Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MYOM3	127294	broad.mit.edu	37	1	24408447	24408447	+	Intron	SNP	C	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24408447C>A	uc001bin.3	-						MYOM3_uc001bim.3_Intron|MYOM3_uc001bio.2_Intron|MYOM3_uc001bip.1_3'UTR	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CTGGTCGCTGCTAAACAAGTC	0.577													3	20	---	---	---	---	PASS
TINAGL1	64129	broad.mit.edu	37	1	32042883	32042883	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32042883G>A	uc001bta.2	+	2	260	c.134G>A	c.(133-135)GGC>GAC	p.G45D	TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Missense_Mutation_p.G45D|TINAGL1_uc010ogj.1_Missense_Mutation_p.G45D|TINAGL1_uc010ogk.1_Missense_Mutation_p.G45D	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	45					endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		GACGCGGGAGGCCGGTACTGC	0.706													17	57	---	---	---	---	PASS
KHDRBS1	10657	broad.mit.edu	37	1	32504213	32504213	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32504213A>T	uc001bub.2	+	7	1274	c.1168A>T	c.(1168-1170)AGT>TGT	p.S390C	KHDRBS1_uc001bua.1_Missense_Mutation_p.S351C|KHDRBS1_uc001buc.1_RNA	NM_006559	NP_006550	Q07666	KHDR1_HUMAN	KH domain containing, RNA binding, signal	390					cell cycle arrest|cell proliferation|cell surface receptor linked signaling pathway|G2/M transition of mitotic cell cycle|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of RNA export from nucleus|transcription, DNA-dependent	membrane|nucleus	DNA binding|RNA binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TTACAGCCAGAGTCAAGGGTG	0.408													13	64	---	---	---	---	PASS
VPS45	11311	broad.mit.edu	37	1	150049228	150049228	+	Silent	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150049228C>T	uc001etp.2	+	6	1068	c.495C>T	c.(493-495)CTC>CTT	p.L165L	VPS45_uc010pbp.1_Intron|VPS45_uc010pbq.1_Silent_p.L129L|VPS45_uc010pbs.1_Intron|VPS45_uc001etq.2_5'Flank|VPS45_uc009wlm.1_Intron|VPS45_uc010pbr.1_Silent_p.L129L	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A	165					blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTACAGCTCTCCTTTTATCTC	0.403													13	155	---	---	---	---	PASS
KIAA0907	22889	broad.mit.edu	37	1	155895374	155895374	+	Intron	SNP	C	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155895374C>G	uc001fmi.1	-						KIAA0907_uc001fmj.1_Intron|KIAA0907_uc009wrk.1_Intron|KIAA0907_uc009wrl.1_Intron|KIAA0907_uc001fml.1_Intron|KIAA0907_uc001fmm.2_3'UTR	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889												0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			CCTGACTGTACCAACAAGTTG	0.388													24	91	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160302290	160302290	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160302290G>C	uc009wti.2	-	6	838	c.444C>G	c.(442-444)GAC>GAG	p.D148E	COPA_uc001fvv.3_Missense_Mutation_p.D148E|COPA_uc009wtj.1_Missense_Mutation_p.D94E	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	148	WD 4.				COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATACTACCAAGTCTTCTGTGG	0.468													10	80	---	---	---	---	PASS
KIF26B	55083	broad.mit.edu	37	1	245848753	245848753	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245848753G>A	uc001ibf.1	+	12	2908	c.2468G>A	c.(2467-2469)CGC>CAC	p.R823H	KIF26B_uc001ibg.1_Missense_Mutation_p.R441H|KIF26B_uc001ibh.1_Missense_Mutation_p.R65H	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	823					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GAAGAAGGCCGCATGCGCAGG	0.647													3	27	---	---	---	---	PASS
GPR148	344561	broad.mit.edu	37	2	131487497	131487497	+	Missense_Mutation	SNP	G	T	T	rs113110453		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131487497G>T	uc002trv.1	+	1	775	c.773G>T	c.(772-774)CGG>CTG	p.R258L		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	258	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1	Colorectal(110;0.1)					GGCTATTCCCGGGCCAGGGGC	0.577													67	187	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	142238027	142238027	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142238027G>T	uc002tvj.1	-	3	1253	c.281C>A	c.(280-282)TCC>TAC	p.S94Y	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	94	Extracellular (Potential).|LDL-receptor class A 2.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCACAGCTGGGATAAATGAAC	0.433										TSP Lung(27;0.18)			42	95	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098956	178098956	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098956A>T	uc002ulh.3	-	2	644	c.89T>A	c.(88-90)CTT>CAT	p.L30H	NFE2L2_uc002ulg.3_Missense_Mutation_p.L14H|NFE2L2_uc010zfa.1_Missense_Mutation_p.L14H|NFE2L2_uc002uli.3_Missense_Mutation_p.L14H|NFE2L2_uc010fra.2_Missense_Mutation_p.L14H|NFE2L2_uc010frb.2_Missense_Mutation_p.L14H	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	30					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTTACTCCAAGATCTATATC	0.363			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			37	87	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211473212	211473212	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211473212C>A	uc002vee.3	+	19	2452	c.2320C>A	c.(2320-2322)CCC>ACC	p.P774T	CPS1_uc010fur.2_Missense_Mutation_p.P780T|CPS1_uc010fus.2_Missense_Mutation_p.P323T	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	774			P -> L (in CPS1D; the enzyme is inactive).		carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CACCAAGATTCCCCGCTGGGA	0.458													31	193	---	---	---	---	PASS
SCG2	7857	broad.mit.edu	37	2	224463615	224463615	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224463615G>A	uc002vnm.2	-	2	519	c.386C>T	c.(385-387)CCA>CTA	p.P129L		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	129					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		ATTTTCTTTTGGTGCAGACTG	0.433													57	366	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191558	10191558	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191558T>C	uc003bvc.2	+	3	764	c.551T>C	c.(550-552)CTC>CCC	p.L184P	VHL_uc003bvd.2_Missense_Mutation_p.L143P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	184			L -> P (in VHLD; type I).|L -> R (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L184P(4)|p.S183*(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCAGGTCGCTCTACGAAGAT	0.517		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				23	37	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47142967	47142967	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47142967A>G	uc003cqs.2	-	8	5049	c.4996T>C	c.