Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
LOC649330	649330	broad.mit.edu	37	1	12907709	12907709	+	Missense_Mutation	SNP	C	T	T	rs4026148		TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12907709C>T	uc009vno.2	-	1	529	c.434G>A	c.(433-435)CGC>CAC	p.R145H	HNRNPCL1_uc010obf.1_Missense_Mutation_p.R145H	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	145							nucleic acid binding|nucleotide binding				0						TAGACGTTGACGTTTCGAGGG	0.483																0.358621	301.429575	306.529498	104	186	KEEP	---	---	---	---	56	67	91	121	-1	capture	Missense_Mutation	SNP	12907709	12907709	LOC649330	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8802	8
LOC649330	649330	broad.mit.edu	37	1	12907886	12907886	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12907886G>A	uc009vno.2	-	1	352	c.257C>T	c.(256-258)GCA>GTA	p.A86V	HNRNPCL1_uc010obf.1_Missense_Mutation_p.A86V	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	86							nucleic acid binding|nucleotide binding				0						TTTTGGCTCTGCAGCCAGGTT	0.488																0.175299	79.616782	104.641836	44	207	KEEP	---	---	---	---	21	28	115	129	-1	capture	Missense_Mutation	SNP	12907886	12907886	LOC649330	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	8802	8
HSPG2	3339	broad.mit.edu	37	1	22216489	22216489	+	Nonsense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22216489G>A	uc001bfj.2	-	6	599	c.559C>T	c.(559-561)CGA>TGA	p.R187*	HSPG2_uc009vqd.2_Nonsense_Mutation_p.R187*|HSPG2_uc009vqe.1_Silent_p.S85S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	187	SEA.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CCCAGGCGTCGGAACTGGAAT	0.488																0.247863	72.218658	78.986697	29	88	KEEP	---	---	---	---	13	17	45	49	-1	capture	Nonsense_Mutation	SNP	22216489	22216489	HSPG2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	7355	8
SLC2A1	6513	broad.mit.edu	37	1	43396355	43396355	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43396355C>T	uc001cik.2	-	4	983	c.458G>A	c.(457-459)CGT>CAT	p.R153H		NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose	153	Cytoplasmic (Potential).		R -> H (in GLUT1DS2).|R -> C (in GLUT1DS1; 44% of wild-type glucose uptake activity).		carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	CAGGGCCCCACGAAGGGCTGT	0.647																0.393939	37.47949	37.800342	13	20	KEEP	---	---	---	---	4	10	11	11	-1	capture	Missense_Mutation	SNP	43396355	43396355	SLC2A1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14430	8
GPR52	9293	broad.mit.edu	37	1	174417940	174417940	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:174417940C>T	uc001gka.1	+	1	729	c.691C>T	c.(691-693)CGT>TGT	p.R231C	RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjx.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron|uc010pmu.1_RNA	NM_005684	NP_005675	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	231	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1						CAAAATTTGCCGTCAGCACAC	0.463	Ovarian(92;924 1390 1930 16467 40583)															0.339152	399.87898	409.050509	136	265	KEEP	---	---	---	---	68	73	139	138	-1	capture	Missense_Mutation	SNP	174417940	174417940	GPR52	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6631	8
KIF21B	23046	broad.mit.edu	37	1	200974537	200974537	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200974537G>A	uc001gvs.1	-	5	948	c.631C>T	c.(631-633)CGC>TGC	p.R211C	KIF21B_uc001gvr.1_Missense_Mutation_p.R211C|KIF21B_uc009wzl.1_Missense_Mutation_p.R211C|KIF21B_uc010ppn.1_Missense_Mutation_p.R211C|KIF21B_uc001gvt.1_5'UTR	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	211	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						GCTGTGGTGCGGGACAGGGCC	0.627																0.301282	130.124133	135.593041	47	109	KEEP	---	---	---	---	24	28	64	56	-1	capture	Missense_Mutation	SNP	200974537	200974537	KIF21B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8211	8
OR2T4	127074	broad.mit.edu	37	1	248525343	248525343	+	Missense_Mutation	SNP	G	A	A	rs141022739		TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248525343G>A	uc001ieh.1	+	1	461	c.461G>A	c.(460-462)CGC>CAC	p.R154H		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	154	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCTATGACCGCTACGTGGCC	0.522																0.329815	341.640927	351.323594	125	254	KEEP	---	---	---	---	81	60	167	136	-1	capture	Missense_Mutation	SNP	248525343	248525343	OR2T4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10931	8
