Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PHACTR4	65979	broad.mit.edu	37	1	28785764	28785764	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28785764C>A	uc001bpw.2	+	3	467	c.185C>A	c.(184-186)TCA>TAA	p.S62*	PHACTR4_uc001bpu.2_Nonsense_Mutation_p.S62*|PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Nonsense_Mutation_p.S46*|PHACTR4_uc001bpy.2_Nonsense_Mutation_p.S72*	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1	62							actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		AAAGAGACTTCAGAAGGTGAG	0.358													11	40	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35579780	35579780	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35579780A>T	uc001bym.2	+	11	2497	c.2349A>T	c.(2347-2349)GAA>GAT	p.E783D	ZMYM1_uc001byn.2_Missense_Mutation_p.E783D|ZMYM1_uc010ohu.1_Missense_Mutation_p.E764D|ZMYM1_uc001byo.2_Missense_Mutation_p.E423D|ZMYM1_uc009vut.2_Missense_Mutation_p.E708D	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	783						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGTCTGGGGAAATGTTGGCAA	0.328													13	60	---	---	---	---	PASS
PPIE	10450	broad.mit.edu	37	1	40211124	40211124	+	Silent	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40211124C>T	uc001cds.1	+	7	505	c.462C>T	c.(460-462)GGC>GGT	p.G154G	PPIE_uc001cdt.1_Silent_p.G88G|PPIE_uc010oiy.1_Silent_p.G75G|PPIE_uc001cdu.1_RNA|PPIE_uc001cdv.2_Silent_p.G154G|PPIE_uc001cdw.2_Silent_p.G154G|PPIE_uc001cdx.1_Silent_p.G70G	NM_006112	NP_006103	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E isoform 1	154	PPIase cyclophilin-type.				protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGCCGGCTGGCCGCATCCAGA	0.572													3	36	---	---	---	---	PASS
GBP1	2633	broad.mit.edu	37	1	89525013	89525013	+	Missense_Mutation	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89525013T>C	uc001dmx.2	-	4	635	c.415A>G	c.(415-417)ATG>GTG	p.M139V		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	139					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		AGTTGGTCCATAGCCTGCTGG	0.522													33	61	---	---	---	---	PASS
BTBD8	284697	broad.mit.edu	37	1	92554272	92554272	+	Missense_Mutation	SNP	T	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92554272T>G	uc001doo.2	+	2	434	c.167T>G	c.(166-168)TTC>TGC	p.F56C	BTBD8_uc010otc.1_RNA	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	56						nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		AGGGAAGAATTCCATACAGAT	0.308													16	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803543	142803543	+	Intron	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803543C>T	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		TGTTGGAATTCCTGATGAATC	0.179													6	156	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161166010	161166010	+	Silent	SNP	A	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161166010A>T	uc001fyt.3	-	3	1469	c.1041T>A	c.(1039-1041)ATT>ATA	p.I347I	ADAMTS4_uc001fyu.2_3'UTR	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	347	Peptidase M12B.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CATCCTCCACAATGGCACAGC	0.577													16	49	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164466509	164466509	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164466509C>G	uc002uck.1	-	3	2144	c.1833G>C	c.(1831-1833)ATG>ATC	p.M611I		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	611						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TGTCCAGTTGCATCAGAAATT	0.443													55	85	---	---	---	---	PASS
ACVR2B	93	broad.mit.edu	37	3	38519652	38519652	+	Missense_Mutation	SNP	A	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38519652A>G	uc003cif.2	+	4	415	c.391A>G	c.(391-393)ACA>GCA	p.T131A	ACVR2B_uc003cig.2_5'UTR	NM_001106	NP_001097	Q13705	AVR2B_HUMAN	activin A receptor, type IIB precursor	131	Extracellular (Potential).				activin receptor signaling pathway|anterior/posterior pattern formation|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|regulation of transcription, DNA-dependent	cell surface|cytoplasm|integral to plasma membrane	activin receptor activity|ATP binding|growth factor binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		GCCACCCCCGACAGCCCCCAC	0.632													15	10	---	---	---	---	PASS
CCDC37	348807	broad.mit.edu	37	3	126142411	126142411	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126142411C>A	uc003eiu.1	+	13	1309	c.1210C>A	c.(1210-1212)CTG>ATG	p.L404M	CCDC37_uc010hsg.1_Missense_Mutation_p.L405M	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	404	Potential.									ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		GAACCTGTCGCTGATCCAGAA	0.597													44	16	---	---	---	---	PASS
STAG1	10274	broad.mit.edu	37	3	136170989	136170989	+	Silent	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136170989C>T	uc003era.1	-	14	1606	c.1314G>A	c.(1312-1314)AAG>AAA	p.K438K	STAG1_uc003erb.1_Silent_p.K438K|STAG1_uc003erc.1_Silent_p.K212K|STAG1_uc010hua.1_Silent_p.K301K	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	438					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						TGCTAAATAGCCTGGAAATGA	0.398													14	62	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89628115	89628115	+	3'UTR	SNP	T	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89628115T>A	uc003hrw.1	+	26					HERC3_uc011cdn.1_3'UTR|HERC3_uc011cdo.1_3'UTR|FAM13AOS_uc003hry.1_5'Flank	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GGCCTGAGGCTTCTCAGCTTG	0.468											OREG0016265	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	30	---	---	---	---	PASS
C5orf55	116349	broad.mit.edu	37	5	442986	442986	+	5'UTR	SNP	T	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:442986T>A	uc010ita.2	-	1					EXOC3_uc003jba.2_5'Flank	NM_138464	NP_612473	Q8N2X6	CE055_HUMAN	hypothetical protein LOC116349 precursor							extracellular region					0						TCTCCGCAGGTTGGGAAGGGA	0.657													3	19	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32059357	32059357	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32059357G>T	uc003jhl.2	+	13	2601	c.2213G>T	c.(2212-2214)GGA>GTA	p.G738V	PDZD2_uc003jhm.2_Missense_Mutation_p.G738V|PDZD2_uc011cnx.1_Missense_Mutation_p.G564V	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	738	PDZ 4.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCAAGAGTTGGATTAGGCATT	0.418													22	31	---	---	---	---	PASS
