Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16974224	16974224	+	RNA	SNP	C	G	G	rs148702086	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974224C>G	uc009vow.2	+	5		c.1034C>G			MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_Intron|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_Intron|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_Intron					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						TTGGTCCCAGCCCCAGAGGGA	0.652													5	33	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17086183	17086183	+	Splice_Site	SNP	T	G	G	rs61769735		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17086183T>G	uc010ock.1	-	7	716	c.716_splice	c.e7-1	p.G239_splice	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Splice_Site	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						CCTCGGACCCTTAGATGGACC	0.652													3	19	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38343913	38343913	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38343913T>C	uc001ccg.1	-	16	1718	c.1624A>G	c.(1624-1626)ATG>GTG	p.M542V	INPP5B_uc009vvk.1_Missense_Mutation_p.M483V|INPP5B_uc001ccf.1_Missense_Mutation_p.M378V|INPP5B_uc010oij.1_RNA	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	622					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TTCAGGGCCATGTGGCTCTGG	0.527													31	62	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186278973	186278973	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186278973T>A	uc001gru.3	+	8	3521	c.3470T>A	c.(3469-3471)TTG>TAG	p.L1157*	PRG4_uc001grt.3_Nonsense_Mutation_p.L1116*|PRG4_uc009wyl.2_Nonsense_Mutation_p.L1064*|PRG4_uc009wym.2_Nonsense_Mutation_p.L1023*|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	1157	Hemopexin-like 1.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CTGACTACTTTGCGCAATGGG	0.358													18	148	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201017771	201017771	+	Silent	SNP	T	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201017771T>A	uc001gvv.2	-	36	4607	c.4380A>T	c.(4378-4380)ACA>ACT	p.T1460T		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1460	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TGAAGGTGACTGTGCCGTCGC	0.607													19	80	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201021711	201021711	+	Silent	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201021711G>A	uc001gvv.2	-	32	4154	c.3927C>T	c.(3925-3927)TTC>TTT	p.F1309F		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1309	Extracellular (Potential).|IV.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CAGCTTGTGGGAAGGTCTGGA	0.562													8	154	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43934682	43934682	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43934682G>A	uc010yny.1	+	11	2047	c.1964G>A	c.(1963-1965)CGA>CAA	p.R655Q	PLEKHH2_uc002rte.3_Missense_Mutation_p.R655Q|PLEKHH2_uc002rtf.3_Missense_Mutation_p.R654Q	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	655	Ser-rich.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCCATGAAACGAGGTGAGGGA	0.478													30	58	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	159992748	159992748	+	Silent	SNP	T	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992748T>G	uc002uag.2	+	5	577	c.303T>G	c.(301-303)CCT>CCG	p.P101P	TANC1_uc010fol.1_Silent_p.P101P|TANC1_uc010zcm.1_Silent_p.P101P|TANC1_uc010fom.1_Silent_p.P101P|TANC1_uc002uah.1_5'UTR	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	101						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						CCAGAGTGCCTGGAGATGCAG	0.473													4	165	---	---	---	---	PASS
DIS3L2	129563	broad.mit.edu	37	2	232952314	232952314	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232952314C>T	uc010fxz.2	+	6	760	c.484C>T	c.(484-486)CCT>TCT	p.P162S	DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vsn.1_Missense_Mutation_p.P162S|DIS3L2_uc002vso.2_RNA	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	162							exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		TAATGACAGTCCTGATGTCAT	0.463													4	79	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52610643	52610643	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52610643G>T	uc003des.2	-	22	3617	c.3605C>A	c.(3604-3606)ACA>AAA	p.T1202K	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.T1202K|PBRM1_uc003der.2_Missense_Mutation_p.T1170K|PBRM1_uc003det.2_Missense_Mutation_p.T1217K|PBRM1_uc003deu.2_Missense_Mutation_p.T1217K|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.T1202K|PBRM1_uc010hmk.1_Missense_Mutation_p.T1177K|PBRM1_uc003dey.2_Missense_Mutation_p.T1177K|PBRM1_uc003dez.1_Missense_Mutation_p.T1201K	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1202	BAH 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTCATGCTCTGTTTCTTCTGG	0.383			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								34	59	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64619448	64619448	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64619448G>T	uc003dmg.2	-	13	1996	c.1964C>A	c.(1963-1965)GCT>GAT	p.A655D	ADAMTS9_uc011bfo.1_Missense_Mutation_p.A627D|ADAMTS9_uc003dmh.1_Missense_Mutation_p.A484D|ADAMTS9_uc003dmk.1_Missense_Mutation_p.A655D	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	655	Cys-rich.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GTCAAAGTGAGCACACTGTTC	0.458													72	223	---	---	---	---	PASS
SPARCL1	8404	broad.mit.edu	37	4	88394938	88394938	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88394938G>C	uc010ikm.2	-	12	2556	c.1984C>G	c.(1984-1986)CTC>GTC	p.L662V	SPARCL1_uc011cdc.1_Missense_Mutation_p.L537V|SPARCL1_uc003hqs.3_Missense_Mutation_p.L662V|SPARCL1_uc011cdd.1_Missense_Mutation_p.L537V	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	662					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		CAAAACAAGAGATTTTCATCT	0.343													31	120	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94693413	94693413	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94693413A>T	uc011cdt.1	+	16	3046	c.2788A>T	c.(2788-2790)ACA>TCA	p.T930S	GRID2_uc011cdu.1_Missense_Mutation_p.T835S	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	930	Cytoplasmic (Potential).|Interaction with AP4M1 (By similarity).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TATTACCACAACAACCTTTAT	0.483													39	102	---	---	---	---	PASS
ANKRA2	57763	broad.mit.edu	37	5	72849308	72849308	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72849308C>A	uc003kcu.1	-	8	1455	c.809G>T	c.(808-810)AGT>ATT	p.S270I		NM_023039	NP_075526	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	270	ANK 3.					cytoskeleton|cytosol|membrane	low-density lipoprotein particle binding				0		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		ATCAGCCCCACTTTCTATACC	0.234													8	78	---	---	---	---	PASS
