extracellular (Potential).				intracellular protein transport|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane	protein transporter activity				0		Breast(86;0.000596)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;9.56e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.49e-11)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.49e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00013)|Lung(119;0.0119)|LUSC - Lung squamous cell carcinoma(224;0.0288)	Pramlintide(DB01278)	GCCGACTGCACCTGGCACATG	0.657													11	38	---	---	---	---	PASS
PRSS50	29122	broad.mit.edu	37	3	46753884	46753884	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46753884C>A	uc003cqe.1	-	6	1069	c.1010G>T	c.(1009-1011)AGC>ATC	p.S337I	PRSS50_uc003cqf.1_Missense_Mutation_p.S251I	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN	testes-specific protease 50 precursor	337	Peptidase S1.				proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity				0						TGGGGCCTCGCTCTTCTGGCA	0.642													3	28	---	---	---	---	PASS
RNF123	63891	broad.mit.edu	37	3	49734822	49734822	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49734822T>C	uc003cxh.2	+	5	360	c.274T>C	c.(274-276)TCC>CCC	p.S92P	RNF123_uc010hky.1_5'Flank|RNF123_uc003cxi.2_5'Flank	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	92	B30.2/SPRY.					cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCTTGGCCCATCCACTGTGGT	0.607													11	27	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3208255	3208255	+	Silent	SNP	G	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3208255G>T	uc011bvq.1	+	44	5902	c.5757G>T	c.(5755-5757)ACG>ACT	p.T1919T		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1917					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGCACTTAACGTGGCTCATTG	0.453													28	126	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57204599	57204599	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57204599C>T	uc003hbn.2	-	15	3419	c.3266G>A	c.(3265-3267)TGT>TAT	p.C1089Y	AASDH_uc010ihb.2_Missense_Mutation_p.C604Y|AASDH_uc011caa.1_3'UTR|AASDH_uc003hbo.2_Missense_Mutation_p.C989Y|AASDH_uc011cab.1_Missense_Mutation_p.C604Y|AASDH_uc010ihc.2_3'UTR	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	1089					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TAAATCCAGACAATAAACATA	0.318													14	172	---	---	---	---	PASS
IL8	3576	broad.mit.edu	37	4	74606347	74606347	+	5'UTR	SNP	C	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74606347C>G	uc003hhe.2	+	1					IL8_uc011cbh.1_5'UTR	NM_000584	NP_000575	P10145	IL8_HUMAN	interleukin 8 precursor						angiogenesis|calcium-mediated signaling|cell cycle arrest|cellular response to lipopolysaccharide|embryonic digestive tract development|G-protein coupled receptor protein signaling pathway|immune response|induction of positive chemotaxis|inflammatory response|negative regulation of cell proliferation|neutrophil activation|neutrophil chemotaxis|positive regulation of neutrophil chemotaxis|regulation of cell adhesion|regulation of retroviral genome replication	extracellular space|intracellular	chemokine activity|interleukin-8 receptor binding			ovary(2)	2	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)	Ketoprofen(DB01009)|Salbutamol(DB01001)|Simvastatin(DB00641)|Zileuton(DB00744)	AAGAAACCACCGGAAGGAACC	0.502													53	203	---	---	---	---	PASS
IPO11	51194	broad.mit.edu	37	5	61779841	61779841	+	Silent	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61779841C>T	uc003jtc.2	+	11	1216	c.1026C>T	c.(1024-1026)AGC>AGT	p.S342S	IPO11_uc011cqr.1_Silent_p.S382S|IPO11_uc003jtb.1_Silent_p.S342S	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	342	HEAT 3.					cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		TTCTAGATAGCAGCCCTGAAA	0.318													18	105	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553992	140553992	+	Missense_Mutation	SNP	G	T	T	rs146429251	byFrequency	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553992G>T	uc003lit.2	+	1	1750	c.1576G>T	c.(1576-1578)GCG>TCG	p.A526S		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	526	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCCTGCAGGCGTTCGAGTT	0.706													21	74	---	---	---	---	PASS
TRIM7	81786	broad.mit.edu	37	5	180622113	180622113	+	3'UTR	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180622113C>T	uc003mmz.1	-	7					TRIM7_uc003mmv.1_3'UTR|TRIM7_uc003mmw.1_3'UTR|TRIM7_uc003mmx.1_3'UTR|TRIM7_uc003mmy.1_3'UTR	NM_203293	NP_976038	Q9C029	TRIM7_HUMAN	tripartite motif-containing 7 isoform 1							cytoplasm|nucleus	zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TCTGGGGAGGCGACATCCCCT	0.637													4	24	---	---	---	---	PASS