DDX4	54514	broad.mit.edu	37	5	55056036	55056036	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55056036G>A	uc003jqg.3	+	4	210	c.136G>A	c.(136-138)GAT>AAT	p.D46N	DDX4_uc010ivz.2_Missense_Mutation_p.D46N|DDX4_uc003jqh.3_Missense_Mutation_p.D46N	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform	46					multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				AGAAATGGATGATGGACCTTC	0.388													59	181	---	---	---	---	PASS
AP3B1	8546	broad.mit.edu	37	5	77298669	77298669	+	3'UTR	SNP	A	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77298669A>G	uc003kfj.2	-	27						NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AGGCAGCAGTAGTGGATGCCA	0.468									Hermansky-Pudlak_syndrome				80	62	---	---	---	---	PASS
PCDH1	5097	broad.mit.edu	37	5	141248528	141248528	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141248528G>T	uc003llq.2	-	2	626	c.509C>A	c.(508-510)TCA>TAA	p.S170*	PCDH1_uc003llp.2_Nonsense_Mutation_p.S170*|PCDH1_uc011dbf.1_Nonsense_Mutation_p.S148*	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	170	Extracellular (Potential).|Cadherin 2.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GATGACTGGTGAGGCGAAGTT	0.562													62	314	---	---	---	---	PASS
PCDH1	5097	broad.mit.edu	37	5	141248529	141248529	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141248529A>T	uc003llq.2	-	2	625	c.508T>A	c.(508-510)TCA>ACA	p.S170T	PCDH1_uc003llp.2_Missense_Mutation_p.S170T|PCDH1_uc011dbf.1_Missense_Mutation_p.S148T	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	170	Extracellular (Potential).|Cadherin 2.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		ATGACTGGTGAGGCGAAGTTG	0.562													63	313	---	---	---	---	PASS
HLA-DQB2	3120	broad.mit.edu	37	6	32726774	32726774	+	Missense_Mutation	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32726774C>T	uc003oby.3	-	3	582	c.499G>A	c.(499-501)GCC>ACC	p.A167T	HLA-DQB2_uc003obz.2_Missense_Mutation_p.A167T	NR_003937		Q5SR06	Q5SR06_HUMAN	SubName: Full=Major histocompatibility complex, class II, DQ beta 2; SubName: Full=Putative uncharacterized protein ENSP00000372579;	167					antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	integral to membrane|MHC class II protein complex					0						ACAACACCGGCTGTCTCCTCC	0.542													6	36	---	---	---	---	PASS
CUTA	51596	broad.mit.edu	37	6	33384503	33384503	+	Missense_Mutation	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33384503T>C	uc003oej.1	-	6	752	c.464A>G	c.(463-465)CAG>CGG	p.Q155R	CUTA_uc003oek.1_Missense_Mutation_p.Q132R|CUTA_uc003oel.1_Missense_Mutation_p.Q132R|CUTA_uc003oem.1_Missense_Mutation_p.Q132R|CUTA_uc003oen.1_Missense_Mutation_p.Q174R	NM_001014840	NP_001014840	O60888	CUTA_HUMAN	cutA divalent cation tolerance homolog isoform	155					protein localization|response to metal ion	membrane	enzyme binding				0						AAAGTTCCCCTGTTCCACAGG	0.517													15	39	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134494169	134494169	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134494169C>G	uc003qen.3	-	6	630	c.541G>C	c.(541-543)GGT>CGT	p.G181R	SGK1_uc003qeo.3_Missense_Mutation_p.G276R|SGK1_uc011ect.1_Missense_Mutation_p.G171R|SGK1_uc011ecu.1_Intron|SGK1_uc011ecv.1_Missense_Mutation_p.G195R|SGK1_uc011ecw.1_Missense_Mutation_p.G209R	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	181	Protein kinase.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ACCTCTCCACCATTAATGTAG	0.428													21	54	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135516962	135516962	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135516962G>A	uc003qfc.2	+	9	1224	c.1025G>A	c.(1024-1026)AGT>AAT	p.S342N	MYB_uc003qfh.2_Missense_Mutation_p.S342N|MYB_uc003qfi.2_Missense_Mutation_p.S342N|MYB_uc010kgi.2_Missense_Mutation_p.S342N|MYB_uc003qfq.2_Missense_Mutation_p.S339N|MYB_uc010kgj.2_Missense_Mutation_p.S307N|MYB_uc003qfo.2_Intron|MYB_uc003qfu.2_Missense_Mutation_p.S339N|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_Intron|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_Translation_Start_Site|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Missense_Mutation_p.S154N|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.S342N|MYB_uc003qge.1_RNA	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog	342	Negative regulatory domain (By similarity).				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		CATGGAGACAGTGCACCTGTT	0.582			T	NFIB	adenoid cystic carcinoma								27	41	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136597333	136597333	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136597333G>T	uc003qgx.1	-	5	1583	c.1330C>A	c.(1330-1332)CTG>ATG	p.L444M	BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Missense_Mutation_p.L442M|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.L442M	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	444					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TTGCCTTTCAGTGAAACTTTG	0.393													27	189	---	---	---	---	PASS
RAB32	10981	broad.mit.edu	37	6	146865253	146865253	+	Silent	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146865253C>T	uc003qln.1	+	1	426	c.246C>T	c.(244-246)ATC>ATT	p.I82I		NM_006834	NP_006825	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	82	GTP (By similarity).				protein transport|small GTPase mediated signal transduction	mitochondrion	GTP binding				0		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		TGTGGGACATCGCGGGTAAGC	0.627													11	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	64525391	64525391	+	RNA	SNP	A	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64525391A>T	uc003ttt.1	+	2		c.227A>T			uc010kzt.1_RNA					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		TTCAACACCCAACAGCTTCCT	0.383													6	114	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71175760	71175760	+	Silent	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71175760C>A	uc003tvy.2	+	10	1515	c.1515C>A	c.(1513-1515)ACC>ACA	p.T505T	WBSCR17_uc003tvz.2_Silent_p.T204T	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	505	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCCGCTACACCAAGGAAGGCT	0.632													18	52	---	---	---	---	PASS
SLC25A13	10165	broad.mit.edu	37	7	95750406	95750406	+	3'UTR	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95750406T>C	uc003uof.3	-	18					SLC25A13_uc003uog.3_3'UTR|SLC25A13_uc011kik.1_3'UTR	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	AAACAAGAGATGGACGTAAAA	0.373													7	11	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8175907	8175907	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8175907C>A	uc003wsh.3	-	5	3978	c.3978G>T	c.(3976-3978)TGG>TGT	p.W1326C		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	1326							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GCCGAGGCCCCCACAGCAGGC	0.682													23	46	---	---	---	---	PASS