(4996-4998)TAT>CAT	p.Y1666H	SETD2_uc003cqv.2_Missense_Mutation_p.Y1733H	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1666	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGGAACTGATAGTCAAACGTT	0.378			N|F|S|Mis		clear cell renal carcinoma								91	137	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101060582	101060582	+	Silent	SNP	C	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101060582C>A	uc003dut.2	-	15	2259	c.2148G>T	c.(2146-2148)CTG>CTT	p.L716L	SENP7_uc003duu.2_Silent_p.L651L|SENP7_uc003duv.2_Silent_p.L683L|SENP7_uc003duw.2_Silent_p.L650L|SENP7_uc003dux.2_Silent_p.L552L	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	716					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						TTTGCTTCTGCAGGAAGGTGT	0.438													14	67	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189586483	189586483	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189586483G>C	uc003fry.2	+	8	1196	c.1107G>C	c.(1105-1107)AAG>AAC	p.K369N	TP63_uc003frx.2_Missense_Mutation_p.K369N|TP63_uc003frz.2_Missense_Mutation_p.K369N|TP63_uc010hzc.1_Missense_Mutation_p.K369N|TP63_uc003fsa.2_Missense_Mutation_p.K275N|TP63_uc003fsb.2_Missense_Mutation_p.K275N|TP63_uc003fsc.2_Missense_Mutation_p.K275N|TP63_uc003fsd.2_Missense_Mutation_p.K275N|TP63_uc010hzd.1_Missense_Mutation_p.K190N|TP63_uc003fse.1_Missense_Mutation_p.K250N	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	369	Interaction with HIPK2.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ACAGTACAAAGAACGGTGATG	0.517									Hay-Wells_syndrome	HNSCC(45;0.13)			8	161	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831942	113831942	+	3'UTR	SNP	T	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831942T>G	uc003kqo.2	+	8					KCNN2_uc003kqp.2_3'UTR|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TTTTAGCTTTTATTGTAAAGC	0.388													15	42	---	---	---	---	PASS
SEMA6A	57556	broad.mit.edu	37	5	115803361	115803361	+	Silent	SNP	C	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115803361C>G	uc010jck.2	-	18	2521	c.1812G>C	c.(1810-1812)CTG>CTC	p.L604L	SEMA6A_uc003krx.3_Silent_p.L621L|SEMA6A_uc003krv.3_Silent_p.L31L|SEMA6A_uc003krw.3_Intron|SEMA6A_uc010jcj.2_Silent_p.L148L	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and	604	Extracellular (Potential).				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GCTTCCAGTCCAGCATTCCTC	0.512													9	55	---	---	---	---	PASS
DNAJC18	202052	broad.mit.edu	37	5	138749940	138749940	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138749940G>A	uc003len.2	-	8	979	c.974C>T	c.(973-975)GCA>GTA	p.A325V	DNAJC18_uc010jff.2_Missense_Mutation_p.A263V	NM_152686	NP_689899	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18	325					protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			ovary(1)|kidney(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTATAATCCTGCCAAATTTGT	0.408													17	100	---	---	---	---	PASS
PCDHB3	56132	broad.mit.edu	37	5	140482637	140482637	+	3'UTR	SNP	A	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140482637A>G	uc003lio.2	+	1					uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTAATAAGGATCTACTGAGC	0.438													40	188	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140712520	140712520	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712520G>T	uc003lji.1	+	1	2269	c.2269G>T	c.(2269-2271)GTC>TTC	p.V757F	PCDHGA1_uc011dan.1_Missense_Mutation_p.V757F	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	757	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCCACGAGGTCTCCCTCAC	0.597													30	206	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31912529	31912529	+	5'Flank	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31912529C>T	uc003nyj.3	+						C2_uc003nyc.2_Missense_Mutation_p.S430F|C2_uc011doo.1_Missense_Mutation_p.S397F|C2_uc011dop.1_Missense_Mutation_p.S429F|C2_uc003nyf.2_Missense_Mutation_p.S643F|C2_uc010jtk.2_Missense_Mutation_p.S511F|C2_uc011doq.1_Missense_Mutation_p.S614F|C2_uc003nyg.2_Missense_Mutation_p.S420F|CFB_uc011dor.1_Missense_Mutation_p.S490F|C2_uc003nyh.1_Missense_Mutation_p.S294F|CFB_uc011dos.1_5'Flank|CFB_uc003nyi.2_5'Flank	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein						complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						GAGGTTGTCTCCCAAGAAAAA	0.483													23	88	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34802014	34802014	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34802014A>C	uc003oju.3	+	5	593	c.359A>C	c.(358-360)AAG>ACG	p.K120T	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	120										ovary(3)	3						TTTGCCGAAAAGGTGGTGGAA	0.403													4	53	---	---	---	---	PASS
CPNE5	57699	broad.mit.edu	37	6	36767798	36767798	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36767798C>T	uc003omr.1	-	4	300	c.233G>A	c.(232-234)CGC>CAC	p.R78H	CPNE5_uc003oms.1_Missense_Mutation_p.R40H	NM_020939	NP_065990	Q9HCH3	CPNE5_HUMAN	copine V	78	C2 1.									skin(1)	1						AATGAACTTGCGCACGAAGTC	0.547													3	40	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37626191	37626191	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37626191C>T	uc003onu.1	-	3	1391	c.212G>A	c.(211-213)CGG>CAG	p.R71Q		NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	71	Ig-like 1.				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						CTTGGTCCACCGTACCTGGGC	0.657													5	68	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102503298	102503298	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102503298A>G	uc003pqp.3	+	15	2654	c.2405A>G	c.(2404-2406)AAT>AGT	p.N802S	GRIK2_uc003pqo.3_Missense_Mutation_p.N802S|GRIK2_uc010kcw.2_Missense_Mutation_p.N802S	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	802	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TGGAGGGGCAATGGTTGCCCA	0.483													35	147	---	---	---	---	PASS
MRPL18	29074	broad.mit.edu	37	6	160211728	160211728	+	Intron	SNP	T	G	G	rs11757681	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160211728T>G	uc003qsw.3	+						TCP1_uc003qsr.2_5'Flank|TCP1_uc003qss.2_5'Flank|TCP1_uc010kjz.2_5'Flank|TCP1_uc003qst.2_5'Flank|TCP1_uc010kka.1_5'Flank|MRPL18_uc010kkb.2_RNA	NM_014161	NP_054880	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18 precursor						rRNA transport|translation	mitochondrial ribosome	5S rRNA binding|structural constituent of ribosome				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		CACAGTACATTGGAACGTGCG	0.552													3	40	---	---	---	---	PASS