IP6K3	117283	broad.mit.edu	37	6	33690404	33690404	+	3'UTR	SNP	A	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33690404A>G	uc010jvf.2	-	7					IP6K3_uc003ofb.2_3'UTR	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3						inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0						ACTATTATGAAGACATCTAAG	0.428													9	12	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57498975	57498975	+	Silent	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57498975T>C	uc003pdx.2	+	14	1326	c.1239T>C	c.(1237-1239)GAT>GAC	p.D413D		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	413					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGATTTTGGATTTAGTAAAGG	0.294													6	22	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21789334	21789334	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21789334G>C	uc003svc.2	+	54	8764	c.8733G>C	c.(8731-8733)AAG>AAC	p.K2911N		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2911	AAA 4 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CTGGAGCCAAGAACATGCCCA	0.468									Kartagener_syndrome				17	50	---	---	---	---	PASS
C7orf29	113763	broad.mit.edu	37	7	150027696	150027696	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150027696G>A	uc003wgy.2	+	1	759	c.203G>A	c.(202-204)CGC>CAC	p.R68H	LRRC61_uc003wgv.2_Intron|LRRC61_uc003wgx.2_Intron|LRRC61_uc003wgw.2_Intron	NM_138434	NP_612443	Q96FA7	CG029_HUMAN	hypothetical protein LOC113763	68										ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.011)			CTCTTCTACCGCGAGGAGTTT	0.622													27	117	---	---	---	---	PASS
CLN8	2055	broad.mit.edu	37	8	1728474	1728474	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1728474T>G	uc003wpo.3	+	3	907	c.602T>G	c.(601-603)TTT>TGT	p.F201C		NM_018941	NP_061764	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8	201	TLC.				cell death|ceramide biosynthetic process|cholesterol metabolic process|lipid transport|negative regulation of proteolysis|phospholipid metabolic process	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		ATTCACATGTTTCACTGCCGC	0.522													4	81	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428649	12428649	+	Intron	SNP	T	C	C	rs593329		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428649T>C	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		TGGTGCTGCTTGGAGTACCAA	0.239													5	16	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428650	12428650	+	Intron	SNP	G	A	A	rs593330		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428650G>A	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		GGTGCTGCTTGGAGTACCAAA	0.239													5	16	---	---	---	---	PASS
C8orf34	116328	broad.mit.edu	37	8	69351861	69351861	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69351861G>A	uc010lyz.2	+	2	246	c.197G>A	c.(196-198)TGG>TAG	p.W66*	C8orf34_uc010lyx.1_Nonsense_Mutation_p.W66*|C8orf34_uc010lyy.1_Nonsense_Mutation_p.W66*|C8orf34_uc003xyb.2_Nonsense_Mutation_p.W41*	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328	66					signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GCAGCTCTATGGGCAGAAAGT	0.368													18	92	---	---	---	---	PASS
TATDN1	83940	broad.mit.edu	37	8	125500921	125500921	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125500921T>C	uc003yrd.2	-	12	850	c.808A>G	c.(808-810)ATG>GTG	p.M270V	TATDN1_uc003yre.2_RNA|TATDN1_uc010mdm.2_Missense_Mutation_p.M223V|TATDN1_uc003yrf.2_Missense_Mutation_p.M306V	NM_032026	NP_114415	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1 isoform a	270						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ACTGCTGACATTATCTCCAAT	0.284													26	131	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12009405	12009405	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12009405G>T	uc001ila.2	-	9	2476	c.2002C>A	c.(2002-2004)CGT>AGT	p.R668S	UPF2_uc001ilb.2_Missense_Mutation_p.R668S|UPF2_uc001ilc.2_Missense_Mutation_p.R668S|UPF2_uc009xiz.1_Missense_Mutation_p.R668S	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	668	MIF4G 2.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				CCTATAAAACGAACAGTTTTA	0.289													16	83	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70333253	70333253	+	Silent	SNP	T	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70333253T>A	uc001jok.3	+	2	1663	c.1158T>A	c.(1156-1158)GGT>GGA	p.G386G		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	386					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						CAGTTCATGGTGAGGCCCTGG	0.488													11	348	---	---	---	---	PASS
KIAA0913	23053	broad.mit.edu	37	10	75551975	75551975	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75551975C>A	uc009xrl.2	+	10	1710	c.1678C>A	c.(1678-1680)CAG>AAG	p.Q560K	KIAA0913_uc001jve.2_Missense_Mutation_p.Q560K|KIAA0913_uc001jvf.2_Missense_Mutation_p.Q560K|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_5'UTR|KIAA0913_uc010qkr.1_5'UTR|KIAA0913_uc001jvj.2_5'UTR	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	560	Gly-rich.						zinc ion binding			breast(1)	1	Prostate(51;0.0112)					CCCCTCATCACAGCGGGGTCC	0.662													3	33	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62288165	62288165	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288165T>G	uc001ntl.2	-	5	14024	c.13724A>C	c.(13723-13725)AAA>ACA	p.K4575T	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4575					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GCCCTTCAGTTTCCCTTCTGG	0.468													23	94	---	---	---	---	PASS