INTS9	55756	broad.mit.edu	37	8	28625776	28625776	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28625776C>G	uc003xha.2	-	17	2163	c.1864G>C	c.(1864-1866)GCT>CCT	p.A622P	INTS9_uc011lav.1_Missense_Mutation_p.A598P|INTS9_uc011law.1_Missense_Mutation_p.A601P|INTS9_uc011lax.1_Missense_Mutation_p.A515P|INTS9_uc010lvc.2_RNA	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1	622					snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AGCGTCTCAGCCTCCTGGAGC	0.522													66	199	---	---	---	---	PASS
CPNE3	8895	broad.mit.edu	37	8	87568470	87568470	+	Missense_Mutation	SNP	G	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87568470G>C	uc003ydv.2	+	16	1557	c.1395G>C	c.(1393-1395)GAG>GAC	p.E465D	CPNE3_uc003ydw.1_Missense_Mutation_p.E181D	NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III	465	VWFA.				lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2						GCGCCATGGAGTTTCTGGATG	0.493													15	32	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103327008	103327008	+	Missense_Mutation	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103327008C>T	uc003ykr.1	-	15	1891	c.1858G>A	c.(1858-1860)GCA>ACA	p.A620T	UBR5_uc003yks.1_Missense_Mutation_p.A620T	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	620					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ATTGAGGATGCATCACTACAC	0.418													9	28	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130206351	130206351	+	Silent	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130206351T>C	uc004bqw.3	+	5	786	c.372T>C	c.(370-372)TCT>TCC	p.S124S	ZNF79_uc011maf.1_Silent_p.S100S|ZNF79_uc011mag.1_Silent_p.S100S	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	124					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						AAGCCCTTTCTGAAGCTTCAT	0.483													23	70	---	---	---	---	PASS
GPSM1	26086	broad.mit.edu	37	9	139250844	139250844	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139250844A>T	uc004chd.2	+	13	1883	c.1663A>T	c.(1663-1665)ATC>TTC	p.I555F	GPSM1_uc011mdu.1_Missense_Mutation_p.I46F|GPSM1_uc004che.2_Missense_Mutation_p.I46F	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1 (AGS3-like, C.	555	GoLoco 2.				cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CTTCGACCTCATCGCCAGCTC	0.711													7	20	---	---	---	---	PASS
TMEM203	94107	broad.mit.edu	37	9	140099456	140099456	+	Nonstop_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140099456C>A	uc004clv.2	-	1	635	c.411G>T	c.(409-411)TAG>TAT	p.*137Y	NDOR1_uc004clx.2_5'Flank|NDOR1_uc004clw.2_5'Flank|NDOR1_uc011mes.1_5'Flank|NDOR1_uc004cly.2_5'Flank	NM_053045	NP_444273	Q969S6	TM203_HUMAN	transmembrane protein 203	137						integral to membrane					0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CTCGGTGAGGCTAGTTGACCC	0.622													12	20	---	---	---	---	PASS
PIPSL	266971	broad.mit.edu	37	10	95720191	95720191	+	Silent	SNP	A	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95720191A>C	uc009xuj.2	-	1	1482	c.963T>G	c.(961-963)GGT>GGG	p.G321G		NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						CCATGGTGCCACCCCGTCGAG	0.517													8	69	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121567515	121567515	+	Missense_Mutation	SNP	G	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121567515G>C	uc001leo.2	+	13	1678	c.1512G>C	c.(1510-1512)ATG>ATC	p.M504I		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	504	SAC.						phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ACCAGATAATGTGGGCCAATA	0.438													41	67	---	---	---	---	PASS
ESAM	90952	broad.mit.edu	37	11	124623594	124623594	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124623594C>A	uc001qav.3	-	7	1294	c.1121G>T	c.(1120-1122)GGT>GTT	p.G374V	VSIG2_uc001qas.2_5'Flank|VSIG2_uc001qat.2_5'Flank|ESAM_uc010sao.1_Intron|ESAM_uc001qau.3_Missense_Mutation_p.G301V|ESAM_uc001qaw.3_RNA|ESAM_uc001qax.3_RNA|ESAM_uc009zbi.2_3'UTR	NM_138961	NP_620411	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule precursor	374	Cytoplasmic (Potential).				blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction					0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		AGGCACAGCACCCATGCGGCT	0.587													14	74	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20832968	20832968	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20832968G>T	uc001reh.1	+	16	3211	c.3189G>T	c.(3187-3189)AAG>AAT	p.K1063N		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	1063	Catalytic (By similarity).				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	ttttaGAAAAGAAGACTTTCA	0.348													6	35	---	---	---	---	PASS
KRT71	112802	broad.mit.edu	37	12	52940112	52940112	+	Missense_Mutation	SNP	T	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52940112T>A	uc001sao.2	-	7	1353	c.1283A>T	c.(1282-1284)GAG>GTG	p.E428V		NM_033448	NP_258259	Q3SY84	K2C71_HUMAN	keratin 71	428	Coil 2.|Rod.						structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.194)		GGTGGCGATCTCCATGTCCAG	0.662													16	46	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81536908	81536908	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81536908G>A	uc001szl.1	+	5	894	c.803G>A	c.(802-804)GGT>GAT	p.G268D	ACSS3_uc001szm.1_Missense_Mutation_p.G267D	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	268						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TTGGCTCCCGGTCGTGACCTT	0.403													36	37	---	---	---	---	PASS
MSI1	4440	broad.mit.edu	37	12	120805861	120805861	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120805861C>G	uc001tye.1	-	4	281	c.217G>C	c.(217-219)GGG>CGG	p.G73R		NM_002442	NP_002433	O43347	MSI1H_HUMAN	musashi 1	73	RRM 1.				nervous system development	cytoplasm|nucleus	nucleotide binding			central_nervous_system(2)|breast(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTATCCACCCCCGCCTGGTCC	0.647													3	7	---	---	---	---	PASS
PSMD9	5715	broad.mit.edu	37	12	122354264	122354264	+	3'UTR	SNP	A	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122354264A>G	uc001ubl.2	+	6					WDR66_uc009zxk.2_5'Flank|PSMD9_uc009zxj.2_RNA|PSMD9_uc001ubm.2_3'UTR	NM_002813	NP_002804	O00233	PSMD9_HUMAN	proteasome 26S non-ATPase subunit 9						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of insulin secretion|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of insulin secretion|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|proteasome regulatory particle assembly|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	nucleus|proteasome regulatory particle	bHLH transcription factor binding|transcription coactivator activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CTTGCCCTGGACTTGGGTCTA	0.483													43	42	---	---	---	---	PASS
