Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MACF1	23499	broad.mit.edu	37	1	39893209	39893209	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39893209A>T	uc010oiu.1	+	26	11850	c.11719A>T	c.(11719-11721)ACA>TCA	p.T3907S	MACF1_uc010ois.1_Missense_Mutation_p.T3405S|MACF1_uc001cda.1_Missense_Mutation_p.T3292S|MACF1_uc001cdc.1_Missense_Mutation_p.T2471S	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	5472	Spectrin 8.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTATCTGTCACAGAGAAAAA	0.438													44	82	---	---	---	---	PASS
RPL5	6125	broad.mit.edu	37	1	93302909	93302909	+	Intron	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93302909G>T	uc001doz.2	+						FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_Intron|RPL5_uc001dpb.2_Intron|RPL5_uc001dpd.2_Intron|SNORD21_uc001dpe.2_RNA	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		CATATGATGCGATAATTGTTT	0.353													4	67	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94514511	94514511	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94514511A>C	uc001dqh.2	-	18	2760	c.2656T>G	c.(2656-2658)TGT>GGT	p.C886G	ABCA4_uc010otn.1_Missense_Mutation_p.C812G	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	886	Cytoplasmic.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTGGTTGAACACCCTGCACCA	0.532													18	149	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109794802	109794802	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109794802A>T	uc001dxa.3	+	1	2162	c.2101A>T	c.(2101-2103)AAT>TAT	p.N701Y		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	701	Cadherin 5.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GATTGTGGTGAATGTCACCGA	0.567													6	7	---	---	---	---	PASS
VPS72	6944	broad.mit.edu	37	1	151150332	151150332	+	Intron	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151150332G>A	uc001exe.1	-						TMOD4_uc001exd.2_5'Flank|TMOD4_uc001exc.3_5'Flank|TMOD4_uc010pct.1_5'Flank|VPS72_uc001exf.1_3'UTR	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1						chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			aaaaaaaaaagaaaaagaaaT	0.199													4	20	---	---	---	---	PASS
NPR1	4881	broad.mit.edu	37	1	153659728	153659728	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153659728C>T	uc001fcs.3	+	13	2409	c.1988C>T	c.(1987-1989)TCA>TTA	p.S663L	NPR1_uc010pdz.1_Missense_Mutation_p.S409L|NPR1_uc010pea.1_Missense_Mutation_p.S141L	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	663	Cytoplasmic (Potential).|Protein kinase.				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	AACCTCAAGTCATCCAACTGC	0.542													15	58	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154573797	154573797	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154573797G>A	uc001ffh.2	-	2	1521	c.1321C>T	c.(1321-1323)CCC>TCC	p.P441S	ADAR_uc001ffj.2_Missense_Mutation_p.P441S|ADAR_uc001ffi.2_Missense_Mutation_p.P441S|ADAR_uc001ffk.2_Missense_Mutation_p.P146S|ADAR_uc001ffl.1_Missense_Mutation_p.P146S	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	441					adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GCTTTTGAGGGGCCATTGTAA	0.483													4	149	---	---	---	---	PASS
HDGF	3068	broad.mit.edu	37	1	156713991	156713991	+	Silent	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156713991T>C	uc001fpy.3	-	4	775	c.453A>G	c.(451-453)AAA>AAG	p.K151K	HDGF_uc009wsd.2_Silent_p.K119K|HDGF_uc001fpz.3_Silent_p.K144K|HDGF_uc009wse.2_Silent_p.K167K|HDGF_uc010phr.1_Silent_p.K174K|HDGF_uc009wsf.2_Silent_p.K119K|HDGF_uc009wsg.2_Silent_p.K151K	NM_004494	NP_004485	P51858	HDGF_HUMAN	hepatoma-derived growth factor isoform a	151	Glu-rich.				cell proliferation|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	DNA binding|growth factor activity|heparin binding|nucleotide binding			lung(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		TCAACGCTCCTTTCTCGTTCT	0.597													5	71	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186332475	186332475	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186332475T>C	uc001grv.2	-	5	827	c.530A>G	c.(529-531)AAG>AGG	p.K177R	TPR_uc010pop.1_Missense_Mutation_p.K253R	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	177	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GGTACTTGCCTTAACAGAAAC	0.299			T	NTRK1	papillary thyroid								8	618	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200578052	200578052	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200578052C>T	uc010ppk.1	-	5	1899	c.1460G>A	c.(1459-1461)AGC>AAC	p.S487N	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	487	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						AATGTGATAGCTGACCTAGTA	0.239													4	226	---	---	---	---	PASS
AIDA	64853	broad.mit.edu	37	1	222860966	222860966	+	Silent	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222860966G>A	uc001hnn.2	-	5	529	c.324C>T	c.(322-324)TTC>TTT	p.F108F	AIDA_uc001hno.2_RNA|AIDA_uc010pus.1_Silent_p.F84F	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	108					dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						CATCAAATGGGAATTCTTTAT	0.254													14	181	---	---	---	---	PASS
DEGS1	8560	broad.mit.edu	37	1	224363555	224363555	+	5'UTR	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224363555G>A	uc001hoi.2	+	1						NM_144780	NP_659004	O15121	DEGS1_HUMAN	degenerative spermatocyte homolog 1, lipid						sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		AGAGCCGGGAGCACAACAGCC	0.582													4	4	---	---	---	---	PASS
FH	2271	broad.mit.edu	37	1	241661202	241661202	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241661202T>C	uc001hyx.2	-	10	1491	c.1459A>G	c.(1459-1461)ATC>GTC	p.I487V		NM_000143	NP_000134	P07954	FUMH_HUMAN	fumarate hydratase precursor	487					fumarate metabolic process|tricarboxylic acid cycle	cell junction|mitochondrial matrix|tricarboxylic acid cycle enzyme complex	fumarate hydratase activity			lung(3)|ovary(1)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		CCAAGTTCGATAGCAGTTTCC	0.368			Mis|N|F			lieomyomatosis|renal			Hereditary_Leiomyomatosis_and_Renal_Cell_Cancer				6	391	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21256255	21256255	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21256255A>G	uc002red.2	-	9	1168	c.1040T>C	c.(1039-1041)CTC>CCC	p.L347P		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	347	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTTATTGAAGAGATTAGCTCT	0.448													11	295	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26717855	26717855	+	Silent	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26717855C>T	uc002rhk.2	-	9	979	c.852G>A	c.(850-852)AAG>AAA	p.K284K		NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	284	Cytoplasmic (Potential).|C2 1.				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGATGTGTACTTCTTGTCGT	0.587													3	11	---	---	---	---	PASS
C2orf3	6936	broad.mit.edu	37	2	75893178	75893178	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75893178A>G	uc002sno.2	-	16	2235	c.2105T>C	c.(2104-2106)GTA>GCA	p.V702A	MRPL19_uc002snm.1_Intron|C2orf3_uc010ffs.2_Missense_Mutation_p.V264A|C2orf3_uc002snn.2_Missense_Mutation_p.V533A|C2orf3_uc010fft.2_Missense_Mutation_p.V377A	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936	702					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						ACATGCTGCTACCTGTTAATC	0.284													102	225	---	---	---	---	PASS
REG1P	5969	broad.mit.edu	37	2	79363961	79363961	+	RNA	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79363961G>A	uc002soa.1	-	4		c.353C>T			REG1P_uc002sob.1_RNA|REG1P_uc002soc.1_RNA					Homo sapiens mRNA for Reg-related sequence derived peptide-1, complete cds.												0						TATCCTTGGTGCCACTCTCTT	0.522													3	21	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100915397	100915397	+	Silent	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100915397A>G	uc002tal.3	-	7	2017	c.1377T>C	c.(1375-1377)CCT>CCC	p.P459P	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	459	RING-type.|TPR 6.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						GCGTAGTGACAGGTTCAAAGA	0.453													6	128	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187464952	187464952	+	Intron	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187464952C>A	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_5'UTR	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		cctggagattcaattctttct	0.144													7	122	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	201997729	201997729	+	Intron	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201997729A>G	uc002uxb.3	+						CFLAR_uc002uwy.2_Intron|CFLAR_uc002uwz.2_Intron|CFLAR_uc002uxa.3_Intron|CFLAR_uc010zhk.1_Intron|CFLAR_uc002uxc.3_Intron|CFLAR_uc010zhl.1_Intron|CFLAR_uc010fsw.1_Intron|CFLAR_uc002uxd.3_Intron|CFLAR_uc002uxe.2_Intron|CFLAR_uc002uxf.2_Intron|CFLAR_uc010fsy.2_Intron|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_5'UTR|CFLAR_uc010fsz.2_5'Flank	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						TGAATTAACTAAATGAACTTG	0.408													17	231	---	---	---	---	PASS
C2orf80	389073	broad.mit.edu	37	2	209051784	209051784	+	5'UTR	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209051784G>A	uc002vcr.2	-	2						NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073											skin(1)	1						TGAGTCTAGAGGCTACAGCAG	0.473													44	104	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47144880	47144880	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47144880G>A	uc003cqs.2	-	7	4926	c.4873C>T	c.(4873-4875)CGT>TGT	p.R1625C	SETD2_uc003cqv.2_Missense_Mutation_p.R1692C	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1625	SET.			R->H: Loss of methyltransferase activity.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTCATGAAACGAGAGCAATTT	0.348			N|F|S|Mis		clear cell renal carcinoma								139	154	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48682160	48682160	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48682160G>T	uc003cul.2	-	26	8355	c.8074C>A	c.(8074-8076)CTG>ATG	p.L2692M	CELSR3_uc003cuf.1_Missense_Mutation_p.L2789M|CELSR3_uc010hkf.2_5'Flank|CELSR3_uc010hkg.2_Missense_Mutation_p.L675M	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2692	Helical; Name=5; (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACTATGACCAGGACAACAGGG	0.617													3	18	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52712615	52712615	+	Splice_Site	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52712615T>C	uc003des.2	-	2	151	c.139_splice	c.e2-1	p.I47_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.I47_splice|PBRM1_uc003der.2_Splice_Site_p.I47_splice|PBRM1_uc003det.2_Splice_Site_p.I47_splice|PBRM1_uc003deu.2_Splice_Site_p.I47_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.I47_splice|PBRM1_uc010hmk.1_Splice_Site_p.I47_splice|PBRM1_uc003dey.2_Splice_Site_p.I47_splice|PBRM1_uc003dez.1_Splice_Site_p.I47_splice|PBRM1_uc003dfb.1_Splice_Site	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CACGGCAATCTACACATTAGC	0.393			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								43	52	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151100523	151100523	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151100523G>T	uc003eyp.2	+	31	4603	c.4565G>T	c.(4564-4566)CGC>CTC	p.R1522L	MED12L_uc011bnz.1_Missense_Mutation_p.R1382L|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Missense_Mutation_p.R685L	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1522					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTGCAACTCCGCCTAAATTTG	0.388													12	103	---	---	---	---	PASS
LXN	56925	broad.mit.edu	37	3	158390257	158390257	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158390257G>A	uc003fch.2	-	1	226	c.11C>T	c.(10-12)CCG>CTG	p.P4L	GFM1_uc003fcd.2_Intron|GFM1_uc003fce.2_Intron|GFM1_uc003fcf.2_Intron|GFM1_uc003fcg.2_Intron|LXN_uc011bov.1_Missense_Mutation_p.P4L	NM_020169	NP_064554	Q9BS40	LXN_HUMAN	latexin	4						cytoplasm	metalloendopeptidase inhibitor activity|protein binding				0			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GTTGGTCGGCGGGATTTCCAT	0.617											OREG0015899	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	27	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164764690	164764690	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164764690C>A	uc003fei.2	-	16	1888	c.1826G>T	c.(1825-1827)TGG>TTG	p.W609L		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	609	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	CATTTGTTCCCATGAAGCAGT	0.393										HNSCC(35;0.089)			6	235	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506597	195506597	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506597G>A	uc011bto.1	-	3	11930	c.11470C>T	c.(11470-11472)CCT>TCT	p.P3824S	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGTGTCA	0.602													3	5	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195511396	195511396	+	Missense_Mutation	SNP	G	T	T	rs147224082	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195511396G>T	uc011bto.1	-	2	7515	c.7055C>A	c.(7054-7056)CCT>CAT	p.P2352H	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACATGAAGAGGGGTGGCGTG	0.582													4	14	---	---	---	---	PASS
CCNG2	901	broad.mit.edu	37	4	78079756	78079756	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78079756A>G	uc003hkq.3	+	2	374	c.71A>G	c.(70-72)TAC>TGC	p.Y24C	CCNG2_uc003hkn.3_Missense_Mutation_p.Y24C|CCNG2_uc011ccc.1_Missense_Mutation_p.Y24C|CCNG2_uc003hkp.3_Missense_Mutation_p.Y24C	NM_004354	NP_004345	Q16589	CCNG2_HUMAN	cyclin G2	24					cell cycle checkpoint|cell division|mitosis	cytoplasm				ovary(2)|lung(1)	3						TTGAACGTCTACCTGGAACAA	0.483													5	83	---	---	---	---	PASS
MRPS18C	51023	broad.mit.edu	37	4	84379580	84379580	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84379580C>A	uc003hor.3	+	3	345	c.232C>A	c.(232-234)CAG>AAG	p.Q78K	HELQ_uc003hom.2_5'Flank|HELQ_uc010ikb.2_5'Flank|HELQ_uc003hol.3_5'Flank|HELQ_uc010ikc.2_5'Flank|HELQ_uc003hon.1_5'Flank|HELQ_uc003hoo.1_5'Flank|HELQ_uc003hop.1_5'Flank|HELQ_uc003hoq.1_5'Flank|MRPS18C_uc011ccu.1_Missense_Mutation_p.Q78K	NM_016067	NP_057151	Q9Y3D5	RT18C_HUMAN	mitochondrial ribosomal protein S18C precursor	78					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0		Hepatocellular(203;0.114)				TAAGAATGTACAGGTGAGATC	0.338													133	361	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	106601204	106601204	+	3'UTR	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106601204G>T	uc003hxv.1	+	5										Homo sapiens cDNA FLJ43963 fis, clone TESTI4016882.																		TCGTCTCACAGAAAATAATAG	0.393													10	84	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160279330	160279330	+	3'UTR	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160279330A>G	uc003iqg.3	+	24						NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2						cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GCCACCTGAAAGGAGAGCACA	0.483													16	120	---	---	---	---	PASS
