Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11B	984	broad.mit.edu	37	1	1654058	1654058	+	Intron	SNP	C	T	T	rs61777495	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1654058C>T	uc001agv.1	-						CDK11B_uc001aha.1_Translation_Start_Site|CDK11B_uc001agw.1_Translation_Start_Site|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron|CDK11A_uc010nyt.1_Intron|CDK11A_uc010nyu.1_Intron|CDK11A_uc009vkt.1_Intron|CDK11A_uc009vku.1_Intron|CDK11A_uc009vkv.1_Intron|CDK11A_uc001aht.1_Intron|CDK11B_uc001ahu.1_Intron|CDK11B_uc001ahv.1_Intron|CDK11B_uc001ahw.1_Intron|uc001ahx.1_5'Flank	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						AAGAACTTCACCGAAGAAGCG	0.338													4	87	---	---	---	---	PASS
ACTRT2	140625	broad.mit.edu	37	1	2938986	2938986	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2938986G>A	uc001ajz.2	+	1	941	c.736G>A	c.(736-738)GAC>AAC	p.D246N		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	246						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CAAGCTGCCCGACGGGAACAT	0.652													30	87	---	---	---	---	PASS
FBXO2	26232	broad.mit.edu	37	1	11709907	11709907	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11709907A>C	uc001asj.2	-	4	888	c.546T>G	c.(544-546)ATT>ATG	p.I182M	FBXO2_uc009vna.2_Missense_Mutation_p.I185M|FBXO2_uc009vnb.1_RNA	NM_012168	NP_036300	Q9UK22	FBX2_HUMAN	F-box only protein 2	182	FBA.				glycoprotein catabolic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|endoplasmic reticulum|membrane|microsome|SCF ubiquitin ligase complex	sugar binding|ubiquitin-protein ligase activity				0	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGCAGGTCAATGACCTGTG	0.617													33	99	---	---	---	---	PASS
CATSPER4	378807	broad.mit.edu	37	1	26517881	26517881	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26517881C>T	uc010oez.1	+	2	317	c.317C>T	c.(316-318)GCC>GTC	p.A106V	CATSPER4_uc010oey.1_5'UTR|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	106	Helical; Name=Segment S1; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		GTGATCAATGCCATCACCATC	0.463													25	45	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152185823	152185823	+	Missense_Mutation	SNP	C	A	A	rs41266120		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152185823C>A	uc001ezt.1	-	3	8358	c.8282G>T	c.(8281-8283)CGA>CTA	p.R2761L		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2761	30.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCCCATGTCGGCCATAGCC	0.602													43	94	---	---	---	---	PASS
BTG2	7832	broad.mit.edu	37	1	203276485	203276485	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203276485T>A	uc001gzq.2	+	2	467	c.396T>A	c.(394-396)TGT>TGA	p.C132*	FMOD_uc010pqi.1_Intron|uc009xao.1_5'Flank|uc001gzp.1_5'Flank|BTG2_uc009xap.1_RNA	NM_006763	NP_006754	P78543	BTG2_HUMAN	B-cell translocation gene 2	132					DNA repair|neuron projection development|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(1)|kidney(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.203)			CCGCCTCCTGTGGGCTCCTCA	0.652													44	94	---	---	---	---	PASS
OPTC	26254	broad.mit.edu	37	1	203465247	203465247	+	Silent	SNP	C	T	T	rs139083417	byFrequency	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203465247C>T	uc001gzu.1	+	2	230	c.114C>T	c.(112-114)GGC>GGT	p.G38G		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	38						proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCAGGGAAGGCGATTCCTTTG	0.527													23	55	---	---	---	---	PASS
RCOR3	55758	broad.mit.edu	37	1	211486237	211486237	+	Silent	SNP	T	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211486237T>A	uc001hig.2	+	10	1246	c.1077T>A	c.(1075-1077)ACT>ACA	p.T359T	RCOR3_uc010psv.1_RNA|RCOR3_uc001hie.2_Silent_p.T417T|RCOR3_uc010psw.1_Silent_p.T417T|RCOR3_uc001hif.2_Intron|RCOR3_uc009xcz.2_RNA	NM_018254	NP_060724	Q9P2K3	RCOR3_HUMAN	REST corepressor 3 isoform d	359					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		ATGCTTCTACTTTAGGGGAGG	0.443													66	109	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	227618218	227618218	+	RNA	SNP	G	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227618218G>T	uc001hqv.2	+	4		c.1453G>T								Homo sapiens cDNA clone IMAGE:5270051.																		TGCCACCTCTGTGGCCACCAT	0.488													12	43	---	---	---	---	PASS
ANKRD20B	729171	broad.mit.edu	37	2	95522772	95522772	+	RNA	SNP	T	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95522772T>C	uc010fhp.2	-	1		c.49A>G				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						GCGCTCCACCTCCGCGGCGTC	0.682													3	73	---	---	---	---	PASS
UNC50	25972	broad.mit.edu	37	2	99226157	99226157	+	Intron	SNP	A	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99226157A>T	uc002szc.3	+						C2orf64_uc002syz.2_5'Flank|C2orf64_uc002sza.2_Intron|UNC50_uc002szb.2_5'UTR|UNC50_uc010yvl.1_5'UTR	NM_014044	NP_054763	Q53HI1	UNC50_HUMAN	unc-50 homolog						protein transport	Golgi membrane|integral to membrane|nuclear inner membrane	RNA binding				0						TCAGAAGAGGAGTGTCGGTAG	0.433													94	207	---	---	---	---	PASS
ANKZF1	55139	broad.mit.edu	37	2	220099090	220099090	+	Intron	SNP	G	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220099090G>T	uc002vkg.2	+						ANKZF1_uc010zkv.1_3'UTR|ANKZF1_uc010zkw.1_3'UTR|ANKZF1_uc002vkh.2_Intron|ANKZF1_uc002vki.2_Intron|ANKZF1_uc002vkj.1_3'UTR	NM_018089	NP_060559	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing							intracellular	zinc ion binding			ovary(2)	2		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTCATAACTGACCCATTTCC	0.383													49	83	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1415695	1415695	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1415695G>A	uc003boz.2	+	16	2300	c.2033G>A	c.(2032-2034)GGC>GAC	p.G678D	CNTN6_uc011asj.1_Missense_Mutation_p.G606D|CNTN6_uc003bpa.2_Missense_Mutation_p.G678D	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	678	Fibronectin type-III 1.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GTTGTTGCCGGCAACAGCATT	0.383													4	94	---	---	---	---	PASS
TMEM110	375346	broad.mit.edu	37	3	52883890	52883890	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52883890C>A	uc003dge.2	-	4	426	c.345G>T	c.(343-345)ATG>ATT	p.M115I	TMEM110_uc003dgc.3_Missense_Mutation_p.M115I	NM_198563	NP_940965	Q86TL2	TM110_HUMAN	transmembrane protein 110	115	Helical; (Potential).					integral to membrane				large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)		AGATGAGCAGCATGCCCACAG	0.612													3	35	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66436782	66436782	+	Intron	SNP	G	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66436782G>T	uc003dmx.2	-						SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Intron|LRIG1_uc003dmw.2_Intron|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGAGGAACCAGCTGCTGTTCA	0.537													10	92	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130283940	130283940	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130283940G>T	uc010htl.2	+	3	795	c.764G>T	c.(763-765)AGT>ATT	p.S255I		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	255	Nonhelical region.|VWFA 2.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TTGGAAGAAAGTGTATCTGCC	0.413													25	244	---	---	---	---	PASS
C4orf23	152992	broad.mit.edu	37	4	8469669	8469669	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8469669A>G	uc003glg.1	+	9	1024	c.836A>G	c.(835-837)TAC>TGC	p.Y279C	C4orf23_uc003glf.1_Missense_Mutation_p.Y267C|C4orf23_uc003glh.1_Missense_Mutation_p.Y116C	NM_152544	NP_689757	Q8IYL2	TRM44_HUMAN	hypothetical protein LOC152992 isoform 2	508					tRNA processing	cytoplasm	methyltransferase activity|nucleic acid binding|zinc ion binding				0						TCCAGAACATACCCTTCCTCC	0.493													28	74	---	---	---	---	PASS
ANAPC4	29945	broad.mit.edu	37	4	25395511	25395511	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25395511C>T	uc003gro.2	+	11	1003	c.874C>T	c.(874-876)CAG>TAG	p.Q292*	ANAPC4_uc003grp.2_Nonsense_Mutation_p.Q177*|ANAPC4_uc010iet.1_Intron|ANAPC4_uc010ieu.1_Nonsense_Mutation_p.Q101*	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN	anaphase-promoting complex subunit 4	292					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)				CAAGTTTGTGCAGGTAAAGCA	0.353													4	97	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79296891	79296891	+	Splice_Site	SNP	A	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79296891A>T	uc003hlb.2	+	26	3592	c.3152_splice	c.e26-2	p.A1051_splice	FRAS1_uc003hkw.2_Splice_Site_p.A1051_splice	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CTTTTTTAATAGCCTGCCCTC	0.483													6	11	---	---	---	---	PASS