SLC22A12	116085	broad.mit.edu	37	11	64360346	64360346	+	Silent	SNP	C	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64360346C>A	uc001oam.1	+	2	1245	c.498C>A	c.(496-498)GCC>GCA	p.A166A	SLC22A12_uc009ypr.1_Silent_p.A166A|SLC22A12_uc001oal.1_5'UTR|SLC22A12_uc009yps.1_Silent_p.A166A|SLC22A12_uc001oan.1_Silent_p.A166A|SLC22A12_uc009ypt.2_5'Flank	NM_144585	NP_653186	Q96S37	S22AC_HUMAN	urate anion exchanger 1 isoform a	166	Helical; (Potential).				cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity			ovary(1)	1						GCGGCCCTGCCTCAGACAGGT	0.622													22	87	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73825591	73825591	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73825591T>C	uc001ouu.2	-	10	1795	c.1568A>G	c.(1567-1569)CAA>CGA	p.Q523R	C2CD3_uc001ouv.2_Missense_Mutation_p.Q523R	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	523						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					TGTCATCGTTTGGGCATCTTC	0.453													26	118	---	---	---	---	PASS
TMED2	10959	broad.mit.edu	37	12	124069276	124069276	+	Silent	SNP	G	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124069276G>A	uc001ufg.2	+	1	201	c.93G>A	c.(91-93)GAG>GAA	p.E31E		NM_006815	NP_006806	Q15363	TMED2_HUMAN	coated vesicle membrane protein precursor	31	Lumenal (Potential).|GOLD.				protein transport|vesicle-mediated transport	COPI coated vesicle membrane|ER-Golgi intermediate compartment|integral to membrane|microsome|zymogen granule membrane	protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000138)|Epithelial(86;0.000613)|all cancers(50;0.00745)		ATGCTGAAGAGTGCTTCTTTG	0.627													21	57	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28896576	28896576	+	Intron	SNP	C	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28896576C>G	uc001usb.3	-						FLT1_uc010aap.2_5'UTR|FLT1_uc010aaq.2_Intron|FLT1_uc001usa.3_Intron	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	ACAATGTTAGCAAAACATAAA	0.383													4	11	---	---	---	---	PASS
NDFIP2	54602	broad.mit.edu	37	13	80094986	80094986	+	Silent	SNP	G	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80094986G>A	uc001vlf.2	+	2	443	c.363G>A	c.(361-363)GAG>GAA	p.E121E	NDFIP2_uc010tib.1_Silent_p.E121E|NDFIP2_uc001vlg.2_RNA	NM_019080	NP_061953	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2 isoform 1	121	Cytoplasmic (Potential).				negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endoplasmic reticulum|Golgi membrane|integral to membrane|mitochondrion|multivesicular body membrane|perinuclear region of cytoplasm	signal transducer activity|WW domain binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		CGGCTATAGAGCAGCCACCTA	0.383													23	72	---	---	---	---	PASS
CLYBL	171425	broad.mit.edu	37	13	100511253	100511253	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100511253C>A	uc001vok.2	+	3	402	c.388C>A	c.(388-390)CCT>ACT	p.P130T	CLYBL_uc010tix.1_Missense_Mutation_p.P130T|CLYBL_uc010tiy.1_Missense_Mutation_p.P130T	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor	130					cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCGGGTCCTTCCTTCCAGCCT	0.498													15	46	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24801009	24801009	+	Silent	SNP	G	C	C	rs146843899	byFrequency	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24801009G>C	uc001wov.2	-	4	660	c.654C>G	c.(652-654)ACC>ACG	p.T218T	ADCY4_uc001wow.2_Silent_p.T218T|ADCY4_uc010toh.1_5'UTR|ADCY4_uc001wox.2_Silent_p.T218T|ADCY4_uc001woy.2_Silent_p.T218T	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	218	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		GCTTCTTCTCGGTGTCCAGCC	0.468													9	21	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54997070	54997070	+	Intron	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54997070T>C	uc001xay.2	+						CGRRF1_uc010tra.1_Intron|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						TAAGCACTCCTCAAGCATTAG	0.343													4	40	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86940775	86940775	+	Silent	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86940775C>T	uc002blz.1	+	17	2495	c.2415C>T	c.(2413-2415)GGC>GGT	p.G805G		NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	805					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						TCATCAACGGCAAGTATGTCA	0.512													29	133	---	---	---	---	PASS