TINF2	26277	broad.mit.edu	37	14	24709719	24709719	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24709719C>G	uc001woa.3	-	6	1309	c.967G>C	c.(967-969)GCC>CCC	p.A323P	TINF2_uc010alm.2_Missense_Mutation_p.A147P|TINF2_uc001wob.3_Missense_Mutation_p.A323P|TINF2_uc010tof.1_Missense_Mutation_p.A288P|TINF2_uc001woc.3_3'UTR	NM_001099274	NP_001092744	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	323				ASTGKSKSPC -> PSNGKYKGPY (in Ref. 1; AAF18439).	negative regulation of epithelial cell proliferation|negative regulation of protein ADP-ribosylation|negative regulation of telomere maintenance via telomerase|positive regulation of telomere maintenance|protein localization to chromosome, telomeric region|telomere assembly|telomere maintenance via telomere lengthening	nuclear telomere cap complex|nucleoplasm|perinucleolar chromocenter	protein binding|protein binding|telomeric DNA binding				0				GBM - Glioblastoma multiforme(265;0.0185)		CCAGTGGAGGCTGCTCTTGTG	0.537									Ataxia_Pancytopenia_syndrome|Congenital_Dyskeratosis				14	38	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106054581	106054581	+	RNA	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106054581C>G	uc010tyt.1	-	3650		c.62905G>C			uc001yrs.2_RNA|uc001yrt.2_Missense_Mutation_p.R57T					Parts of antibodies, mostly variable regions.												0						TGGGAAGTTTCTGGCGGTCAC	0.632													11	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102293008	102293008	+	Intron	SNP	A	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102293008A>G	uc010usj.1	+						uc002bxo.2_5'Flank|uc002bxp.3_RNA|uc002bxq.2_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		GCGTGGGAACAAGAAGACACT	0.582													2	4	---	---	---	---	PASS
PRR14	78994	broad.mit.edu	37	16	30665503	30665503	+	Intron	SNP	T	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30665503T>G	uc002dyy.2	+						PRR14_uc002dyz.2_Intron|PRR14_uc002dza.2_Intron|PRR14_uc002dzb.1_5'UTR	NM_024031	NP_076936	Q9BWN1	PRR14_HUMAN	proline rich 14												0			Colorectal(24;0.103)			CTGGCTCAGGTGGGATACCTG	0.393													14	179	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31090216	31090216	+	Missense_Mutation	SNP	T	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31090216T>A	uc002eap.2	+	2	2860	c.2571T>A	c.(2569-2571)TTT>TTA	p.F857L		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	857	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CGAAGGAGTTTGACTCTCTGC	0.617													33	113	---	---	---	---	PASS
FUS	2521	broad.mit.edu	37	16	31201624	31201624	+	Silent	SNP	T	C	C	rs76570520		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31201624T>C	uc002ebf.2	+	12	1280	c.1197T>C	c.(1195-1197)GGT>GGC	p.G399G	FUS_uc002ebh.2_Silent_p.G398G|FUS_uc002ebg.2_Silent_p.G194G|FUS_uc002ebi.2_Silent_p.G400G|FUS_uc002ebj.2_Silent_p.G195G|FUS_uc010caj.1_Silent_p.G90G	NM_004960	NP_004951	P35637	FUS_HUMAN	fusion (involved in t(12;16) in malignant	399	Arg/Gly-rich.				cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		FUS/DDIT3(623)|FUS/ERG(163)|FUS/CREB3L2(158)|FUS/CREB3L1(6)|FUS/ATF1(4)|FUS/FEV(2)	soft_tissue(791)|haematopoietic_and_lymphoid_tissue(153)|bone(12)|breast(2)	958		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		gctatggaggtggtggcagtg	0.323			T	DDIT3|ERG|FEV|ATF1|CREB3L2|CREB3L1	liposarcoma|AML|Ewing sarcoma|angiomatoid fibrous histiocytoma|fibromyxoid sarcoma								34	48	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49670001	49670001	+	Missense_Mutation	SNP	C	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49670001C>T	uc002efs.2	-	5	3360	c.3062G>A	c.(3061-3063)CGC>CAC	p.R1021H	ZNF423_uc010vgn.1_Missense_Mutation_p.R904H	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1021	C2H2-type 24.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GACCACACAGCGGAAGCCCGT	0.602													11	24	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71683569	71683569	+	Missense_Mutation	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71683569T>C	uc002fax.2	-	18	3202	c.3196A>G	c.(3196-3198)AAG>GAG	p.K1066E	PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Missense_Mutation_p.K999E	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	1066						cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						GTGGCTGGCTTAGGGGCATCC	0.527													18	82	---	---	---	---	PASS
CTNS	1497	broad.mit.edu	37	17	3563891	3563891	+	3'UTR	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3563891C>G	uc002fwb.2	+	12					CTNS_uc002fwa.2_Intron|CTNS_uc010ckj.2_Intron|CTNS_uc010vrv.1_3'UTR|CTNS_uc010vrw.1_Intron	NM_004937	NP_004928	O60931	CTNS_HUMAN	cystinosin isoform 2						ATP metabolic process|brain development|cognition|glutathione metabolic process	integral to membrane|late endosome|lysosomal membrane	L-cystine transmembrane transporter activity				0				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	GCCTTGACACCGCCATCTCTT	0.662													18	137	---	---	---	---	PASS
CTNS	1497	broad.mit.edu	37	17	3563892	3563892	+	3'UTR	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3563892G>A	uc002fwb.2	+	12					CTNS_uc002fwa.2_Intron|CTNS_uc010ckj.2_Intron|CTNS_uc010vrv.1_3'UTR|CTNS_uc010vrw.1_Intron	NM_004937	NP_004928	O60931	CTNS_HUMAN	cystinosin isoform 2						ATP metabolic process|brain development|cognition|glutathione metabolic process	integral to membrane|late endosome|lysosomal membrane	L-cystine transmembrane transporter activity				0				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	CCTTGACACCGCCATCTCTTT	0.657													18	137	---	---	---	---	PASS
PRKAR1A	5573	broad.mit.edu	37	17	66525084	66525084	+	Missense_Mutation	SNP	G	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66525084G>C	uc002jhg.2	+	9	1023	c.843G>C	c.(841-843)AAG>AAC	p.K281N	PRKAR1A_uc002jhh.2_Missense_Mutation_p.K281N|PRKAR1A_uc002jhi.2_Missense_Mutation_p.K281N|PRKAR1A_uc002jhj.2_Missense_Mutation_p.K281N|PRKAR1A_uc002jhk.2_Missense_Mutation_p.K157N|PRKAR1A_uc002jhl.2_Missense_Mutation_p.K281N|PRKAR1A_uc002jhm.2_Missense_Mutation_p.K281N	NM_212471	NP_997636	P10644	KAP0_HUMAN	cAMP-dependent protein kinase, regulatory	281	cAMP 2.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity|protein binding			adrenal_gland(4)|lung(3)|thyroid(2)|soft_tissue(2)|breast(1)	12	Breast(10;1.64e-13)					ATGGGCAGAAGATTGTGGTGC	0.403			T|Mis|N|F|S	RET	papillary thyroid	myxoma|endocrine|papillary thyroid			Carney_Complex|Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial|Cardiac_Myxomas_Familial_Clustering_of				63	90	---	---	---	---	PASS