SUN1	23353	broad.mit.edu	37	7	893013	893013	+	Intron	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:893013C>A	uc011jvp.1	+						GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Intron|SUN1_uc011jvr.1_Intron|SUN1_uc003sji.2_Intron|SUN1_uc003sjk.2_5'UTR	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0						GCTTGTTTGACTACCTGGTTT	0.537													3	95	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47869703	47869703	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47869703C>A	uc003tny.1	-	43	6493	c.6493G>T	c.(6493-6495)GTG>TTG	p.V2165L	C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_5'Flank	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2165	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						AGCCACTGCACACATTGCTCC	0.572													3	46	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82784471	82784471	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82784471A>G	uc003uhx.2	-	2	1775	c.1486T>C	c.(1486-1488)TCA>CCA	p.S496P	PCLO_uc003uhv.2_Missense_Mutation_p.S496P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGCTTTGCTGAGCCAGGCTGT	0.607													12	222	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149486417	149486417	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149486417C>G	uc010lpk.2	+	30	4393	c.4393C>G	c.(4393-4395)CTG>GTG	p.L1465V		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1465	LDL-receptor class A 3.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGGACGCTGCCTGCCGCCGGC	0.677													4	34	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22167480	22167480	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22167480G>A	uc003xbn.2	+	15	1841	c.1693G>A	c.(1693-1695)GGA>AGA	p.G565R	PIWIL2_uc011kzf.1_Missense_Mutation_p.G565R|PIWIL2_uc010ltv.2_Missense_Mutation_p.G565R	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	565					DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TTAGATTGAAGGACGTGTTCT	0.388													30	101	---	---	---	---	PASS
OSR2	116039	broad.mit.edu	37	8	99961558	99961558	+	Silent	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99961558G>A	uc003yir.2	+	2	913	c.378G>A	c.(376-378)ACG>ACA	p.T126T	OSR2_uc010mbn.2_Silent_p.T126T|OSR2_uc003yiq.2_Silent_p.T126T|OSR2_uc011lgx.1_Silent_p.T247T	NM_001142462	NP_001135934	Q8N2R0	OSR2_HUMAN	odd-skipped related 2 isoform a	126					bone morphogenesis|chondrocyte differentiation|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic leg joint morphogenesis|embryonic skeletal joint morphogenesis|eyelid development in camera-type eye|head development|mesonephros development|metanephros development|middle ear morphogenesis|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|osteoblast proliferation|palate development|positive regulation of bone mineralization|positive regulation of epithelial cell proliferation|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|zinc ion binding			central_nervous_system(1)	1	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			TGGCTGCCACGCAAGAGGATC	0.607													19	238	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111659236	111659236	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111659236G>A	uc004bdm.3	-	24	3104	c.2584C>T	c.(2584-2586)CAA>TAA	p.Q862*	IKBKAP_uc004bdl.2_Nonsense_Mutation_p.Q513*|IKBKAP_uc011lwc.1_Nonsense_Mutation_p.Q748*|IKBKAP_uc010mtq.2_Nonsense_Mutation_p.Q513*	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	862					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						TCTCTACCTTGAAGCTCGTGT	0.443													31	120	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115818875	115818875	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115818875G>T	uc004bgm.1	-	1	122	c.94C>A	c.(94-96)CTG>ATG	p.L32M	ZFP37_uc011lwz.1_Missense_Mutation_p.L32M|ZFP37_uc011lxa.1_Missense_Mutation_p.L32M	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	32	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						GCCATCTCCAGTGGTCGCCCG	0.632													99	278	---	---	---	---	PASS
NMT2	9397	broad.mit.edu	37	10	15151770	15151770	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15151770A>T	uc001inz.1	-	11	1491	c.1407T>A	c.(1405-1407)TTT>TTA	p.F469L	NMT2_uc001ioa.1_Missense_Mutation_p.F456L|NMT2_uc009xjo.1_Intron|NMT2_uc010qbz.1_Missense_Mutation_p.F281L	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2	469					N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						CTCCTATACCAAACTTGAGTT	0.328													37	133	---	---	---	---	PASS
TSPAN32	10077	broad.mit.edu	37	11	2323364	2323364	+	5'UTR	SNP	G	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2323364G>C	uc001lvy.1	+	1					C11orf21_uc009ydj.2_5'Flank|C11orf21_uc001lvv.2_5'Flank|TSPAN32_uc001lvx.1_Missense_Mutation_p.E30D|TSPAN32_uc009ydk.1_Missense_Mutation_p.E30D|TSPAN32_uc010qxk.1_Missense_Mutation_p.E30D|TSPAN32_uc009ydl.1_RNA|TSPAN32_uc001lvz.1_5'Flank|TSPAN32_uc001lwb.1_5'Flank|TSPAN32_uc001lwc.1_5'Flank	NM_139022	NP_620591	Q96QS1	TSN32_HUMAN	tumor-suppressing subtransferable candidate 6						cell-cell signaling	integral to membrane				central_nervous_system(1)	1		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		gaggagaggagaggagaggAA	0.498											OREG0003771	type=REGULATORY REGION|Gene=NM_014144|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	11	---	---	---	---	PASS
MICALCL	84953	broad.mit.edu	37	11	12316166	12316166	+	Silent	SNP	T	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12316166T>G	uc001mkg.1	+	3	1479	c.1188T>G	c.(1186-1188)CTT>CTG	p.L396L		NM_032867	NP_116256	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	396					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)		GAATCTCACTTTTTTCCTCCC	0.458													19	233	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94731985	94731985	+	Silent	SNP	T	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731985T>A	uc001pfe.2	+	3	2281	c.1449T>A	c.(1447-1449)GCT>GCA	p.A483A		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	483					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CATGCACAGCTTCGGGCCCAG	0.617													13	67	---	---	---	---	PASS
ST14	6768	broad.mit.edu	37	11	130066577	130066577	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130066577T>A	uc001qfw.2	+	11	1529	c.1336T>A	c.(1336-1338)TCC>ACC	p.S446T	ST14_uc010sca.1_Missense_Mutation_p.S256T	NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase	446	CUB 2.|Extracellular (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	TGAATACCTCTCCTACGACTC	0.562													31	81	---	---	---	---	PASS
MAP1LC3B2	643246	broad.mit.edu	37	12	117013678	117013678	+	5'UTR	SNP	C	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117013678C>T	uc009zwk.1	+	2						NM_001085481	NP_001078950	A6NCE7	MP3B2_HUMAN	microtubule-associated protein 1 light chain 3						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule					0						TTCGCTGCCGCAGCAGCCGCC	0.453													10	39	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130648146	130648146	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130648146G>A	uc001uii.2	+	1	1115	c.659G>A	c.(658-660)AGC>AAC	p.S220N	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	220	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GTGTACTGGAGCCGCGAGGAC	0.617													25	73	---	---	---	---	PASS