FBXL19	54620	broad.mit.edu	37	16	30939867	30939867	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30939867C>T	uc002eab.2	+	6	925	c.767C>T	c.(766-768)CCG>CTG	p.P256L	FBXL19_uc002dzz.1_5'UTR|FBXL19_uc002eaa.1_Intron	NM_001099784	NP_001093254	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	256	Pro-rich.						DNA binding|zinc ion binding			ovary(2)|lung(1)|breast(1)	4						CCAGGCGGCCCGGGCCTGCTG	0.667													4	11	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31141808	31141808	+	Silent	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31141808C>T	uc002eay.2	+	9	1056	c.1038C>T	c.(1036-1038)GTC>GTT	p.V346V	MYST1_uc002eax.2_Silent_p.V346V|MYST1_uc002eaz.2_Silent_p.V188V|MYST1_uc002eba.2_Silent_p.V130V|MYST1_uc002ebb.2_RNA	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1	346					histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						AGAGCACAGTCGGCTCCCCGG	0.627													5	30	---	---	---	---	PASS
COG1	9382	broad.mit.edu	37	17	71204408	71204408	+	Intron	SNP	G	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71204408G>A	uc002jjg.2	+						COG1_uc002jjh.2_Intron|COG1_uc002jjf.1_3'UTR|FAM104A_uc002jjj.3_3'UTR|FAM104A_uc002jji.3_3'UTR	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1						Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			TGGGCAGGAGGGCTCAGGCCA	0.612													18	38	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271484	22271484	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271484C>T	uc010ecx.2	+	4	1101	c.932C>T	c.(931-933)ACT>ATT	p.T311I	ZNF257_uc010ecy.2_Missense_Mutation_p.T279I	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	311					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGAATTCATACTGGAGAGAAA	0.408													16	93	---	---	---	---	PASS
ZNF528	84436	broad.mit.edu	37	19	52918813	52918813	+	Silent	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52918813T>C	uc002pzh.2	+	7	1134	c.708T>C	c.(706-708)ACT>ACC	p.T236T	ZNF528_uc002pzi.2_Silent_p.T3T	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		GAATGCATACTGGAGAGAAGC	0.393													30	117	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39990048	39990048	+	Silent	SNP	T	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39990048T>G	uc002xjy.1	-	4	2385	c.2161A>C	c.(2161-2163)AGA>CGA	p.R721R		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	721						proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				AGGCCCTCTCTGGGCCTCAGT	0.667													5	30	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47531392	47531392	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47531392T>C	uc002zia.1	+	2	84	c.2T>C	c.(1-3)ATG>ACG	p.M1T	COL6A2_uc002zhy.1_Missense_Mutation_p.M1T|COL6A2_uc002zhz.1_Missense_Mutation_p.M1T|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	1					axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCTGCCAAGATGCTCCAGGGC	0.672													6	32	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53227751	53227751	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53227751G>A	uc004drz.2	-	17	2970	c.2437C>T	c.(2437-2439)CAG>TAG	p.Q813*	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Nonsense_Mutation_p.Q746*|KDM5C_uc004dsa.2_Nonsense_Mutation_p.Q812*	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	813					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						TTTAGTTGCTGCAGCAGCTCA	0.552			N|F|S		clear cell renal carcinoma								7	7	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129146951	129146951	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129146951G>C	uc004evb.1	+	4	317	c.203G>C	c.(202-204)GGC>GCC	p.G68A	BCORL1_uc010nrd.1_5'UTR	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	68					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						GTTGGAAGTGGCAGCAATGCC	0.577													45	37	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3418615	3418615	+	Intron	DEL	G	-	-	rs111656273		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3418615delG	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GTGCCCCCCCGGCGCCTCCTC	0.711													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13123163	13123163	+	IGR	DEL	A	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13123163delA								PRAMEF5 (5412 upstream) : LOC440563 (59798 downstream)																							agactccatcaaaaaaaaaaa	0.234													8	4	---	---	---	---	
SRRM1	10250	broad.mit.edu	37	1	24973014	24973014	+	Intron	DEL	A	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24973014delA	uc001bjm.2	+						SRRM1_uc010oel.1_Intron|SRRM1_uc009vrh.1_Intron|SRRM1_uc009vri.1_5'Flank|SRRM1_uc010oem.1_5'Flank	NM_005839	NP_005830	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		actctgtctcaaaaaaaaaaa	0.129													8	5	---	---	---	---	
RPA2	6118	broad.mit.edu	37	1	28223995	28223996	+	Intron	DEL	AG	-	-	rs55902224		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28223995_28223996delAG	uc001bpe.1	-						RPA2_uc001bpd.1_Intron|RPA2_uc010ofp.1_Intron	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		AAAAAAAAAAAGAAAAGTTATT	0.302								Direct_reversal_of_damage|NER					4	2	---	---	---	---	