EDIL3	10085	broad.mit.edu	37	5	83402565	83402565	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83402565C>A	uc003kio.1	-	6	972	c.553G>T	c.(553-555)GGA>TGA	p.G185*	EDIL3_uc003kip.1_Nonsense_Mutation_p.G175*	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like	185	F5/8 type C 1.				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TTTTGGAGTCCAAAAAGAGCT	0.448													122	279	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89940562	89940562	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89940562A>G	uc003kju.2	+	15	2870	c.2774A>G	c.(2773-2775)GAT>GGT	p.D925G	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	925	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AACTTTGGTGATGTTAGTGTA	0.343													10	690	---	---	---	---	PASS
PJA2	9867	broad.mit.edu	37	5	108719205	108719205	+	5'UTR	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108719205C>A	uc003kos.3	-	2						NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		acactatggacaagccgcaga	0.000													11	52	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126774247	126774247	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126774247T>C	uc003kuh.3	+	18	2583	c.2221T>C	c.(2221-2223)TAC>CAC	p.Y741H	MEGF10_uc003kui.3_Missense_Mutation_p.Y741H	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor	741	Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.|EGF-like 13.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GACAGGGCTCTACTGCACTCA	0.562													9	19	---	---	---	---	PASS
FAM13B	51306	broad.mit.edu	37	5	137323191	137323191	+	Silent	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137323191T>C	uc003lbz.2	-	9	1539	c.1005A>G	c.(1003-1005)GAA>GAG	p.E335E	FAM13B_uc003lcb.2_Silent_p.E217E|FAM13B_uc003lca.2_Silent_p.E335E	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	335					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						TACTTTCTGCTTCATTATTAC	0.323													7	450	---	---	---	---	PASS
C5orf54	63920	broad.mit.edu	37	5	159822266	159822266	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159822266T>C	uc003lye.1	-	2	696	c.232A>G	c.(232-234)ACC>GCC	p.T78A	C5orf54_uc003lyf.1_Missense_Mutation_p.T78A	NM_022090	NP_071373	Q8IZ13	CE054_HUMAN	transposon-derived Buster3 transposase-like	78										pancreas(1)	1						gctttcaaggtttcactctga	0.000													6	143	---	---	---	---	PASS
FAM153B	202134	broad.mit.edu	37	5	175528119	175528119	+	Missense_Mutation	SNP	T	C	C	rs148622492	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175528119T>C	uc003mdk.2	+	11	689	c.632T>C	c.(631-633)ATG>ACG	p.M211T		NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134	211										ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		GAAGTTCACATGGTAAAGTCG	0.433													6	262	---	---	---	---	PASS
FBXO9	26268	broad.mit.edu	37	6	52958266	52958266	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52958266A>G	uc003pbo.2	+	10	947	c.896A>G	c.(895-897)TAC>TGC	p.Y299C	FBXO9_uc003pbk.2_Missense_Mutation_p.Y255C|FBXO9_uc003pbl.2_Missense_Mutation_p.Y289C|FBXO9_uc003pbm.2_Missense_Mutation_p.Y179C|FBXO9_uc003pbn.2_Missense_Mutation_p.Y179C	NM_012347	NP_036479	Q9UK97	FBX9_HUMAN	F-box only protein 9 isoform 1	299						ubiquitin ligase complex	ubiquitin-protein ligase activity			pancreas(1)	1	Lung NSC(77;0.103)					TTACATAGGTACATAAGATTC	0.388													5	296	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55933843	55933843	+	Splice_Site	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55933843C>A	uc003pcs.2	-	22	2323	c.2091_splice	c.e22+1	p.K697_splice	COL21A1_uc010jzz.2_Splice_Site_p.K82_splice|COL21A1_uc011dxg.1_Splice_Site_p.K82_splice|COL21A1_uc011dxh.1_Splice_Site_p.K82_splice|COL21A1_uc003pcr.2_Splice_Site_p.R55_splice	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCAATGCATACCTTTTTTCCT	0.383													48	190	---	---	---	---	PASS
TTK	7272	broad.mit.edu	37	6	80744856	80744856	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80744856A>C	uc003pjc.2	+	15	1843	c.1769A>C	c.(1768-1770)GAT>GCT	p.D590A	TTK_uc003pjb.3_Missense_Mutation_p.D589A	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	590	Protein kinase.				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		CGACTTTATGATTAGTAAGAA	0.269													111	175	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119295627	119295627	+	Silent	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119295627G>A	uc003pyj.2	-	14	3229	c.2881C>T	c.(2881-2883)CTA>TTA	p.L961L	FAM184A_uc003pyk.3_Intron|FAM184A_uc003pyl.3_Intron|FAM184A_uc003pyi.2_RNA	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	961										ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						TCCTTGAGTAGCTCGTTAGTC	0.348													6	728	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152565703	152565703	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152565703T>C	uc010kiw.2	-	106	20263	c.19661A>G	c.(19660-19662)CAG>CGG	p.Q6554R	SYNE1_uc010kiv.2_Missense_Mutation_p.Q1078R|SYNE1_uc003qos.3_Missense_Mutation_p.Q1078R|SYNE1_uc003qot.3_Missense_Mutation_p.Q6483R|SYNE1_uc003qou.3_Missense_Mutation_p.Q6554R	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6554	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATGGACGGCTGCTCGACCTG	0.453										HNSCC(10;0.0054)			62	125	---	---	---	---	PASS
TRIM50	135892	broad.mit.edu	37	7	72732707	72732707	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72732707T>A	uc010lbd.1	-	5	853	c.728A>T	c.(727-729)AAG>ATG	p.K243M	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Missense_Mutation_p.K243M|TRIM50_uc003txz.1_Splice_Site_p.F243_splice	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A	243						cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1						GGAGTGGAACTTCTGGAAGGC	0.602													84	195	---	---	---	---	PASS
POMZP3	22932	broad.mit.edu	37	7	76247559	76247559	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76247559G>T	uc003uft.2	-	4	1033	c.286C>A	c.(286-288)CCA>ACA	p.P96T	uc003ufs.1_Intron|POMZP3_uc003ufu.2_Missense_Mutation_p.P96T|POMZP3_uc003ufv.2_RNA|POMZP3_uc011kgm.1_RNA	NM_012230	NP_036362	Q6PJE2	POZP3_HUMAN	POMZP3 fusion protein isoform 1	96											0		Myeloproliferative disorder(862;0.204)				AGTGTATCTGGCCCGGGTCGA	0.473													7	75	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99912180	99912180	+	5'UTR	SNP	G	A	A	rs858635		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99912180G>A	uc003uug.1	+	1						NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3												0						CCAGCCCCCCGCGTAGGTCCC	0.577													5	59	---	---	---	---	PASS
RBM28	55131	broad.mit.edu	37	7	127954992	127954992	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127954992C>T	uc003vmp.2	-	17	1985	c.1870G>A	c.(1870-1872)GCT>ACT	p.A624T	RBM28_uc003vmo.2_Missense_Mutation_p.A166T|RBM28_uc011koj.1_Missense_Mutation_p.A483T	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	624					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						TGGTGTTGAGCTGCCTTCTGT	0.522													3	43	---	---	---	---	PASS
NOM1	64434	broad.mit.edu	37	7	156756569	156756569	+	Intron	SNP	G	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156756569G>C	uc003wmy.2	+						NOM1_uc010lqp.1_3'UTR	NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1						RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		GGAGACATGCGTATGACTTGT	0.507													4	49	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30700999	30700999	+	Silent	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30700999A>G	uc003xil.2	-	1	5535	c.5535T>C	c.(5533-5535)GTT>GTC	p.V1845V		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1845										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GATACGAATGAACTTTAGGAG	0.353													5	139	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38913266	38913266	+	Silent	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38913266T>C	uc003xmr.2	+	14	1644	c.1566T>C	c.(1564-1566)GCT>GCC	p.A522A	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xms.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	522	Cys-rich.|Extracellular (Potential).				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			ATTATGATGCTCAATGTCAAG	0.313													6	271	---	---	---	---	PASS
SDR16C5	195814	broad.mit.edu	37	8	57228627	57228627	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57228627C>G	uc003xsy.1	-	2	918	c.280G>C	c.(280-282)GCC>CCC	p.A94P	SDR16C5_uc010lyk.1_Missense_Mutation_p.A94P|SDR16C5_uc010lyl.1_Missense_Mutation_p.A94P	NM_138969	NP_620419	Q8N3Y7	RDHE2_HUMAN	epidermal retinal dehydrogenase 2	94					detection of light stimulus involved in visual perception|keratinocyte proliferation|retinal metabolic process|retinol metabolic process	endoplasmic reticulum membrane|integral to membrane|integral to membrane of membrane fraction	binding|retinol dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						CAGGTATAGGCGTGCACTCTT	0.468													8	30	---	---	---	---	PASS
TP53INP1	94241	broad.mit.edu	37	8	95952145	95952145	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95952145G>T	uc003yhg.2	-	3	800	c.416C>A	c.(415-417)CCT>CAT	p.P139H	C8orf38_uc003yhe.1_Intron|C8orf38_uc003yhf.2_Intron|TP53INP1_uc003yhh.2_Missense_Mutation_p.P139H	NM_033285	NP_150601	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	139					apoptosis	PML body					0	Breast(36;8.75e-07)					ACTGAGACCAGGGCAGGAGTT	0.483													23	80	---	---	---	---	PASS
C8orf37	157657	broad.mit.edu	37	8	96272706	96272706	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96272706G>T	uc003yho.1	-	3	318	c.298C>A	c.(298-300)CTT>ATT	p.L100I		NM_177965	NP_808880	Q96NL8	CH037_HUMAN	hypothetical protein LOC157657	100											0	Breast(36;3.41e-05)					CTTTTACCAAGGCCTTCAATG	0.328													82	302	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134107431	134107431	+	Silent	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134107431C>A	uc003ytw.2	+	42	7424	c.7383C>A	c.(7381-7383)GTC>GTA	p.V2461V	TG_uc010mdw.2_Silent_p.V1220V|TG_uc011ljb.1_Silent_p.V830V|TG_uc011ljc.1_Silent_p.V594V|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2461					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTGCCAATGTCCTCAATGATG	0.453													5	18	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144991673	144991673	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144991673C>A	uc003zaf.1	-	32	12897	c.12727G>T	c.(12727-12729)GAG>TAG	p.E4243*	PLEC_uc003zab.1_Nonsense_Mutation_p.E4106*|PLEC_uc003zac.1_Nonsense_Mutation_p.E4110*|PLEC_uc003zad.2_Nonsense_Mutation_p.E4106*|PLEC_uc003zae.1_Nonsense_Mutation_p.E4074*|PLEC_uc003zag.1_Nonsense_Mutation_p.E4084*|PLEC_uc003zah.2_Nonsense_Mutation_p.E4092*|PLEC_uc003zaj.2_Nonsense_Mutation_p.E4133*	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4243	Plectin 26.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						ATACAACGCTCCATCAGCTGC	0.597													3	8	---	---	---	---	PASS
PTPLAD2	401494	broad.mit.edu	37	9	21015933	21015933	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21015933A>G	uc010miq.1	-	4	393	c.347T>C	c.(346-348)GTT>GCT	p.V116A	PTPLAD2_uc003zoj.1_Missense_Mutation_p.V79A|PTPLAD2_uc010mir.1_Missense_Mutation_p.V116A	NM_001010915	NP_001010915	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain	116	Helical; (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity			skin(1)	1				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		GACGAATAAAACACACACCAC	0.363													7	369	---	---	---	---	PASS
MELK	9833	broad.mit.edu	37	9	36665559	36665559	+	Silent	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36665559T>C	uc003zzn.2	+	14	1527	c.1389T>C	c.(1387-1389)CGT>CGC	p.R463R	MELK_uc011lpm.1_Silent_p.R332R|MELK_uc011lpn.1_Silent_p.R422R|MELK_uc011lpo.1_Silent_p.R269R|MELK_uc010mll.2_Silent_p.R431R|MELK_uc011lpp.1_Silent_p.R415R|MELK_uc010mlm.2_Silent_p.R392R|MELK_uc011lpq.1_Silent_p.R269R|MELK_uc011lpr.1_Silent_p.R392R|MELK_uc011lps.1_Silent_p.R383R	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	463						cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CGCCAAATCGTTACACTACAC	0.358													5	112	---	---	---	---	PASS
RBM17	84991	broad.mit.edu	37	10	6150695	6150695	+	Silent	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6150695A>G	uc001ijb.2	+	6	778	c.552A>G	c.(550-552)AAA>AAG	p.K184K	RBM17_uc010qav.1_Silent_p.K184K	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	184					mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						TGGTAGAGAAAGACAAAGAGT	0.488											OREG0019990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	97	---	---	---	---	PASS
SUV39H2	79723	broad.mit.edu	37	10	14941677	14941677	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14941677A>G	uc001inh.2	+	3	865	c.809A>G	c.(808-810)AAT>AGT	p.N270S	SUV39H2_uc001ing.2_Missense_Mutation_p.N150S|SUV39H2_uc001ini.2_Missense_Mutation_p.N270S|SUV39H2_uc001inj.2_Missense_Mutation_p.N270S|DCLRE1C_uc010qbx.1_Intron	NM_024670	NP_078946	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2	330	SET.				cell cycle|cell differentiation|chromatin assembly or disassembly|chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|chromosome, centromeric region|nucleus	histone methyltransferase activity (H3-K9 specific)|protein binding|zinc ion binding			breast(2)|ovary(1)	3						CATTTTGTGAATCACAGCGTA	0.373													30	80	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	25010766	25010766	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25010766C>G	uc001isb.2	-	2	550	c.63G>C	c.(61-63)GAG>GAC	p.E21D	ARHGAP21_uc009xkl.1_Missense_Mutation_p.E21D|ARHGAP21_uc001isc.1_Missense_Mutation_p.E21D|ARHGAP21_uc001isd.1_Missense_Mutation_p.E21D	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	20					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						CCGCGCTTACCTCGCAGGCCT	0.597													6	4	---	---	---	---	PASS
RAB18	22931	broad.mit.edu	37	10	27822869	27822869	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27822869G>C	uc001itv.2	+	6	441	c.391G>C	c.(391-393)GTC>CTC	p.V131L	RAB18_uc001itw.2_Missense_Mutation_p.V160L|RAB18_uc010qdq.1_Intron|RAB18_uc010qdr.1_Missense_Mutation_p.V67L	NM_021252	NP_067075	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family	131					endocytosis|protein transport|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction	intracellular|plasma membrane	ATP binding|GTP binding|GTPase activity|transcription factor binding				0						AAATCGTGAAGTCGATAGAAA	0.328													184	333	---	---	---	---	PASS