CSNK1A1L	122011	broad.mit.edu	37	13	37678647	37678647	+	Silent	SNP	A	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37678647A>G	uc001uwm.1	-	1	1155	c.747T>C	c.(745-747)TGT>TGC	p.C249C		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	249	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		GAAACCCCTTACATAAAACTT	0.453													18	152	---	---	---	---	PASS
GRTP1	79774	broad.mit.edu	37	13	114009706	114009706	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114009706T>C	uc001vtn.2	-	3	369	c.272A>G	c.(271-273)AAT>AGT	p.N91S	GRTP1_uc010tkb.1_Missense_Mutation_p.N13S|GRTP1_uc010tkc.1_Missense_Mutation_p.N91S|GRTP1_uc010agv.1_RNA	NM_024719	NP_078995	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	91	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GTAGCCGGGATTCTGGTCCAT	0.657													7	99	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59113389	59113389	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59113389C>A	uc001xdw.2	+	4	2212	c.2048C>A	c.(2047-2049)GCC>GAC	p.A683D	DACT1_uc010trv.1_Missense_Mutation_p.A402D|DACT1_uc001xdx.2_Missense_Mutation_p.A646D|DACT1_uc010trw.1_Missense_Mutation_p.A402D	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	683					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						AAGTCCTCGGCCGAGATTTCC	0.701													10	20	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													3	17	---	---	---	---	PASS
MYO1C	4641	broad.mit.edu	37	17	1380799	1380799	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1380799G>T	uc002fsp.2	-	14	1794	c.1574C>A	c.(1573-1575)ACG>AAG	p.T525K	MYO1C_uc002fsn.2_Missense_Mutation_p.T506K|MYO1C_uc002fso.2_Missense_Mutation_p.T490K|MYO1C_uc010vqj.1_Missense_Mutation_p.T490K|MYO1C_uc010vqk.1_Missense_Mutation_p.T501K	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a	525	Myosin head-like.				mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCCCACTCACGTCAGGAAGTG	0.637													3	62	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35545400	35545400	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35545400G>T	uc002hnm.2	-	39	4673	c.4482C>A	c.(4480-4482)AGC>AGA	p.S1494R	ACACA_uc002hnk.2_Missense_Mutation_p.S1416R|ACACA_uc002hnl.2_Missense_Mutation_p.S1436R|ACACA_uc002hnn.2_Missense_Mutation_p.S1494R|ACACA_uc002hno.2_Missense_Mutation_p.S1531R|ACACA_uc010cuy.2_Missense_Mutation_p.S188R	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1494					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GCATTACCATGCTCCGCACGG	0.458													14	97	---	---	---	---	PASS
KRTAP4-9	100132386	broad.mit.edu	37	17	39261865	39261865	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39261865C>A	uc010wfp.1	+	1	225	c.225C>A	c.(223-225)TGC>TGA	p.C75*		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	75	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].|10.		Missing (in allele KAP.9-v1).			keratin filament					0						CCACCTGTTGCAGGACCACCT	0.647													5	56	---	---	---	---	PASS
ATG4D	84971	broad.mit.edu	37	19	10663721	10663721	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10663721C>A	uc002mov.2	+	10	1523	c.1403C>A	c.(1402-1404)TCT>TAT	p.S468Y	ATG4D_uc010xlh.1_Missense_Mutation_p.S405Y|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_Missense_Mutation_p.S135Y	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	468					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			CGCCCCAGCTCTGAGGACTTT	0.547													27	79	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40420153	40420153	+	Silent	SNP	G	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40420153G>C	uc002omp.3	-	6	2849	c.2841C>G	c.(2839-2841)GTC>GTG	p.V947V		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	947	VWFD 2.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GATACTGAAGGACGTCATCCA	0.498													15	58	---	---	---	---	PASS
CLPTM1	1209	broad.mit.edu	37	19	45465320	45465320	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45465320G>A	uc002pai.2	+	2	188	c.173G>A	c.(172-174)GGT>GAT	p.G58D	CLPTM1_uc010ejv.1_Translation_Start_Site|CLPTM1_uc010xxf.1_Translation_Start_Site|CLPTM1_uc010xxg.1_Missense_Mutation_p.G44D	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	58	Extracellular (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		GTCATCAAAGGTGTGCTGTTT	0.547													15	50	---	---	---	---	PASS
SLC1A5	6510	broad.mit.edu	37	19	47285647	47285647	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47285647T>C	uc002pfs.2	-	4	1437	c.817A>G	c.(817-819)ATC>GTC	p.I273V	SLC1A5_uc010xyh.1_Missense_Mutation_p.I71V|SLC1A5_uc002pfq.2_Missense_Mutation_p.I97V|SLC1A5_uc002pfr.2_Missense_Mutation_p.I45V	NM_005628	NP_005619	Q15758	AAAT_HUMAN	solute carrier family 1 member 5 isoform 1	273	Helical; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane|melanosome|membrane fraction	neutral amino acid transmembrane transporter activity|protein binding|receptor activity|sodium:dicarboxylate symporter activity				0		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	TACCACATGATCCAGGAGACC	0.622													20	80	---	---	---	---	PASS
DHX34	9704	broad.mit.edu	37	19	47870384	47870384	+	Silent	SNP	A	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47870384A>G	uc010xyn.1	+	7	2081	c.1740A>G	c.(1738-1740)CTA>CTG	p.L580L	DHX34_uc010elc.1_Silent_p.L495L	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	580						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GGTCCCTGCTAGCCCAGCTGC	0.652													3	44	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17417465	17417465	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17417465C>A	uc002wpm.2	+	8	1142	c.822C>A	c.(820-822)AAC>AAA	p.N274K	PCSK2_uc002wpl.2_Missense_Mutation_p.N255K|PCSK2_uc010zrm.1_Missense_Mutation_p.N239K	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	274	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCACAGACAACGGCAAGACAG	0.627													3	56	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41306778	41306778	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306778G>A	uc002xkg.2	-	7	1065	c.881C>T	c.(880-882)CCC>CTC	p.P294L	PTPRT_uc010ggj.2_Missense_Mutation_p.P294L	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	294	Extracellular (Potential).|Fibronectin type-III 1.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CAGCTCTGGGGGAGCAATGGG	0.512													3	58	---	---	---	---	PASS
ZSWIM3	140831	broad.mit.edu	37	20	44506283	44506283	+	Silent	SNP	C	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44506283C>A	uc002xqd.2	+	2	1289	c.1086C>A	c.(1084-1086)CTC>CTA	p.L362L	ZSWIM3_uc010zxg.1_Silent_p.L356L	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	362							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				ATGAGGATCTCTTCAACTTCC	0.547													5	122	---	---	---	---	PASS