EIF3I	8668	broad.mit.edu	37	1	32691629	32691629	+	Intron	DEL	A	-	-	rs74686229		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32691629delA	uc001bur.3	+						EIF3I_uc009vuc.2_Intron|EIF3I_uc001bus.2_Intron	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				ctcaaaaaagaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37568490	37568496	+	IGR	DEL	AGAGGAG	-	-	rs12747649		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37568490_37568496delAGAGGAG								GRIK3 (68646 upstream) : ZC3H12A (371623 downstream)																							aggaagaggaagaggagggaggaggag	0.000													4	2	---	---	---	---	
CHI3L2	1117	broad.mit.edu	37	1	111772328	111772328	+	Intron	DEL	G	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111772328delG	uc001eam.2	+						CHI3L2_uc001ean.2_Intron|CHI3L2_uc001eao.2_5'Flank|CHI3L2_uc009wga.2_5'Flank	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		aaaaaaaaaagaaaCCACAGC	0.254													12	9	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145106429	145106442	+	Intron	DEL	GTGTGTGTGTATGT	-	-	rs3977180		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145106429_145106442delGTGTGTGTGTATGT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						gtattccatggtgtgtgtgtatgtgtgtgtgtgt	0.000													3	4	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150390386	150390387	+	Intron	INS	-	TC	TC	rs140431392	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150390386_150390387insTC	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						tcttttctttttctctctctct	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	227987663	227987666	+	IGR	DEL	TCCT	-	-	rs112328936		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227987663_227987666delTCCT								SNAP47 (18731 upstream) : PRSS38 (15752 downstream)																							tttttCtccctccttccttccttc	0.005													4	3	---	---	---	---	
PPM1G	5496	broad.mit.edu	37	2	27605696	27605697	+	Intron	INS	-	T	T	rs111310967		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27605696_27605697insT	uc002rkl.2	-						ZNF513_uc002rkj.2_5'Flank|ZNF513_uc002rkk.2_5'Flank|PPM1G_uc002rkm.2_Intron	NM_002707	NP_002698	O15355	PPM1G_HUMAN	protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					agtcttttttgttttttttttt	0.025													5	4	---	---	---	---	
C2orf42	54980	broad.mit.edu	37	2	70396380	70396381	+	Intron	DEL	CA	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70396380_70396381delCA	uc002sgh.2	-							NM_017880	NP_060350	Q9NWW7	CB042_HUMAN	hypothetical protein LOC54980												0						TCTCCCTCACcacacacacaca	0.233													4	2	---	---	---	---	
GGCX	2677	broad.mit.edu	37	2	85781577	85781578	+	Intron	INS	-	TTGTTGTTG	TTGTTGTTG	rs145024834	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85781577_85781578insTTGTTGTTG	uc002sps.2	-						GGCX_uc010yss.1_Intron|GGCX_uc010yst.1_Intron	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	CTCTAGgttgtttgttgttgtt	0.233													8	4	---	---	---	---	
TRIM43	129868	broad.mit.edu	37	2	96265407	96265408	+	3'UTR	INS	-	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96265407_96265408insT	uc002suv.2	+	7						NM_138800	NP_620155	Q96BQ3	TRI43_HUMAN	tripartite motif-containing 43							intracellular	zinc ion binding			ovary(1)	1						ACTGTTCAGGCTTTTTTGTACT	0.307													3	3	---	---	---	---	
POLR1B	84172	broad.mit.edu	37	2	113332301	113332301	+	Intron	DEL	A	-	-	rs35338335		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113332301delA	uc002thw.2	+						POLR1B_uc010fkn.2_Intron|POLR1B_uc002thx.2_Intron|POLR1B_uc010fko.2_Intron|POLR1B_uc010fkp.2_Intron|POLR1B_uc010yxn.1_Intron|POLR1B_uc002thy.2_Intron|POLR1B_uc010yxo.1_Intron	NM_019014	NP_061887	Q9H9Y6	RPA2_HUMAN	RNA polymerase I polypeptide B isoform 1						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(1)	1						cctgtatcataaaaaaaaaaa	0.104													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173929386	173929387	+	IGR	INS	-	GT	GT	rs138895402	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173929386_173929387insGT								RAPGEF4 (11768 upstream) : ZAK (11178 downstream)																							tatgcatgtgcgtgtgtgtgtg	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235453352	235453353	+	IGR	INS	-	G	G			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235453352_235453353insG								ARL4C (47659 upstream) : SH3BP4 (407275 downstream)																							gaaggaaggaaggaagggaagg	0.000													9	5	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11483145	11483145	+	Intron	DEL	T	-	-	rs35365064		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11483145delT	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						ttttttttaattttttttttt	0.159													4	3	---	---	---	---	