SPZ1	84654	broad.mit.edu	37	5	79616434	79616434	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79616434G>A	uc003kgn.2	+	1	645	c.400G>A	c.(400-402)GAG>AAG	p.E134K	uc011ctk.1_Intron	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	134					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		TTTAGCCCCAGAGAAAGAAGA	0.368													39	193	---	---	---	---	PASS
SPZ1	84654	broad.mit.edu	37	5	79616440	79616440	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79616440G>C	uc003kgn.2	+	1	651	c.406G>C	c.(406-408)GAA>CAA	p.E136Q	uc011ctk.1_Intron	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		CCCAGAGAAAGAAGACAATGA	0.373													34	193	---	---	---	---	PASS
TCERG1	10915	broad.mit.edu	37	5	145838701	145838701	+	Silent	SNP	T	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145838701T>C	uc003lob.2	+	4	733	c.693T>C	c.(691-693)GCT>GCC	p.A231A	TCERG1_uc003loc.2_Silent_p.A231A|TCERG1_uc011dbt.1_Silent_p.A231A	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1	231	Potential.|Ala/Gln-rich.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aggctcaggctcaggcacaag	0.124													3	58	---	---	---	---	PASS
STL	7955	broad.mit.edu	37	6	125231888	125231888	+	RNA	SNP	T	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125231888T>G	uc003pzq.2	-	7		c.2846A>C				NR_026876				Homo sapiens mRNA; cDNA DKFZp451I132 (from clone DKFZp451I132).												0						GCTAATAAGTTTCTAATAAGC	0.199			T	ETV6	B-ALL								13	30	---	---	---	---	PASS
SYTL3	94120	broad.mit.edu	37	6	159146585	159146585	+	Silent	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159146585A>G	uc003qrp.2	+	10	1015	c.771A>G	c.(769-771)AAA>AAG	p.K257K	SYTL3_uc011efp.1_Silent_p.K257K|SYTL3_uc003qro.2_Silent_p.K189K|SYTL3_uc003qrq.2_Silent_p.K189K|SYTL3_uc003qrr.2_Silent_p.K257K|SYTL3_uc003qrs.2_Silent_p.K189K|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	257					intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		AGGATCCCAAATGCTCTACTA	0.428													16	356	---	---	---	---	PASS
DNAJC30	84277	broad.mit.edu	37	7	73097664	73097664	+	Silent	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73097664G>A	uc003tys.1	-	1	118	c.90C>T	c.(88-90)AGC>AGT	p.S30S	WBSCR22_uc010lbi.1_5'Flank|WBSCR22_uc003tyt.2_5'Flank|WBSCR22_uc003tyu.2_5'Flank|WBSCR22_uc003tyv.2_5'Flank|WBSCR22_uc003tyw.1_5'Flank	NM_032317	NP_115693	Q96LL9	DJC30_HUMAN	DnaJ (Hsp40) homolog subfamily C member 30	30					protein folding		heat shock protein binding|unfolded protein binding				0						CTAGGCCCAGGCTGGGTGCAG	0.617													48	100	---	---	---	---	PASS
SERPINE1	5054	broad.mit.edu	37	7	100780223	100780223	+	Intron	SNP	T	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100780223T>G	uc003uxt.2	+						SERPINE1_uc011kkj.1_Intron|SERPINE1_uc003uxu.1_3'UTR	NM_000602	NP_000593	P05121	PAI1_HUMAN	plasminogen activator inhibitor-1 isoform 1						angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)	aCGGCGGGGGTGGGGGTGGTG	0.333													8	18	---	---	---	---	PASS
LAMB1	3912	broad.mit.edu	37	7	107564469	107564469	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107564469C>G	uc003vew.2	-	34	5623	c.5288G>C	c.(5287-5289)AGA>ACA	p.R1763T	LAMB1_uc003vev.2_Missense_Mutation_p.R1787T|LAMB1_uc003veu.2_Missense_Mutation_p.R246T	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1763	Potential.|Domain I.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCCTTCCAGTCTTGCTAATTC	0.353													49	105	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10470413	10470413	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10470413C>T	uc003wtc.2	-	4	1424	c.1195G>A	c.(1195-1197)GGG>AGG	p.G399R		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	399					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CCTGGCTGCCCGCCTCGGCCA	0.657													14	127	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68107615	68107615	+	Splice_Site	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68107615A>G	uc003xxi.2	+	31	3591	c.3560_splice	c.e31-2	p.D1187_splice	ARFGEF1_uc003xxl.1_Intron|CSPP1_uc003xxj.2_Splice_Site_p.D1152_splice|CSPP1_uc003xxk.2_Splice_Site_p.D807_splice|CSPP1_uc010lyw.2_Splice_Site_p.M201_splice	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TGCCTCCTGTAGATGATGAGA	0.522													146	347	---	---	---	---	PASS
HNRNPK	3190	broad.mit.edu	37	9	86584095	86584095	+	3'UTR	SNP	T	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86584095T>C	uc004ang.3	-	17					HNRNPK_uc011lsw.1_3'UTR|HNRNPK_uc004and.3_3'UTR|HNRNPK_uc004ank.3_3'UTR|HNRNPK_uc004anf.3_3'UTR|HNRNPK_uc004anh.3_3'UTR|HNRNPK_uc011lsx.1_3'UTR|HNRNPK_uc004ani.3_3'UTR|HNRNPK_uc004anj.3_3'UTR|HNRNPK_uc004ann.3_3'UTR|HNRNPK_uc004anl.3_3'UTR|HNRNPK_uc004anm.3_3'UTR	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K						interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						TGCACGCCCTTCCCCCCCCCA	0.403													6	17	---	---	---	---	PASS
OR13C5	138799	broad.mit.edu	37	9	107361334	107361334	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107361334C>G	uc011lvp.1	-	1	361	c.361G>C	c.(361-363)GAC>CAC	p.D121H		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						ACATAGCGGTCAAAGGCCATC	0.517													58	163	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119976970	119976970	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119976970A>G	uc004bjs.1	-	3	783	c.682T>C	c.(682-684)TAC>CAC	p.Y228H	ASTN2_uc004bjr.1_Missense_Mutation_p.Y228H|ASTN2_uc004bjt.1_Missense_Mutation_p.Y228H	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	228	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CGCTGGGCGTACAGCGCCACG	0.602													22	56	---	---	---	---	PASS
TOR2A	27433	broad.mit.edu	37	9	130494163	130494163	+	3'UTR	SNP	T	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130494163T>G	uc004brs.3	-	5					TOR2A_uc004brt.3_3'UTR|TOR2A_uc004brw.3_3'UTR|TOR2A_uc011maj.1_3'UTR|TOR2A_uc004bru.3_3'UTR|TOR2A_uc004brv.3_RNA|TOR2A_uc004brx.1_3'UTR	NM_001085347	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A isoform a						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum|extracellular region	ATP binding|nucleoside-triphosphatase activity				0						CGAGCCAGTTTAGAGGCCAGG	0.642													3	3	---	---	---	---	PASS
CELF2	10659	broad.mit.edu	37	10	11047307	11047307	+	5'UTR	SNP	C	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11047307C>A	uc001iki.3	+	1					CELF2_uc010qbi.1_5'UTR|CELF2_uc010qbj.1_5'UTR	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						GATGTTTGAGCATACTTCTGA	0.313													16	191	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832122	42832122	+	RNA	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832122C>T	uc010qey.1	-	3		c.1853G>A				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CAGTAAAAGGCTTTGCCACAT	0.348													4	20	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123353298	123353298	+	Missense_Mutation	SNP	C	T	T	rs143978938	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123353298C>T	uc010qtk.1	-	2	681	c.34G>A	c.(34-36)GTG>ATG	p.V12M	FGFR2_uc010qtg.1_Missense_Mutation_p.V12M|FGFR2_uc010qth.1_Missense_Mutation_p.V12M|FGFR2_uc010qti.1_Missense_Mutation_p.V12M|FGFR2_uc010qtj.1_Missense_Mutation_p.V12M|FGFR2_uc010qtl.1_Missense_Mutation_p.V12M|FGFR2_uc010qtm.1_Missense_Mutation_p.V12M|FGFR2_uc001lfl.3_Missense_Mutation_p.V12M|FGFR2_uc001lfm.2_Missense_Mutation_p.V12M|FGFR2_uc001lfn.3_RNA|FGFR2_uc010qtn.1_Missense_Mutation_p.V31M|FGFR2_uc010qto.1_Missense_Mutation_p.V31M|FGFR2_uc001lfo.1_Missense_Mutation_p.V31M|FGFR2_uc010qtp.1_Missense_Mutation_p.V31M|FGFR2_uc010qtq.1_Missense_Mutation_p.V31M	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	12					angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	ATGGTGACCACGACCAGGCAG	0.502		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				8	149	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134018475	134018475	+	3'UTR	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134018475G>A	uc009ybb.2	+	14						NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4						axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		GGCCCCACCCGAGGCCGCGGG	0.642													34	72	---	---	---	---	PASS