TCP10	6953	broad.mit.edu	37	6	167789404	167789404	+	Intron	SNP	C	G	G	rs28409124	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167789404C>G	uc003qvv.1	-						TCP10_uc003qvu.2_Intron|TCP10_uc003qvw.2_3'UTR	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10							cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		AGAAAGCCCCCCACTTTACAG	0.557													3	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	39894421	39894421	+	RNA	SNP	A	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39894421A>T	uc003thg.2	-	1		c.439T>A								full-length cDNA clone CS0DF025YB16 of Fetal brain of Homo sapiens (human).																		CTTGGCTAATATACTCTGCTT	0.388													55	157	---	---	---	---	PASS
SMO	6608	broad.mit.edu	37	7	128852025	128852025	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128852025T>G	uc003vor.2	+	12	2377	c.2097T>G	c.(2095-2097)AGT>AGG	p.S699R	SMO_uc003vos.2_3'UTR	NM_005631	NP_005622	Q99835	SMO_HUMAN	smoothened precursor	699	Cytoplasmic (Potential).				adenohypophysis development|axon extension involved in axon guidance|canonical Wnt receptor signaling pathway|cardioblast differentiation|central nervous system neuron differentiation|cerebellar cortex morphogenesis|ciliary receptor clustering involved in smoothened signaling pathway|determination of left/right symmetry|dorsal/ventral neural tube patterning|embryonic camera-type eye development|embryonic digestive tract morphogenesis|embryonic neurocranium morphogenesis|embryonic viscerocranium morphogenesis|exocrine pancreas development|facial nerve development|floor plate formation|gonad development|heart morphogenesis|muscle cell fate commitment|negative regulation of apoptosis|neural crest cell migration|neuron fate commitment|neuron projection regeneration|odontogenesis of dentine-containing tooth|osteoblast differentiation|otolith morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of neuroblast proliferation|positive regulation of smoothened signaling pathway|semicircular canal morphogenesis|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation|smoothened signaling pathway involved in ventral spinal cord patterning|spermatogenesis|vasculogenesis	cilium|cytoplasm|integral to membrane|neuronal cell body|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			skin(19)|large_intestine(10)|central_nervous_system(3)|upper_aerodigestive_tract(2)|biliary_tract(1)|lung(1)|liver(1)	37						CTGCCCCCAGTACCATTCCTC	0.602			Mis		skin basal cell 								2	7	---	---	---	---	PASS
RBM33	155435	broad.mit.edu	37	7	155465597	155465597	+	Silent	SNP	A	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155465597A>T	uc010lqk.1	+	3	527	c.159A>T	c.(157-159)CTA>CTT	p.L53L	RBM33_uc003wme.2_Silent_p.L53L	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	53							nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		AAGATTTGCTATCTGGCAAAA	0.323													2	3	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106813670	106813670	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106813670C>A	uc003ymd.2	+	8	1383	c.1360C>A	c.(1360-1362)CCA>ACA	p.P454T	ZFPM2_uc011lhs.1_Missense_Mutation_p.P185T|uc003yme.1_5'Flank	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	454					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GAACCAGAGACCAGAGATACA	0.458													9	74	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110476839	110476839	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110476839A>T	uc003yne.2	+	49	7882	c.7778A>T	c.(7777-7779)GAT>GTT	p.D2593V		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2593	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AACCACCCTGATGGGCCATCC	0.453										HNSCC(38;0.096)			45	61	---	---	---	---	PASS
MAN1B1	11253	broad.mit.edu	37	9	140002187	140002187	+	Intron	SNP	C	T	T	rs12000517	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140002187C>T	uc004cld.2	+						MAN1B1_uc011mep.1_Silent_p.L657L|MAN1B1_uc010ncc.2_Intron|MAN1B1_uc004clf.1_Intron|MAN1B1_uc004clg.1_Intron	NM_016219	NP_057303	Q9UKM7	MA1B1_HUMAN	alpha 1,2-mannosidase						oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|endoplasmic reticulum quality control compartment|integral to membrane	alpha-mannosidase activity|calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(1)|central_nervous_system(1)	2	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		GGGGCTCAGGCTGGCTCCGCT	0.711													3	47	---	---	---	---	PASS
ZRANB1	54764	broad.mit.edu	37	10	126670374	126670374	+	Silent	SNP	A	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126670374A>G	uc001lic.2	+	6	1895	c.1524A>G	c.(1522-1524)GCA>GCG	p.A508A	ZRANB1_uc010qug.1_Silent_p.A534A	NM_017580	NP_060050	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	508	OTU.|TRAF-binding.				positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		AAGACTGGGCATTTATACTCT	0.398													24	112	---	---	---	---	PASS
UEVLD	55293	broad.mit.edu	37	11	18600293	18600293	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18600293G>T	uc001mot.2	-	2	185	c.105C>A	c.(103-105)TTC>TTA	p.F35L	UEVLD_uc001mou.2_Missense_Mutation_p.F35L|UEVLD_uc010rde.1_5'UTR|UEVLD_uc010rdf.1_Missense_Mutation_p.F35L|UEVLD_uc010rdg.1_Intron|UEVLD_uc001mov.2_Missense_Mutation_p.F35L|UEVLD_uc010rdh.1_Missense_Mutation_p.F35L	NM_001040697	NP_001035787	Q8IX04	UEVLD_HUMAN	ubiquitin-conjugating enzyme E2-like isoform a	35	UEV.				cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0						TGGAATATTTGAAATGTGGGA	0.333													36	85	---	---	---	---	PASS
DTX4	23220	broad.mit.edu	37	11	58949232	58949232	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58949232C>T	uc001nns.2	+	2	489	c.232C>T	c.(232-234)CGC>TGC	p.R78C	DTX4_uc001nnr.2_5'UTR	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN	deltex 4 homolog	78	WWE 1.				Notch signaling pathway	cytoplasm	zinc ion binding			lung(2)|central_nervous_system(1)	3		all_epithelial(135;0.125)				CCCAGTTCGCCGCAACTACTA	0.582													8	182	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59834429	59834429	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59834429G>T	uc001nom.2	+	5	485	c.357G>T	c.(355-357)CAG>CAT	p.Q119H	MS4A3_uc001non.2_Missense_Mutation_p.Q73H|MS4A3_uc001noo.2_5'UTR	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	119	Cytoplasmic (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TTTAGATACAGAACAGTTTTG	0.289													7	47	---	---	---	---	PASS
EHBP1L1	254102	broad.mit.edu	37	11	65346872	65346872	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65346872C>T	uc001oeo.3	+	3	488	c.223C>T	c.(223-225)CCT>TCT	p.P75S	EHBP1L1_uc001oep.1_5'Flank	NM_001099409	NP_001092879	Q8N3D4	EH1L1_HUMAN	tangerin	75										central_nervous_system(1)	1						GTGGATGGTACCTGAGAATGT	0.557													3	4	---	---	---	---	PASS