ZMYND8	23613	broad.mit.edu	37	20	45853096	45853096	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45853096T>C	uc002xta.1	-	19	3324	c.3070A>G	c.(3070-3072)AAG>GAG	p.K1024E	ZMYND8_uc010ghq.1_Missense_Mutation_p.K655E|ZMYND8_uc010ghr.1_Missense_Mutation_p.K926E|ZMYND8_uc002xst.1_Missense_Mutation_p.K906E|ZMYND8_uc002xsu.1_Missense_Mutation_p.K897E|ZMYND8_uc002xsv.1_Missense_Mutation_p.K952E|ZMYND8_uc002xsw.1_Missense_Mutation_p.K730E|ZMYND8_uc002xsx.1_Missense_Mutation_p.K730E|ZMYND8_uc002xsy.1_Missense_Mutation_p.K953E|ZMYND8_uc002xsz.1_Missense_Mutation_p.K915E|ZMYND8_uc010zxy.1_Missense_Mutation_p.K1051E|ZMYND8_uc002xtb.1_Missense_Mutation_p.K998E|ZMYND8_uc002xss.2_Missense_Mutation_p.K1024E|ZMYND8_uc010zxz.1_Missense_Mutation_p.K892E|ZMYND8_uc002xtc.1_Missense_Mutation_p.K998E|ZMYND8_uc002xtd.1_Missense_Mutation_p.K973E|ZMYND8_uc002xte.1_Missense_Mutation_p.K978E|ZMYND8_uc010zya.1_Missense_Mutation_p.K1024E|ZMYND8_uc002xtf.1_Missense_Mutation_p.K1044E|ZMYND8_uc002xsr.1_Missense_Mutation_p.K123E	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b	1024							protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			CACTGCTTCTTCTTGGTCTCA	0.592													69	204	---	---	---	---	PASS
LRRC3	81543	broad.mit.edu	37	21	45876499	45876499	+	5'UTR	SNP	G	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45876499G>C	uc002zfa.2	+	2						NM_030891	NP_112153	Q9BY71	LRRC3_HUMAN	leucine-rich repeat-containing 3 precursor							integral to membrane	protein binding				0		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		GCAGAGGCTCGCGTGTCCCCG	0.657													4	45	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18020333	18020333	+	Silent	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18020333G>A	uc010gqw.1	+	13	1788	c.1662G>A	c.(1660-1662)TCG>TCA	p.S554S	CECR2_uc010gqv.1_Silent_p.S413S|CECR2_uc002zml.2_Silent_p.S413S	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	596					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		GAGGAAAGTCGTTGCCCCCCA	0.642													4	74	---	---	---	---	PASS
MTP18	51537	broad.mit.edu	37	22	30824783	30824783	+	3'UTR	SNP	G	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30824783G>T	uc003ahw.1	+	4					SEC14L2_uc010gvw.1_Intron|MTP18_uc010gvx.1_3'UTR|MTP18_uc003ahv.1_3'UTR|MTP18_uc010gvy.1_3'UTR|MTP18_uc003ahx.1_3'UTR	NM_016498	NP_057582	Q9UDX5	MTFP1_HUMAN	mitochondrial protein 18 kDa isoform a						apoptosis|carbon utilization	integral to membrane|mitochondrial inner membrane	carbonate dehydratase activity|zinc ion binding				0						GCCCGGCCCTGTCTTTTTCAG	0.383													3	8	---	---	---	---	PASS
PNPLA3	80339	broad.mit.edu	37	22	44332986	44332986	+	Silent	SNP	T	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44332986T>C	uc003bei.1	+	6	986	c.813T>C	c.(811-813)CCT>CCC	p.P271P	PNPLA3_uc010gzm.1_RNA	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	271	Lumenal (Potential).				triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)				GGATGGATCCTGAGGTCGCCA	0.602													3	84	---	---	---	---	PASS
NUP50	10762	broad.mit.edu	37	22	45574718	45574718	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45574718T>G	uc003bfr.2	+	5	1402	c.940T>G	c.(940-942)TCT>GCT	p.S314A	NUP50_uc003bfs.2_Missense_Mutation_p.S286A|NUP50_uc011aqn.1_Missense_Mutation_p.S64A|NUP50_uc003bft.2_Missense_Mutation_p.S286A|NUP50_uc011aqo.1_Missense_Mutation_p.S64A	NM_007172	NP_009103	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa isoform b	314	Ser-rich.				carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TAAACCAGTCTCTTCACCATT	0.463													19	56	---	---	---	---	PASS
USP51	158880	broad.mit.edu	37	X	55513238	55513238	+	Nonstop_Mutation	SNP	T	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55513238T>A	uc004dun.1	-	2	2214	c.2135A>T	c.(2134-2136)TAG>TTG	p.*712L	USP51_uc011moo.1_Nonstop_Mutation_p.*416L	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	712					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						CTGGTAAGACTAGTCTTTCTC	0.403													28	105	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138870490	138870490	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138870490G>C	uc004faz.2	-	14	1489	c.1390C>G	c.(1390-1392)CTG>GTG	p.L464V	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.L464V	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	464	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					CGTAGAAACAGCTCTTCTCGA	0.358													4	133	---	---	---	---	PASS
SLC10A3	8273	broad.mit.edu	37	X	153716013	153716013	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153716013C>G	uc004flq.2	-	3	1531	c.1267G>C	c.(1267-1269)GTG>CTG	p.V423L	UBL4A_uc004flo.2_5'Flank|SLC10A3_uc004flr.2_Missense_Mutation_p.V394L|SLC10A3_uc004flp.2_Missense_Mutation_p.V423L	NM_001142392	NP_001135864	P09131	P3_HUMAN	solute carrier family 10, member 3 isoform 1	423	Helical; (Potential).				organic anion transport	integral to membrane	bile acid:sodium symporter activity			ovary(1)|skin(1)	2	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGTTCTGCACCCCTACCTCA	0.642													12	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2916	2916	+	5'Flank	SNP	G	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2916G>A	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AACTTGACCAACGGAACAAGT	0.478													3	14	---	---	---	---	PASS
MEAF6	64769	broad.mit.edu	37	1	37961298	37961298	+	Intron	DEL	C	-	-	rs61058093		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37961298delC	uc001cbg.1	-						MEAF6_uc001cbd.1_Intron|MEAF6_uc001cbe.1_Intron|MEAF6_uc009vvd.1_Intron|MEAF6_uc001cbf.1_Intron	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding				0						aaaaaaaaaacaaaaaacaaa	0.139													7	5	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49462490	49462497	+	Intron	DEL	CCTTCCTT	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49462490_49462497delCCTTCCTT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ttccttcctcccttccttccttccttcc	0.000													2	5	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57498844	57498845	+	Intron	INS	-	ACAC	ACAC	rs141683665	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57498844_57498845insACAC	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						CACTTTTGTTTacacacacaca	0.248													8	5	---	---	---	---	
LOC400759	400759	broad.mit.edu	37	1	89887469	89887469	+	Intron	DEL	G	-	-	rs67428662		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89887469delG	uc009wcy.1	+							NR_003133				Homo sapiens cDNA, FLJ17004.												0						ctgtatttctgaaaaaaaaaa	0.129													4	3	---	---	---	---	