SCGB2A1	4246	broad.mit.edu	37	11	61981221	61981221	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61981221G>C	uc001nta.2	+	3	331	c.267G>C	c.(265-267)TGG>TGC	p.W89C		NM_002407	NP_002398	O75556	SG2A1_HUMAN	secretoglobin, family 2A, member 1 precursor	89						extracellular region	androgen binding				0						ACAGCATTTGGTGTAATATGA	0.368													14	247	---	---	---	---	PASS
CCDC87	55231	broad.mit.edu	37	11	66359599	66359599	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66359599C>A	uc001oiq.3	-	1	956	c.888G>T	c.(886-888)AGG>AGT	p.R296S	CCS_uc001oir.2_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	296										ovary(1)|skin(1)	2						AGGGGGAAGCCCTGCTGGTGG	0.612													41	99	---	---	---	---	PASS
BIN2	51411	broad.mit.edu	37	12	51696509	51696509	+	Silent	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51696509G>A	uc001ryg.2	-	4	325	c.273C>T	c.(271-273)AGC>AGT	p.S91S	BIN2_uc009zlz.2_Silent_p.S91S|BIN2_uc001ryh.2_5'UTR|BIN2_uc010sng.1_Silent_p.S65S	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2	91	BAR.					cytoplasm	protein binding			ovary(1)	1						CGTCCCACTCGCTGCTGTAGA	0.468													136	275	---	---	---	---	PASS
MARS	4141	broad.mit.edu	37	12	57908819	57908819	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57908819A>G	uc001sog.2	+	17	2205	c.2182A>G	c.(2182-2184)ATT>GTT	p.I728V	MARS_uc001sof.1_RNA|MARS_uc010srq.1_Missense_Mutation_p.I494V|MARS_uc001soh.1_Missense_Mutation_p.I123V	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	728					methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CTGGAAGCGGATTAAAGGCAG	0.517													30	73	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67698394	67698394	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67698394A>G	uc001stn.2	+	9	1740	c.1303A>G	c.(1303-1305)ATT>GTT	p.I435V	CAND1_uc001sto.2_Missense_Mutation_p.I113V	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	435	HEAT 10.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GGTTCCCAACATTGTTAAAGC	0.378													49	110	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	19857036	19857036	+	RNA	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19857036A>G	uc001vvq.1	-	5		c.494T>C								Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		CTGGATAATAAAGTTCATCTC	0.373													4	157	---	---	---	---	PASS
PCK2	5106	broad.mit.edu	37	14	24572088	24572088	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24572088G>A	uc001wlt.2	+	8	1493	c.1361G>A	c.(1360-1362)CGC>CAC	p.R454H	NRL_uc001wlq.2_Intron|PCK2_uc001wlr.1_Missense_Mutation_p.R466H|PCK2_uc010tnw.1_Missense_Mutation_p.R320H|PCK2_uc010tnx.1_Missense_Mutation_p.R320H|PCK2_uc001wlu.3_Missense_Mutation_p.R320H	NM_004563	NP_004554	Q16822	PCKGM_HUMAN	mitochondrial phosphoenolpyruvate carboxykinase	454		GTP (By similarity).			gluconeogenesis	mitochondrial matrix	GTP binding|metal ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0184)		TTTGGTGGCCGCAGACCCAAA	0.572													5	216	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65208079	65208079	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65208079G>A	uc001xho.1	+	16	2113	c.1844G>A	c.(1843-1845)CGG>CAG	p.R615Q	PLEKHG3_uc001xhn.1_Missense_Mutation_p.R559Q|PLEKHG3_uc001xhp.2_Missense_Mutation_p.R736Q|PLEKHG3_uc010aqh.1_Missense_Mutation_p.R157Q|PLEKHG3_uc001xhq.1_Missense_Mutation_p.R120Q	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	615					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		AGCTTCTCTCGGCGGAGCAGC	0.662													23	47	---	---	---	---	PASS
CYP19A1	1588	broad.mit.edu	37	15	51520122	51520122	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51520122C>G	uc001zyz.3	-	5	556	c.305G>C	c.(304-306)AGT>ACT	p.S102T	CYP19A1_uc001zza.3_Missense_Mutation_p.S102T|CYP19A1_uc001zzb.2_Missense_Mutation_p.S102T|CYP19A1_uc001zzd.2_Missense_Mutation_p.S102T|CYP19A1_uc010bey.1_Missense_Mutation_p.S102T	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19	102					estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	GTGGAACATACTTGAGGACCT	0.428													57	112	---	---	---	---	PASS
LMAN1L	79748	broad.mit.edu	37	15	75112351	75112351	+	Intron	SNP	G	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75112351G>T	uc002ayt.1	+						LMAN1L_uc010bkd.2_3'UTR|LMAN1L_uc010ulo.1_3'UTR|LMAN1L_uc010bke.1_Intron	NM_021819	NP_068591	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like precursor							ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0						CTGGGTGGAGGGGTCTTACTT	0.577													4	113	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	82809008	82809008	+	Intron	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82809008G>A	uc010unt.1	-						uc002bhl.2_Intron|uc002bhm.2_Intron|uc010unw.1_RNA			A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						TGCTGGAGCTGGGGTGGGAAG	0.642													3	4	---	---	---	---	PASS
FANCI	55215	broad.mit.edu	37	15	89825246	89825246	+	Intron	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89825246C>T	uc010bnp.1	+						FANCI_uc002bnm.1_Intron|FANCI_uc002bnn.1_Intron|FANCI_uc002bnp.1_Intron|FANCI_uc002bnq.1_5'UTR	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I isoform						cell cycle|DNA repair	nucleoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					ttcatttagtcttcagagcaa	0.129								Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				2	4	---	---	---	---	PASS
IGF1R	3480	broad.mit.edu	37	15	99482525	99482525	+	Silent	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99482525C>T	uc002bul.2	+	18	3443	c.3393C>T	c.(3391-3393)TTC>TTT	p.F1131F	IGF1R_uc010bon.2_Silent_p.F1130F	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	1131	Protein kinase.|Cytoplasmic (Potential).				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	CCAATAAGTTCGTCCACAGAG	0.502													30	212	---	---	---	---	PASS
SRL	6345	broad.mit.edu	37	16	4245640	4245640	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4245640C>T	uc002cvz.3	-	5	537	c.524G>A	c.(523-525)GGC>GAC	p.G175D	SRL_uc002cvy.3_RNA	NM_001098814	NP_001092284	Q86TD4	SRCA_HUMAN	sarcalumenin	634						sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)|skin(2)	5						AACCTCAATGCCAATCAGCTT	0.507													66	158	---	---	---	---	PASS
ALG1	56052	broad.mit.edu	37	16	5134911	5134911	+	3'UTR	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5134911A>G	uc002cym.2	+	13					ALG1_uc002cyj.2_3'UTR|ALG1_uc002cyn.2_3'UTR|ALG1_uc010bue.2_3'UTR|ALG1_uc010uxy.1_3'UTR|FAM86A_uc002cyo.2_3'UTR|FAM86A_uc002cyp.2_3'UTR	NM_019109	NP_061982	Q9BT22	ALG1_HUMAN	beta-1,4-mannosyltransferase						dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)				AAACCCCAGGACCCCTGCTGT	0.582													3	89	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20648750	20648750	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20648750C>T	uc002dhm.1	-	8	1208	c.1140G>A	c.(1138-1140)TGG>TGA	p.W380*	ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_Nonsense_Mutation_p.W380*	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	380					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						TCTTCATTCCCCAGTAGGTGG	0.522													6	150	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65016300	65016300	+	Intron	SNP	C	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016300C>A	uc002eoi.2	-						CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GAATATTCCTCAAAGAGAGAA	0.378			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			3	31	---	---	---	---	PASS
ZNF276	92822	broad.mit.edu	37	16	89793740	89793740	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89793740G>C	uc002fos.3	+	5	1157	c.1060G>C	c.(1060-1062)GAC>CAC	p.D354H	ZNF276_uc010ciq.2_Intron|ZNF276_uc002fop.2_Intron|ZNF276_uc002foq.3_Missense_Mutation_p.D279H|ZNF276_uc010cir.2_RNA|ZNF276_uc002for.3_Intron|ZNF276_uc010cis.2_Missense_Mutation_p.D113H|ZNF276_uc002fot.3_Intron|ZNF276_uc010vpm.1_Missense_Mutation_p.D192H|ZNF276_uc010cit.1_Missense_Mutation_p.D113H	NM_001113525	NP_001106997	Q8N554	ZN276_HUMAN	zinc finger protein 276 isoform a	354					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TCGGGTAAAAGACGAGTTCAG	0.473													42	104	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1559690	1559690	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1559690T>C	uc002fte.2	-	36	5903	c.5789A>G	c.(5788-5790)TAC>TGC	p.Y1930C		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1930	Involved in interaction with pre-mRNA 5' splice site.					catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCATACCGTGTAAGATGAAAT	0.468													8	264	---	---	---	---	PASS