RSF1	51773	broad.mit.edu	37	11	77412660	77412660	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77412660T>G	uc001oyn.2	-	6	1734	c.1614A>C	c.(1612-1614)GAA>GAC	p.E538D	RSF1_uc001oym.2_Missense_Mutation_p.E286D	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	538					CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CAAGAGAAGTTTCCATTTCTG	0.413													79	386	---	---	---	---	PASS
FOXRED1	55572	broad.mit.edu	37	11	126146919	126146919	+	Intron	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126146919C>T	uc001qdi.2	+						FOXRED1_uc010sbn.1_Intron|FOXRED1_uc010sbo.1_RNA|FOXRED1_uc010sbp.1_Intron|FOXRED1_uc010sbq.1_Intron|FOXRED1_uc001qdj.2_Intron|FOXRED1_uc010sbr.1_Intron|FOXRED1_uc001qdk.2_Intron	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CTGGGCCTGTCCTTGTGTCCC	0.532													28	44	---	---	---	---	PASS
FLI1	2313	broad.mit.edu	37	11	128680490	128680490	+	Silent	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680490C>T	uc010sbu.1	+	9	1307	c.966C>T	c.(964-966)GGC>GGT	p.G322G	FLI1_uc010sbt.1_Silent_p.G129G|FLI1_uc010sbv.1_Silent_p.G289G|FLI1_uc009zci.2_Silent_p.G256G	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	322	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GGCGCTGGGGCGAGCGGAAAA	0.552			T	EWSR1	Ewing sarcoma								7	20	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43777521	43777521	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43777521G>A	uc010skx.1	-	31	4637	c.4637C>T	c.(4636-4638)TCA>TTA	p.S1546L		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1546	TSP type-1 13.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTCTCACATGATGTTGAACA	0.343													70	86	---	---	---	---	PASS
MUCL1	118430	broad.mit.edu	37	12	55250594	55250594	+	Silent	SNP	T	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55250594T>A	uc001sgk.2	+	3	209	c.141T>A	c.(139-141)ACT>ACA	p.T47T		NM_058173	NP_477521	Q96DR8	MUCL1_HUMAN	small breast epithelial mucin precursor	47	1.|Thr-rich.|3 X 8 AA tandem repeat of T-T-A-A-[APS]- T-T-A.		Missing.			extracellular region|membrane					0						ctgaaaccactgctgctgcaa	0.194													29	47	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103520522	103520522	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103520522G>A	uc001vpw.2	+	12	3036	c.2593G>A	c.(2593-2595)GGA>AGA	p.G865R	ERCC5_uc001vpu.1_Missense_Mutation_p.G1319R|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.G697R	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	865	I-domain.			EGIPTVGCV -> GNTNCGLC (in Ref. 2; BAA03812).	negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TTATACCGAAGGAATACCAAC	0.343			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				28	163	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20847178	20847178	+	Silent	SNP	G	A	A	rs138032035		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20847178G>A	uc001vxe.2	-	36	5254	c.5214C>T	c.(5212-5214)GAC>GAT	p.D1738D	TEP1_uc010ahk.2_Silent_p.D1081D|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Silent_p.D1630D|TEP1_uc010tlh.1_Silent_p.D76D	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1738	WD 3.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCAGGAGCCCGTCGAAGGCAG	0.547													21	154	---	---	---	---	PASS
C14orf101	54916	broad.mit.edu	37	14	57070637	57070637	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57070637A>G	uc001xcm.2	+	4	571	c.449A>G	c.(448-450)AAT>AGT	p.N150S	C14orf101_uc001xcj.2_RNA|C14orf101_uc001xck.2_Missense_Mutation_p.N150S|C14orf101_uc010aot.1_Missense_Mutation_p.N150S|C14orf101_uc001xcl.1_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_Intron	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916	150	Helical; (Potential).					integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)		AGCTTAAACAATCTCTTTGTG	0.443													33	201	---	---	---	---	PASS
C15orf21	283651	broad.mit.edu	37	15	45848224	45848224	+	RNA	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45848224G>T	uc010beg.1	+	6		c.1219G>T			C15orf21_uc010beh.1_RNA|C15orf21_uc010bei.1_RNA|C15orf21_uc010bej.1_RNA|C15orf21_uc001zvm.1_RNA|C15orf21_uc001zvn.1_RNA					Homo sapiens cDNA FLJ39426 fis, clone PROST2000505.												0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;3.03e-17)|GBM - Glioblastoma multiforme(94;7.36e-07)		TGCAGATTTTGTTTAGCTTTT	0.318			T	ETV1	prostate								7	24	---	---	---	---	PASS
C15orf60	283677	broad.mit.edu	37	15	73843391	73843391	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73843391C>T	uc002avq.2	+	4	474	c.446C>T	c.(445-447)CCT>CTT	p.P149L	C15orf60_uc010bjb.2_Missense_Mutation_p.P121L	NM_001042367	NP_001035826	Q7Z4M0	CO060_HUMAN	hypothetical protein LOC283677	149										pancreas(1)	1						GTGCAGGTGCCTGATGGAAAC	0.537													19	57	---	---	---	---	PASS
ADAMTS17	170691	broad.mit.edu	37	15	100594117	100594117	+	Silent	SNP	T	C	C			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100594117T>C	uc002bvv.1	-	16	2359	c.2280A>G	c.(2278-2280)CTA>CTG	p.L760L		NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	760	Spacer.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		AGTGCAGCGGTAGTTTGGTTG	0.532													131	345	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15126793	15126793	+	Silent	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15126793G>T	uc002dda.3	+	18	1871	c.1647G>T	c.(1645-1647)CTG>CTT	p.L549L	PDXDC1_uc010uzl.1_Silent_p.L534L|PDXDC1_uc010uzm.1_Silent_p.L458L|PDXDC1_uc002ddb.3_Silent_p.L522L|PDXDC1_uc010uzn.1_Silent_p.L521L|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	549					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CTGGACTCCTGAAGAAGTTAA	0.413													64	181	---	---	---	---	PASS
ZNF747	65988	broad.mit.edu	37	16	30545836	30545836	+	Silent	SNP	C	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30545836C>A	uc002dyn.2	-	1	359	c.165G>T	c.(163-165)CGG>CGT	p.R55R	ZNF768_uc010vex.1_5'UTR|ZNF747_uc002dyo.1_Silent_p.R55R|ZNF747_uc010vey.1_Silent_p.R55R|uc002dyp.1_5'Flank	NM_023931	NP_076420	Q9BV97	ZN747_HUMAN	zinc finger protein 747	55	KRAB.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						TCTGCGCGGGCCGCAGGCAGC	0.726													3	9	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47733322	47733322	+	3'UTR	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47733322G>T	uc002eev.3	+	31					PHKB_uc002eeu.3_3'UTR|PHKB_uc002eew.3_3'UTR	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GTTCTGAAGTGTGTTGTGTTT	0.478													19	100	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67290936	67290936	+	Silent	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67290936C>T	uc002esm.2	+	7	1318	c.1255C>T	c.(1255-1257)CTG>TTG	p.L419L	SLC9A5_uc010cee.2_Silent_p.L124L|SLC9A5_uc010vji.1_5'UTR	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	419	Helical; (Potential).				regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CGTCATCCTACTGGATAGGAC	0.557													90	214	---	---	---	---	PASS