ANUBL1	93550	broad.mit.edu	37	10	46121548	46121548	+	Missense_Mutation	SNP	C	T	T	rs149725835		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46121548C>T	uc001jcp.3	-	7	1965	c.1723G>A	c.(1723-1725)GGG>AGG	p.G575R	ANUBL1_uc001jcl.3_Missense_Mutation_p.G95R|ANUBL1_uc001jcm.3_Missense_Mutation_p.G575R|ANUBL1_uc009xmu.2_Missense_Mutation_p.G501R|ANUBL1_uc001jcn.3_Missense_Mutation_p.G501R|ANUBL1_uc001jco.3_Intron	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog	575							zinc ion binding				0						CTTGTGCTCCCGGCCAGTGAG	0.473													33	65	---	---	---	---	PASS
FAM21A	387680	broad.mit.edu	37	10	51829431	51829431	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51829431A>G	uc001jjb.2	+	3	333	c.251A>G	c.(250-252)AAT>AGT	p.N84S	uc001jiz.1_5'Flank|FAM21A_uc001jja.1_5'UTR|FAM21A_uc010qhi.1_Missense_Mutation_p.N84S|FAM21A_uc010qhj.1_Missense_Mutation_p.N84S	NM_001005751	NP_001005751	Q641Q2	FA21A_HUMAN	hypothetical protein LOC387680	84					retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						AATGTCTTCAATGACTTCCTT	0.368													95	302	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70411657	70411657	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70411657C>T	uc001jok.3	+	5	4836	c.4331C>T	c.(4330-4332)CCA>CTA	p.P1444L		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1444					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						GGGGCAGGACCAAGTGTTGCT	0.408													5	243	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72631655	72631655	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72631655T>C	uc001jrm.2	+	11	1193	c.971T>C	c.(970-972)GTC>GCC	p.V324A	SGPL1_uc009xqk.2_RNA	NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	324	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	TTCCTCATCGTCTTTATGGAG	0.448													35	69	---	---	---	---	PASS
OR4D6	219983	broad.mit.edu	37	11	59224939	59224939	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59224939G>T	uc010rku.1	+	1	506	c.506G>T	c.(505-507)TGT>TTT	p.C169F		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTCCCCTTCTGTGGCCCCAAC	0.498													4	134	---	---	---	---	PASS
VWCE	220001	broad.mit.edu	37	11	61048292	61048292	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61048292C>G	uc001nra.2	-	8	1482	c.1203G>C	c.(1201-1203)GAG>GAC	p.E401D	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	401	VWFC 1.					extracellular region	calcium ion binding			ovary(1)	1						AACACCCAGGCTCTGTCCAGC	0.642													6	8	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83544667	83544667	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83544667T>A	uc001paj.2	-	12	1700	c.1397A>T	c.(1396-1398)CAG>CTG	p.Q466L	DLG2_uc001pai.2_Missense_Mutation_p.Q363L|DLG2_uc010rsy.1_Missense_Mutation_p.Q433L|DLG2_uc010rsz.1_Missense_Mutation_p.Q466L|DLG2_uc010rta.1_Missense_Mutation_p.Q466L|DLG2_uc001pak.2_Missense_Mutation_p.Q571L|DLG2_uc010rtb.1_Missense_Mutation_p.Q433L|DLG2_uc001pal.1_Missense_Mutation_p.Q466L|DLG2_uc001pam.1_Missense_Mutation_p.Q505L	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	466	PDZ 3.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CGATAGGATCTGGTCTCCTCT	0.433													24	67	---	---	---	---	PASS
PHLDB1	23187	broad.mit.edu	37	11	118484605	118484605	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118484605G>T	uc001ptr.1	+	3	407	c.54G>T	c.(52-54)ATG>ATT	p.M18I	PHLDB1_uc010ryh.1_Missense_Mutation_p.M18I|PHLDB1_uc001pts.2_Missense_Mutation_p.M18I|PHLDB1_uc001ptt.2_Missense_Mutation_p.M18I|PHLDB1_uc001ptu.1_RNA	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	18											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCCAGACCATGGTGCAGGTGA	0.547													6	42	---	---	---	---	PASS
CDON	50937	broad.mit.edu	37	11	125891274	125891274	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125891274T>A	uc009zbw.2	-	3	346	c.218A>T	c.(217-219)GAA>GTA	p.E73V	CDON_uc001qdc.3_Missense_Mutation_p.E73V|CDON_uc001qdd.3_RNA|CDON_uc009zbx.2_Missense_Mutation_p.E73V	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member	73	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		CTTAACATGTTCCAGGTTTCC	0.453													37	101	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2794921	2794921	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2794921G>A	uc009zdu.1	+	47	6155	c.5842G>A	c.(5842-5844)GAA>AAA	p.E1948K	CACNA1C_uc009zdv.1_Missense_Mutation_p.E1862K|CACNA1C_uc001qkb.2_Missense_Mutation_p.E1865K|CACNA1C_uc001qkc.2_Missense_Mutation_p.E1884K|CACNA1C_uc001qke.2_Missense_Mutation_p.E1854K|CACNA1C_uc001qkf.2_Missense_Mutation_p.E1873K|CACNA1C_uc001qjz.2_Missense_Mutation_p.E1865K|CACNA1C_uc001qkd.2_Missense_Mutation_p.E1884K|CACNA1C_uc001qkg.2_Missense_Mutation_p.E1871K|CACNA1C_uc009zdw.1_Missense_Mutation_p.E1906K|CACNA1C_uc001qkh.2_Missense_Mutation_p.E1873K|CACNA1C_uc001qkl.2_Missense_Mutation_p.E1913K|CACNA1C_uc001qkn.2_Missense_Mutation_p.E1865K|CACNA1C_uc001qko.2_Missense_Mutation_p.E1885K|CACNA1C_uc001qkp.2_Missense_Mutation_p.E1865K|CACNA1C_uc001qkr.2_Missense_Mutation_p.E1882K|CACNA1C_uc001qku.2_Missense_Mutation_p.E1900K|CACNA1C_uc001qkq.2_Missense_Mutation_p.E1893K|CACNA1C_uc001qks.2_Missense_Mutation_p.E1865K|CACNA1C_uc001qkt.2_Missense_Mutation_p.E1884K|CACNA1C_uc001qki.1_Missense_Mutation_p.E1672K|CACNA1C_uc001qkj.1_Missense_Mutation_p.E1636K|CACNA1C_uc001qkk.1_Missense_Mutation_p.E1601K|CACNA1C_uc001qkm.1_Missense_Mutation_p.E1661K|CACNA1C_uc010sea.1_Missense_Mutation_p.E556K|uc001qkx.1_Intron|CACNA1C_uc001qky.1_Missense_Mutation_p.E183K	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1948	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CCAGGATGACGAAAATCGGCA	0.592													3	17	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6121277	6121277	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6121277C>T	uc001qnn.1	-	33	5890	c.5640G>A	c.(5638-5640)ATG>ATA	p.M1880I	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1880					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CATCCTCATCCATGCAAATCC	0.403													5	448	---	---	---	---	PASS
TAS2R8	50836	broad.mit.edu	37	12	10959049	10959049	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10959049T>C	uc010shh.1	-	1	531	c.531A>G	c.(529-531)ATA>ATG	p.I177M		NM_023918	NP_076407	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	177	Extracellular (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			ovary(2)	2						CAAAGTATGGTATTTTACTCA	0.338													213	351	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12397197	12397197	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12397197C>T	uc001rah.3	-	2	590	c.448G>A	c.(448-450)GGG>AGG	p.G150R	LRP6_uc010shl.1_Missense_Mutation_p.G150R	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	150	Extracellular (Potential).|LDL-receptor class B 3.|Beta-propeller 1.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				AAAACTTACCCACTTGAAGGA	0.388													3	37	---	---	---	---	PASS
HDAC7	51564	broad.mit.edu	37	12	48185052	48185052	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48185052C>G	uc010slo.1	-	16	2168	c.1973G>C	c.(1972-1974)GGT>GCT	p.G658A	HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_Missense_Mutation_p.G92A|HDAC7_uc001rqj.3_Missense_Mutation_p.G621A|HDAC7_uc001rqk.3_Missense_Mutation_p.G641A	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a	619	Histone deacetylase.				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		CCCAACCCCACCACAGGGCAG	0.652													7	12	---	---	---	---	PASS
XRCC6BP1	91419	broad.mit.edu	37	12	58339426	58339426	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58339426T>C	uc001sqp.2	+	2	243	c.203T>C	c.(202-204)CTT>CCT	p.L68P		NM_033276	NP_150592	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	68					double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1						TATGTCAAACTTCTGCTTGAT	0.333													9	732	---	---	---	---	PASS
PAH	5053	broad.mit.edu	37	12	103288680	103288680	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103288680A>T	uc001tjq.1	-	4	657	c.185T>A	c.(184-186)CTG>CAG	p.L62Q	PAH_uc010swc.1_Missense_Mutation_p.L62Q	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	62	ACT.				catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AATGTGGGTCAGGTTTACATC	0.438													5	233	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	117993020	117993020	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117993020T>C	uc001two.2	-	9	1440	c.1385A>G	c.(1384-1386)GAC>GGC	p.D462G		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	491					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GATGTGCAGGTCTGAATAGCG	0.542													7	196	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121779810	121779810	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121779810T>C	uc001uag.2	-	5	775	c.653A>G	c.(652-654)CAA>CGA	p.Q218R	ANAPC5_uc001uah.2_Missense_Mutation_p.Q119R	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a	218					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACATACCTGTTGAGAAAGAAA	0.378													6	303	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130847573	130847573	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130847573G>A	uc001uik.2	+	18	2169	c.2079G>A	c.(2077-2079)ATG>ATA	p.M693I	PIWIL1_uc001uij.1_Missense_Mutation_p.M693I	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	693	Piwi.				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ATGAGTACATGCCCAGCCGGA	0.498													22	36	---	---	---	---	PASS
CSNK1A1L	122011	broad.mit.edu	37	13	37679100	37679100	+	Silent	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37679100T>C	uc001uwm.1	-	1	702	c.294A>G	c.(292-294)GAA>GAG	p.E98E		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	98	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TAAAGAGGTCTTCGAGGCTGG	0.448													65	164	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861063	108861063	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861063C>T	uc001vqn.2	-	2	2827	c.2554G>A	c.(2554-2556)GTA>ATA	p.V852I	LIG4_uc001vqo.2_Missense_Mutation_p.V852I|LIG4_uc010agg.1_Missense_Mutation_p.V785I|LIG4_uc010agf.2_Missense_Mutation_p.V852I|LIG4_uc001vqp.2_Missense_Mutation_p.V852I	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	852	BRCT 2.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CAAGAAACTACTTTTGCTCCA	0.373								NHEJ					117	242	---	---	---	---	PASS
RTL1	388015	broad.mit.edu	37	14	101350371	101350371	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101350371C>T	uc010txj.1	-	1	814	c.755G>A	c.(754-756)TGG>TAG	p.W252*	MIR432_hsa-mir-432|MI0003133_5'Flank|uc010txk.1_5'Flank|MIR136_hsa-mir-136|MI0000475_5'Flank	NM_001134888	NP_001128360	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	252										pancreas(1)	1						AGCTTTGGCCCATTCTAATGC	0.532													10	58	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102452696	102452696	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102452696G>A	uc001yks.2	+	8	2298	c.2134G>A	c.(2134-2136)GGT>AGT	p.G712S		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	712	Interaction with DYNC1LI2 (By similarity).|Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCGCAACCTCGGTGTCTCGGG	0.527													5	13	---	---	---	---	PASS
SORD	6652	broad.mit.edu	37	15	45353179	45353179	+	Intron	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45353179G>T	uc001zul.3	+						SORD_uc010uel.1_Intron|SORD_uc001zum.3_Intron|SORD_uc010bdz.2_Splice_Site	NM_003104	NP_003095	Q00796	DHSO_HUMAN	sorbitol dehydrogenase						fructose biosynthetic process|glucose metabolic process|L-xylitol catabolic process|sorbitol catabolic process|sperm motility	cilium|extracellular space|flagellum|membrane fraction|mitochondrial membrane|soluble fraction	L-iditol 2-dehydrogenase activity|NAD binding|sugar binding|zinc ion binding				0		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)	NADH(DB00157)	TGTTTTCAAAGGTTGGAAAAC	0.517													10	12	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52098676	52098676	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52098676C>T	uc002abk.2	+	9	1200	c.979C>T	c.(979-981)CGA>TGA	p.R327*	TMOD2_uc002abl.3_Nonsense_Mutation_p.R291*|TMOD2_uc010bfb.2_Nonsense_Mutation_p.R283*	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	327					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		GCAAGGGCCACGAACAAGGGT	0.453													24	53	---	---	---	---	PASS
SLTM	79811	broad.mit.edu	37	15	59186051	59186051	+	Silent	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59186051C>A	uc002afp.2	-	12	1705	c.1617G>T	c.(1615-1617)TCG>TCT	p.S539S	SLTM_uc002afn.2_Intron|SLTM_uc002afo.2_Silent_p.S521S|SLTM_uc002afq.2_Silent_p.S108S|SLTM_uc010bgd.2_Silent_p.S108S	NM_024755	NP_079031	Q9NWH9	SLTM_HUMAN	modulator of estrogen induced transcription	539					apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)	1						TTTTTTTAATCGATTCTGATG	0.323													25	565	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88423631	88423631	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88423631C>T	uc002bme.1	-	18	2366	c.2204G>A	c.(2203-2205)CGC>CAC	p.R735H	NTRK3_uc002bmh.2_Missense_Mutation_p.R713H|NTRK3_uc002bmf.1_Missense_Mutation_p.R721H	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	735	Cytoplasmic (Potential).|Protein kinase.		R -> F (in a lung large cell carcinoma sample; somatic mutation; requires 2 nucleotide substitutions).		transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	p.R721H(1)|p.R721F(1)	ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGGCATCCAGCGAATGGGGAG	0.507			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			11	43	---	---	---	---	PASS
PGPEP1L	145814	broad.mit.edu	37	15	99512702	99512702	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99512702C>T	uc002bum.2	-	4	529	c.323G>A	c.(322-324)CGC>CAC	p.R108H	PGPEP1L_uc010bop.2_Missense_Mutation_p.R54H|PGPEP1L_uc002bun.2_RNA	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein	108					proteolysis		cysteine-type peptidase activity				0						CACAGCTACGCGCTTGCAGAC	0.622													7	9	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	715657	715657	+	Intron	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:715657G>T	uc002cii.1	+						WDR90_uc002cij.1_Intron|WDR90_uc002cil.1_Intron|WDR90_uc002cin.1_Intron|WDR90_uc010uul.1_Missense_Mutation_p.Q29H|WDR90_uc002cio.1_Missense_Mutation_p.Q29H|WDR90_uc010bqx.1_Missense_Mutation_p.Q29H|RHOT2_uc010uum.1_5'Flank|RHOT2_uc002cip.2_5'Flank|RHOT2_uc002ciq.2_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90											ovary(1)	1		Hepatocellular(780;0.0218)				AACACCCCCAGCCTAGCTACG	0.662													3	1	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15112697	15112697	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15112697A>G	uc002dda.3	+	12	1188	c.964A>G	c.(964-966)ACT>GCT	p.T322A	PDXDC1_uc010uzl.1_Missense_Mutation_p.T307A|PDXDC1_uc010uzm.1_Missense_Mutation_p.T231A|PDXDC1_uc002dcz.2_Missense_Mutation_p.T299A|PDXDC1_uc002ddb.3_Missense_Mutation_p.T295A|PDXDC1_uc010uzn.1_Missense_Mutation_p.T294A|PDXDC1_uc002ddc.2_Missense_Mutation_p.T322A	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	322					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	GCTTTTTTAGACTTTAGTTGC	0.318													9	368	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18820753	18820753	+	3'UTR	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18820753G>A	uc002dfm.2	-	63					SMG1_uc010bwb.2_3'UTR|SMG1_uc010bwa.2_3'UTR	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CTAGTGCACCGAGATTTCCTA	0.557													11	223	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20451155	20451155	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20451155T>C	uc002dhe.2	+	13	1717	c.1570T>C	c.(1570-1572)TAC>CAC	p.Y524H		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	524					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						TACTCCAGCCTACTCCTCTCA	0.463													49	168	---	---	---	---	PASS