ACAP1	9744	broad.mit.edu	37	17	7246741	7246741	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7246741G>A	uc002ggd.2	+	6	594	c.388G>A	c.(388-390)GGG>AGG	p.G130R		NM_014716	NP_055531	Q15027	ACAP1_HUMAN	centaurin beta1	130	BAR.|Required for formation of endosomal tubules when overexpressed with PIP5K1C.				intracellular signal transduction|lipid metabolic process|protein transport|regulation of ARF GTPase activity		ARF GTPase activator activity|phospholipase C activity|protein binding|zinc ion binding			breast(2)|large_intestine(1)	3						TTTCTGGCGGGGGGCTGAGAG	0.647													28	99	---	---	---	---	PASS
RICH2	9912	broad.mit.edu	37	17	12893426	12893426	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12893426C>T	uc002gnr.3	+	21	2722	c.2395C>T	c.(2395-2397)CGG>TGG	p.R799W	RICH2_uc010vvk.1_3'UTR|RICH2_uc010vvl.1_3'UTR|RICH2_uc002gns.3_3'UTR|RICH2_uc010vvm.1_Missense_Mutation_p.R793W|RICH2_uc010vvn.1_RNA	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2	799					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						GGAGCACATGCGGCGACACTC	0.587													4	68	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35600351	35600351	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35600351T>C	uc002hnm.2	-	22	2947	c.2756A>G	c.(2755-2757)AAG>AGG	p.K919R	ACACA_uc002hnk.2_Missense_Mutation_p.K841R|ACACA_uc002hnl.2_Missense_Mutation_p.K861R|ACACA_uc002hnn.2_Missense_Mutation_p.K919R|ACACA_uc002hno.2_Missense_Mutation_p.K956R|ACACA_uc010cuz.2_Missense_Mutation_p.K919R	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	919					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CATTTCCTTCTTGATAGACTT	0.448													110	223	---	---	---	---	PASS
LIPG	9388	broad.mit.edu	37	18	47088655	47088655	+	5'UTR	SNP	T	G	G	rs34474737	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47088655T>G	uc002ldv.2	+	1					LIPG_uc002ldu.1_5'UTR|LIPG_uc010xdh.1_5'UTR	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor						cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						TTCTGTTTCTTGGGAGGGGGT	0.572													3	52	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9069219	9069219	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9069219G>A	uc002mkp.2	-	3	18431	c.18227C>T	c.(18226-18228)CCT>CTT	p.P6076L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6078	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTTCAGTTCAGGAGTCAGAGG	0.483													49	86	---	---	---	---	PASS
KRI1	65095	broad.mit.edu	37	19	10668296	10668296	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10668296C>G	uc002moy.1	-	16	1576	c.1567G>C	c.(1567-1569)GAC>CAC	p.D523H	KRI1_uc002mow.1_Missense_Mutation_p.D142H|KRI1_uc002mox.1_Missense_Mutation_p.D519H	NM_023008	NP_075384	Q8N9T8	KRI1_HUMAN	KRI1 homolog	523										ovary(1)	1			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GGCAGGTCGTCGATGATGTCC	0.617													39	86	---	---	---	---	PASS
ZNF613	79898	broad.mit.edu	37	19	52447997	52447997	+	Silent	SNP	A	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52447997A>G	uc002pxz.1	+	6	1284	c.861A>G	c.(859-861)TCA>TCG	p.S287S	ZNF613_uc002pya.1_Silent_p.S251S	NM_001031721	NP_001026891	Q6PF04	ZN613_HUMAN	zinc finger protein 613 isoform 1	287					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		GAGAGAAGTCATATATATGCA	0.428													4	146	---	---	---	---	PASS
TNNI3	7137	broad.mit.edu	37	19	55665514	55665514	+	Missense_Mutation	SNP	G	A	A	rs104894724		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55665514G>A	uc002qjg.3	-	7	433	c.433C>T	c.(433-435)CGG>TGG	p.R145W	TNNI3_uc010yft.1_Missense_Mutation_p.R137W	NM_000363	NP_000354	P19429	TNNI3_HUMAN	troponin I, cardiac	145	Involved in binding TNC and actin.		R -> G (in CMH7).		cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding			lung(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CTCACTCTCCGCAGGGTGGGC	0.587													4	107	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30415852	30415852	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30415852G>T	uc002ymy.2	+	13	1490	c.1288G>T	c.(1288-1290)GAT>TAT	p.D430Y	USP16_uc002ymx.2_Missense_Mutation_p.D429Y|USP16_uc002ymw.2_Missense_Mutation_p.D430Y|USP16_uc011acm.1_Missense_Mutation_p.D415Y|USP16_uc011acn.1_Missense_Mutation_p.D96Y|USP16_uc011aco.1_Missense_Mutation_p.D120Y	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	430					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						AGAGAGAAGTGATATTCCTTC	0.348													27	90	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31835807	31835807	+	3'UTR	SNP	C	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31835807C>A	uc003akz.1	-	19					EIF4ENIF1_uc003akx.1_3'UTR|EIF4ENIF1_uc003aky.1_3'UTR|EIF4ENIF1_uc003ala.1_3'UTR|EIF4ENIF1_uc003alb.1_3'UTR|EIF4ENIF1_uc003akw.1_3'UTR	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E							nucleus	protein binding|protein transporter activity			ovary(1)	1						CGAGATGAAGCAGGGTCCTGC	0.517													3	40	---	---	---	---	PASS
FOXRED2	80020	broad.mit.edu	37	22	36900193	36900193	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36900193C>T	uc003apn.3	-	3	1109	c.1001G>A	c.(1000-1002)CGG>CAG	p.R334Q	FOXRED2_uc003apo.3_Missense_Mutation_p.R334Q|FOXRED2_uc003app.3_Missense_Mutation_p.R334Q	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	334					ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						GCGGATTACCCGGTCATAGGG	0.547													38	79	---	---	---	---	PASS
HDAC10	83933	broad.mit.edu	37	22	50685358	50685358	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50685358G>A	uc003bkg.2	-	15	1833	c.1460C>T	c.(1459-1461)GCA>GTA	p.A487V	TUBGCP6_uc003bkb.1_5'Flank|TUBGCP6_uc010har.1_5'Flank|TUBGCP6_uc010has.1_5'Flank|TUBGCP6_uc010hau.1_5'Flank|HDAC10_uc003bke.2_Missense_Mutation_p.A213V|HDAC10_uc003bkf.2_Missense_Mutation_p.A213V|HDAC10_uc010hav.2_Missense_Mutation_p.A467V|HDAC10_uc003bkh.2_Missense_Mutation_p.A280V|HDAC10_uc003bki.2_Missense_Mutation_p.A437V|HDAC10_uc003bkj.2_RNA	NM_032019	NP_114408	Q969S8	HDA10_HUMAN	histone deacetylase 10 isoform 1	487					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nucleus	histone deacetylase activity|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGTGGCTGCTGCAGCAGAGGC	0.577													11	25	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54954164	54954164	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54954164C>T	uc004dtq.2	+	11	1935	c.1828C>T	c.(1828-1830)CGC>TGC	p.R610C	TRO_uc004dts.2_Missense_Mutation_p.R610C|TRO_uc004dtr.2_Missense_Mutation_p.R610C|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_Missense_Mutation_p.R213C|TRO_uc011mok.1_Missense_Mutation_p.R141C|TRO_uc004dtw.2_Missense_Mutation_p.R213C|TRO_uc004dtx.2_5'UTR	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	610	MAGE.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						CTGGGGCTTGCGCTCCTACCA	0.483													3	41	---	---	---	---	PASS
ARMCX3	51566	broad.mit.edu	37	X	100879926	100879926	+	5'UTR	SNP	G	A	A			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100879926G>A	uc004ehz.1	+	5					ARMCX3_uc004eia.1_5'UTR|ARMCX3_uc004eib.1_5'UTR|ARMCX3_uc004eic.1_5'UTR	NM_016607	NP_057691	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3							integral to membrane	binding			ovary(1)|lung(1)	2						CAGCCTGAGTGACTACTCTAT	0.597													40	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15111	15111	+	Silent	SNP	C	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15111C>T	uc004coy.2	+	1	351	c.276C>T	c.(274-276)TGC>TGT	p.C92C	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		CCTCCTGCTTGCAACTATAGC	0.448											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	6	25	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10845226	10845226	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10845226delT	uc001aro.2	-						CASZ1_uc001arp.1_Intron	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		tccttccttcttttcctccct	0.000													4	2	---	---	---	---	
PDPN	10630	broad.mit.edu	37	1	13910742	13910744	+	Intron	DEL	GGA	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13910742_13910744delGGA	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_5'Flank|PDPN_uc009voc.2_5'Flank|PDPN_uc001ave.2_5'Flank|PDPN_uc001avf.2_5'Flank	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		GCTGAGCGCCGGAGGAGGAGAGG	0.690													4	2	---	---	---	---	