CCDC18	343099	broad.mit.edu	37	1	93692082	93692083	+	Intron	DEL	AT	-	-	rs71875718		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93692082_93692083delAT	uc001dpq.2	+						CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GTAGGACAAAatatatatatat	0.124													9	6	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145368208	145368213	+	Intron	DEL	TCTCTG	-	-	rs72354261		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145368208_145368213delTCTCTG	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GGTCACTTTCtctctgtctctgtctc	0.320													5	3	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235652776	235652776	+	Intron	DEL	T	-	-	rs11299116		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235652776delT	uc001hxc.2	-						B3GALNT2_uc001hxd.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			GCATGAGTCCTTTATTGCAAT	0.338													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19934791	19934794	+	IGR	DEL	GAAA	-	-	rs72315540	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19934791_19934794delGAAA								OSR1 (376419 upstream) : TTC32 (161724 downstream)																							aggaaggaaggaaagaaggaagga	0.064													1	7	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29129301	29129301	+	Intron	DEL	T	-	-	rs113220687		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29129301delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					cagccttaaattttttttttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34041837	34041838	+	IGR	INS	-	CCTCC	CCTCC	rs141683394	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34041837_34041838insCCTCC								MYADML (88553 upstream) : None (None downstream)																							tcttctcttctcctcccctccc	0.000													5	4	---	---	---	---	
ATL2	64225	broad.mit.edu	37	2	38541581	38541582	+	Intron	INS	-	TAT	TAT	rs71400348		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38541581_38541582insTAT	uc002rqq.2	-						ATL2_uc010ynm.1_Intron|ATL2_uc010ynn.1_Intron|ATL2_uc010yno.1_Intron|ATL2_uc002rqs.2_Intron|ATL2_uc002rqr.2_Intron	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2						endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			ovary(1)|kidney(1)|skin(1)	3						TCCTGTTCGCCTACTGATAAGT	0.342													7	5	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42760224	42760224	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42760224delT	uc002rso.1	+							NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TGGGGCAttcttttttttttt	0.239													4	2	---	---	---	---	
SNRNP200	23020	broad.mit.edu	37	2	96950487	96950488	+	Intron	INS	-	T	T	rs150751016		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96950487_96950488insT	uc002svu.2	-						SNRNP200_uc002svt.2_5'Flank|SNRNP200_uc010yuj.1_Intron|SNRNP200_uc002svv.1_5'UTR	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						GCAGCtttttcttttttttttt	0.243													6	3	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152474001	152474002	+	Intron	INS	-	G	G	rs4303716	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152474001_152474002insG	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAAAAAAAAAAAGAGAGAGAGA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	166308934	166308934	+	IGR	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166308934delT								SCN2A (60116 upstream) : CSRNP3 (17223 downstream)																							ccttccttcctttccttcctt	0.184													5	3	---	---	---	---	
SLC25A12	8604	broad.mit.edu	37	2	172693471	172693472	+	Intron	DEL	CA	-	-	rs3836020		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172693471_172693472delCA	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron|SLC25A12_uc010zdv.1_Intron	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	cacacacatgcacacacacaca	0.282													6	3	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106824710	106824710	+	Intron	DEL	T	-	-	rs139188639		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106824710delT	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0						tttttatatcttttttttttt	0.199													4	2	---	---	---	---	
GUCA1C	9626	broad.mit.edu	37	3	108627204	108627204	+	Intron	DEL	A	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108627204delA	uc003dxj.2	-						GUCA1C_uc003dxk.2_Intron	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						TCATTTAAACAAAAAAAAAAA	0.318													4	3	---	---	---	---	
CCKAR	886	broad.mit.edu	37	4	26494531	26494532	+	5'Flank	INS	-	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26494531_26494532insT	uc003gse.1	-							NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	ttctttctttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28669474	28669475	+	IGR	INS	-	CCTT	CCTT	rs2022169	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28669474_28669475insCCTT								None (None upstream) : None (None downstream)																							cttccttccttcctcccttctt	0.129													5	3	---	---	---	---	
AMBN	258	broad.mit.edu	37	4	71469349	71469350	+	Intron	DEL	AC	-	-	rs112130724		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71469349_71469350delAC	uc003hfl.2	+							NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor						bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			TCTTGGCCAGacacacacacac	0.267													4	2	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76530541	76530542	+	Intron	DEL	AC	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76530541_76530542delAC	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron|CDKL2_uc010iix.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ccatctcaaaacacacacacac	0.114													4	2	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79254255	79254257	+	Intron	DEL	AGG	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79254255_79254257delAGG	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc003hkz.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CTTGCTTTGCAGGAGACTGCCTT	0.414													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165331899	165331900	+	IGR	INS	-	TCCTTCCTTCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCTTCCTTCCT			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165331899_165331900insTCCTTCCTTCCTTCCTTCCTTCCT								MARCH1 (26697 upstream) : TRIM61 (543700 downstream)																							ccttccttccttccttccttcc	0.094													4	2	---	---	---	---	
RNASEN	29102	broad.mit.edu	37	5	31449242	31449242	+	Intron	DEL	A	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31449242delA	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						accctgtctcaaaaaaaaaaa	0.179													9	4	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64942852	64942853	+	Intron	INS	-	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64942852_64942853insT	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						ctcattTGGACTTTTTTTTTTT	0.198													4	2	---	---	---	---	
SNX2	6643	broad.mit.edu	37	5	122139009	122139009	+	Intron	DEL	T	-	-	rs67155650		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122139009delT	uc003kte.2	+						SNX2_uc011cwn.1_Intron	NM_003100	NP_003091	O60749	SNX2_HUMAN	sorting nexin 2						cell communication|endocytosis|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding|protein transporter activity			kidney(1)	1		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		ATGGTTTAGGTTTTTTTTTTA	0.204													8	6	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131306104	131306105	+	Intron	INS	-	T	T			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131306104_131306105insT	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kvw.1_Intron|ACSL6_uc010jdn.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGAAGTGCTAttttttttttt	0.257													4	2	---	---	---	---	