GOLGA4	2803	broad.mit.edu	37	3	37293117	37293118	+	Intron	DEL	TT	-	-	rs112817114		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37293117_37293118delTT	uc003cgv.2	+						GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Intron|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgu.1_Intron	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4						Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ACAATTGGTCTTTTTTTTTTTT	0.183													5	4	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44893954	44893955	+	Intron	DEL	AA	-	-	rs78085865		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44893954_44893955delAA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TTCCTGAATTAAAAAAAAAAAA	0.292													4	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184552423	184552423	+	Intron	DEL	T	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184552423delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc003fpc.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATGTTTTTCTTTTTTTTTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194712007	194712008	+	IGR	INS	-	TCC	TCC	rs111948714	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194712007_194712008insTCC								FAM43A (302243 upstream) : C3orf21 (77007 downstream)																							cctcctcctcttcctcctcctc	0.000													4	2	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937314	195937315	+	Intron	INS	-	TAAAG	TAAAG	rs59406858		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937314_195937315insTAAAG	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		agagaaagaaagaaagaaaaga	0.233													4	2	---	---	---	---	
SDHA	6389	broad.mit.edu	37	5	218381	218382	+	5'UTR	INS	-	C	C	rs3214561		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:218381_218382insC	uc003jao.3	+	1					CCDC127_uc003jam.1_5'Flank|SDHA_uc003jan.2_5'UTR|SDHA_uc011clv.1_5'UTR|SDHA_uc011clw.1_5'UTR|SDHA_uc003jap.3_5'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	AGGCGCGGTATCCCCCCTCCCC	0.748									Familial_Paragangliomas				3	3	---	---	---	---	
PLCXD3	345557	broad.mit.edu	37	5	41312744	41312748	+	3'UTR	DEL	CCCTC	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41312744_41312748delCCCTC	uc003jmm.1	-	3						NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						ttctgtccttccctcccttcttccc	0.015													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85703814	85703815	+	IGR	INS	-	AAGG	AAGG	rs149876942	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85703814_85703815insAAGG								NBPF22P (110452 upstream) : COX7C (209969 downstream)																							ggaaggaaggaaggaaggaagg	0.089													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159251286	159251287	+	IGR	DEL	GA	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159251286_159251287delGA								LOC285627 (358002 upstream) : ADRA1B (92453 downstream)																							tgcagcaagTGAGAGAGAGAGA	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37307805	37307806	+	IGR	INS	-	AC	AC	rs140040115	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37307805_37307806insAC								TBC1D22B (7060 upstream) : RNF8 (13942 downstream)																							tgagactcagtacacacacaca	0.010													3	5	---	---	---	---	
C6orf153	88745	broad.mit.edu	37	6	42989414	42989419	+	In_Frame_Del	DEL	GCCGGG	-	-	rs3833662		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42989414_42989419delGCCGGG	uc003otp.1	+	1	30_35	c.22_27delGCCGGG	c.(22-27)GCCGGGdel	p.AG14del		NM_033112	NP_149103	Q96EU6	RRP36_HUMAN	hypothetical protein LOC88745	14_15					ribosomal small subunit biogenesis|rRNA processing	nucleolus					0			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TAACTAccgcgccggggccggggccg	0.529													11	5	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													9	4	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29438231	29438232	+	Intron	INS	-	G	G	rs140510730	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29438231_29438232insG	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						ttatgttatgaggggggggtcc	0.084													4	3	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73456758	73456758	+	Intron	DEL	A	-	-	rs72489767		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73456758delA	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	accttgtgtcaaaaaaaaaaa	0.239			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						2	4	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83720616	83720617	+	Intron	INS	-	AAAG	AAAG	rs141527267	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83720616_83720617insAAAG	uc003uhz.2	-							NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						aagaaaaagaaaaagaaaggaa	0.020													3	4	---	---	---	---	
KIF13B	23303	broad.mit.edu	37	8	28990075	28990076	+	Intron	INS	-	A	A			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28990075_28990076insA	uc003xhh.3	-						uc003xhi.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TTATATCAGGGAAAAAAAATAG	0.307													4	2	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	gcacgccacacacgcacgccacac	0.137													3	3	---	---	---	---	