XPO6	23214	broad.mit.edu	37	16	28109748	28109748	+	3'UTR	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28109748G>T	uc002dpa.1	-	24					XPO6_uc002dpb.1_3'UTR|XPO6_uc010vcp.1_3'UTR	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						TGCTTGCGGTGGGAGAAGCCA	0.647													2	0	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66950224	66950224	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66950224C>T	uc002eql.2	-	4	311	c.238G>A	c.(238-240)GTG>ATG	p.V80M	CDH16_uc010cdy.2_Missense_Mutation_p.V80M|CDH16_uc002eqm.2_Missense_Mutation_p.V80M	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	80	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GCCCTGGTCACCAGCAGGAAG	0.627													4	10	---	---	---	---	PASS
PMFBP1	83449	broad.mit.edu	37	16	72158692	72158692	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72158692C>A	uc002fcc.3	-	17	2750	c.2578G>T	c.(2578-2580)GAG>TAG	p.E860*	PMFBP1_uc002fcd.2_Nonsense_Mutation_p.E855*|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Nonsense_Mutation_p.E710*|PMFBP1_uc010cgo.1_Nonsense_Mutation_p.E151*	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	860	Potential.									ovary(2)	2		Ovarian(137;0.179)				AGGAGGTTCTCTTTTAAGGCG	0.567											OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	22	---	---	---	---	PASS
WFDC1	58189	broad.mit.edu	37	16	84328656	84328656	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84328656C>A	uc002fhw.2	+	1	256	c.79C>A	c.(79-81)CAC>AAC	p.H27N	WFDC1_uc002fhv.2_Missense_Mutation_p.H27N	NM_021197	NP_067020	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1 precursor	27					negative regulation of cell growth	extracellular space	serine-type endopeptidase inhibitor activity			breast(1)	1						ACTTCTCCTCCACGCCGGCTC	0.632													3	17	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10408351	10408351	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10408351G>A	uc002gmo.2	-	22	2561	c.2467C>T	c.(2467-2469)CGT>TGT	p.R823C	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	823						muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						ATGAAGGCACGGACATTGTAC	0.423													4	172	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15965052	15965052	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15965052C>A	uc002gpo.2	-	37	5784	c.5544G>T	c.(5542-5544)AGG>AGT	p.R1848S	NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpm.2_Missense_Mutation_p.R368S|NCOR1_uc010vwb.1_Missense_Mutation_p.R432S|NCOR1_uc010coy.2_Missense_Mutation_p.R756S|NCOR1_uc010vwc.1_Missense_Mutation_p.R658S	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1848	Interaction with C1D (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TTTCTTCTAACCTGGCAGCTT	0.493													5	8	---	---	---	---	PASS
SLFN14	342618	broad.mit.edu	37	17	33884519	33884519	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33884519G>A	uc010ctu.1	-	1	592	c.563C>T	c.(562-564)TCA>TTA	p.S188L		NM_001129820	NP_001123292	P0C7P3	SLN14_HUMAN	schlafen family member 14	188							ATP binding			central_nervous_system(1)	1						AAAAAATTCTGAGGCCAATAT	0.378													44	127	---	---	---	---	PASS
GGNBP2	79893	broad.mit.edu	37	17	34935726	34935726	+	Silent	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34935726G>T	uc002hnb.2	+	8	1146	c.897G>T	c.(895-897)CTG>CTT	p.L299L	GGNBP2_uc002hna.2_Silent_p.L299L|GGNBP2_uc002hnc.1_Silent_p.L128L	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403	299					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AAGAAGTTCTGACCTGCTTGG	0.403													53	154	---	---	---	---	PASS
CWC25	54883	broad.mit.edu	37	17	36969064	36969064	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36969064T>C	uc002hqu.2	-	4	635	c.482A>G	c.(481-483)AAG>AGG	p.K161R	CWC25_uc010wdv.1_Missense_Mutation_p.K98R|CWC25_uc010wdw.1_RNA|CWC25_uc010wdx.1_RNA	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49	161	Lys-rich.										0						TTTGATTTTCTTCATTTTCAC	0.343													8	765	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40639358	40639358	+	Silent	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40639358C>T	uc002hzr.2	+	10	1163	c.996C>T	c.(994-996)TCC>TCT	p.S332S	ATP6V0A1_uc002hzq.2_Silent_p.S332S|ATP6V0A1_uc002hzs.2_Silent_p.S339S|ATP6V0A1_uc010wgj.1_Silent_p.S289S|ATP6V0A1_uc010wgk.1_Silent_p.S289S|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Silent_p.S191S	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	332	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		ACCTTGACTCCATCCAGTTTG	0.502													13	29	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41343513	41343513	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41343513C>T	uc010czd.2	+	10	1128	c.988C>T	c.(988-990)CAC>TAC	p.H330Y	NBR1_uc010diz.2_Missense_Mutation_p.H330Y|NBR1_uc010whu.1_Missense_Mutation_p.H330Y|NBR1_uc010whv.1_Missense_Mutation_p.H330Y|NBR1_uc010whw.1_Missense_Mutation_p.H309Y|NBR1_uc010whx.1_Missense_Mutation_p.H139Y	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	330					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		TAGGAAAATTCACCTGTGGAA	0.458													32	80	---	---	---	---	PASS
RGS9	8787	broad.mit.edu	37	17	63154436	63154436	+	Missense_Mutation	SNP	G	T	T	rs115440141	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63154436G>T	uc002jfe.2	+	3	288	c.178G>T	c.(178-180)GTC>TTC	p.V60F	RGS9_uc010dem.2_Missense_Mutation_p.V60F|RGS9_uc002jfd.2_Missense_Mutation_p.V60F|RGS9_uc002jff.2_RNA	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	60	DEP.				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						GCAATGGATCGTCCAGCGGCT	0.502													93	142	---	---	---	---	PASS
GREB1L	80000	broad.mit.edu	37	18	19093876	19093876	+	Silent	SNP	C	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19093876C>A	uc010xam.1	+	28	5101	c.4830C>A	c.(4828-4830)GTC>GTA	p.V1610V		NM_001142966	NP_001136438	Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast	1610						integral to membrane					0						GCCAGTGTGTCTGGCCTTTCA	0.502													10	79	---	---	---	---	PASS
LOXHD1	125336	broad.mit.edu	37	18	44122812	44122812	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44122812G>A	uc010xcw.1	-	24	3626	c.3626C>T	c.(3625-3627)ACC>ATC	p.T1209I	LOXHD1_uc002lcg.1_Missense_Mutation_p.T931I|LOXHD1_uc002lce.3_Missense_Mutation_p.T2I|LOXHD1_uc002lcf.3_Missense_Mutation_p.T98I|LOXHD1_uc010xcv.1_Missense_Mutation_p.T142I|LOXHD1_uc010xcx.1_RNA	NM_144612	NP_653213	Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1 isoform 1	931	PLAT 7.				sensory perception of sound	stereocilium	protein binding				0						CTTCAGGAGGGTCATTCCTGT	0.498													16	36	---	---	---	---	PASS
STXBP2	6813	broad.mit.edu	37	19	7712373	7712373	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7712373G>A	uc002mha.3	+	18	1717	c.1672G>A	c.(1672-1674)GAG>AAG	p.E558K	STXBP2_uc002mhb.3_Missense_Mutation_p.E555K|STXBP2_uc010dvj.2_RNA|STXBP2_uc010xjr.1_Missense_Mutation_p.E569K|STXBP2_uc010dvk.2_Missense_Mutation_p.E526K|STXBP2_uc002mhc.3_Missense_Mutation_p.E294K|STXBP2_uc002mhe.1_3'UTR	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	558					leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						CAGGGCCACCGAGGGCAAGTG	0.647													3	8	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11944956	11944956	+	3'UTR	SNP	C	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11944956C>T	uc002msp.1	+	4						NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ttttttttttcccccagaaag	0.109													8	148	---	---	---	---	PASS
ZFP14	57677	broad.mit.edu	37	19	36832152	36832152	+	Silent	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36832152T>C	uc002odx.1	-	4	669	c.576A>G	c.(574-576)AGA>AGG	p.R192R	ZFP14_uc010xtd.1_Silent_p.R193R|ZFP14_uc010eex.1_Silent_p.R192R	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	192	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					CAGTATGAATTCTCAGGTGTT	0.423													55	87	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39028524	39028524	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39028524G>C	uc002oit.2	+	84	11743	c.11613G>C	c.(11611-11613)GAG>GAC	p.E3871D	RYR1_uc002oiu.2_Missense_Mutation_p.E3866D|RYR1_uc002oiv.1_Missense_Mutation_p.E780D	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3871					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ACCTAGGAGAGAAGGTCATGG	0.577													16	27	---	---	---	---	PASS
GLTSCR2	29997	broad.mit.edu	37	19	48260339	48260339	+	3'UTR	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48260339G>T	uc010elj.2	+	10					GLTSCR2_uc010elk.1_RNA	NM_015710	NP_056525	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2							nucleolus				central_nervous_system(1)	1		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		CGTGTGGCTTGTGTGCCTCCT	0.602													15	13	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57642541	57642541	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57642541G>A	uc002qny.2	+	4	2854	c.2498G>A	c.(2497-2499)GGG>GAG	p.G833E		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	833					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGCCATATCGGGAGCTCCCCA	0.478													9	61	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10906858	10906858	+	3'UTR	SNP	T	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906858T>G	uc002yip.1	-	24					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_3'UTR|TPTE_uc002yir.1_3'UTR|TPTE_uc010gkv.1_3'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGTGGCAGGGTTGGAAAGAAC	0.303													14	126	---	---	---	---	PASS
GCFC1	94104	broad.mit.edu	37	21	34142136	34142136	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34142136G>A	uc002yqn.2	-	2	651	c.461C>T	c.(460-462)TCA>TTA	p.S154L	GCFC1_uc002yqo.2_RNA|GCFC1_uc002yqp.2_Missense_Mutation_p.S154L|GCFC1_uc002yqr.2_Missense_Mutation_p.S154L|C21orf49_uc002yqs.2_5'Flank|C21orf49_uc002yqu.3_5'Flank|C21orf49_uc002yqt.2_5'Flank	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate	154						cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TTCAGCTGATGAGTTGAGTTC	0.303													231	529	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50053811	50053811	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50053811G>T	uc004dox.3	+	6	2940	c.2642G>T	c.(2641-2643)TGG>TTG	p.W881L	CCNB3_uc004doy.2_Missense_Mutation_p.W881L|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	881					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					TCAGCTTTGTGGGAGAAGCCC	0.498													23	13	---	---	---	---	PASS
PHF6	84295	broad.mit.edu	37	X	133551239	133551239	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133551239G>C	uc004exj.2	+	9	1077	c.875G>C	c.(874-876)TGT>TCT	p.C292S	PHF6_uc004exk.2_Missense_Mutation_p.C292S|PHF6_uc011mvk.1_Missense_Mutation_p.C258S|PHF6_uc004exi.2_Missense_Mutation_p.C293S	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	292	PHD-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					ACTATTGGATGTGAAATAAAA	0.353													19	201	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154189411	154189411	+	Silent	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154189411A>G	uc004fmt.2	-	10	1647	c.1476T>C	c.(1474-1476)TAT>TAC	p.Y492Y		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	492	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGTAGATGTTATATGGTCTGC	0.343													5	273	---	---	---	---	PASS
RPS4Y1	6192	broad.mit.edu	37	Y	2709666	2709666	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2709666A>G	uc004fqi.2	+	1	44	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_001008	NP_000999	P22090	RS4Y1_HUMAN	ribosomal protein S4, Y-linked 1 Y isoform	1					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0						GAGTTTCGCCATGGTAAGACC	0.473													20	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12236	12236	+	RNA	SNP	G	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12236G>A	uc004cow.1	+	1		c.30G>A			uc004cox.3_5'Flank|uc004coy.2_5'Flank					DQ584698																		TGCTAACTCATGCCCCCATGT	0.388													31	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15262	15262	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15262T>C	uc004coy.2	+	1	502	c.427T>C	c.(427-429)TCC>CCC	p.S143P	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		TCAGTAGACAGTCCCACCCTC	0.468											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	16	2	---	---	---	---	PASS
KIAA0562	9731	broad.mit.edu	37	1	3751685	3751686	+	Intron	INS	-	AT	AT			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3751685_3751686insAT	uc001aky.2	-						KIAA0562_uc010nzm.1_Intron|KIAA0562_uc001akz.2_Intron	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,							centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		CATTTCATGGCATCACACAACC	0.386													47	21	---	---	---	---	
HNRNPCL1	343069	broad.mit.edu	37	1	12908384	12908385	+	Intron	INS	-	A	A	rs143606605		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12908384_12908385insA	uc010obf.1	-						LOC649330_uc009vno.2_5'Flank	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like							ribonucleoprotein complex	nucleotide binding				0						ATTGCATTTAGAAAAAAAATCA	0.356													9	4	---	---	---	---	
IGSF21	84966	broad.mit.edu	37	1	18444629	18444629	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18444629delT	uc001bau.1	+							NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GCCTTTGGGGTTTTTTTTTGT	0.547													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22719479	22719479	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22719479delA								WNT4 (249094 upstream) : ZBTB40 (58865 downstream)																							actctgacttaaaaaaaaaaT	0.269													4	2	---	---	---	---	