HLA-DQA1	3117	broad.mit.edu	37	6	32610142	32610152	+	Intron	DEL	TTCTGTCTCTC	-	-	rs28383464	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32610142_32610152delTTCTGTCTCTC	uc003obr.2	+						HLA-DQA1_uc003obs.2_Intron|HLA-DQA1_uc003obt.1_Frame_Shift_Del_p.F242fs|HLA-DQA1_uc003obu.2_5'Flank	NM_002122	NP_002113	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						TGGGTTTCTTTTCTGTCTCTCTTTTTTTTTT	0.218													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	39149059	39149062	+	IGR	DEL	ACAC	-	-	rs150898333		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39149059_39149062delACAC								C6orf64 (66194 upstream) : KCNK5 (7686 downstream)																							acagacacagacacacacacacac	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57929464	57929464	+	IGR	DEL	G	-	-	rs76511107		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57929464delG								ZNF716 (396199 upstream) : None (None downstream)																							AGGACCTTTCGAAATAAAATG	0.423													6	5	---	---	---	---	
FAM115C	285966	broad.mit.edu	37	7	143417404	143417405	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143417404_143417405delCT	uc003wdf.2	+	3	1335_1336	c.1252_1253delCT	c.(1252-1254)CTCfs	p.L418fs	FAM115C_uc003wdg.2_Frame_Shift_Del_p.L137fs|FAM115C_uc011ktk.1_Frame_Shift_Del_p.L418fs|FAM115C_uc003wdh.2_Frame_Shift_Del_p.L418fs|FAM115C_uc011ktm.1_Frame_Shift_Del_p.L418fs|uc011ktn.1_Intron|uc011kto.1_Intron|uc011ktp.1_Intron|LOC154761_uc011ktq.1_Intron|LOC154761_uc011ktr.1_Intron|LOC154761_uc011kts.1_Intron|FAM115C_uc011ktt.1_Frame_Shift_Del_p.L254fs|FAM115C_uc003wdi.1_Frame_Shift_Del_p.L137fs	NM_001130025	NP_001123497	A6NFQ2	F115C_HUMAN	hypothetical protein LOC285966 isoform A	418											0						CCGCAAGGCGCTCTCTCAATTC	0.530													2	4	---	---	---	---	
ZNF282	8427	broad.mit.edu	37	7	148904293	148904294	+	Intron	INS	-	AAGGTTCTTCATAAG	AAGGTTCTTCATAAG	rs147860582	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148904293_148904294insAAGGTTCTTCATAAG	uc003wfm.2	+						ZNF282_uc011kun.1_Intron|ZNF282_uc003wfn.2_Intron|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		GACTCGTTTTCAGATTACCCGC	0.545													3	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151898379	151898380	+	Intron	DEL	AC	-	-	rs3839689		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151898379_151898380delAC	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		acagacacagacacacacacac	0.327			N		medulloblastoma								4	2	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250877	86250878	+	Intron	INS	-	TT	TT			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250877_86250878insTT	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	ttctttctttctttctttcttt	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96977958	96977958	+	IGR	DEL	G	-	-	rs35277274		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96977958delG								C8orf37 (696521 upstream) : GDF6 (176602 downstream)																							aaggaaggaagggaaggaagg	0.119													4	2	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143337540	143337542	+	Intron	DEL	CAC	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143337540_143337542delCAC	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ccatcaccatcaccaccaccatc	0.000													4	2	---	---	---	---	
MAFA	389692	broad.mit.edu	37	8	144511954	144511956	+	In_Frame_Del	DEL	TGG	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144511954_144511956delTGG	uc003yyc.1	-	1	621_623	c.621_623delCCA	c.(619-624)CACCAT>CAT	p.207_208HH>H		NM_201589	NP_963883	Q8NHW3	MAFA_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	207_208	His-rich.				insulin secretion|nitric oxide mediated signal transduction|response to glucose stimulus	nucleus	protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggt	0.581										HNSCC(29;0.082)			4	3	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71668387	71668388	+	Intron	INS	-	GATGGATG	GATGGATG	rs73647061	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668387_71668388insGATGGATG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						actctgtcatagatggatggat	0.069													14	7	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78790226	78790227	+	Intron	INS	-	AGAAC	AGAAC	rs45587131	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790226_78790227insAGAAC	uc004ajz.2	+						PCSK5_uc004ajy.2_3'UTR|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						tagaatagaatagaacagaaca	0.119													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137379857	137379864	+	IGR	DEL	CCTTTCTC	-	-	rs68173061	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137379857_137379864delCCTTTCTC								RXRA (47426 upstream) : COL5A1 (153788 downstream)																							ttccttccttcctttctCtctctctctc	0.163													4	2	---	---	---	---	
DHTKD1	55526	broad.mit.edu	37	10	12162420	12162420	+	Intron	DEL	C	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12162420delC	uc001ild.3	+							NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain						glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			gcaagctccgccccccgggtt	0.005													10	8	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32307659	32307659	+	Intron	DEL	T	-	-	rs211377		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32307659delT	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				aaaaaaaaaattttttttttt	0.154													6	3	---	---	---	---	
ANUBL1	93550	broad.mit.edu	37	10	46122633	46122633	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46122633delT	uc001jcp.3	-						ANUBL1_uc001jcl.3_Intron|ANUBL1_uc001jcm.3_Intron|ANUBL1_uc009xmu.2_Intron|ANUBL1_uc001jcn.3_Intron|ANUBL1_uc001jco.3_Intron	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog								zinc ion binding				0						GAAGAAAATGTTACTTACCAT	0.294													16	8	---	---	---	---	
ARHGAP22	58504	broad.mit.edu	37	10	49786600	49786601	+	Intron	DEL	TG	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49786600_49786601delTG	uc001jgt.2	-						ARHGAP22_uc001jgu.2_Intron|ARHGAP22_uc010qgl.1_Intron|ARHGAP22_uc010qgm.1_Intron|ARHGAP22_uc001jgv.2_Intron	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						tgtgtgtgtctgtgtgtgtgtg	0.168													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57298158	57298161	+	Intron	DEL	CTTC	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298158_57298161delCTTC	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				tccttcctttcttccttccttcct	0.137										HNSCC(58;0.16)			5	5	---	---	---	---	