HN1	51155	broad.mit.edu	37	17	73132071	73132071	+	3'UTR	SNP	G	A	A	rs76538354		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73132071G>A	uc002jna.1	-	5					HN1_uc002jmz.1_3'UTR|HN1_uc002jnb.1_3'UTR|HN1_uc010dgc.1_RNA|HN1_uc002jnc.2_RNA|HN1_uc002jnd.2_3'UTR	NM_016185	NP_057269	Q9UK76	HN1_HUMAN	hematological and neurological expressed 1							nucleus					0	all_lung(278;0.14)|Lung NSC(278;0.168)					AAAAAAAAAAGACAGCAGTAC	0.403													6	53	---	---	---	---	PASS
TK1	7083	broad.mit.edu	37	17	76170832	76170832	+	3'UTR	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76170832C>A	uc002juw.2	-	7					TK1_uc002jux.2_3'UTR	NM_003258	NP_003249	P04183	KITH_HUMAN	thymidine kinase 1						DNA replication|protein homotetramerization|pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|thymidine kinase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)			GCGGCCCTCGCAGGTCCCTCA	0.662													4	6	---	---	---	---	PASS
ACTG1	71	broad.mit.edu	37	17	79477756	79477756	+	Missense_Mutation	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79477756T>C	uc002kaj.1	-	5	1113	c.1088A>G	c.(1087-1089)GAC>GGC	p.D363G	ACTG1_uc002kah.1_Missense_Mutation_p.D241G|ACTG1_uc002kai.1_Missense_Mutation_p.D320G|ACTG1_uc002kak.1_Missense_Mutation_p.D363G|ACTG1_uc010wun.1_Missense_Mutation_p.D363G|ACTG1_uc002kal.1_Missense_Mutation_p.D363G|ACTG1_uc002kag.2_RNA	NM_001614	NP_001605	P63261	ACTG_HUMAN	actin, gamma 1 propeptide	363					adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GCCCGACTCGTCGTACTCCTG	0.547													21	90	---	---	---	---	PASS
DPP9	91039	broad.mit.edu	37	19	4704158	4704158	+	Silent	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4704158G>A	uc002mba.2	-	6	843	c.585C>T	c.(583-585)GGC>GGT	p.G195G	DPP9_uc002mbb.2_Silent_p.G195G|DPP9_uc002mbc.2_Silent_p.G195G	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	166					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		AGCCGTTCTTGCCGCCGTCGC	0.672													20	46	---	---	---	---	PASS
DAND5	199699	broad.mit.edu	37	19	13084386	13084386	+	Missense_Mutation	SNP	C	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13084386C>G	uc002mwc.1	+	2	551	c.508C>G	c.(508-510)CGT>GGT	p.R170G	DAND5_uc010dyz.1_3'UTR	NM_152654	NP_689867	Q8N907	DAND5_HUMAN	dante precursor	170	CTCK.					extracellular region				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			CTCAGCCTCCCGTCGACGGGT	0.607													26	80	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17212688	17212688	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17212688G>A	uc010eak.2	+	2	313	c.161G>A	c.(160-162)AGC>AAC	p.S54N	MYO9B_uc002nfi.2_Missense_Mutation_p.S54N|MYO9B_uc002nfj.1_Missense_Mutation_p.S54N	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	54	Ras-associating.|Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						GCCATTGCCAGCCTGCGGCTG	0.637													7	21	---	---	---	---	PASS
FXYD3	5349	broad.mit.edu	37	19	35612224	35612224	+	Intron	SNP	T	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35612224T>G	uc010xsn.1	+						FXYD3_uc010xsj.1_Missense_Mutation_p.W58G|FXYD3_uc010xsk.1_Missense_Mutation_p.W58G|FXYD3_uc010xsl.1_Intron|FXYD3_uc010xsm.1_Intron|FXYD3_uc002nxw.2_Intron|FXYD3_uc002nxv.2_Intron|FXYD3_uc010xso.1_Intron	NM_001136011	NP_001129483	Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3							chloride channel complex|integral to plasma membrane	chloride channel activity				0	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CATACAGGGTTGGGGCCTGAC	0.522													5	35	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38948875	38948875	+	Missense_Mutation	SNP	A	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38948875A>G	uc002oit.2	+	18	2240	c.2110A>G	c.(2110-2112)AAC>GAC	p.N704D	RYR1_uc002oiu.2_Missense_Mutation_p.N704D	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	704	Cytoplasmic.|B30.2/SPRY 1.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CTGGGGCGGCAACGGGGTCGG	0.652													35	84	---	---	---	---	PASS
CLC	1178	broad.mit.edu	37	19	40222118	40222118	+	Missense_Mutation	SNP	T	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40222118T>A	uc002omh.2	-	4	407	c.331A>T	c.(331-333)ACC>TCC	p.T111S		NM_001828	NP_001819	Q05315	LPPL_HUMAN	Charcot-Leyden crystal protein	111	Galectin.				lipid catabolic process|multicellular organismal development		carboxylesterase activity|lysophospholipase activity|sugar binding				0	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)		TGGTCAAAGGTGTAAGAGGAT	0.408													9	255	---	---	---	---	PASS
CSRP2BP	57325	broad.mit.edu	37	20	18125954	18125954	+	Missense_Mutation	SNP	G	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18125954G>T	uc002wqj.2	+	3	959	c.337G>T	c.(337-339)GGC>TGC	p.G113C	CSRP2BP_uc002wqk.2_5'UTR	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	113					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						CTCAGCAGATGGCAAGGAGCA	0.458													61	161	---	---	---	---	PASS
LSM14B	149986	broad.mit.edu	37	20	60701436	60701436	+	Missense_Mutation	SNP	A	G	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60701436A>G	uc010gjy.1	+	3	574	c.368A>G	c.(367-369)TAC>TGC	p.Y123C	LSM14B_uc002ybt.2_Missense_Mutation_p.Y123C|LSM14B_uc010gjx.1_Missense_Mutation_p.Y149C|LSM14B_uc002ybv.2_Missense_Mutation_p.Y123C|LSM14B_uc010gjz.1_Missense_Mutation_p.Y4C|LSM14B_uc010zzz.1_Missense_Mutation_p.Y4C	NM_144703	NP_653304	Q9BX40	LS14B_HUMAN	LSM14 homolog B	123					multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			ATGGCGCCCTACGGCCCGCTG	0.632													9	21	---	---	---	---	PASS
SLCO4A1	28231	broad.mit.edu	37	20	61300316	61300316	+	Silent	SNP	G	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61300316G>T	uc002ydb.1	+	11	2116	c.1911G>T	c.(1909-1911)GTG>GTT	p.V637V	SLCO4A1_uc002ydc.1_RNA|LOC100127888_uc002ydd.2_5'Flank|SLCO4A1_uc002yde.1_Silent_p.V39V	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family	637	Helical; Name=11; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			TCGGCTGGGTGATCGACAAGG	0.647											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	29	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62050979	62050979	+	Missense_Mutation	SNP	G	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62050979G>A	uc002yey.1	-	12	1471	c.1294C>T	c.(1294-1296)CGC>TGC	p.R432C	KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	432	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	TACCTAGAGCGTCCGGGGCAG	0.662													6	21	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32624302	32624302	+	Silent	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32624302C>A	uc002yow.1	-	6	1639	c.1167G>T	c.(1165-1167)CGG>CGT	p.R389R	TIAM1_uc011adk.1_Silent_p.R389R|TIAM1_uc011adl.1_Silent_p.R389R|TIAM1_uc002yox.1_5'UTR	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	389					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						TCTCCAGCTCCCGCCGGAAGT	0.687													18	58	---	---	---	---	PASS