NFYC	4802	broad.mit.edu	37	1	41212916	41212917	+	Intron	INS	-	A	A	rs78359579		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41212916_41212917insA	uc001cge.2	+						NFYC_uc010ojm.1_Intron|NFYC_uc001cfx.3_Intron|NFYC_uc009vwd.2_Intron|NFYC_uc001cfz.2_Intron|NFYC_uc010ojn.1_Intron|NFYC_uc001cfy.3_Intron|NFYC_uc001cgc.2_Intron|NFYC_uc001cgb.2_Intron|NFYC_uc001cgd.3_Intron	NM_001142588	NP_001136060	Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma isoform 1						protein folding|regulation of transcription from RNA polymerase II promoter	CCAAT-binding factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)|kidney(1)	3	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			TTGTGCTGACGAAAAAAAAAAA	0.371													4	2	---	---	---	---	
USP24	23358	broad.mit.edu	37	1	55559269	55559269	+	Intron	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55559269delG	uc001cyg.3	-							NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						ACCTTAACTTGTTTTTCTCTC	0.269													2	7	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62459723	62459724	+	Intron	INS	-	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62459723_62459724insA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						TTCTCTAGTTTAAAAAAAAATA	0.233													4	2	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	66999290	66999291	+	5'Flank	DEL	GA	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66999290_66999291delGA	uc001dcr.2	+							NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						AAGAGAGACGGAGAGAGAGAGA	0.470													4	2	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67194669	67194669	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67194669delA	uc001dcr.2	+						SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Intron|SGIP1_uc001dcu.2_Intron	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						aaaagttcagaaaaaaaaaac	0.000													4	2	---	---	---	---	
RPE65	6121	broad.mit.edu	37	1	68895274	68895274	+	3'UTR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68895274delT	uc001dei.1	-	14						NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein						visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						AAATACGTACTTTTTTTTTTA	0.323													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	69579868	69579868	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69579868delA								DEPDC1 (617069 upstream) : LRRC7 (453000 downstream)																							tgaactttctaaaaacctgca	0.214													4	2	---	---	---	---	
SEP15	9403	broad.mit.edu	37	1	87329492	87329495	+	Intron	DEL	TCAT	-	-	rs112704469		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87329492_87329495delTCAT	uc010osi.1	-						SEP15_uc010osj.1_Intron	NM_004261	NP_004252	O60613	SEP15_HUMAN	15 kDa selenoprotein isoform 1 precursor						'de novo' posttranslational protein folding	endoplasmic reticulum lumen	selenium binding				0		Lung NSC(277;0.153)		all cancers(265;0.00744)|Epithelial(280;0.0333)		AAAAAAtcactcattcattcattc	0.132													5	8	---	---	---	---	
AGL	178	broad.mit.edu	37	1	100379373	100379373	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100379373delA	uc001dsi.1	+						AGL_uc001dsj.1_Intron|AGL_uc001dsk.1_Intron|AGL_uc001dsl.1_Intron|AGL_uc001dsm.1_Intron|AGL_uc001dsn.1_Intron	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ATTTGTTTTCAAATTCACTTC	0.299													58	28	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142538655	142538656	+	IGR	INS	-	AGTTGAGTGA	AGTTGAGTGA			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142538655_142538656insAGTTGAGTGA								None (None upstream) : None (None downstream)																							gagtgaagtggagtggagtgga	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148849428	148849430	+	IGR	DEL	TCG	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148849428_148849430delTCG								NBPF16 (91117 upstream) : LOC645166 (78856 downstream)																							tcttttcatctcgtcatttcatt	0.000													2	4	---	---	---	---	
PRPF3	9129	broad.mit.edu	37	1	150317240	150317240	+	Intron	DEL	T	-	-	rs5777721		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150317240delT	uc001eum.3	+						PRPF3_uc009wlp.2_Intron|PRPF3_uc010pca.1_Intron|PRPF3_uc010pcb.1_Intron|PRPF3_uc009wlq.1_Intron	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog						nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TCAAGTCTTCTTTTTTTTTTT	0.328													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	166275375	166275375	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166275375delT								FAM78B (139169 upstream) : FMO9P (297778 downstream)																							gtggatgtgcttttctggtgg	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	190672202	190672202	+	IGR	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190672202delG								FAM5C (225443 upstream) : None (None downstream)																							GGAGTGTTTTGGGGGGAAATG	0.338													4	2	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235386699	235386702	+	Intron	DEL	CACG	-	-	rs72222916	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235386699_235386702delCACG	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			tatatatatacacgtatatatatg	0.137													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242950496	242950497	+	IGR	INS	-	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242950496_242950497insA								PLD5 (262498 upstream) : CEP170 (337234 downstream)																							gttctcacttcaaaatatactc	0.000													4	2	---	---	---	---	
TTC15	51112	broad.mit.edu	37	2	3423957	3423958	+	Intron	INS	-	A	A	rs112164644		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3423957_3423958insA	uc002qxm.1	+						TTC15_uc002qxn.1_Intron|TTC15_uc010ewm.1_Intron	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15								binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		gttcagcatttaaaaaaaaaac	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37857075	37857075	+	IGR	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37857075delC								QPCT (256611 upstream) : CDC42EP3 (13668 downstream)																							gaaagtcaaaccccatcgctg	0.000													4	2	---	---	---	---	
ACTR2	10097	broad.mit.edu	37	2	65480593	65480593	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65480593delA	uc002sdq.2	+						ACTR2_uc010yqf.1_Intron|ACTR2_uc002sdp.2_Intron|ACTR2_uc010yqg.1_Intron	NM_005722	NP_005713	P61160	ARP2_HUMAN	actin-related protein 2 isoform b						cellular component movement	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|ATP binding				0						aaaaaaaaggaaaaaaaaGTC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78815467	78815467	+	IGR	DEL	C	-	-	rs71385224		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78815467delC								SNAR-H (633315 upstream) : REG3G (437359 downstream)																							aaatacataacccatcaggag	0.000													2	5	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100066141	100066141	+	Intron	DEL	T	-	-	rs11351549		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100066141delT	uc002tad.2	-						REV1_uc002tac.2_Intron|REV1_uc002tae.1_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						GCTATGTTGCTTTTAGTACAT	0.428								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107927262	107927263	+	IGR	INS	-	GT	GT	rs139397314	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107927262_107927263insGT								ST6GAL2 (423699 upstream) : LOC729121 (512257 downstream)																							CGTTAGTCATAGTGTTTAGCTT	0.371													4	2	---	---	---	---	
BUB1	699	broad.mit.edu	37	2	111414279	111414283	+	Intron	DEL	TTGTC	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111414279_111414283delTTGTC	uc002tgc.2	-						BUB1_uc010yxh.1_Intron|BUB1_uc010fkb.2_Intron	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1						apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		cctttgctttttgtctgaagcaagt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129777184	129777184	+	IGR	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129777184delC								HS6ST1 (701013 upstream) : LOC389033 (903251 downstream)																							AGGAAGGGCTCCATACTTAAA	0.483													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141299722	141299724	+	Intron	DEL	TGT	-	-	rs66946730		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141299722_141299724delTGT	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ttatttaaaatGTTGTAGTCATT	0.177										TSP Lung(27;0.18)			4	4	---	---	---	---	
OLA1	29789	broad.mit.edu	37	2	175078223	175078223	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175078223delA	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						GTGTCAAAAGAAAAAAAAAAG	0.294													9	4	---	---	---	---	
DNAJC10	54431	broad.mit.edu	37	2	183621404	183621404	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183621404delT	uc002uow.1	+						DNAJC10_uc002uox.1_Intron|DNAJC10_uc002uoy.1_Intron|DNAJC10_uc002uoz.1_Intron|DNAJC10_uc010fro.1_Intron	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10						apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCTGGTACACTTTTTTTTTTT	0.244													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186645854	186645857	+	Intron	DEL	ACTT	-	-	rs113243139		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186645854_186645857delACTT	uc002upl.2	+											Homo sapiens cDNA FLJ34780 fis, clone NT2NE2003705, weakly similar to U2 SMALL NUCLEAR RIBONUCLEOPROTEIN AUXILIARY FACTOR 35 KDA SUBUNIT RELATED-PROTEIN 2.																		atggcccctgacttacttacagtg	0.000													2	4	---	---	---	---	
ABCA12	26154	broad.mit.edu	37	2	215834746	215834746	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215834746delA	uc002vew.2	-						ABCA12_uc002vev.2_Intron|ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GGCTTCAAGGAAAAAAAAAAT	0.303													5	5	---	---	---	---	
EPHA4	2043	broad.mit.edu	37	2	222429296	222429297	+	Intron	INS	-	T	T	rs144228279	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222429296_222429297insT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TATTGAGGAAGTTTTTTTTTTG	0.351													5	3	---	---	---	---	
HJURP	55355	broad.mit.edu	37	2	234745932	234745935	+	3'UTR	DEL	AAAC	-	-	rs72003380		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234745932_234745935delAAAC	uc002vvg.2	-	9					HJURP_uc010znd.1_3'UTR|HJURP_uc010zne.1_3'UTR	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein						cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		actgtctcaaaaacaaacaaacaa	0.137													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235199640	235199641	+	IGR	INS	-	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235199640_235199641insC								SPP2 (213864 upstream) : ARL4C (202047 downstream)																							tggggatttctccccaccaccg	0.035													4	2	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1443812	1443812	+	Intron	DEL	A	-	-	rs72185294		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1443812delA	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGCATTGGCCAAAAAAAAAAA	0.368													5	3	---	---	---	---	
C3orf24	115795	broad.mit.edu	37	3	10146617	10146621	+	Intron	DEL	TTATT	-	-	rs113292025		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10146617_10146621delTTATT	uc003buz.2	-						C3orf24_uc003bva.1_Intron	NM_173472	NP_775743	Q96PS1	CC024_HUMAN	hypothetical protein LOC115795												0				OV - Ovarian serous cystadenocarcinoma(96;0.196)		ATATTAGTAAttattttattttatt	0.180													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	29072988	29072988	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29072988delA								ZCWPW2 (506358 upstream) : RBMS3 (249955 downstream)																							GGCGACCTTGAAAAAATTGTT	0.239													4	2	---	---	---	---	
C3orf67	200844	broad.mit.edu	37	3	58849097	58849097	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58849097delA	uc003dkt.1	-						C3orf67_uc003dks.1_Intron|uc003dku.1_Intron|C3orf67_uc003dkv.1_Intron|C3orf67_uc003dkw.2_3'UTR	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844												0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		ACTGTTAATTAAAAAAAAAAA	0.308													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117639286	117639286	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117639286delA								None (None upstream) : IGSF11 (980195 downstream)																							CAGAAAAGACAAAAAAAAGTC	0.428													4	2	---	---	---	---	
PLS1	5357	broad.mit.edu	37	3	142423019	142423021	+	Intron	DEL	TAA	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142423019_142423021delTAA	uc010huv.2	+						PLS1_uc003euz.2_Intron|PLS1_uc003eva.2_Intron	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1							cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						atattttatttaaaaatGGGTCA	0.227													6	3	---	---	---	---	
PCOLCE2	26577	broad.mit.edu	37	3	142548931	142548931	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142548931delT	uc003evd.2	-							NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						tttttatctctttttttatgg	0.005													4	2	---	---	---	---	
FAM194A	131831	broad.mit.edu	37	3	150404193	150404193	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150404193delT	uc003eyg.2	-						FAM194A_uc003eyh.2_Intron	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831											skin(2)|ovary(1)	3						GAAAAGAAGCTGAATATAAAA	0.333													106	96	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166703270	166703270	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166703270delA								None (None upstream) : ZBBX (254811 downstream)																							ATCTTTTTTGAAAAAAAAAAA	0.328													2	4	---	---	---	---	
SKIL	6498	broad.mit.edu	37	3	170110419	170110420	+	3'UTR	DEL	AA	-	-	rs71634467		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170110419_170110420delAA	uc003fgu.2	+	7					SKIL_uc011bps.1_3'UTR|SKIL_uc003fgv.2_3'UTR|SKIL_uc003fgw.2_3'UTR	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1						cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			GTACTTTTTTAAAAAAATCAGC	0.252													1	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	170753835	170753835	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170753835delA								SLC2A2 (9067 upstream) : TNIK (26457 downstream)																							ctcaaggtccacctggagtca	0.000													4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	171081697	171081697	+	Intron	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171081697delG	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CAAAACAGGCGGGTATCACAT	0.313													4	2	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175176738	175176738	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175176738delC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TGCACTATTTCCCCTGGTAGT	0.478													4	2	---	---	---	---	