FAM27L	284123	broad.mit.edu	37	17	21826096	21826096	+	RNA	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21826096G>T	uc002gyz.2	+	2		c.206G>T				NR_028336				Homo sapiens family with sequence similarity 27-like, mRNA (cDNA clone MGC:35151 IMAGE:5169482), complete cds.												0				UCEC - Uterine corpus endometrioid carcinoma (53;0.11)|BRCA - Breast invasive adenocarcinoma(1;0.00463)		TCTTTTCTAGGATCAAGATGA	0.527													37	83	---	---	---	---	PASS
ZNF207	7756	broad.mit.edu	37	17	30692370	30692370	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30692370G>A	uc002hhh.3	+	7	792	c.644G>A	c.(643-645)CGT>CAT	p.R215H	ZNF207_uc002hhj.3_Missense_Mutation_p.R231H|ZNF207_uc002hhi.3_Missense_Mutation_p.R231H|ZNF207_uc010csz.2_Missense_Mutation_p.R234H|ZNF207_uc002hhk.1_Missense_Mutation_p.R231H|ZNF207_uc002hhl.1_RNA	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a	215						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			CCTGTTCCACGTCCTGGAATT	0.463													20	99	---	---	---	---	PASS
TOM1L1	10040	broad.mit.edu	37	17	53014035	53014035	+	Silent	SNP	T	C	C			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53014035T>C	uc002iud.2	+	9	1055	c.880T>C	c.(880-882)TTG>CTG	p.L294L	TOM1L1_uc002iuc.2_Silent_p.L294L|TOM1L1_uc010dca.1_Silent_p.L294L|TOM1L1_uc010wnb.1_Silent_p.L287L|TOM1L1_uc010wnc.1_Silent_p.L217L|TOM1L1_uc010dbz.2_Silent_p.L217L|TOM1L1_uc010wnd.1_Silent_p.L182L|TOM1L1_uc010dcb.1_RNA	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1	294					intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						ACAAAGGATTTTGGAGCAAAA	0.274													30	42	---	---	---	---	PASS
EPX	8288	broad.mit.edu	37	17	56277703	56277703	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56277703G>A	uc002ivq.2	+	10	1741	c.1655G>A	c.(1654-1656)GGG>GAG	p.G552E		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	552					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						AGGAGGATTGGGCTGGACCTG	0.637											OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	89	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79166553	79166553	+	Silent	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79166553C>T	uc002jzp.1	-	19	2621	c.2421G>A	c.(2419-2421)CTG>CTA	p.L807L	AZI1_uc002jzm.1_Silent_p.L234L|AZI1_uc002jzn.1_Silent_p.L804L|AZI1_uc002jzo.1_Intron|AZI1_uc010wum.1_Intron|AZI1_uc002jzq.2_Intron	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	807					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCTGCTGGCCCAGCCGCTCCC	0.552													5	25	---	---	---	---	PASS
B3GNTL1	146712	broad.mit.edu	37	17	80915092	80915092	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80915092T>G	uc002kgg.1	-	10	909	c.895A>C	c.(895-897)ATC>CTC	p.I299L	B3GNTL1_uc002kgf.1_Missense_Mutation_p.I188L|B3GNTL1_uc002kge.1_RNA	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal	299							transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			CCTTTCCTGATCTTGTTCTCG	0.622													34	178	---	---	---	---	PASS
REXO1	57455	broad.mit.edu	37	19	1827759	1827759	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1827759C>A	uc002lua.3	-	2	1124	c.1029G>T	c.(1027-1029)CAG>CAT	p.Q343H	REXO1_uc010dsr.1_Missense_Mutation_p.Q297H	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	343						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACGTCGCACTGCACGGCCG	0.721													11	29	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31769985	31769985	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769985A>T	uc002nsy.3	-	2	779	c.714T>A	c.(712-714)CAT>CAA	p.H238Q		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	238	C2H2-type 1.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					CGTCGCGGTAATGCCCCGTCT	0.592													79	280	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31769986	31769986	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769986T>A	uc002nsy.3	-	2	778	c.713A>T	c.(712-714)CAT>CTT	p.H238L		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	238	C2H2-type 1.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GTCGCGGTAATGCCCCGTCTC	0.592													78	279	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40903260	40903260	+	Silent	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40903260C>T	uc002onr.2	-	7	1268	c.999G>A	c.(997-999)GTG>GTA	p.V333V	PRX_uc002onq.2_Silent_p.V194V|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	333					axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGTCCACCCCCACAGTCGGTG	0.667													12	20	---	---	---	---	PASS
GIPR	2696	broad.mit.edu	37	19	46174612	46174612	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46174612G>A	uc002pcu.1	+	4	341	c.242G>A	c.(241-243)CGT>CAT	p.R81H	GIPR_uc002pct.1_Missense_Mutation_p.R81H|GIPR_uc010xxp.1_Intron|GIPR_uc010xxq.1_RNA	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	81	Extracellular (Potential).				generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		GCCACTGCCCGTGCGTCCTGC	0.662													49	110	---	---	---	---	PASS
KLK6	5653	broad.mit.edu	37	19	51462556	51462556	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51462556G>A	uc002pui.2	-	7	859	c.599C>T	c.(598-600)CCG>CTG	p.P200L	KLK6_uc010eoj.2_Missense_Mutation_p.R72C|KLK6_uc002puh.2_Missense_Mutation_p.P209L|KLK6_uc002puj.2_Missense_Mutation_p.P93L|KLK6_uc010ycn.1_Missense_Mutation_p.P93L|KLK6_uc002pul.2_Missense_Mutation_p.P200L|KLK6_uc002pum.2_Missense_Mutation_p.P93L	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A	200	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		ACATACCAGCGGACCCCCAGA	0.348													28	140	---	---	---	---	PASS