ZFAND5	7763	broad.mit.edu	37	9	74974177	74974178	+	Intron	INS	-	TCT	TCT	rs76548591		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74974177_74974178insTCT	uc004aiv.2	-						ZFAND5_uc010mox.1_Intron|ZFAND5_uc010moy.1_Intron|ZFAND5_uc004aix.2_Intron|ZFAND5_uc004aiw.2_Intron|ZFAND5_uc004aiy.2_Intron	NM_006007	NP_005998	O76080	ZFAN5_HUMAN	zinc finger, AN1-type domain 5								DNA binding|zinc ion binding				0						GATACTCATACTCAAGATACTT	0.406													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	26958525	26958527	+	IGR	DEL	AAG	-	-	rs138608083		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26958525_26958527delAAG								LOC731789 (16143 upstream) : PDSS1 (28068 downstream)																							aagaaaagaaaagaagaaGAATC	0.133													6	4	---	---	---	---	
CALHM2	51063	broad.mit.edu	37	10	105208932	105208932	+	Intron	DEL	A	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105208932delA	uc001kwz.2	-						CALHM2_uc001kxa.2_Intron|CALHM2_uc001kxc.2_Intron|CALHM2_uc001kxb.2_Intron|CALHM2_uc001kxd.1_3'UTR	NM_015916	NP_057000	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2							integral to membrane				skin(1)	1						GATTTACAGTAAAAAAAAAAA	0.398													4	2	---	---	---	---	
NDUFV1	4723	broad.mit.edu	37	11	67377308	67377309	+	Intron	INS	-	T	T			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67377308_67377309insT	uc001omj.2	+						NDUFV1_uc010rpv.1_Intron|NDUFV1_uc001oml.2_Intron|NDUFV1_uc001omk.3_Intron|NDUFV1_uc009yrz.1_Intron|NDUFV1_uc010rpw.1_5'Flank	NM_007103	NP_009034	P49821	NDUV1_HUMAN	NADH dehydrogenase ubiquinone flavoprotein 1						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	GCTGGTGTAAATTTTTTTTTTT	0.411													4	2	---	---	---	---	
MAGOHB	55110	broad.mit.edu	37	12	10763420	10763427	+	Intron	DEL	TAGACATG	-	-	rs140380366		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10763420_10763427delTAGACATG	uc001qyq.1	-						MAGOHB_uc001qyr.1_Intron	NM_018048	NP_060518	Q96A72	MGN2_HUMAN	mago-nashi homolog B						mRNA processing|mRNA transport|RNA splicing	nucleus	RNA binding			breast(1)	1						AGATCATTGCTAGACATGTAGACAATAA	0.312													3	6	---	---	---	---	
AK7	122481	broad.mit.edu	37	14	96937671	96937671	+	Intron	DEL	A	-	-	rs35566282		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96937671delA	uc001yfn.2	+							NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		ccgtctctttaaaaaaaaaaa	0.109													5	3	---	---	---	---	
NF1P1	440225	broad.mit.edu	37	15	21135196	21135197	+	5'Flank	DEL	GT	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21135196_21135197delGT	uc001ytv.1	-											Human NF1-related locus DNA in A9 mouse DNA background.												0						gtcttTGAGAgtgtgtgtgtgt	0.233													4	2	---	---	---	---	
GNB5	10681	broad.mit.edu	37	15	52433631	52433631	+	Intron	DEL	T	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52433631delT	uc002abt.1	-						GNB5_uc002abr.1_Intron|GNB5_uc002abs.1_Intron	NM_016194	NP_057278	O14775	GBB5_HUMAN	guanine nucleotide-binding protein, beta-5							heterotrimeric G-protein complex	GTPase activity|signal transducer activity			lung(1)	1				all cancers(107;0.0163)		TCTTTCTTtcttttttttttt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98845069	98845070	+	IGR	INS	-	GAGGAGGAA	GAGGAGGAA	rs141877439	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98845069_98845070insGAGGAGGAA								ARRDC4 (328002 upstream) : FAM169B (135321 downstream)																							aggaggaagaggaggaggagga	0.129													4	2	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13003703	13003706	+	Intron	DEL	CCTT	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13003703_13003706delCCTT	uc010uyy.1	+						SHISA9_uc002dcd.2_3'UTR	NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						cttcccttccccttccttccttcc	0.020													4	2	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13267235	13267238	+	Intron	DEL	ACAC	-	-	rs66910345		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13267235_13267238delACAC	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						GTGTGCATGTacacacacacacac	0.181													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700253	14700254	+	Intron	INS	-	A	A	rs113976422		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700253_14700254insA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						agaccctgagggaaaaaaaaaa	0.139													5	3	---	---	---	---	