PDLIM1	9124	broad.mit.edu	37	10	96998112	96998112	+	Intron	DEL	T	-	-	rs45543839		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96998112delT	uc001kkh.2	-						PDLIM1_uc001kki.2_Intron|PDLIM1_uc009xuv.2_Intron|PDLIM1_uc001kkj.1_3'UTR	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1						response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		ATTTTTCTCATTTTACATGTT	0.483													4	3	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17496775	17496775	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17496775delT	uc001mnc.2	-						ABCC8_uc010rcy.1_Intron	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CCACCACACCtttttactgag	0.274													3	3	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	84213203	84213204	+	Intron	INS	-	CCTTTC	CCTTTC	rs151187364	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84213203_84213204insCCTTTC	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				cttccttcctttctctctctct	0.000													4	2	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112332120	112332121	+	IGR	INS	-	T	T	rs111710457		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112332120_112332121insT								PTS (191443 upstream) : NCAM1 (499874 downstream)																							CTGATTTTATGTTTTTTTTTTT	0.376													4	2	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134037301	134037304	+	Intron	DEL	ACTT	-	-	rs66495156		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037301_134037304delACTT	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTGCACACTCACTTGTGAGATGAG	0.598													6	3	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32520417	32520417	+	Intron	DEL	A	-	-	rs63514564		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32520417delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TGTATTTAAGAAAAAAAAAAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53535721	53535721	+	IGR	DEL	G	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53535721delG								SOAT2 (17399 upstream) : CSAD (15727 downstream)																							aaaaaaaaaagaaaaaaaaaa	0.249													15	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89702806	89702807	+	IGR	INS	-	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89702806_89702807insA								KITLG (728568 upstream) : DUSP6 (39032 downstream)																							CCGACCCCCAGAAAAAAAAAAG	0.351													3	3	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132403325	132403326	+	Intron	INS	-	GT	GT	rs67230512		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132403325_132403326insGT	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		tggggtgtcgggtgtggggtgt	0.134													4	3	---	---	---	---	
RXFP2	122042	broad.mit.edu	37	13	32360924	32360927	+	Intron	DEL	AAAT	-	-	rs3051238		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32360924_32360927delAAAT	uc001utt.2	+						RXFP2_uc010aba.2_Intron	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		ACTGAATGACAAATAAGCCTCATT	0.368													5	6	---	---	---	---	
SIP1	8487	broad.mit.edu	37	14	39587985	39587985	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39587985delT	uc001wuq.2	+						SIP1_uc001wur.2_Intron|SIP1_uc001wus.2_Intron|SIP1_uc010amx.2_Intron	NM_003616	NP_003607	O14893	GEMI2_HUMAN	SMN-interacting protein 1 isoform alpha						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)		TCATGACAAAttttttttttt	0.154													5	3	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64427327	64427327	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64427327delT	uc001xgm.2	+						SYNE2_uc001xgk.2_Intron|SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAGTGAAGTGTTTTTTTTTTT	0.204													5	3	---	---	---	---	
DCAF4	26094	broad.mit.edu	37	14	73412936	73412936	+	Intron	DEL	A	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73412936delA	uc001xng.2	+						DCAF4_uc001xnj.2_Intron|DCAF4_uc010ttr.1_Intron|DCAF4_uc001xnh.2_Intron|DCAF4_uc010tts.1_Intron|DCAF4_uc010ttt.1_Intron|DCAF4_uc001xni.2_Intron|DCAF4_uc001xnk.2_Intron	NM_015604	NP_056419	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4 isoform 1							CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)|skin(1)	3						ttgtctctacaaaaaaaaaaa	0.045													5	3	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100602451	100602463	+	Intron	DEL	CCCCCAGAGCCTC	-	-	rs67380624		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100602451_100602463delCCCCCAGAGCCTC	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				TCTTATGGGTCCCCCAGAGCCTCCCCCAGGAGC	0.629													15	9	---	---	---	---	
MIR544	664613	broad.mit.edu	37	14	101514904	101514905	+	5'Flank	DEL	GT	-	-	rs112536165		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101514904_101514905delGT	hsa-mir-544|MI0003515	+						MIR655_hsa-mir-655|MI0003677_5'Flank																	0						CACCTCTGGGgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
CYFIP1	23191	broad.mit.edu	37	15	22930041	22930042	+	Intron	INS	-	GC	GC			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22930041_22930042insGC	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GGGCTGTGTGAGCACCTGCTTC	0.569													4	4	---	---	---	---	
LCTL	197021	broad.mit.edu	37	15	66845029	66845031	+	Intron	DEL	ATT	-	-	rs35244038		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66845029_66845031delATT	uc002aqc.2	-						LCTL_uc002aqd.3_Intron|LCTL_uc010bhw.2_Intron	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor						carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						aaaaaaaaaCATTGTTGGAGGGG	0.192													3	4	---	---	---	---	
CES1	1066	broad.mit.edu	37	16	55864721	55864722	+	Intron	INS	-	GTAA	GTAA	rs28552095		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55864721_55864722insGTAA	uc002eim.2	-						CES1_uc002eil.2_Intron|CES1_uc002ein.2_Intron	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	aaggaaggaaggaaggaaggaa	0.054													4	3	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919483	57919492	+	Intron	DEL	TTTCTTTCTT	-	-	rs3038253		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919483_57919492delTTTCTTTCTT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						tctctctctctttctttctttctttctttc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	71304304	71304307	+	IGR	DEL	AGGA	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71304304_71304307delAGGA								HYDIN (39679 upstream) : FTSJD1 (11897 downstream)																							ggagggagggaggaaggaaggaag	0.000													3	3	---	---	---	---	
GAN	8139	broad.mit.edu	37	16	81387847	81387847	+	Intron	DEL	A	-	-	rs139978939		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81387847delA	uc002fgo.2	+							NM_022041	NP_071324	Q9H2C0	GAN_HUMAN	gigaxonin						cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)				CAACTCTTGGAAAAAAAAAAA	0.259													4	2	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10547473	10547474	+	Intron	INS	-	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10547473_10547474insA	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						aactcagtctcaaaaaaaaaaa	0.163													4	2	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16664648	16664648	+	Intron	DEL	A	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16664648delA	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						actccatctcaaaaaaaaaaa	0.119													4	3	---	---	---	---	
KIAA0100	9703	broad.mit.edu	37	17	26950601	26950602	+	Intron	DEL	AA	-	-	rs35696171		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26950601_26950602delAA	uc002hbu.2	-						KIAA0100_uc002hbt.2_5'Flank	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					CACCATGAGGAAAAAAAAAAAA	0.366													4	2	---	---	---	---	