CACNG6	59285	broad.mit.edu	37	19	54515324	54515324	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54515324G>A	uc002qct.2	+	4	1254	c.664G>A	c.(664-666)GGC>AGC	p.G222S	CACNG6_uc002qcu.2_Missense_Mutation_p.G176S|CACNG6_uc002qcv.2_Missense_Mutation_p.G151S	NM_145814	NP_665813	Q9BXT2	CCG6_HUMAN	voltage-dependent calcium channel gamma-6	222	Helical; (Potential).					voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(2)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CTGGTCCCTGGGCTGCGGCGT	0.701													31	91	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8698474	8698474	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8698474G>T	uc002wnb.2	+	14	1495	c.1492G>T	c.(1492-1494)GAG>TAG	p.E498*	PLCB1_uc010zrb.1_Nonsense_Mutation_p.E397*|PLCB1_uc002wna.2_Nonsense_Mutation_p.E498*|PLCB1_uc002wnc.1_Nonsense_Mutation_p.E397*|PLCB1_uc002wnd.1_Nonsense_Mutation_p.E75*	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	498					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						CAGCATGTTCGAGCCCTCATC	0.458													26	52	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47970565	47970565	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47970565G>A	uc002zjo.2	+	23	2930	c.2747G>A	c.(2746-2748)CGC>CAC	p.R916H	DIP2A_uc011afy.1_Missense_Mutation_p.R852H|DIP2A_uc011afz.1_Missense_Mutation_p.R912H	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	916					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		ACCAAACAGCGCTTTCTGGAA	0.552													9	48	---	---	---	---	PASS
NDUFA6	4700	broad.mit.edu	37	22	42482196	42482196	+	Silent	SNP	G	A	A	rs150607291	byFrequency	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42482196G>A	uc003bcb.2	-	3	518	c.456C>T	c.(454-456)CAC>CAT	p.H152H		NM_002490	NP_002481	P56556	NDUA6_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	152					mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	TTCATGGATCGTGGCCAACAT	0.373													32	221	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46793698	46793698	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46793698C>T	uc003bhw.1	-	12	5574	c.5574G>A	c.(5572-5574)ATG>ATA	p.M1858I	CELSR1_uc011arc.1_Missense_Mutation_p.M179I	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1858	Extracellular (Potential).|Laminin G-like 2.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GTGCGTTGTTCATGTTCAGGG	0.622													14	30	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50893063	50893063	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50893063G>A	uc003blh.2	-	36	5116	c.4921C>T	c.(4921-4923)CCT>TCT	p.P1641S	SBF1_uc003ble.2_Missense_Mutation_p.P105S|SBF1_uc003blf.2_Missense_Mutation_p.P117S|SBF1_uc011arx.1_Missense_Mutation_p.P1279S	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1615					protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GGGGGTTCAGGGGGCCCCTGG	0.667													38	124	---	---	---	---	PASS
CA5B	11238	broad.mit.edu	37	X	15790716	15790716	+	Silent	SNP	C	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15790716C>T	uc004cxe.2	+	4	555	c.438C>T	c.(436-438)GAC>GAT	p.D146D		NM_007220	NP_009151	Q9Y2D0	CAH5B_HUMAN	carbonic anhydrase VB, mitochondrial precursor	146					one-carbon metabolic process	mitochondrion	carbonate dehydratase activity|zinc ion binding				0	Hepatocellular(33;0.183)					ACACCGTGGACAGCAAATGCT	0.478													113	84	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70341181	70341181	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70341181G>T	uc004dyy.2	+	6	939	c.740G>T	c.(739-741)GGA>GTA	p.G247V	MED12_uc011mpq.1_Missense_Mutation_p.G247V|MED12_uc004dyz.2_Missense_Mutation_p.G247V|MED12_uc004dza.2_Missense_Mutation_p.G94V	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	247					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CCATAGGATGGAATGCTGGAC	0.488													39	110	---	---	---	---	PASS
NONO	4841	broad.mit.edu	37	X	70516749	70516749	+	Nonsense_Mutation	SNP	T	G	G			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70516749T>G	uc004dzo.2	+	8	1505	c.795T>G	c.(793-795)TAT>TAG	p.Y265*	BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Nonsense_Mutation_p.Y265*|NONO_uc004dzp.2_Nonsense_Mutation_p.Y265*|NONO_uc011mpv.1_Nonsense_Mutation_p.Y176*|NONO_uc004dzq.2_Nonsense_Mutation_p.Y134*	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	265	DBHS.				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					CCTTTGAGTATGAATATGCCA	0.517			T	TFE3	papillary renal cancer								17	15	---	---	---	---	PASS
DNAJC16	23341	broad.mit.edu	37	1	15891040	15891041	+	Intron	INS	-	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15891040_15891041insT	uc001aws.2	+						DNAJC16_uc001awr.1_Intron|DNAJC16_uc001awt.2_Intron|DNAJC16_uc001awu.2_Intron	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ttattttttacttttttttttt	0.158													3	3	---	---	---	---	
EPHA8	2046	broad.mit.edu	37	1	22913274	22913275	+	Intron	INS	-	GGGT	GGGT	rs66713995		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22913274_22913275insGGGT	uc001bfx.1	+						EPHA8_uc001bfw.2_Intron	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGTCTGAGGTGGGGGGGGTGAC	0.658													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128558	31128559	+	IGR	INS	-	TGG	TGG	rs150361136	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128558_31128559insTGG								None (None upstream) : MATN1 (55567 downstream)																							ggtggtggtgatggtggtgatg	0.069													4	2	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86372701	86372702	+	Intron	DEL	TA	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86372701_86372702delTA	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TACAAAAGATTATGAGTTGTAT	0.277													5	7	---	---	---	---	
PKN2	5586	broad.mit.edu	37	1	89225729	89225730	+	Intron	INS	-	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89225729_89225730insT	uc001dmn.2	+						PKN2_uc001dmm.1_Intron|PKN2_uc010osp.1_Intron|PKN2_uc010osq.1_Intron|PKN2_uc009wcv.2_Intron	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2						signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TCAGATACGTGTTTTTTTTTTT	0.312													4	2	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214706878	214706878	+	Intron	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214706878delA	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|PTPN14_uc001hkl.1_Intron	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CGGTTTaaataaaaaaaaaaa	0.234													4	3	---	---	---	---	
LEFTY1	10637	broad.mit.edu	37	1	226093466	226093466	+	Intron	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226093466delA	uc010pvj.1	-									O75610	LFTY1_HUMAN	SubName: Full=cDNA FLJ54750, moderately similar to Pyrroline-5-carboxylate reductase 2 (EC 1.5.1.2);						cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					ACAGAGGTACAAGAGCAGAGA	0.542													4	2	---	---	---	---	