DNAJC16	23341	broad.mit.edu	37	1	15891041	15891041	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15891041delT	uc001aws.2	+						DNAJC16_uc001awr.1_Intron|DNAJC16_uc001awt.2_Intron|DNAJC16_uc001awu.2_Intron	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		tattttttacttttttttttt	0.159													6	3	---	---	---	---	
MST1P2	11209	broad.mit.edu	37	1	16972311	16972311	+	Intron	DEL	C	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16972311delC	uc009vow.2	+						CROCCL1_uc001azg.1_5'Flank|CROCCL1_uc001azi.1_5'Flank|uc001azj.1_5'Flank|MST1P2_uc010ocg.1_Intron|MST1P2_uc010och.1_Intron|MST1P2_uc010oci.1_5'Flank|MST1P2_uc001azk.2_5'Flank|MST1P2_uc001azl.3_5'Flank|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						TTGAGCACAGCTGGGAAGCCC	0.557													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	46951108	46951109	+	IGR	DEL	GT	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46951108_46951109delGT								FAAH (71588 upstream) : DMBX1 (21559 downstream)																							AACTAACAGGGTGTGTGTGTGT	0.609													4	2	---	---	---	---	
GDAP2	54834	broad.mit.edu	37	1	118429438	118429439	+	Intron	INS	-	ACA	ACA	rs143592216	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118429438_118429439insACA	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CTACTCTGCAGACAACACCTAT	0.307													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161716375	161716376	+	IGR	DEL	CT	-	-	rs151003373		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716375_161716376delCT								FCRLB (18443 upstream) : DUSP12 (3205 downstream)																							tccttccttccttcTCTCTCTC	0.035													4	2	---	---	---	---	
CENPL	91687	broad.mit.edu	37	1	173772816	173772816	+	Intron	DEL	T	-	-	rs141936109		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173772816delT	uc001gje.3	-						CENPL_uc009wwg.2_Intron|CENPL_uc001gjg.3_Intron|CENPL_uc001gjf.3_Intron	NM_033319	NP_201576	Q8N0S6	CENPL_HUMAN	centromere protein L isoform 2						mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus					0						ATAATTGGCCttttttttttt	0.164													4	2	---	---	---	---	
SLC26A9	115019	broad.mit.edu	37	1	205893754	205893754	+	Intron	DEL	T	-	-	rs67742034		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205893754delT	uc001hdq.2	-						SLC26A9_uc001hdo.2_Intron|SLC26A9_uc001hdp.2_Intron	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a							integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TTAAATAGCATTTTTTGCAAT	0.373													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273399	207273414	+	IGR	DEL	ATGTGTGTGTGTGTGT	-	-	rs57088528		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273399_207273414delATGTGTGTGTGTGTGT								C4BPB (64 upstream) : C4BPA (4097 downstream)																							ATAATGCACCAtgtgtgtgtgtgtgtgtgtgtgtgt	0.255													9	8	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246093466	246093466	+	Intron	DEL	A	-	-	rs11295264		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246093466delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron|SMYD3_uc001ibi.2_5'Flank|SMYD3_uc001ibj.2_5'UTR	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CTCCTGGGAGAAAAAAAAAAA	0.383													3	3	---	---	---	---	
GFPT1	2673	broad.mit.edu	37	2	69581850	69581851	+	Intron	INS	-	A	A	rs150887587	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69581850_69581851insA	uc002sfh.2	-						GFPT1_uc002sfi.1_Intron	NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						AAGAATTTTTTAAAAAAATCAG	0.158													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71004413	71004414	+	IGR	INS	-	A	A	rs55926232		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004413_71004414insA								ADD2 (9084 upstream) : FIGLA (28 downstream)																							aactctatctcaaaaaaaaaaa	0.163													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	193998939	193998940	+	IGR	DEL	GT	-	-	rs72303740		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193998939_193998940delGT								PCGEM1 (357318 upstream) : None (None downstream)																							atgAATATTGgtgtgtgtgtgt	0.015													4	2	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196771178	196771178	+	Intron	DEL	T	-	-	rs35550789		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196771178delT	uc002utj.3	-							NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCTTTCTTTCTTTTTTTtttt	0.060													4	2	---	---	---	---	
ABCA12	26154	broad.mit.edu	37	2	215890649	215890649	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215890649delT	uc002vew.2	-						ABCA12_uc002vev.2_Intron|ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGAATGAAAATTTAACCTTTA	0.303													4	2	---	---	---	---	
C3orf24	115795	broad.mit.edu	37	3	10146617	10146621	+	Intron	DEL	TTATT	-	-	rs113292025		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10146617_10146621delTTATT	uc003buz.2	-						C3orf24_uc003bva.1_Intron	NM_173472	NP_775743	Q96PS1	CC024_HUMAN	hypothetical protein LOC115795												0				OV - Ovarian serous cystadenocarcinoma(96;0.196)		ATATTAGTAAttattttattttatt	0.180													4	3	---	---	---	---	
SLC9A10	285335	broad.mit.edu	37	3	111988585	111988586	+	Intron	INS	-	T	T	rs146409035	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111988585_111988586insT	uc003dyu.2	-						SLC9A10_uc011bhu.1_Intron|SLC9A10_uc010hqc.2_Intron	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger						cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						ttggtacattgtttctgttgta	0.064													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180777958	180777959	+	IGR	INS	-	GTGT	GTGT	rs146771798	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180777958_180777959insGTGT								DNAJC19 (70428 upstream) : SOX2OT (503550 downstream)																							GACTCACCAGCgtgtgtgtgtg	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195325306	195325307	+	IGR	DEL	TG	-	-	rs9778111		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195325306_195325307delTG								APOD (14230 upstream) : SDHAP2 (59603 downstream)																							AATTACTCTCtgtgtgtgtgtg	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195362972	195362973	+	IGR	INS	-	G	G			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195362972_195362973insG								APOD (51896 upstream) : SDHAP2 (21937 downstream)																							CCGCTGTACTCCTCAGCGGGAC	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3578072	3578074	+	5'Flank	DEL	GAA	-	-	rs111370021		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3578072_3578074delGAA	uc003ghj.1	+						uc003ghk.1_5'Flank					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		ggaggagaaggaagaggaggagg	0.177													4	2	---	---	---	---	
NFKB1	4790	broad.mit.edu	37	4	103506206	103506206	+	Intron	DEL	T	-	-	rs72362867		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103506206delT	uc011ceq.1	+						NFKB1_uc011cep.1_Intron|NFKB1_uc011cer.1_Intron	NM_003998	NP_003989	P19838	NFKB1_HUMAN	nuclear factor kappa-B, subunit 1 isoform 1						anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|breast(2)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)	gccgggctaattttttttttt	0.000													4	2	---	---	---	---	
NPNT	255743	broad.mit.edu	37	4	106848559	106848561	+	In_Frame_Del	DEL	GTT	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106848559_106848561delGTT	uc003hya.2	+	3	444_446	c.239_241delGTT	c.(238-243)GGTTAT>GAT	p.80_81GY>D	NPNT_uc011cfc.1_In_Frame_Del_p.97_98GY>D|NPNT_uc011cfd.1_In_Frame_Del_p.80_81GY>D|NPNT_uc011cfe.1_In_Frame_Del_p.80_81GY>D|NPNT_uc010ilt.1_In_Frame_Del_p.80_81GY>D|NPNT_uc011cff.1_In_Frame_Del_p.80_81GY>D|NPNT_uc010ilu.1_5'UTR	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	80_81	EGF-like 1.				cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		TGTCATCCTGGTTATGCTGGAAA	0.399													66	32	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	129869491	129869491	+	Intron	DEL	A	-	-	rs145196324		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129869491delA	uc003igp.2	-						SCLT1_uc003ign.2_Intron|SCLT1_uc003igo.2_Intron|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						actccattgcaaaaaaaaaaa	0.124													4	3	---	---	---	---	