CRTAC1	55118	broad.mit.edu	37	10	99683092	99683092	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:99683092C>T	uc001kou.1	-	4	843	c.487G>A	c.(487-489)GAT>AAT	p.D163N	CRTAC1_uc001kov.2_Missense_Mutation_p.D152N|CRTAC1_uc001kot.1_5'UTR	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	163						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TTGACCTCATCGCTCAGGATG	0.612																0.0625	-5.388228	10.568428	5	75	KEEP	---	---	---	---	4	2	38	44	-1	capture	Missense_Mutation	SNP	99683092	99683092	CRTAC1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3861	8
DEAF1	10522	broad.mit.edu	37	11	688025	688025	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:688025C>T	uc001lqq.1	-	4	1243	c.550G>A	c.(550-552)GGC>AGC	p.G184S	DEAF1_uc009ycf.1_RNA	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1	184					embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		TTTTCTTGGCCGGGAGCCAGA	0.547																0.333333	94.244499	96.678714	33	66	KEEP	---	---	---	---	19	17	41	32	-1	capture	Missense_Mutation	SNP	688025	688025	DEAF1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4338	8
OR51E1	143503	broad.mit.edu	37	11	4674216	4674216	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4674216C>T	uc001lzi.3	+	2	604	c.460C>T	c.(460-462)CGG>TGG	p.R154W		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCTGTGGTGCGGGGGGCTGC	0.557																0.336957	76.67215	78.798953	31	61	KEEP	---	---	---	---	17	17	33	46	-1	capture	Missense_Mutation	SNP	4674216	4674216	OR51E1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	10998	8
OR2AG1	144125	broad.mit.edu	37	11	6807033	6807033	+	Silent	SNP	C	G	G			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6807033C>G	uc001mer.1	+	1	765	c.765C>G	c.(763-765)GCC>GCG	p.A255A		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATGGAGCTGCCACATTCATGT	0.488																0.414634	154.282048	155.069296	51	72	KEEP	---	---	---	---	29	25	57	41	-1	capture	Silent	SNP	6807033	6807033	OR2AG1	11	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	10888	8
OR4C12	283093	broad.mit.edu	37	11	50004010	50004010	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:50004010A>G	uc010ria.1	-	1	28	c.28T>C	c.(28-30)TTC>CTC	p.F10L		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						ATTAAAATGAATTCAGTCACA	0.338																0.247788	85.199898	91.785575	28	85	KEEP	---	---	---	---	13	22	48	58	-1	capture	Missense_Mutation	SNP	50004010	50004010	OR4C12	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	10950	8
FIBP	9158	broad.mit.edu	37	11	65655866	65655866	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65655866G>A	uc001ogd.2	-	1	145	c.24C>T	c.(22-24)TTC>TTT	p.F8F	FIBP_uc009yqu.2_Silent_p.F8F|FIBP_uc001oge.2_Silent_p.F8F|FIBP_uc010roq.1_Silent_p.F8F|FIBP_uc010ror.1_Silent_p.F8F|CCDC85B_uc001ogf.2_5'Flank	NM_198897	NP_942600	O43427	FIBP_HUMAN	FGF intracellular binding protein isoform a	8					fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.166)		TGTTCCCCACGAAGATGTCCA	0.682														OREG0021090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.8	13.408064	13.82124	4	1	KEEP	---	---	---	---	1	3	0	2	-1	capture	Silent	SNP	65655866	65655866	FIBP	11	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	5832	8
MMP1	4312	broad.mit.edu	37	11	102663439	102663439	+	Silent	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102663439C>T	uc001phi.2	-	7	1073	c.930G>A	c.(928-930)CCG>CCA	p.P310P	uc001phh.1_Intron|MMP1_uc010ruv.1_Silent_p.P244P	NM_002421	NP_002412	P03956	MMP1_HUMAN	matrix metalloproteinase 1 isoform 1	310	Hemopexin-like 1.				blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)|lung(1)	4	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)		GCTCAACTTCCGGGTAGAAGG	0.423					227											0.344498	213.342914	217.803409	72	137	KEEP	---	---	---	---	31	44	68	75	-1	capture	Silent	SNP	102663439	102663439	MMP1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9560	8
OR8D4	338662	broad.mit.edu	37	11	123777647	123777647	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123777647G>A	uc010saa.1	+	1	509	c.509G>A	c.(508-510)GGA>GAA	p.G170E		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	170	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TCTTTCTGTGGATCAAACATC	0.418																0.356701	503.017487	511.79966	173	312	KEEP	---	---	---	---	100	87	178	180	-1	capture	Missense_Mutation	SNP	123777647	123777647	OR8D4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11137	8