NCOA1	8648	broad.mit.edu	37	2	24951490	24951490	+	Intron	DEL	T	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24951490delT	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATATATGAGTTTTTTTTTTA	0.269			T	PAX3	alveolar rhadomyosarcoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64893259	64893259	+	IGR	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64893259delA								SERTAD2 (12213 upstream) : SLC1A4 (322320 downstream)																							AACTTAAAATAAAAAAAAAAA	0.269													5	3	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109369249	109369249	+	Intron	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109369249delA	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						actctgtctcaaaaaaaaaaa	0.144													5	3	---	---	---	---	
ROBO1	6091	broad.mit.edu	37	3	79639075	79639075	+	5'UTR	DEL	T	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79639075delT	uc003dqe.2	-	2						NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGTCCCTTCCTTGCATTACAA	0.378													69	56	---	---	---	---	
RFC1	5981	broad.mit.edu	37	4	39304918	39304918	+	Intron	DEL	G	-	-	rs73238567	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39304918delG	uc003gty.1	-						RFC1_uc003gtx.1_Intron	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit						DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						TGTTGTTAAAGAAAAAAAAAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	46725773	46725775	+	IGR	DEL	GTT	-	-	rs80135740		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46725773_46725775delGTT								GABRA2 (333352 upstream) : COX7B2 (11074 downstream)																							ttttttcttggtttttttttttt	0.340													4	4	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79101921	79101922	+	Intron	INS	-	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79101921_79101922insT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GAATGACAGTCTTTTTTTTTTT	0.342													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050862	154050863	+	IGR	INS	-	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050862_154050863insA								FHDC1 (150014 upstream) : TRIM2 (23407 downstream)																							tcaccacccccccaccaccatc	0.000													4	2	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80404696	80404701	+	Intron	DEL	TGTGTA	-	-	rs10606038		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80404696_80404701delTGTGTA	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		tgtgtgtgtgtgtgtAAGAGACAGGG	0.272													5	3	---	---	---	---	
LANCL2	55915	broad.mit.edu	37	7	55469209	55469219	+	Intron	DEL	TTTTTTTTTTT	-	-	rs72129244		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55469209_55469219delTTTTTTTTTTT	uc003tqp.2	+							NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2						negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			GTATGGAGTCttttttttttttttttttttt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141036755	141036756	+	IGR	INS	-	ACT	ACT			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141036755_141036756insACT								MRPS33 (321974 upstream) : AGK (214322 downstream)																							tcaccaccaccaccatcactac	0.000													4	2	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													2	4	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6594803	6594804	+	Intron	INS	-	AAAGAAAG	AAAGAAAG			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6594803_6594804insAAAGAAAG	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	aaaaggaaataaaagaaagaaa	0.069													4	3	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14824710	14824711	+	Intron	DEL	TA	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14824710_14824711delTA	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		ACCACAGTACTATATATATATA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68357111	68357112	+	IGR	INS	-	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68357111_68357112insA								FAM27B (562922 upstream) : MIR1299 (645127 downstream)																							GCAGTACGTACAAAAAATAATG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93513725	93513727	+	IGR	DEL	AAC	-	-	rs34140480		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93513725_93513727delAAC								DIRAS2 (108617 upstream) : SYK (50285 downstream)																							AAAATAAGCAAACAACTGCCAGG	0.478													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42380125	42380126	+	IGR	INS	-	TTCGGGTTG	TTCGGGTTG			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42380125_42380126insTTCGGGTTG								None (None upstream) : LOC441666 (447189 downstream)																							attccattccattccattccat	0.000													6	5	---	---	---	---	
NUP160	23279	broad.mit.edu	37	11	47817704	47817705	+	Intron	INS	-	A	A	rs149207420		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47817704_47817705insA	uc001ngm.2	-						NUP160_uc009ylw.2_Intron	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						agacttcatctaaaaaaaaaaa	0.198													4	4	---	---	---	---	
TRIM49	57093	broad.mit.edu	37	11	89534159	89534160	+	Intron	INS	-	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89534159_89534160insA	uc001pdb.2	-							NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18							intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CCAAAAGCCTGAAAAAAAAAAA	0.337													6	3	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118240362	118240362	+	Intron	DEL	T	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118240362delT	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TCCCTCTCTCTTTTTTTTTTT	0.323													4	2	---	---	---	---	
ARNTL2	56938	broad.mit.edu	37	12	27529304	27529304	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27529304delA	uc001rht.1	+	4	328	c.310delA	c.(310-312)AAAfs	p.K104fs	ARNTL2_uc001rhw.2_Intron|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Intron|ARNTL2_uc009zji.1_Frame_Shift_Del_p.K70fs|ARNTL2_uc001rhv.1_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear	104					circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					ACACCAAGTTAAAATGAAGGC	0.398													92	69	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31630951	31630952	+	Intron	INS	-	T	T	rs142172766	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31630951_31630952insT	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Intron|DENND5B_uc001rkk.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						TAAAAAATGGATTTTTTTTTTA	0.322													9	5	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62978905	62978905	+	Intron	DEL	C	-	-	rs7299795		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62978905delC	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srf.2_Intron|MON2_uc001srg.2_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		caaaaaaaaacaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145415	119145416	+	IGR	INS	-	TGGTGA	TGGTGA	rs28483306		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145415_119145416insTGGTGA								SUDS3 (289576 upstream) : SRRM4 (273980 downstream)																							gatggtgatggtggtggtggtg	0.000													9	6	---	---	---	---	