DCLK2	166614	broad.mit.edu	37	4	151120062	151120063	+	Intron	INS	-	C	C	rs71596224		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151120062_151120063insC	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					CCCTTTCAGCACCCCCCCCCCC	0.446													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173408401	173408402	+	Intron	INS	-	CTTC	CTTC	rs337987		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173408401_173408402insCTTC	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						tttctttctttcttccttcctt	0.054													4	4	---	---	---	---	
RXFP3	51289	broad.mit.edu	37	5	33938339	33938339	+	3'UTR	DEL	G	-	-	rs3832336		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33938339delG	uc003jic.1	+	1						NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3							integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						AAGGAGGGCTGGGGGGGGCCC	0.642													12	11	---	---	---	---	
C7	730	broad.mit.edu	37	5	40979699	40979699	+	Intron	DEL	T	-	-	rs35148902		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40979699delT	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AGTTTCCACCTTTTTTTTTTT	0.313													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	142137009	142137010	+	IGR	DEL	GT	-	-	rs140893047		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142137009_142137010delGT								FGF1 (59374 upstream) : ARHGAP26 (13282 downstream)																							aacagggtgagtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180708698	180708699	+	IGR	INS	-	G	G	rs1815381		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180708698_180708699insG								TRIM52 (20579 upstream) : None (None downstream)																							gggcggtaggcgggggctggag	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	861190	861191	+	IGR	DEL	GT	-	-	rs71743918		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:861190_861191delGT								EXOC2 (168081 upstream) : LOC285768 (100051 downstream)																							CCACAGTCTGgtgtgtgtgtgt	0.356													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	19997486	19997489	+	IGR	DEL	AAGA	-	-	rs68035898	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19997486_19997489delAAGA								ID4 (156572 upstream) : MBOAT1 (103446 downstream)																							ggaaggaaggaagaaagaaagaaa	0.000													6	5	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26460170	26460171	+	Intron	INS	-	CACAGGGAGATTCCACAGGGA	CACAGGGAGATTCCACAGGGA	rs142117310	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26460170_26460171insCACAGGGAGATTCCACAGGGA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						ACTCCCTTTTCCACTCTCCCTG	0.480													3	3	---	---	---	---	
LOC222699	222699	broad.mit.edu	37	6	28185356	28185356	+	RNA	DEL	G	-	-	rs71762698		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28185356delG	uc011dla.1	-	1		c.1352delC				NR_002936				Homo sapiens pp14762 mRNA, complete cds.												0						ttttttttttggcctttcctt	0.358													4	2	---	---	---	---	
DDX43	55510	broad.mit.edu	37	6	74115935	74115936	+	Intron	INS	-	GG	GG	rs143908408	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74115935_74115936insGG	uc003pgw.2	+						DDX43_uc011dyn.1_Intron	NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						ttagtagagacggtttctctat	0.000													6	8	---	---	---	---	
SNX14	57231	broad.mit.edu	37	6	86282278	86282279	+	Intron	INS	-	AAATACC	AAATACC	rs144690652	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86282278_86282279insAAATACC	uc003pkr.2	-						SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		ATCAGAGAAAAAAATACCACAT	0.252													1	5	---	---	---	---	
C6orf167	253714	broad.mit.edu	37	6	97730448	97730448	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97730448delT	uc003ppb.2	-						C6orf167_uc011eaf.1_5'Flank|C6orf167_uc010kcn.1_Intron|C6orf167_uc010kco.1_5'Flank|C6orf167_uc003ppc.2_5'Flank	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		GGGGGGGGGGTGGGGCCGAGA	0.502													8	4	---	---	---	---	
TRA2A	29896	broad.mit.edu	37	7	23552393	23552393	+	Intron	DEL	A	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23552393delA	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						tcctatctttaaaaaaaaaaa	0.104													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93742422	93742423	+	IGR	INS	-	TTCCTTCC	TTCCTTCC			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93742422_93742423insTTCCTTCC								BET1 (108732 upstream) : COL1A2 (281450 downstream)																							AATTCAATTGTTTGTttccttc	0.218													3	3	---	---	---	---	
IFRD1	3475	broad.mit.edu	37	7	112113110	112113123	+	Intron	DEL	TGTGTGTGTGTGTA	-	-	rs59135774		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112113110_112113123delTGTGTGTGTGTGTA	uc003vgh.2	+						IFRD1_uc011kmn.1_Intron|IFRD1_uc003vgj.2_Intron|IFRD1_uc011kmo.1_Intron|IFRD1_uc011kmp.1_Intron|IFRD1_uc003vgk.2_Intron	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1						multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						tgtgtgtgtgtgtgtgtgtgtgtatatatgtgtc	0.201													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135223828	135223831	+	IGR	DEL	TTCT	-	-	rs59702810	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135223828_135223831delTTCT								CNOT4 (28977 upstream) : NUP205 (18831 downstream)																							ctttccttccttctttccttcctt	0.093													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141654507	141654514	+	IGR	DEL	ACACACAC	-	-	rs71522165		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141654507_141654514delACACACAC								CLEC5A (7724 upstream) : TAS2R38 (17917 downstream)																							CATAAAAGATacacacacacacacacac	0.279													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40266042	40266043	+	IGR	INS	-	CTTT	CTTT	rs142186427	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40266042_40266043insCTTT								C8orf4 (253221 upstream) : ZMAT4 (122073 downstream)																							ctcctttcttcctttctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103654417	103654418	+	IGR	DEL	AC	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103654417_103654418delAC								ODF1 (81172 upstream) : KLF10 (6587 downstream)																							CACCCCCCCGACACACACACAC	0.431													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103749227	103749228	+	IGR	INS	-	AT	AT			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103749227_103749228insAT								KLF10 (81244 upstream) : AZIN1 (89309 downstream)																							cacacacacacacacacacaca	0.287													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106561747	106561750	+	Intron	DEL	CTTC	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106561747_106561750delCTTC	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			tccctcccatcttccttccttcct	0.181													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131469126	131469126	+	IGR	DEL	T	-	-	rs139545712		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131469126delT								ASAP1 (54910 upstream) : ADCY8 (323422 downstream)																							ccttccttccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	14997076	14997079	+	Intron	DEL	GAGT	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14997076_14997079delGAGT	uc003zln.1	-						LOC389705_uc010mid.1_Intron					Homo sapiens cDNA FLJ46077 fis, clone TESTI2003768, weakly  similar to Chloride channel protein 3.																		GGGTGAACAAGAGTGAGTGATACT	0.328													8	7	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37741448	37741449	+	Intron	DEL	AC	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37741448_37741449delAC	uc004aag.1	+						FRMPD1_uc004aah.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		TCCTGGCAGGacacacacacac	0.396													4	2	---	---	---	---	
PGM5P2	595135	broad.mit.edu	37	9	69128420	69128422	+	Intron	DEL	AGG	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69128420_69128422delAGG	uc004aff.3	-							NR_002836				Homo sapiens phosphoglucomutase 5 pseudogene 2, mRNA (cDNA clone IMAGE:4121651), with apparent retained intron.												0						gaaggaaggaaggaaggaaggaa	0.000													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	80021060	80021060	+	Intron	DEL	A	-	-	rs66687988		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80021060delA	uc004akr.2	+						VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						GGCTTAAAGGAAAAAAAAAAA	0.383													13	6	---	---	---	---	