TRA2B	6434	broad.mit.edu	37	3	185637502	185637503	+	Intron	INS	-	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185637502_185637503insA	uc003fpv.2	-						TRA2B_uc003fpt.2_Intron|TRA2B_uc003fpu.2_Intron|TRA2B_uc010hym.2_Intron|TRA2B_uc003fpw.2_Intron	NM_004593	NP_004584	P62995	TRA2B_HUMAN	splicing factor, arginine/serine-rich 10						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)	2						TAAATGCTCTTAAAAAAAAAAA	0.327													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13884054	13884055	+	Intron	DEL	GA	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13884054_13884055delGA	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																		TGGAAAAGGGGAGAAGGTAAGA	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29736613	29736613	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29736613delT								None (None upstream) : PCDH7 (985424 downstream)																							TCTGACAGCCTTACAGCTCTG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49506176	49506177	+	IGR	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49506176_49506177insT								CWH43 (442083 upstream) : None (None downstream)																							GTCATCATTCATTTTTTGAAAA	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	90319127	90319127	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90319127delT								GPRIN3 (89966 upstream) : SNCA (326124 downstream)																							gttttggtggtagactcaaca	0.000													4	2	---	---	---	---	
ETFDH	2110	broad.mit.edu	37	4	159603683	159603683	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159603683delT	uc003iqb.2	+						ETFDH_uc011cjg.1_Intron|ETFDH_uc010iqr.2_Intron|ETFDH_uc011cjh.1_Intron|ETFDH_uc010iqs.2_Intron	NM_004453	NP_004444	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase						fatty acid beta-oxidation using acyl-CoA dehydrogenase|respiratory electron transport chain|response to oxidative stress|transport	integral to mitochondrial inner membrane|mitochondrial matrix	4 iron, 4 sulfur cluster binding|electron carrier activity|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity, oxidizing metal ions with flavin as acceptor|ubiquinone binding			large_intestine(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		TAACTCTATCttttttttttt	0.129													7	4	---	---	---	---	
WDR17	116966	broad.mit.edu	37	4	177055969	177055969	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177055969delC	uc003iuj.2	+						WDR17_uc003iuk.2_Intron|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ATATCTTTTGCACTGAATTGA	0.313													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183225274	183225274	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183225274delA	uc010irv.1	+									Q9P273	TEN3_HUMAN	Homo sapiens ODZ3 (ODZ3) mRNA, partial cds.						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ATTGGCAAGTAAAAAAAAAAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12027399	12027399	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12027399delT								CTNND2 (123289 upstream) : None (None downstream)																							ccaaatctcatttttttttca	0.000													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13844148	13844148	+	Intron	DEL	C	-	-	rs5866072		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13844148delC	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TAACAAGTGGCTTTTAATTGC	0.373									Kartagener_syndrome				1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25017801	25017801	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25017801delT								CDH10 (372890 upstream) : None (None downstream)																							caagcatggatttttacactg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42908527	42908528	+	IGR	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42908527_42908528insT								SEPP1 (82529 upstream) : C5orf39 (130655 downstream)																							AGTCAAAATAGTTTTTTTTCTG	0.401													4	2	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64931003	64931003	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64931003delT	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						TAGTATTATATTTAGGAAGTA	0.254													21	12	---	---	---	---	
SFRS12	140890	broad.mit.edu	37	5	65449703	65449704	+	Intron	INS	-	A	A	rs140777730	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65449703_65449704insA	uc003juo.2	+						SFRS12_uc003jum.2_Intron|SFRS12_uc003jun.2_Intron|SFRS12_uc010iwy.2_Intron	NM_139168	NP_631907	Q8WXA9	SREK1_HUMAN	splicing factor, arginine/serine-rich 12 isoform						mRNA processing|RNA splicing	spliceosomal complex	nucleic acid binding|nucleotide binding|protein binding				0		Lung NSC(167;9.34e-06)|Prostate(74;0.00187)|Ovarian(174;0.0545)|Breast(144;0.0928)|Colorectal(97;0.234)		Lung(70;0.00449)		TTTCTGAAATTAAAAAATAATT	0.277													8	4	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66121966	66121966	+	5'Flank	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66121966delT	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_5'Flank	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CAGCCTTTCATTTTTGTCCCA	0.323													4	2	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81283695	81283699	+	Intron	DEL	CAGGC	-	-	rs34898483		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81283695_81283699delCAGGC	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron|ATG10_uc003kht.1_RNA	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		tgattattatcaggctaatgaagta	0.000													6	8	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81283700	81283701	+	Intron	INS	-	G	G			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81283700_81283701insG	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron|ATG10_uc003kht.1_RNA	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		attatcaggctaatgaagtatt	0.000													5	8	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81283703	81283704	+	Intron	DEL	TG	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81283703_81283704delTG	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron|ATG10_uc003kht.1_RNA	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		atcaggctaatgaagtattatt	0.000													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	89429910	89429911	+	IGR	INS	-	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89429910_89429911insA								None (None upstream) : CETN3 (259620 downstream)																							gagccctcaccaggaaccaaat	0.000													3	3	---	---	---	---	
PAM	5066	broad.mit.edu	37	5	102353532	102353533	+	Intron	DEL	GA	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102353532_102353533delGA	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knz.2_Intron	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GCATCCGTTTGAGACATATTAT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117426772	117426772	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117426772delA								None (None upstream) : DTWD2 (745799 downstream)																							ttacattaataaaaaaaatca	0.000													4	2	---	---	---	---	
KIF3A	11127	broad.mit.edu	37	5	132039656	132039656	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132039656delA	uc003kxo.2	-						KIF3A_uc003kxm.2_5'Flank|KIF3A_uc003kxn.2_Intron|KIF3A_uc011cxf.1_Intron|KIF3A_uc003kxp.2_Intron	NM_007054	NP_008985	Q9Y496	KIF3A_HUMAN	kinesin family member 3A						blood coagulation|organelle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding			pancreas(1)	1		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATATAGGTTAAAAAAAAAGC	0.289													6	3	---	---	---	---	
RNF14	9604	broad.mit.edu	37	5	141364714	141364715	+	Intron	DEL	AC	-	-	rs150158676		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141364714_141364715delAC	uc003lly.2	+						RNF14_uc003llz.2_Intron|RNF14_uc003lma.2_Intron|RNF14_uc003lmb.2_Intron|RNF14_uc003lmc.2_Intron|RNF14_uc011dbg.1_Intron|RNF14_uc011dbh.1_Intron|RNF14_uc003lmd.2_Intron	NM_183399	NP_899646	Q9UBS8	RNF14_HUMAN	ring finger protein 14 isoform 1						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|protein ubiquitination|regulation of androgen receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|small conjugating protein ligase activity|transcription coactivator activity|zinc ion binding				0		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		aagttttcaaacacagaaaatt	0.109													2	5	---	---	---	---	
DPYSL3	1809	broad.mit.edu	37	5	146778262	146778262	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146778262delA	uc003lon.1	-						DPYSL3_uc003loo.2_Intron	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tgacttccggaagttaggtat	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2309682	2309682	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2309682delT								GMDS (63836 upstream) : C6orf195 (313290 downstream)																							ttcttttttattttttttttt	0.090													7	4	---	---	---	---	
LY86	9450	broad.mit.edu	37	6	6652969	6652969	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6652969delC	uc003mwy.1	+						LY86_uc003mwz.1_Intron	NM_004271	NP_004262	O95711	LY86_HUMAN	MD-1, RP105-associated precursor						apoptosis|cell proliferation|humoral immune response|inflammatory response|innate immune response	extracellular space|plasma membrane					0	Ovarian(93;0.0377)					CTCCTGGCCTCCCAGCACACA	0.493													4	2	---	---	---	---	
DST	667	broad.mit.edu	37	6	56498031	56498032	+	Intron	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56498031_56498032insT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAGTTTCACTCttttttttttt	0.134													6	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57323955	57323956	+	Intron	INS	-	T	T	rs150464138		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57323955_57323956insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgttttgtgattttgcatcag	0.050													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80117223	80117223	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80117223delT								HMGN3 (172768 upstream) : LCA5 (77486 downstream)																							AAAAATAATCTTTTTTGAGCG	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	97361989	97361989	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97361989delA								NDUFAF4 (16222 upstream) : KLHL32 (10507 downstream)																							atctacaagcaaaaaagggtg	0.000													4	2	---	---	---	---	
ARMC2	84071	broad.mit.edu	37	6	109285993	109285993	+	Intron	DEL	A	-	-	rs77214837		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109285993delA	uc003pss.3	+						ARMC2_uc011eao.1_Intron	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		actctgtctcaaaaaaaaaaa	0.114													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	115492327	115492327	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115492327delT								HS3ST5 (828787 upstream) : FRK (770366 downstream)																							CCTTACTCCCTTTTTCCCTTT	0.254													4	2	---	---	---	---	
GPR126	57211	broad.mit.edu	37	6	142724145	142724145	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142724145delT	uc010khc.2	+						GPR126_uc010khd.2_Intron|GPR126_uc010khe.2_Intron|GPR126_uc010khf.2_Intron	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		GTTCTGTGTGTTTTTTTTTTT	0.264													6	3	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	3615710	3615710	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3615710delA	uc003smx.2	+							NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCTGACTTTACATTTCAGAT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17142952	17142952	+	IGR	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17142952delC								AGR3 (221339 upstream) : AHR (195324 downstream)																							TTTCTTGATACCCCAGAGGTC	0.498													4	2	---	---	---	---	
SCRN1	9805	broad.mit.edu	37	7	29994603	29994603	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29994603delT	uc010kvp.2	-						SCRN1_uc011jzy.1_Intron|SCRN1_uc003tak.2_Intron|SCRN1_uc011jzz.1_Intron|SCRN1_uc011kaa.1_Intron|SCRN1_uc011jzw.1_Intron|SCRN1_uc011jzx.1_Intron	NM_001145515	NP_001138987	Q12765	SCRN1_HUMAN	secernin 1 isoform c						exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2						agccacttgatttttttttat	0.075													4	2	---	---	---	---	
STK17A	9263	broad.mit.edu	37	7	43641505	43641505	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43641505delC	uc003tih.2	+							NM_004760	NP_004751	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			skin(2)	2						CCTTTTAACACCCCCACCCCC	0.428													4	2	---	---	---	---	
ZNF117	51351	broad.mit.edu	37	7	64441352	64441353	+	Intron	INS	-	A	A	rs138709151	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64441352_64441353insA	uc003ttr.2	-							NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				taaacaacaacaaaaaaaccaa	0.119													4	3	---	---	---	---	
POMZP3	22932	broad.mit.edu	37	7	76240592	76240593	+	Intron	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76240592_76240593insT	uc003uft.2	-						uc003ufs.1_Intron|POMZP3_uc003ufu.2_Intron|POMZP3_uc003ufv.2_Intron|POMZP3_uc011kgm.1_Intron	NM_012230	NP_036362	Q6PJE2	POZP3_HUMAN	POMZP3 fusion protein isoform 1												0		Myeloproliferative disorder(862;0.204)				CCGAGGTGGAAGGCTGAGAGCC	0.470													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	81237828	81237829	+	Intron	DEL	TC	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81237828_81237829delTC	uc003uhk.1	-											Homo sapiens mRNA sequence.																		AATATCACTTTCTCTCTCTCTC	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98378234	98378235	+	IGR	INS	-	G	G	rs151031847	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98378234_98378235insG								NPTX2 (119053 upstream) : TMEM130 (65877 downstream)																							tgcagctcccaggaagccatgt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	109909470	109909470	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109909470delA								EIF3IP1 (309200 upstream) : IMMP2L (393640 downstream)																							ACTTCATAGCAAAAGAACAAA	0.353													4	2	---	---	---	---	
MDFIC	29969	broad.mit.edu	37	7	114656337	114656338	+	3'UTR	DEL	CA	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114656337_114656338delCA	uc003vhf.2	+	5						NM_199072	NP_951038	Q9P1T7	MDFIC_HUMAN	MyoD family inhibitor domain containing protein						activation of JUN kinase activity|interspecies interaction between organisms|negative regulation of protein import into nucleus|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|regulation of Wnt receptor signaling pathway|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleolus|nucleus	cyclin binding|Tat protein binding			ovary(1)	1						TATTATTTTTCAGTGTGTATTT	0.292													2	5	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127493079	127493081	+	Intron	DEL	CTT	-	-	rs142577435		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127493079_127493081delCTT	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TCTTGGACAGCTTCATCACAAAA	0.453													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142021522	142021523	+	Intron	DEL	CA	-	-	rs72430962		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142021522_142021523delCA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TTCTGCAACTCAGGGCTGGGGA	0.520													5	5	---	---	---	---	