GCFC1	94104	broad.mit.edu	37	21	34120909	34120909	+	Silent	SNP	T	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34120909T>C	uc002yqn.2	-	11	2014	c.1824A>G	c.(1822-1824)AAA>AAG	p.K608K	GCFC1_uc002yql.2_Silent_p.K117K|GCFC1_uc002yqm.2_Silent_p.K102K|GCFC1_uc002yqo.2_RNA|GCFC1_uc002yqp.2_Silent_p.K608K	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate	608						cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						ATGTGTAGTATTTTGAACGCC	0.383													45	56	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47705106	47705106	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47705106C>A	uc002zir.1	-	1	131	c.95G>T	c.(94-96)CGA>CTA	p.R32L	C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	32					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					TTGACCAAATCGAAATGGCGG	0.458													23	70	---	---	---	---	PASS
L3MBTL2	83746	broad.mit.edu	37	22	41609749	41609749	+	Intron	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41609749C>A	uc003azo.2	+						L3MBTL2_uc010gyi.1_Intron|L3MBTL2_uc003azn.2_Intron|uc003azp.1_RNA	NM_031488	NP_113676	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3						CACACCAGTACCTCCCATTCC	0.507													6	15	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50054338	50054338	+	Missense_Mutation	SNP	C	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50054338C>A	uc004dox.3	+	6	3467	c.3169C>A	c.(3169-3171)CCA>ACA	p.P1057T	CCNB3_uc004doy.2_Missense_Mutation_p.P1057T|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1057					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					TGGAACCAGCCCATATGTGTT	0.522													17	102	---	---	---	---	PASS
VGLL1	51442	broad.mit.edu	37	X	135638638	135638638	+	Missense_Mutation	SNP	A	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135638638A>T	uc004ezy.2	+	5	887	c.717A>T	c.(715-717)AAA>AAT	p.K239N		NM_016267	NP_057351	Q99990	VGLL1_HUMAN	vestigial like 1	239					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription coactivator activity				0	Acute lymphoblastic leukemia(192;0.000127)					CACCTGGGAAATACTCACTTA	0.478													21	97	---	---	---	---	PASS
RIMKLA	284716	broad.mit.edu	37	1	42880841	42880842	+	3'UTR	INS	-	CA	CA	rs140509445	by1000genomes	TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42880841_42880842insCA	uc001chi.2	+	5						NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						ATAAAAACACTCAAGAACAACG	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165677605	165677608	+	Intron	DEL	AGTC	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165677605_165677608delAGTC	uc001gdi.2	+											Homo sapiens carbonic anhydrase XIV (CA14) pseudogene, mRNA (cDNA clone IMAGE:4643256).																		GTGCCCACATAGTCAGGACCACTG	0.510													4	4	---	---	---	---	
CCDC88A	55704	broad.mit.edu	37	2	55589419	55589421	+	Intron	DEL	AAT	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55589419_55589421delAAT	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc010ypb.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						AAACTTTCACAATATACTGAAAG	0.325													38	25	---	---	---	---	
MPHOSPH10	10199	broad.mit.edu	37	2	71361866	71361866	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71361866delT	uc002sht.1	+	4	1389	c.1037delT	c.(1036-1038)GTTfs	p.V346fs	MPHOSPH10_uc010feb.1_Frame_Shift_Del_p.V346fs	NM_005791	NP_005782	O00566	MPP10_HUMAN	M-phase phosphoprotein 10	346					RNA splicing, via transesterification reactions|rRNA processing	chromosome|nucleolus|small nucleolar ribonucleoprotein complex	protein binding			skin(2)|ovary(1)	3						GATACAGGTGTTTTAAATGTA	0.294													77	52	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88091375	88091375	+	Intron	DEL	G	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091375delG	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						aaaaaaaaaaGACCAAAATGT	0.234													4	2	---	---	---	---	
ZAP70	7535	broad.mit.edu	37	2	98355676	98355677	+	Intron	DEL	CA	-	-	rs56067009		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98355676_98355677delCA	uc002syd.1	+						ZAP70_uc002sye.1_Intron|ZAP70_uc002syf.1_Intron	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa						immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						TCTCACACCCCAGAGTCCTCTC	0.609													2	4	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187503359	187503360	+	Intron	DEL	GT	-	-	rs71946663		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187503359_187503360delGT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		tcttttgagcgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188260	10188260	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188260delT	uc003bvc.2	+	2	616	c.403delT	c.(403-405)TTAfs	p.L135fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	135	Involved in binding to CCT complex.		L -> F (in hemangioblastoma).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L135fs*24(6)|p.L135*(2)|p.L135F(1)|p.L135fs*9(1)|p.L135fs*7(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCAAACTGAATTATTTGTGCC	0.438		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				85	99	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54872837	54872838	+	Intron	INS	-	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54872837_54872838insT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		TATTTAAAAGGTTTTTTTTTTA	0.317													4	2	---	---	---	---	
LMOD3	56203	broad.mit.edu	37	3	69168594	69168595	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69168594_69168595insT	uc003dns.2	-	2	1120_1121	c.911_912insA	c.(910-912)AACfs	p.N304fs	LMOD3_uc003dnt.2_Frame_Shift_Ins_p.N304fs	NM_198271	NP_938012	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	304						cytoplasm|cytoskeleton	tropomyosin binding			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		CACGCAACATGTTAGCCAAGGC	0.411													63	74	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100570788	100570788	+	Intron	DEL	A	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100570788delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						TAAGTTGCTTAAAAAAAAAAA	0.338													8	5	---	---	---	---	