C1QTNF9	338872	broad.mit.edu	37	13	24889990	24889990	+	Intron	DEL	T	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24889990delT	uc001upj.2	+						C1QTNF9_uc001upe.2_Intron	NM_178540	NP_848635	P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9							collagen	hormone activity				0		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GAGCCTTCTGTCCAAGTTTGT	0.537													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21366464	21366466	+	IGR	DEL	ATG	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21366464_21366466delATG								NF1P1 (231839 upstream) : LOC646214 (566048 downstream)																							GATGTGGAATATGATGAAGGAGA	0.369													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22503383	22503383	+	IGR	DEL	G	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22503383delG								OR4N3P (88998 upstream) : MIR1268 (9846 downstream)																							aaggggtgttggggaaagagg	0.219													4	2	---	---	---	---	
UNC13C	440279	broad.mit.edu	37	15	54817611	54817611	+	Intron	DEL	A	-	-	rs113510539		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54817611delA	uc002ack.2	+							NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTCAAAGACCaaaaaaaaaaa	0.279													3	3	---	---	---	---	
ARID3B	10620	broad.mit.edu	37	15	74865017	74865018	+	Intron	INS	-	A	A			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74865017_74865018insA	uc002aye.2	+						ARID3B_uc002ayc.2_Intron|ARID3B_uc002ayd.2_Intron	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						AATCAAAAGCCAAAAAAAAAAA	0.386													4	2	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31383487	31383487	+	Intron	DEL	G	-	-	rs67981265		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31383487delG	uc002ebu.1	+						ITGAX_uc002ebt.2_Intron	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						cgggaggtctgggggggggga	0.144													4	2	---	---	---	---	
TOP3A	7156	broad.mit.edu	37	17	18211538	18211555	+	Intron	DEL	AAAAAAAAAAAAAAAAAA	-	-	rs67569771		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18211538_18211555delAAAAAAAAAAAAAAAAAA	uc002gsx.1	-						TOP3A_uc002gsw.1_5'Flank|TOP3A_uc010vxs.1_Intron|TOP3A_uc010cqa.1_Intron	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha						DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						tgtctccaacaaaaaaaaaaaaaaaaaaaaaaaaaaaa	0.133													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	29369492	29369493	+	IGR	DEL	CA	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29369492_29369493delCA								RNF135 (42567 upstream) : NF1 (52502 downstream)																							cacaggcaagcacacacacaca	0.203													4	2	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49353082	49353083	+	Intron	INS	-	T	T			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49353082_49353083insT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTTGTTTTTTGTTTTTTTTTTT	0.287													8	4	---	---	---	---	
RHBDF2	79651	broad.mit.edu	37	17	74476090	74476099	+	Intron	DEL	TGTGTGTGTG	-	-	rs67036316		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74476090_74476099delTGTGTGTGTG	uc002jrq.1	-						RHBDF2_uc002jrp.1_Intron|RHBDF2_uc002jrr.1_Intron|RHBDF2_uc010wtf.1_Intron|RHBDF2_uc002jrs.1_Intron	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1						negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						atatatataatgtgtgtgtgtgtgtgtgtg	0.167													4	4	---	---	---	---	
PPP4R1	9989	broad.mit.edu	37	18	9594800	9594801	+	Intron	INS	-	T	T	rs77692629		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9594800_9594801insT	uc002koe.1	-						PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron|PPP4R1_uc010wzp.1_Intron	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						ATTAATGGTAATTTTTTTTTTT	0.272													4	2	---	---	---	---	
UBXN6	80700	broad.mit.edu	37	19	4452146	4452146	+	Intron	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4452146delA	uc002man.1	-						UBXN6_uc010dty.1_Intron|UBXN6_uc002mam.1_Intron	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6							microtubule organizing center|nucleus	protein binding				0						actccatctcaaaaaaaaaaa	0.209													4	3	---	---	---	---	
CGB	1082	broad.mit.edu	37	19	49550508	49550508	+	Intron	DEL	T	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49550508delT	uc010yad.1	-							NM_033183	NP_149439	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 8						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	tctttctttcttttttttttt	0.244													4	2	---	---	---	---	
NLRP7	199713	broad.mit.edu	37	19	55452576	55452576	+	Intron	DEL	A	-	-	rs111382825		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55452576delA	uc002qih.3	-						NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Intron|NLRP7_uc010esk.2_Intron|NLRP7_uc010esl.2_Intron	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		ctaaaaatacaaaaaaaaaaa	0.000													8	5	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													6	3	---	---	---	---	
DHX35	60625	broad.mit.edu	37	20	37652159	37652159	+	Intron	DEL	T	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37652159delT	uc002xjh.2	+						DHX35_uc010zwa.1_Intron|DHX35_uc010zwb.1_Intron|DHX35_uc010zwc.1_Intron	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35							catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				gccctgctgattttttttttt	0.000													5	3	---	---	---	---	
SERHL2	253190	broad.mit.edu	37	22	42962565	42962565	+	Intron	DEL	A	-	-	rs147819513		TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42962565delA	uc003bcr.2	+						SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Intron|SERHL2_uc010gyz.2_Intron|SERHL2_uc010gyy.2_Intron|SERHL2_uc011apo.1_Intron|RRP7B_uc003bcs.2_Intron	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2							perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						ccatctcaagaaaaaaaaaac	0.005													3	3	---	---	---	---	
DKC1	1736	broad.mit.edu	37	X	153994771	153994771	+	Intron	DEL	A	-	-			TCGA-BP-5178-01A-01D-1429-08	TCGA-BP-5178-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153994771delA	uc004fmm.2	+						DKC1_uc010nvf.2_Intron|SNORA36A_uc004fmn.2_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1						cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCATTAAGAAAAAAAAAAA	0.418									Congenital_Dyskeratosis				5	4	---	---	---	---	