GSR	2936	broad.mit.edu	37	8	30539225	30539225	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30539225delA	uc003xih.1	-							NM_000637	NP_000628	P00390	GSHR_HUMAN	glutathione reductase precursor						cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity			ovary(2)|pancreas(2)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Glutathione(DB00143)|NADH(DB00157)	taaaaaAGCTAAAAAAAAAAG	0.224													4	3	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38783806	38783806	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38783806delA	uc003xmi.3	+						PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			ATCCTTTGGTAAAAAAAAAAT	0.303													3	3	---	---	---	---	
EFCAB1	79645	broad.mit.edu	37	8	49641921	49641922	+	Intron	INS	-	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49641921_49641922insA	uc003xqo.2	-						EFCAB1_uc003xqn.3_Intron|EFCAB1_uc011ldj.1_Intron|EFCAB1_uc010lxx.2_Intron|EFCAB1_uc011ldk.1_Intron	NM_024593	NP_078869	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform a								calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				tcatctctattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95836995	95836995	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95836995delA	uc003yhb.2	+						INTS8_uc003yha.1_Intron|INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					CTTTTGTGGCAAAAAAAAAAC	0.413													4	2	---	---	---	---	
FBXO43	286151	broad.mit.edu	37	8	101146397	101146398	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101146397_101146398insT	uc003yjd.2	-	4	2582_2583	c.1869_1870insA	c.(1867-1872)GAATATfs	p.E623fs	FBXO43_uc003yje.2_Frame_Shift_Ins_p.E589fs	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	623_624	IBR-type.				meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			ACCTTAACATATTCTTCCTGTT	0.342													75	38	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	140883384	140883384	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140883384delT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						gtccctgcagtagaggcttct	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	19383903	19383903	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19383903delA								RPS6 (3668 upstream) : ACER2 (13904 downstream)																							GCTAATTGAGAAAAAAAAAAA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66460715	66460716	+	5'Flank	INS	-	T	T	rs58550614		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66460715_66460716insT	uc004aeb.2	-						uc004aec.2_Intron					Homo sapiens cDNA clone IMAGE:3941306, partial cds.																		tgtatttgttgtttttggtgtc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68417570	68417571	+	IGR	INS	-	AA	AA	rs111263548		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68417570_68417571insAA								FAM27B (623381 upstream) : MIR1299 (584668 downstream)																							AGGATAGGAATAAAACATCAGT	0.243													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68427527	68427527	+	IGR	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68427527delG								FAM27B (633338 upstream) : MIR1299 (574712 downstream)																							ATTGTATAAAGTAAAGTAAGA	0.368													6	3	---	---	---	---	
CBWD6	644019	broad.mit.edu	37	9	69256447	69256448	+	Intron	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69256447_69256448insT	uc004afj.3	-						CBWD6_uc004afk.3_Intron|CBWD6_uc011lrf.1_Intron	NM_001085457	NP_001078926	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding				0						TTTGATAGTCATTTTTTTTTTT	0.218													4	3	---	---	---	---	
SNX30	401548	broad.mit.edu	37	9	115631329	115631330	+	3'UTR	DEL	TC	-	-	rs140973637		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115631329_115631330delTC	uc004bgj.3	+	9					SNX30_uc004bgi.3_3'UTR	NM_001012994	NP_001013012	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30						cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0						GGCTAGAATATCTCTCAGCAAG	0.450													3	6	---	---	---	---	
NSUN6	221078	broad.mit.edu	37	10	18834658	18834658	+	3'UTR	DEL	T	-	-	rs34407644		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18834658delT	uc010qcp.1	-	11					NSUN6_uc001iqb.2_5'Flank	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2						AAAAAAAAAATCTTTTAAAAA	0.323													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30798290	30798291	+	IGR	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30798290_30798291insT								MAP3K8 (47529 upstream) : LYZL2 (102418 downstream)																							AAACTGCTCACTTTTTTTTTGA	0.332													4	2	---	---	---	---	
DDX21	9188	broad.mit.edu	37	10	70739010	70739010	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70739010delT	uc001jov.1	+						DDX21_uc001jow.1_Intron	NM_004728	NP_004719	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21							nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)	3						TTTCAGAATCTTTTTTTTTCT	0.179													9	4	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94230334	94230335	+	Intron	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94230334_94230335insT	uc001kia.2	-						IDE_uc010qnp.1_Intron|IDE_uc001khz.2_Intron	NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ccatttttatctttttttttat	0.000													6	3	---	---	---	---	
OBFC1	79991	broad.mit.edu	37	10	105652235	105652236	+	Intron	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105652235_105652236insT	uc001kxl.2	-						OBFC1_uc001kxm.2_Intron|OBFC1_uc001kxn.2_Intron	NM_024928	NP_079204	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold						positive regulation of DNA replication|telomere maintenance via telomere lengthening		protein binding|single-stranded telomeric DNA binding			ovary(1)	1		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		CTTAGTTGTGATTTTTTTTTTT	0.391													4	2	---	---	---	---	
PIK3C2A	5286	broad.mit.edu	37	11	17177227	17177228	+	Intron	INS	-	TA	TA			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17177227_17177228insTA	uc001mmq.3	-						PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_Intron|PIK3C2A_uc010rcx.1_Intron|PIK3C2A_uc009ygv.1_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha						cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	CCACAAAATGCTACATAGCAGC	0.277													40	23	---	---	---	---	
LDHC	3948	broad.mit.edu	37	11	18434612	18434612	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18434612delT	uc001mon.3	+						LDHC_uc001mom.3_Intron|LDHC_uc009yhp.2_Intron|LDHC_uc001moo.3_Intron|LDHC_uc009yhq.2_Intron|LDHC_uc009yhr.2_Intron	NM_017448	NP_059144	P07864	LDHC_HUMAN	L-lactate dehydrogenase C						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	ttttcctttctttttttttct	0.010													6	3	---	---	---	---	
LUZP2	338645	broad.mit.edu	37	11	24927788	24927788	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24927788delA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						AGCCAAAAGGAAAAAAAAAAA	0.259													5	3	---	---	---	---	
QSER1	79832	broad.mit.edu	37	11	32998332	32998332	+	3'UTR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32998332delT	uc001mty.2	+	13					QSER1_uc001mtz.1_Intron	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1											ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					CTAAGTATAATTTTTTTTTAT	0.313													4	2	---	---	---	---	
PRR5L	79899	broad.mit.edu	37	11	36425089	36425090	+	Intron	DEL	TG	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36425089_36425090delTG	uc001mwo.3	+						PRR5L_uc001mwp.2_Intron|PRR5L_uc009ykk.2_Intron|PRR5L_uc010rfc.1_Intron	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a											ovary(1)	1						TGTTGCGTTCTGAGACCTGTGT	0.431													4	2	---	---	---	---	
SMTNL1	219537	broad.mit.edu	37	11	57317779	57317779	+	3'UTR	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57317779delC	uc009ymh.1	+	8						NM_001105565	NP_001099035	E9PPJ3	E9PPJ3_HUMAN	smoothelin-like 1											ovary(1)	1						CCATACTTGGCCCAGGAACCT	0.498													4	2	---	---	---	---	
ZDHHC5	25921	broad.mit.edu	37	11	57440359	57440360	+	5'UTR	INS	-	C	C			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57440359_57440360insC	uc001nkx.1	+	2					ZDHHC5_uc001nky.1_Intron	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1						GAATCACCTTTCCCCCTCCCAT	0.411													4	2	---	---	---	---	
TBX10	347853	broad.mit.edu	37	11	67399597	67399597	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67399597delA	uc001omp.2	-						NUDT8_uc001omn.2_5'Flank|NUDT8_uc001omo.1_5'Flank	NM_005995	NP_005986	O75333	TBX10_HUMAN	T-box 10						anatomical structure morphogenesis|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						cctgcctggcaccccctgcct	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	93922330	93922330	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93922330delA								PANX1 (7195 upstream) : FOLR4 (116473 downstream)																							GAGCAGAAAGAAAAAAAAAAG	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123330778	123330779	+	RNA	DEL	GT	-	-	rs10579380		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123330778_123330779delGT	uc001pyv.1	+	2		c.2131_2132delGT								full-length cDNA clone CS0DK011YO01 of HeLa cells Cot 25-normalized of Homo sapiens (human).																		TTGGACATACGTGTGTGTGTGT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5098997	5098997	+	IGR	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5098997delG								KCNA1 (71577 upstream) : KCNA5 (54088 downstream)																							ACCTAACACTGGATGACCAGG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5141557	5141557	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5141557delT								KCNA1 (114137 upstream) : KCNA5 (11528 downstream)																							ctttcccttcttTTTTTTTTT	0.174													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43441807	43441807	+	IGR	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43441807delG								PRICKLE1 (458235 upstream) : ADAMTS20 (306206 downstream)																							GGAGAACAGTGGGAAATGAAG	0.393													4	2	---	---	---	---	
SLC38A1	81539	broad.mit.edu	37	12	46583049	46583049	+	Intron	DEL	A	-	-	rs75181654		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46583049delA	uc001rpa.2	-						SLC38A1_uc001rpb.2_Intron|SLC38A1_uc001rpc.2_Intron|SLC38A1_uc001rpd.2_Intron|SLC38A1_uc001rpe.2_Intron	NM_030674	NP_109599	Q9H2H9	S38A1_HUMAN	amino acid transporter system A1						cellular nitrogen compound metabolic process|neurotransmitter uptake	integral to membrane|plasma membrane	sodium:amino acid symporter activity			ovary(2)|skin(2)|central_nervous_system(1)	5	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			GGAAAATAGGAAAAAAAAAAA	0.368													8	9	---	---	---	---	
PCBP2	5094	broad.mit.edu	37	12	53858380	53858380	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53858380delT	uc001sdl.3	+						PCBP2_uc001sdc.3_Intron|PCBP2_uc001sdb.3_Intron|PCBP2_uc001sde.3_Intron|PCBP2_uc001sdi.3_Intron|PCBP2_uc001sdd.3_Intron|PCBP2_uc001sdf.3_Intron|PCBP2_uc009zna.2_Intron|PCBP2_uc010soi.1_Intron|PCBP2_uc001sdj.3_Intron|PCBP2_uc010soj.1_Intron|PCBP2_uc001sdk.3_Intron|PCBP2_uc010soh.1_Intron	NM_001128911	NP_001122383	Q15366	PCBP2_HUMAN	poly(rC) binding protein 2 isoform d						innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0						ACTAGGTAACTTTTTTTTTTA	0.363													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54610302	54610302	+	IGR	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54610302delG								SMUG1 (27545 upstream) : CBX5 (14430 downstream)																							ACAGGAGAAAGGGGCTGCCTT	0.498											OREG0021888	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TMTC2	160335	broad.mit.edu	37	12	83488998	83488998	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83488998delT	uc001szt.2	+						TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						aatttcatggttttttttttt	0.040													2	4	---	---	---	---	
WSCD2	9671	broad.mit.edu	37	12	108594266	108594267	+	Intron	INS	-	TTCA	TTCA	rs140389107	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108594266_108594267insTTCA	uc001tms.2	+						WSCD2_uc001tmt.2_Intron	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						tcatttattctttcattcattc	0.050													6	3	---	---	---	---	
ATP2A2	488	broad.mit.edu	37	12	110743429	110743430	+	Intron	INS	-	AT	AT			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110743429_110743430insAT	uc001tqk.3	+						ATP2A2_uc001tql.3_Intron|ATP2A2_uc010sxy.1_Intron	NM_170665	NP_733765	P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, slow twitch 2 isoform						ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding			ovary(3)|skin(1)	4						tcagtaccatactgtcttgata	0.000													19	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	118874331	118874331	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118874331delT								SUDS3 (18492 upstream) : SRRM4 (545065 downstream)																							CCGCTGCTAATTTTAGCTTGC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128532369	128532370	+	IGR	INS	-	T	T			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128532369_128532370insT								None (None upstream) : TMEM132C (366921 downstream)																							acagcctcacctgcagaacgct	0.000													4	2	---	---	---	---	
GOLGA3	2802	broad.mit.edu	37	12	133398461	133398461	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133398461delC	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		aaaaaaaaaacaaCTTTGAAT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	65171735	65171735	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65171735delT								OR7E156P (855034 upstream) : None (None downstream)																							cagagcaaaattttaggagtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73065410	73065411	+	IGR	INS	-	A	A			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73065410_73065411insA								DACH1 (624080 upstream) : C13orf37 (217084 downstream)																							TTCAGAGGCAGAAAAAAAAAAA	0.327													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	91783666	91783666	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91783666delA								LOC144776 (204815 upstream) : MIR17HG (216408 downstream)																							TAATATCTGTAAAAAAAAAAA	0.124													4	3	---	---	---	---	