TRIM37	4591	broad.mit.edu	37	17	57094987	57094987	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57094987delT	uc002iwy.3	-						TRIM37_uc002iwz.3_Intron|TRIM37_uc002ixa.3_Intron|TRIM37_uc010woc.1_Intron	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein							perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GAGCAGAATCttttttttttt	0.179									Mulibrey_Nanism				4	4	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482166	59482166	+	Intron	DEL	C	-	-	rs66504335		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482166delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R353fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						AGGGAGGTGGCGGCGGGGGGT	0.706													4	3	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674528	78674530	+	Intron	DEL	TGA	-	-	rs141252102	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674528_78674530delTGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gtggtggtggtgatgatggtggt	0.000													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3581662	3581663	+	Intron	INS	-	A	A			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3581662_3581663insA	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TTCTCACCATGaaaaaaaaaaa	0.381													4	3	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50866418	50866419	+	Intron	DEL	AC	-	-	rs3217360		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50866418_50866419delAC	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTGTCTATCTacacacacacac	0.233													5	3	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5218213	5218214	+	Intron	INS	-	A	A	rs149426302		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5218213_5218214insA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		ATGTTAACTTTAAAAAAAAAAA	0.406													4	8	---	---	---	---	
CYP4F3	4051	broad.mit.edu	37	19	15769843	15769843	+	Intron	DEL	G	-	-	rs111660338		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15769843delG	uc002nbj.2	+						CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron|CYP4F3_uc010xon.1_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GGTCTAGGCTGGGGGGTTGGA	0.577													8	4	---	---	---	---	
UBA2	10054	broad.mit.edu	37	19	34949495	34949498	+	Intron	DEL	AAAG	-	-	rs71165659		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34949495_34949498delAAAG	uc002nvk.2	+						UBA2_uc010xrx.1_Intron|UBA2_uc002nvl.2_Intron	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	SUMO-1 activating enzyme subunit 2						protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			aaaaaaaaaaaaaGAAGGTTGAAA	0.176													6	4	---	---	---	---	
CACNG8	59283	broad.mit.edu	37	19	54483337	54483338	+	Intron	INS	-	GC	GC	rs56223082		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483337_54483338insGC	uc002qcs.1	+						MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		tgtgtgtgtgtgtgcgcgcgcg	0.554													4	2	---	---	---	---	
LILRB3	11025	broad.mit.edu	37	19	54733630	54733631	+	Intron	INS	-	T	T	rs141238984	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54733630_54733631insT	uc010erh.1	-						LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		atttttttgtattttcagtaga	0.005													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56053834	56053837	+	IGR	DEL	CATC	-	-	rs113583456		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56053834_56053837delCATC								SBK2 (6173 upstream) : ZNF579 (35055 downstream)																							ccaaacctttcatccatccatcca	0.000													6	5	---	---	---	---	
ZIM3	114026	broad.mit.edu	37	19	57648045	57648046	+	Intron	INS	-	A	A	rs145532440	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57648045_57648046insA	uc002qnz.1	-							NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		aaaaaaaaaagaaaaaaaaaaG	0.188													7	4	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332941	1332942	+	Intron	INS	-	T	T	rs35712372		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332941_1332942insT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	tccttccttccttccttccttc	0.005													4	2	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445891	35445891	+	Intron	DEL	A	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445891delA	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				AGatttaattaaaaaaaaaaa	0.507													3	4	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	52086153	52086154	+	Intron	INS	-	AAAG	AAAG	rs116779353	by1000genomes	TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52086153_52086154insAAAG	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			gaaagatagatagagagggagg	0.000													6	3	---	---	---	---	
PCK1	5105	broad.mit.edu	37	20	56136889	56136901	+	Intron	DEL	TGCACAAAAGCTC	-	-	rs66514941		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56136889_56136901delTGCACAAAAGCTC	uc002xyn.3	+						PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			ATGAGGTGTGTGCACAAAAGCTCTGCCAACTAG	0.451													4	4	---	---	---	---	
USP25	29761	broad.mit.edu	37	21	17238522	17238523	+	Intron	DEL	AT	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17238522_17238523delAT	uc002yjy.1	+						USP25_uc011aby.1_Intron|USP25_uc002yjz.1_Intron|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25						protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TGatttacaaatatatatatat	0.228													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	5197160	5197161	+	IGR	INS	-	AGGA	AGGA	rs10701505		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5197160_5197161insAGGA								None (None upstream) : NLGN4X (610923 downstream)																							aaggaagagagaggaaggaagg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	8265160	8265163	+	IGR	DEL	CCTC	-	-	rs62582723		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8265160_8265163delCCTC								VCX2 (125852 upstream) : VCX3B (167708 downstream)																							ttccttccttcctcccttctttcc	0.015													4	2	---	---	---	---	
EGFL6	25975	broad.mit.edu	37	X	13618385	13618386	+	Intron	INS	-	TTCT	TTCT	rs71913558		TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13618385_13618386insTTCT	uc004cvi.2	+						EGFL6_uc004cvj.2_Intron|EGFL6_uc011mik.1_Intron	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6						cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						cctttctttccttctttctttc	0.119													6	5	---	---	---	---	
PLS3	5358	broad.mit.edu	37	X	114844800	114844800	+	Intron	DEL	T	-	-			TCGA-BP-5186-01A-01D-1429-08	TCGA-BP-5186-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114844800delT	uc004eqd.2	+						PLS3_uc010nqf.2_Intron|PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Intron|PLS3_uc004eqe.2_Intron|PLS3_uc011mtg.1_Intron|PLS3_uc011mth.1_Intron	NM_005032	NP_005023	P13797	PLST_HUMAN	plastin 3							cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2						GTTTTATTTCTTTTTTTTTTT	0.264													6	3	---	---	---	---	