SPATA2L	124044	broad.mit.edu	37	16	89764882	89764882	+	Intron	DEL	C	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89764882delC	uc002foj.2	-						SPATA2L_uc002fok.2_Intron	NM_152339	NP_689552	Q8IUW3	SPA2L_HUMAN	spermatogenesis associated 2-like												0		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		ATGATGATTTCtttttttttt	0.289													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18988562	18988562	+	IGR	DEL	T	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18988562delT								GRAP (38226 upstream) : GRAPL (42220 downstream)																							CTGATGTGTGTTTTTTTTTTT	0.279													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	32126397	32126404	+	Intron	DEL	CTTTCTTT	-	-	rs2881780		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32126397_32126404delCTTTCTTT	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	ttctttcttcctttctttctttctttct	0.067													4	2	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925054	47925055	+	Intron	INS	-	AC	AC	rs150685532	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925054_47925055insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						cacacacacagacacacacaca	0.183													4	2	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	50176388	50176388	+	Intron	DEL	G	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50176388delG	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			ttcatatggtggtgttatgct	0.000													4	2	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79639512	79639513	+	Intron	DEL	CT	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79639512_79639513delCT	uc002kbc.3	+						CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TCACCCTCCCCTCTCTCCCTCA	0.644													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15198505	15198508	+	IGR	DEL	TTTG	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15198505_15198508delTTTG								ANKRD30B (345768 upstream) : LOC644669 (115047 downstream)																							CACATTCTGATTTGTTTTTTGTAT	0.358													4	2	---	---	---	---	
LAMA3	3909	broad.mit.edu	37	18	21469682	21469689	+	Intron	DEL	AAGGAAGA	-	-	rs112936521	by1000genomes	TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21469682_21469689delAAGGAAGA	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	gggaggaaggaaggaagaaaggaaggaa	0.106													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13445408	13445411	+	Intron	DEL	TGTG	-	-	rs138143360		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13445408_13445411delTGTG	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	tgtgtgtgtttgtgtgtgtgtgtg	0.309													5	3	---	---	---	---	
NWD1	284434	broad.mit.edu	37	19	16872616	16872616	+	Intron	DEL	A	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16872616delA	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7						TGATGTAAGGAAAAAAAAAAC	0.269													4	2	---	---	---	---	
CYP2F1	1572	broad.mit.edu	37	19	41877314	41877327	+	Intron	DEL	CTTTCTCTCTCTCT	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41877314_41877327delCTTTCTCTCTCTCT	uc010xvw.1	+						TMEM91_uc002oqi.2_Intron|TMEM91_uc010ehq.2_Intron			P24903	CP2F1_HUMAN	SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						tccctccctcctttctctctctctctttctctct	0.000													4	2	---	---	---	---	
KIR2DL3	3804	broad.mit.edu	37	19	55271765	55271766	+	Intron	DEL	GA	-	-	rs112795662		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55271765_55271766delGA	uc010erw.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		GGTGGAGGGTgagagagagaga	0.446													3	3	---	---	---	---	
MRPL39	54148	broad.mit.edu	37	21	26976400	26976400	+	Intron	DEL	A	-	-	rs11303574		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26976400delA	uc002ylo.2	-						MRPL39_uc002yln.2_Intron	NM_017446	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39 isoform a							mitochondrial ribosome	nucleotide binding				0						ATAATCAATTAAAAAAAAAAA	0.154													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28865288	28865291	+	IGR	DEL	GTGT	-	-	rs10691035		TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28865288_28865291delGTGT								ADAMTS5 (525849 upstream) : NCRNA00113 (229407 downstream)																							AAGAACCACCgtgtgtgtgtgtgt	0.221													4	2	---	---	---	---	
SNRPD3	6634	broad.mit.edu	37	22	24967719	24967719	+	Intron	DEL	A	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24967719delA	uc003aam.1	+						SNRPD3_uc011aju.1_Intron	NM_004175	NP_004166	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein polypeptide D3						histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	enzyme binding|histone pre-mRNA DCP binding			ovary(1)	1						ctcaaaaaataaaaaaaaaaa	0.259													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467628	1467629	+	Intron	DEL	TT	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467628_1467629delTT	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tttctttttctttctttctttc	0.000													3	4	---	---	---	---	
SSX3	10214	broad.mit.edu	37	X	48217953	48217953	+	5'Flank	DEL	A	-	-			TCGA-BP-5000-01A-01D-1462-08	TCGA-BP-5000-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48217953delA	uc004djd.1	-						SSX3_uc004dje.2_5'Flank|SSX3_uc010nic.2_5'Flank	NM_021014	NP_066294	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						agcaagactgaaaaaaaaaaa	0.015													5	3	---	---	---	---	