PSAT1	29968	broad.mit.edu	37	9	80915359	80915360	+	Intron	DEL	TG	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80915359_80915360delTG	uc004ala.2	+						PSAT1_uc004alb.2_Intron	NM_058179	NP_478059	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1 isoform 1						L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)	TCGCTGGCTTTGTGGACATGGG	0.490													4	2	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994280	114994282	+	Intron	DEL	AGA	-	-	rs3983403		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994280_114994282delAGA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						agaagagaagagaagagaagaga	0.089													11	5	---	---	---	---	
JMJD1C	221037	broad.mit.edu	37	10	65139866	65139866	+	Intron	DEL	T	-	-	rs34420480		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65139866delT	uc001jmn.2	-						JMJD1C_uc009xpi.2_Intron|JMJD1C_uc001jmr.1_3'UTR	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					catccagctattttttttttt	0.000													4	2	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69798110	69798110	+	Intron	DEL	A	-	-	rs35054670		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69798110delA	uc001jng.3	-						HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						AGCTAGATACAAAAAAAAAAA	0.323													4	2	---	---	---	---	
PKD2L1	9033	broad.mit.edu	37	10	102048434	102048435	+	Intron	INS	-	T	T	rs112981669		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102048434_102048435insT	uc001kqx.1	-						BLOC1S2_uc001kqv.1_5'Flank|BLOC1S2_uc001kqw.1_5'Flank|PKD2L1_uc009xwm.1_Intron	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1						signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TGTTTGTTAACTTTTTTTTTTT	0.421													3	4	---	---	---	---	
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5655757	5655762	+	Intron	DEL	ACACAT	-	-	rs3060967		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5655757_5655762delACACAT	uc001mbf.2	+						HBG2_uc001mak.1_Intron|TRIM34_uc001mbh.2_Intron|TRIM34_uc009yeq.2_Intron|TRIM34_uc001mbi.2_Intron|TRIM34_uc001mbj.2_Intron	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite							intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		acacacacacacacatatatatatat	0.228													9	7	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9485630	9485633	+	Intron	DEL	TGTT	-	-	rs144180501	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9485630_9485633delTGTT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		Cgtgtgtgtgtgtttgtgtgtgtg	0.020													1	5	---	---	---	---	
PHF21A	51317	broad.mit.edu	37	11	46100980	46100980	+	Intron	DEL	T	-	-	rs34312343		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46100980delT	uc001ncc.3	-						PHF21A_uc001ncb.3_Intron|PHF21A_uc009ykx.2_Intron|PHF21A_uc001nce.2_Intron	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a						blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						TGACAGTGGCTTCCGAAAGGA	0.403													3	3	---	---	---	---	
CD6	923	broad.mit.edu	37	11	60785952	60785953	+	Intron	INS	-	AAGGGGAAAAGGAGAAAGG	AAGGGGAAAAGGAGAAAGG	rs144632420	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60785952_60785953insAAGGGGAAAAGGAGAAAGG	uc001nqq.2	+						CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						TGCATTCGCTCAAGGGGAAAAG	0.391													5	3	---	---	---	---	
SLC22A20	440044	broad.mit.edu	37	11	64997532	64997532	+	Intron	DEL	T	-	-	rs150430504	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64997532delT	uc010roc.1	+							NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						ccttccttcctttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69171131	69171131	+	IGR	DEL	G	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69171131delG								MYEOV (14682 upstream) : CCND1 (284742 downstream)																							ggaagagagagggaaggaaag	0.000													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	84902212	84902213	+	Intron	INS	-	CACG	CACG			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84902212_84902213insCACG	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				gcgcgcacacacacacacacac	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89719007	89719007	+	IGR	DEL	G	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89719007delG								TRIM64 (11769 upstream) : UBTFL1 (100111 downstream)																							ATGACTACATGGGGGTGGGGG	0.343													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	102415498	102415501	+	IGR	DEL	TTCC	-	-	rs10543432		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102415498_102415501delTTCC								MMP7 (14020 upstream) : MMP20 (32066 downstream)																							ccccccttctttccttccttcctt	0.069													4	3	---	---	---	---	
CNTN1	1272	broad.mit.edu	37	12	41359801	41359802	+	Intron	DEL	CA	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41359801_41359802delCA	uc001rmm.1	+						CNTN1_uc009zjy.1_Intron|CNTN1_uc001rmn.1_Intron|CNTN1_uc001rmo.2_Intron	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CTCATcacaccacacacacaca	0.257													4	2	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51893409	51893410	+	Intron	DEL	AC	-	-	rs144447102		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51893409_51893410delAC	uc001rys.1	+						SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryt.1_5'Flank	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		ctataattctacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	65527520	65527523	+	IGR	DEL	GGAA	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65527520_65527523delGGAA								WIF1 (12404 upstream) : LEMD3 (35848 downstream)																							ATAGAGCTGTggaaggaaggaagg	0.181													4	2	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66957859	66957860	+	Intron	INS	-	TT	TT	rs146009716	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66957859_66957860insTT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GGTTTCTTCTCTGTCTTTTTCA	0.277													3	4	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88447356	88447356	+	Intron	DEL	A	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88447356delA	uc001tar.2	-						CEP290_uc001taq.2_Intron|uc001tas.2_5'Flank	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						AATCTGAGCCAAAAAAAAAAA	0.338													6	3	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118517627	118517630	+	Intron	DEL	TTTC	-	-	rs66686401		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517627_118517630delTTTC	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						CACCTTTGCAtttctttctttctt	0.221													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19265910	19265910	+	IGR	DEL	G	-	-	rs61185882		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19265910delG								None (None upstream) : LOC284232 (142633 downstream)																							aaggaaggaagaaagaaagaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21835723	21835728	+	IGR	DEL	GGCGAG	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21835723_21835728delGGCGAG								MRP63 (82505 upstream) : ZDHHC20 (114782 downstream)																							GATGGACTGAGGCGAGGGGTGGGACT	0.646													4	3	---	---	---	---	
CPB2	1361	broad.mit.edu	37	13	46641325	46641325	+	Intron	DEL	A	-	-	rs66903637		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46641325delA	uc001vaw.2	-						uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Intron	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a						blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		aataaaagttaaaaaaaatta	0.159													7	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57511137	57511140	+	IGR	DEL	AAGA	-	-	rs12895005	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57511137_57511140delAAGA								OTX2 (233953 upstream) : EXOC5 (158056 downstream)																							ggaaggaaggaagaaaggaaggaa	0.118													4	4	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92537088	92537089	+	Intron	INS	-	T	T			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92537088_92537089insT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		ccacatctagcTTTTTTTTTTT	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95121832	95121845	+	IGR	DEL	CACGCGCGCACACA	-	-	rs76231258	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95121832_95121845delCACGCGCGCACACA								SERPINA13 (8502 upstream) : GSC (112716 downstream)																							CACGCGCGCGCACGCGCGcacacacacacacaca	0.107													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106877447	106877448	+	Intron	INS	-	TGATCT	TGATCT	rs144817208	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877447_106877448insTGATCT	uc010tyt.1	-						uc010tyu.1_In_Frame_Ins_p.168_169insRS					Parts of antibodies, mostly variable regions.												