CPB1	1360	broad.mit.edu	37	3	148562685	148562685	+	Intron	DEL	A	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148562685delA	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TAAAAGCACCAAAAAAAAAAA	0.139													4	3	---	---	---	---	
CHRD	8646	broad.mit.edu	37	3	184102073	184102073	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184102073delT	uc003fov.2	+						CHRD_uc003fow.2_Intron|CHRD_uc003fox.2_Intron|CHRD_uc003foy.2_Intron|CHRD_uc010hyc.2_Intron|CHRD_uc011brr.1_Intron	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor						BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ccttacatagtttttggcttt	0.005													4	2	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20619357	20619357	+	Intron	DEL	A	-	-	rs71653889		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20619357delA	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						agaaaaagtgaaaaaaaaaaa	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													21	12	---	---	---	---	
UBE2D3	7323	broad.mit.edu	37	4	103790068	103790069	+	5'Flank	INS	-	C	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103790068_103790069insC	uc003hwq.2	-						CISD2_uc003hwt.3_5'Flank|UBE2D3_uc003hwr.2_5'Flank	NM_181893	NP_871622	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3 isoform 3						apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TACGTCACTCGCCCGCCGCCAA	0.515													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16902322	16902322	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16902322delT	uc003jft.3	-						MYO10_uc003jfu.2_Intron|MYO10_uc003jfv.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						gcccggctaattttttttttt	0.164													4	2	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70939860	70939861	+	Intron	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs80094732	by1000genomes	TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70939860_70939861insTGTGTGTGTG	uc003kbs.3	+						MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	gtgcgcgggcatgtgtgtgtgt	0.173													8	5	---	---	---	---	
FCHO2	115548	broad.mit.edu	37	5	72378704	72378704	+	Intron	DEL	T	-	-	rs11349696		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72378704delT	uc003kcl.2	+						FCHO2_uc011csl.1_Intron|FCHO2_uc010izb.2_Intron|FCHO2_uc011csn.1_Intron	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a											ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TGAAAATTGAttttttttttt	0.144													8	12	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80404654	80404661	+	Intron	DEL	TGTGTGTG	-	-	rs143382125		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80404654_80404661delTGTGTGTG	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TTACCTACTCtgtgtgtgtgtgtgtgtg	0.269													4	2	---	---	---	---	
ANXA6	309	broad.mit.edu	37	5	150512589	150512590	+	Intron	INS	-	AAAAT	AAAAT	rs146823252	by1000genomes	TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150512589_150512590insAAAAT	uc003ltl.1	-						ANXA6_uc011dcp.1_Intron|ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAAAGAAAAGAGATAAAGAAA	0.371													5	4	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167671782	167671782	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167671782delT	uc010jjd.2	+						ODZ2_uc003lzr.3_Intron|ODZ2_uc003lzt.3_Intron|ODZ2_uc010jje.2_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TTCCGGCttcttttttttttt	0.249													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42467818	42467818	+	IGR	DEL	A	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42467818delA								TRERF1 (47953 upstream) : UBR2 (64240 downstream)																							AGTTTATGTTAAAAAAAAAAA	0.343													4	2	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84371393	84371393	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84371393delT	uc011dze.1	-						SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron|SNAP91_uc011dzf.1_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		CATAGTACTATTTTTTTTTAA	0.323													7	4	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													4	3	---	---	---	---	
TEX10	54881	broad.mit.edu	37	9	103065721	103065721	+	Intron	DEL	C	-	-	rs35109045		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103065721delC	uc004bas.2	-						TEX10_uc011lvf.1_Intron|TEX10_uc011lvg.1_Intron	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1							integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CACAGACACACCCCCCCCCCC	0.363													9	5	---	---	---	---	
SPOCK2	9806	broad.mit.edu	37	10	73848106	73848106	+	5'UTR	DEL	G	-	-	rs34081585		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73848106delG	uc001jso.1	-	1					SPOCK2_uc001jsp.2_5'UTR|SPOCK2_uc010qjs.1_5'UTR|SPOCK2_uc010qjt.1_5'UTR	NM_014767	NP_055582	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						extracellular matrix organization|regulation of cell differentiation|signal transduction|synapse assembly	proteinaceous extracellular matrix	calcium ion binding				0						GGTTCGACCTGGGGGGGTCTT	0.697													8	7	---	---	---	---	
KIF11	3832	broad.mit.edu	37	10	94399350	94399351	+	Intron	INS	-	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94399350_94399351insA	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						accctgtctctaaaaaaaaaaa	0.124													4	2	---	---	---	---	
IFITM1	8519	broad.mit.edu	37	11	314534	314534	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:314534delT	uc001loy.3	+							NM_003641	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1						negative regulation of cell proliferation|regulation of immune response|response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding|receptor signaling protein activity				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGTGTGTGGCTTTGGGGAATC	0.567													5	4	---	---	---	---	