CLYBL	171425	broad.mit.edu	37	13	100379759	100379760	+	Intron	INS	-	G	G	rs147933239	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100379759_100379760insG	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCAACCAAGTAGAAAAAAAGGA	0.426													2	4	---	---	---	---	
TMTC4	84899	broad.mit.edu	37	13	101278639	101278639	+	Intron	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101278639delG	uc001vou.2	-						TMTC4_uc001vot.2_Intron|TMTC4_uc010tja.1_Intron|TMTC4_uc001vov.1_Intron|TMTC4_uc001vow.1_Intron	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AAGCACAACAGAAGGGAAATA	0.348													4	2	---	---	---	---	
DAAM1	23002	broad.mit.edu	37	14	59797002	59797003	+	Intron	INS	-	ACAGA	ACAGA	rs145839594	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59797002_59797003insACAGA	uc001xdz.1	+						DAAM1_uc001xea.1_Intron|DAAM1_uc001xeb.1_Intron	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of						actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TTCAGTCTCTTACGTAGTTAAT	0.386													5	3	---	---	---	---	
ABCD4	5826	broad.mit.edu	37	14	74772359	74772359	+	5'Flank	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74772359delT	uc001xpr.2	-						ABCD4_uc001xps.2_5'Flank|ABCD4_uc001xpt.2_5'Flank|ABCD4_uc010tur.1_5'Flank|ABCD4_uc001xpu.2_5'Flank|ABCD4_uc001xpv.2_5'Flank	NM_005050	NP_005041	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D, member 4							ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00153)		GTGTTTGGGATTTTTTTTTAG	0.214													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347469	92347469	+	Intron	DEL	A	-	-	rs67931788	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347469delA	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				TATTCTacacacacacacaca	0.204													3	3	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347471	92347477	+	Intron	DEL	ACACACA	-	-	rs11353223		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347471_92347477delACACACA	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				TTCTacacacacacacacacacacaca	0.222													3	3	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27335988	27335988	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27335988delT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		gtgcaactgatttttgttgag	0.000													4	2	---	---	---	---	
COPS2	9318	broad.mit.edu	37	15	49421504	49421504	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49421504delA	uc001zxf.2	-						COPS2_uc001zxh.2_Intron|COPS2_uc010ufa.1_Intron	NM_004236	NP_004227	P61201	CSN2_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		cctgtctcttaaaaaaaaaaa	0.085													6	5	---	---	---	---	
PRTG	283659	broad.mit.edu	37	15	55994127	55994128	+	Intron	DEL	GA	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55994127_55994128delGA	uc002adg.2	-							NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ggagtcaggggagagagagggt	0.000													4	2	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75664693	75664693	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75664693delA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TTCTTAAAAGAAAAAAAAAAG	0.343													4	4	---	---	---	---	
NPRL3	8131	broad.mit.edu	37	16	187993	187993	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:187993delT	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1						ATGATTTTAATTTTTTTTTTC	0.373													5	3	---	---	---	---	
PPP4C	5531	broad.mit.edu	37	16	30093556	30093556	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30093556delA	uc002dwe.2	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|PPP4C_uc002dwf.2_Intron|PPP4C_uc002dwg.2_Intron|PPP4C_uc002dwh.2_Intron	NM_002720	NP_002711	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit						microtubule cytoskeleton organization|regulation of double-strand break repair via homologous recombination	centrosome|nucleus	metal ion binding|NF-kappaB-inducing kinase activity|protein binding|protein serine/threonine phosphatase activity			skin(1)	1						TAGAGAGAGGAAGGGGCCGGG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32848034	32848034	+	IGR	DEL	A	-	-	rs75274373		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32848034delA								TP53TG3B (159156 upstream) : SLC6A10P (40763 downstream)																							tatttctttcattaaaaaatt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33941390	33941391	+	IGR	INS	-	T	T	rs148453508		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33941390_33941391insT								None (None upstream) : MIR1826 (24117 downstream)																							AATTTGTGGGATTTTTAAAAGC	0.317													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33968149	33968153	+	IGR	DEL	TTTTC	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33968149_33968153delTTTTC								MIR1826 (2557 upstream) : UBE2MP1 (435649 downstream)																							cctgaacctgttttcttttctacaa	0.176													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55005874	55005875	+	IGR	DEL	TC	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55005874_55005875delTC								IRX5 (37481 upstream) : IRX6 (352596 downstream)																							tttctttctttctctctttctt	0.000													10	6	---	---	---	---	
NUP93	9688	broad.mit.edu	37	16	56878294	56878294	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56878294delC	uc002eka.2	+						NUP93_uc002ekb.2_Intron|NUP93_uc010vhi.1_Intron	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						AGGGATCTGTCCCTGACACGC	0.493													14	10	---	---	---	---	
CDH1	999	broad.mit.edu	37	16	68774184	68774184	+	Intron	DEL	T	-	-	rs140983652	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68774184delT	uc002ewg.1	+						CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.?(1)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGTCTTTACATTTTTTTTTTG	0.393			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				4	2	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81170896	81170896	+	Intron	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81170896delG	uc002fgh.1	-						PKD1L2_uc002fgf.1_5'Flank|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CTCACAAACTGGGGGTGAAAA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85848160	85848160	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85848160delT								COX4I1 (7555 upstream) : IRF8 (84614 downstream)																							CCttcttttctttttttttga	0.194													4	2	---	---	---	---	
WSCD1	23302	broad.mit.edu	37	17	5993530	5993531	+	Intron	INS	-	A	A	rs142258731	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5993530_5993531insA	uc010cli.2	+						WSCD1_uc002gcn.2_Intron|WSCD1_uc002gco.2_Intron|WSCD1_uc010clj.2_Intron	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1							integral to membrane	sulfotransferase activity				0						aaacaaaaaaCAAAAAAAAAAC	0.277													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21563911	21563911	+	IGR	DEL	T	-	-	rs112625646		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21563911delT								C17orf51 (86180 upstream) : FAM27L (261459 downstream)																							ctcttatggatttttttctgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21563966	21563966	+	IGR	DEL	G	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21563966delG								C17orf51 (86235 upstream) : FAM27L (261404 downstream)																							ctatattgtagattagtccat	0.000													8	4	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45668440	45668440	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45668440delA	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010wkv.1_Intron	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						GGTAGGCAGTAAAAAAAAATT	0.169													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11883216	11883217	+	IGR	INS	-	A	A	rs142433477	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11883216_11883217insA								GNAL (72 upstream) : MPPE1 (257 downstream)																							ATCACCGTCTTACTGCCTCCCC	0.361													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11883224	11883225	+	IGR	INS	-	T	T	rs111393316		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11883224_11883225insT								GNAL (80 upstream) : MPPE1 (249 downstream)																							CTTACTGCCTCCCCATCCACTG	0.366													5	4	---	---	---	---	
SS18	6760	broad.mit.edu	37	18	23618273	23618274	+	Intron	INS	-	CT	CT	rs147713301	by1000genomes	TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23618273_23618274insCT	uc002kvm.2	-						SS18_uc002kvn.2_Intron|SS18_uc010xbf.1_Intron|SS18_uc010xbg.1_Intron|SS18_uc010xbh.1_Intron|SS18_uc010xbi.1_Intron|SS18_uc010dlz.1_Intron	NM_001007559	NP_001007560	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding		SS18/SSX1(1169)|SS18/SSX2(702)|SS18/SSX4(12)	soft_tissue(1883)|ovary(1)	1884	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					ACAAAAAGATCCTTTTACATAA	0.243			T	SSX1| SSX2	synovial sarcoma								5	5	---	---	---	---	
CDH2	1000	broad.mit.edu	37	18	25568931	25568931	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25568931delC	uc002kwg.2	-						CDH2_uc010xbn.1_Intron	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						TTCTTGTCCACTTCAACAGAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31110107	31110107	+	IGR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31110107delT								ZNF536 (61142 upstream) : DKFZp566F0947 (530676 downstream)																							cttgcttatctttttttttct	0.020													4	2	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33133275	33133275	+	Intron	DEL	A	-	-	rs71747098		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33133275delA	uc002ntn.1	-						ANKRD27_uc002nto.1_Intron	NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					AGAAAAGCTGAAAAAAAAAAA	0.373													5	4	---	---	---	---	
LSM14A	26065	broad.mit.edu	37	19	34718608	34718608	+	3'UTR	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34718608delT	uc002nvb.3	+	11					LSM14A_uc002nva.3_3'UTR|LSM14A_uc010xru.1_3'UTR|LSM14A_uc002nvc.3_3'UTR	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a						cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)					CACTGAAAGGTTTTTTTTTTT	0.313													5	3	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41071881	41071883	+	Intron	DEL	ATG	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41071881_41071883delATG	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGAAGGAGGAATGGGAGTCAGAA	0.557													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43135743	43135743	+	Intron	DEL	C	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43135743delC	uc010eif.1	+						uc010eig.1_Intron|uc010eih.1_Intron					Homo sapiens cDNA FLJ39530 fis, clone PUAEN2004400.																		ATGTTTGTCTCCCCTGTGTGT	0.498													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	1683251	1683263	+	IGR	DEL	TAGCTCTACCAGT	-	-	rs35946389		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1683251_1683263delTAGCTCTACCAGT								SIRPG (44826 upstream) : SIRPA (191550 downstream)																							gttcgaatcatagctctaccagttaccaatgag	0.146													3	4	---	---	---	---	
ATRN	8455	broad.mit.edu	37	20	3599510	3599510	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3599510delA	uc002wim.2	+							NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						GTTTTTTAAGAAAAAAGGAAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	21645212	21645212	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21645212delA								NKX2-2 (150548 upstream) : PAX1 (41085 downstream)																							tatccaaaacaaaaaaaaata	0.000													4	2	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33176056	33176056	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33176056delA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						accctgtctcaaaaaaaaaag	0.000													3	3	---	---	---	---	
BPI	671	broad.mit.edu	37	20	36946524	36946524	+	Intron	DEL	A	-	-	rs71932802		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36946524delA	uc002xib.2	+							NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein						defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				caacagcaacaaaaaaaaaaa	0.035													5	3	---	---	---	---	
MYT1	4661	broad.mit.edu	37	20	62860798	62860798	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62860798delA	uc002yii.2	+						MYT1_uc002yij.2_Intron	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ACTGAGCTTTAAAAAAAAACA	0.398													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10705056	10705056	+	IGR	DEL	A	-	-	rs150496275		TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10705056delA								None (None upstream) : TPTE (201687 downstream)																							catctcacagagttgaaattt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28597049	28597049	+	IGR	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28597049delA								ADAMTS5 (257610 upstream) : NCRNA00113 (497649 downstream)																							CTGCATAGGGAAAAAAGAGCT	0.323													4	2	---	---	---	---	
CLTCL1	8218	broad.mit.edu	37	22	19198133	19198134	+	Intron	DEL	AC	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19198133_19198134delAC	uc002zpb.2	-						CLTCL1_uc011agv.1_Intron|CLTCL1_uc011agw.1_Intron|CLTCL1_uc011agt.1_5'Flank|CLTCL1_uc011agu.1_5'Flank|CLTCL1_uc010grm.1_5'Flank|CLTCL1_uc002zpe.2_Intron|CLTCL1_uc002zpd.1_Intron	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1						anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TAATTAATATACACACACATAA	0.267			T	?	ALCL								4	2	---	---	---	---	
CACNG2	10369	broad.mit.edu	37	22	37097401	37097402	+	Intron	DEL	TT	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37097401_37097402delTT	uc003aps.1	-						uc003apt.1_5'Flank	NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						CCCACAGGAGTTTTTTTTTCTG	0.490													4	2	---	---	---	---	
TXLNG	55787	broad.mit.edu	37	X	16837192	16837192	+	Intron	DEL	T	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16837192delT	uc004cxq.1	+						TXLNG_uc010ney.1_Intron	NM_018360	NP_060830	Q9NUQ3	TXLNG_HUMAN	gamma-taxilin						cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane				lung(1)	1						GGACGCTTAGTTTTTTTTTTT	0.303													5	3	---	---	---	---	
ZNF185	7739	broad.mit.edu	37	X	152138791	152138791	+	Intron	DEL	A	-	-			TCGA-CZ-5461-01A-01D-1501-10	TCGA-CZ-5461-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152138791delA	uc010ntv.1	+						ZNF185_uc011myg.1_Intron|ZNF185_uc011myh.1_Intron|ZNF185_uc011myi.1_Intron|ZNF185_uc011myj.1_Intron|ZNF185_uc011myk.1_Intron|ZNF185_uc004fgw.3_Intron|ZNF185_uc004fgu.2_Intron|ZNF185_uc004fgv.2_Intron|ZNF185_uc004fgx.2_Intron	NM_007150	NP_009081	O15231	ZN185_HUMAN	zinc finger protein 185							cytoplasm|cytoskeleton|focal adhesion	zinc ion binding			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ctccctactgaaaaaaaaggc	0.144													4	2	---	---	---	---	