0						GAGGGAGACGACTGAGAAGATG	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24729061	24729062	+	IGR	DEL	AC	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24729061_24729062delAC								PWRN2 (313966 upstream) : PWRN1 (49777 downstream)																							atacatacatacacacacacac	0.000													2	4	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43269881	43269881	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43269881delT	uc001zqq.2	-							NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATTGAAGTGCTTTTTTTTTTT	0.333													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53409565	53409566	+	IGR	INS	-	T	T	rs8039879		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53409565_53409566insT								ONECUT1 (327356 upstream) : WDR72 (396372 downstream)																							tccttccttcctttccttcctt	0.000													6	4	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15102453	15102453	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15102453delT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AAATTCACCCTTTTTTTTTTT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26821345	26821352	+	IGR	DEL	GAAGGAAT	-	-	rs13334453	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26821345_26821352delGAAGGAAT								HS3ST4 (672337 upstream) : C16orf82 (256867 downstream)																							aggaaggaaggaaggaatgaaggaagga	0.000													4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482166	59482166	+	Intron	DEL	C	-	-	rs66504335		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482166delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R353fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						AGGGAGGTGGCGGCGGGGGGT	0.706													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5890005	5890005	+	IGR	DEL	A	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5890005delA								EPB41L3 (259363 upstream) : TMEM200C (179 downstream)																							TAGTTTGCTTAAAAAAAAAAA	0.338													6	4	---	---	---	---	
RALBP1	10928	broad.mit.edu	37	18	9513340	9513340	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9513340delT	uc002kob.2	+						RALBP1_uc002koc.2_Intron	NM_006788	NP_006779	Q15311	RBP1_HUMAN	ralA binding protein 1						chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1						tttattttactttattttatt	0.129													6	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	9961494	9961495	+	IGR	INS	-	GT	GT	rs146734978	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9961494_9961495insGT								VAPA (1477 upstream) : APCDD1 (493130 downstream)																							TGCGCTGCAGAgtgtgtgtgtg	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15198505	15198508	+	IGR	DEL	TTTG	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15198505_15198508delTTTG								ANKRD30B (345768 upstream) : LOC644669 (115047 downstream)																							CACATTCTGATTTGTTTTTTGTAT	0.358													7	4	---	---	---	---	
LMAN1	3998	broad.mit.edu	37	18	57026573	57026574	+	5'Flank	INS	-	C	C	rs140141851	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57026573_57026574insC	uc002lhz.2	-						LMAN1_uc010xek.1_5'Flank	NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor						blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	AGCCCGGGGGACCCCCAAGGGC	0.752													4	5	---	---	---	---	
TSPAN16	26526	broad.mit.edu	37	19	11422999	11423000	+	Intron	DEL	AA	-	-	rs149530459		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11422999_11423000delAA	uc002mqv.1	+						TSPAN16_uc002mqu.1_Intron|uc002mqw.1_Intron	NM_012466	NP_036598	Q9UKR8	TSN16_HUMAN	transmembrane 4 superfamily member 16							integral to membrane				skin(1)	1						gaacaaaactaaaaaaaAAAAA	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15593365	15593366	+	IGR	INS	-	TC	TC			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15593365_15593366insTC								PGLYRP2 (3050 upstream) : CYP4F22 (25970 downstream)																							ctttctttctttctttctttct	0.000													3	3	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39614497	39614500	+	5'Flank	DEL	GAAG	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39614497_39614500delGAAG	uc002okj.1	+						PAK4_uc002okl.1_5'Flank|PAK4_uc002okn.1_5'Flank|PAK4_uc002okm.1_5'Flank|PAK4_uc002oko.1_5'Flank|PAK4_uc002okp.1_5'Flank	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			aggaaagaaagaaggaaggaagga	0.000													4	4	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991061	39991061	+	Intron	DEL	C	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991061delC	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			gtgagattctCCCCCCCCCCC	0.303													4	2	---	---	---	---	
TULP2	7288	broad.mit.edu	37	19	49384467	49384468	+	Intron	DEL	TC	-	-	rs111886033		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384467_49384468delTC	uc002pkz.2	-							NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		tttttttttttctttttttttt	0.203													9	10	---	---	---	---	
ISOC2	79763	broad.mit.edu	37	19	55964546	55964547	+	3'UTR	INS	-	C	C	rs139098245	by1000genomes	TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55964546_55964547insC	uc002qlb.2	-	6					ISOC2_uc002qla.2_3'UTR|ISOC2_uc002qlc.2_3'UTR	NM_001136201	NP_001129673	Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2 isoform 1						protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding			ovary(1)	1	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		GCAGCACCCTGCCCCCCCCACA	0.639													4	3	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													4	3	---	---	---	---	
RPN2	6185	broad.mit.edu	37	20	35817727	35817730	+	Intron	DEL	TGTG	-	-	rs6094081		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35817727_35817730delTGTG	uc002xgp.2	+						RPN2_uc002xgo.3_Intron|RPN2_uc010gfw.2_Intron|RPN2_uc002xgq.2_Intron	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				tgtgtgtgtatgtgtgtgtgtgtg	0.157													4	2	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190971	62190974	+	Intron	DEL	AGTC	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190971_62190974delAGTC	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			gtcagatgggagtcagtcagagtc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	34386886	34386886	+	IGR	DEL	C	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34386886delC								C21orf62 (200833 upstream) : OLIG2 (11353 downstream)																							ccctctacttccccctcttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35370733	35370734	+	IGR	DEL	AC	-	-	rs33938354		TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35370733_35370734delAC								None (None upstream) : ISX (91395 downstream)																							TCCCTGacatacacacacacac	0.337													4	2	---	---	---	---	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Translation_Start_Site	DEL	TCCTCGAGGCAGCC	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	uc010njt.2	-	1						NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11							cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.584										HNSCC(48;0.14)			3	4	---	---	---	---	
KDM5C	8242	broad.mit.edu	37	X	53253992	53253992	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53253992delG	uc004drz.2	-	1	613	c.80delC	c.(79-81)CCTfs	p.P27fs	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Frame_Shift_Del_p.P27fs|KDM5C_uc004dsa.2_Frame_Shift_Del_p.P27fs	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	27	JmjN.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GTAGCCAAGAGGGTCTCGGAA	0.667			N|F|S		clear cell renal carcinoma								14	32	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	122935586	122935586	+	IGR	DEL	A	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122935586delA								THOC2 (68682 upstream) : XIAP (58076 downstream)																							ggaaggaaggaaggaagaaag	0.134													4	2	---	---	---	---	
OCRL	4952	broad.mit.edu	37	X	128674642	128674642	+	Intron	DEL	T	-	-			TCGA-BP-5202-01A-02D-1429-08	TCGA-BP-5202-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128674642delT	uc004euq.2	+						OCRL_uc004eur.2_Intron	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						gggggggggGTGGAAGACCCC	0.537													10	5	---	---	---	---	