DCHS1	8642	broad.mit.edu	37	11	6662745	6662746	+	In_Frame_Ins	INS	-	CAG	CAG			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6662745_6662746insCAG	uc001mem.1	-	2	509_510	c.99_100insCTG	c.(97-102)insCTG	p.33_34insL		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	33_34					calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCCCAGCCCCcagcagcagca	0.530													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129902697	129902698	+	IGR	INS	-	T	T	rs71481901	byFrequency	TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129902697_129902698insT								NCRNA00167 (27316 upstream) : APLP2 (37018 downstream)																							TTTTTCCATGGTTTTTTTTTTT	0.376													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	24737258	24737263	+	5'Flank	DEL	CCCCCA	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24737258_24737263delCCCCCA	uc001rgb.1	-											Homo sapiens cDNA FLJ32894 fis, clone TESTI2004994.																		CTTCGATTAGcccccacccccacccc	0.432													4	3	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	99837603	99837604	+	Intron	INS	-	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99837603_99837604insA	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		AATAAAAATAGAACTGCCATGA	0.351													63	61	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	130919596	130919596	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130919596delT	uc001uil.2	-						RIMBP2_uc001uim.2_Intron|RIMBP2_uc001uin.1_Intron	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CACCAGAAtcttttttttttt	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22999179	22999180	+	Intron	INS	-	C	C	rs138189166		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22999179_22999180insC	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_Intron|uc001wfi.2_Intron|uc001wfk.2_Intron|uc001wfl.2_Intron|uc010ajy.1_Intron|uc001wfn.2_Intron|uc001wfp.2_Intron|uc001wfq.1_Intron|uc001wfr.1_Intron|uc010ajz.1_Intron|uc001wfs.1_Intron|uc001wft.1_Intron|uc001wfu.2_Intron|uc001wfv.1_Intron|uc001wfw.1_Intron|uc001wfx.2_Intron|uc001wfy.1_Intron|uc001wfz.1_Intron|uc001wgb.2_5'Flank|uc001wgc.2_5'Flank|uc001wgd.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AAAGGGGGAATCCAGCCAGAGC	0.436													5	3	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105356242	105356243	+	Intron	INS	-	ATGG	ATGG			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105356242_105356243insATGG	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_Intron|KIAA0284_uc001ypt.2_Intron	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		tggatggacaaatggatggatg	0.213													6	3	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72164666	72164669	+	Intron	DEL	AAGA	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72164666_72164669delAAGA	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				AGGGTGTATGAAGATCACACTCTT	0.510													10	5	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16056552	16056552	+	Intron	DEL	T	-	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16056552delT	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GCTACATCTCTCTTATCCCAA	0.338													10	5	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31618462	31618463	+	Intron	INS	-	T	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31618462_31618463insT	uc002hhu.2	-						ACCN1_uc002hht.2_Frame_Shift_Ins_p.Y224fs	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GCTCGCCGCGGTACTTGCAGGA	0.688													22	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41796306	41796306	+	IGR	DEL	C	-	-	rs78166835		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41796306delC								MEOX1 (57044 upstream) : SOST (34793 downstream)																							AGACAACAttctttttttttt	0.229													4	2	---	---	---	---	
GPATCH8	23131	broad.mit.edu	37	17	42514114	42514115	+	Intron	INS	-	C	C	rs146935319	by1000genomes	TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42514114_42514115insC	uc002igw.1	-						GPATCH8_uc002igv.1_Intron|GPATCH8_uc010wiz.1_Intron	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8							intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		ACCTTGGCTGACGTCCAGTTGG	0.371													2	5	---	---	---	---	
USP32	84669	broad.mit.edu	37	17	58332409	58332410	+	Intron	INS	-	T	T	rs35284371		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58332409_58332410insT	uc002iyo.1	-						USP32_uc002iyn.1_Intron|USP32_uc010wov.1_Intron	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32						protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TAATGTAGTTCttttttttttt	0.351													5	3	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79408694	79408695	+	Intron	INS	-	A	A	rs11333301		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79408694_79408695insA	uc002kaf.2	+						BAHCC1_uc002kae.2_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			gactccgtctcaaaaaaaaaaa	0.218													4	2	---	---	---	---	
MARK4	57787	broad.mit.edu	37	19	45767748	45767749	+	Intron	INS	-	A	A	rs79255924		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45767748_45767749insA	uc002pbb.1	+						MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Intron|MARK4_uc002pbc.1_5'Flank			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		aactccatctcaaaaaaaaaaa	0.228													4	4	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45850598	45850599	+	Intron	INS	-	A	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45850598_45850599insA	uc002pbf.1	+						KLC3_uc002pbe.2_3'UTR|KLC3_uc010ejy.1_Intron|KLC3_uc002pbg.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		aactccgtctcaaaaaaaaaaa	0.233													4	2	---	---	---	---	
RBM39	9584	broad.mit.edu	37	20	34328950	34328952	+	Intron	DEL	TTC	-	-	rs8183604		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34328950_34328952delTTC	uc002xeb.2	-						RBM39_uc002xea.2_Intron|RBM39_uc010gfn.2_Intron|RBM39_uc010zvm.1_Intron|RBM39_uc002xeg.2_Intron|RBM39_uc002xec.2_Intron|RBM39_uc002xed.2_Intron|RBM39_uc002xee.2_Intron|RBM39_uc002xef.2_Intron|RBM39_uc010zvn.1_Intron	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					GTAAACAtttttctttttttttt	0.177													6	3	---	---	---	---	
CSE1L	1434	broad.mit.edu	37	20	47693690	47693690	+	Intron	DEL	C	-	-	rs11481347		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47693690delC	uc002xty.2	+						CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Intron|CSE1L_uc010ghy.2_Intron|CSE1L_uc010zyh.1_Intron	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CCCTTTTGttctttttttttt	0.179													8	4	---	---	---	---	
EDN3	1908	broad.mit.edu	37	20	57899654	57899654	+	Intron	DEL	C	-	-	rs111992101		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57899654delC	uc002yap.2	+						EDN3_uc002yaq.2_3'UTR|EDN3_uc002yar.2_3'UTR|EDN3_uc002yas.2_3'UTR	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					CTTAACAATACCCCCCCCCCA	0.507													5	3	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31298126	31298127	+	Intron	DEL	CC	-	-	rs56186828		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298126_31298127delCC	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						AAAAAAAAAACCAAAAAAAAAA	0.282													2	4	---	---	---	---	