ANKS1B	56899	broad.mit.edu	37	12	100166859	100166859	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100166859G>A	uc001tge.1	-	8	1386	c.969C>T	c.(967-969)ACC>ACT	p.T323T	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Silent_p.T289T	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	323						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CTCCAGTGACGGTTTCACCTA	0.323																0.291667	41.630469	43.496446	14	34	KEEP	---	---	---	---	7	7	15	25	-1	capture	Silent	SNP	100166859	100166859	ANKS1B	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	683	8
KDM2B	84678	broad.mit.edu	37	12	121880300	121880300	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121880300C>T	uc001uat.2	-	19	3048	c.2944G>A	c.(2944-2946)GAG>AAG	p.E982K	KDM2B_uc001uaq.2_Missense_Mutation_p.E422K|KDM2B_uc010szy.1_Missense_Mutation_p.E422K|KDM2B_uc001uar.2_Missense_Mutation_p.E573K|KDM2B_uc001uas.2_Missense_Mutation_p.E913K|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_Missense_Mutation_p.E230K|KDM2B_uc010szx.1_Missense_Mutation_p.E230K|KDM2B_uc001uap.2_RNA	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	982					embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						TTGGGCTCCTCGCCCTCGCTC	0.632																0.272727	45.138836	48.201197	18	48	KEEP	---	---	---	---	13	7	30	23	-1	capture	Missense_Mutation	SNP	121880300	121880300	KDM2B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8047	8
PAN3	255967	broad.mit.edu	37	13	28841518	28841518	+	Missense_Mutation	SNP	A	C	C			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28841518A>C	uc001urz.2	+	11	1342	c.1334A>C	c.(1333-1335)TAC>TCC	p.Y445S	PAN3_uc010tdo.1_Missense_Mutation_p.Y591S|PAN3_uc001ury.2_Missense_Mutation_p.Y279S|PAN3_uc001urx.2_Missense_Mutation_p.Y391S	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	591	Protein kinase.|Interaction with PAN2.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GCTGATGCCTACTTCACCAAG	0.363																0.330097	109.706023	112.346058	34	69	KEEP	---	---	---	---	19	17	34	37	-1	capture	Missense_Mutation	SNP	28841518	28841518	PAN3	13	A	C	C	C	1	0	0	0	0	1	0	0	0	182	14	4	4	11319	8
RXFP2	122042	broad.mit.edu	37	13	32360537	32360537	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32360537C>T	uc001utt.2	+	12	1018	c.947C>T	c.(946-948)ACG>ATG	p.T316M	RXFP2_uc010aba.2_Missense_Mutation_p.T275M	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	316	Extracellular (Potential).|LRR 8.					integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TCTAGCAATACGATAACGGAA	0.358																0.395161	147.947542	149.140843	49	75	KEEP	---	---	---	---	26	31	42	45	-1	capture	Missense_Mutation	SNP	32360537	32360537	RXFP2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13652	8
SLCO3A1	28232	broad.mit.edu	37	15	92663774	92663774	+	Silent	SNP	A	C	C			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:92663774A>C	uc002bqx.2	+	5	1290	c.1089A>C	c.(1087-1089)GCA>GCC	p.A363A	SLCO3A1_uc002bqy.2_Silent_p.A363A|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Silent_p.A305A	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,	363	Helical; Name=7; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			TGGAGATTGCAGTGGTGGCTG	0.567																0.364362	421.353711	427.446421	137	239	KEEP	---	---	---	---	81	88	169	171	-1	capture	Silent	SNP	92663774	92663774	SLCO3A1	15	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	14620	8
LASS3	204219	broad.mit.edu	37	15	101013181	101013181	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101013181C>T	uc002bvz.2	-	10	1188	c.686G>A	c.(685-687)CGC>CAC	p.R229H	LASS3_uc002bwa.2_Missense_Mutation_p.R240H|LASS3_uc002bwb.2_Missense_Mutation_p.R229H	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3	229	TLC.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			GGTCCCACTGCGAATATAATT	0.433	NSCLC(135;1149 2482 10680 49908)															0.268116	97.117219	103.813659	37	101	KEEP	---	---	---	---	23	19	42	64	-1	capture	Missense_Mutation	SNP	101013181	101013181	LASS3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8560	8
PDIA2	64714	broad.mit.edu	37	16	334899	334899	+	Missense_Mutation	SNP	G	A	A	rs141542731	by1000genomes	TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:334899G>A	uc002cgn.1	+	9	1670	c.562G>A	c.(562-564)GCC>ACC	p.A188T	PDIA2_uc010bqt.1_Missense_Mutation_p.A33T|PDIA2_uc002cgo.1_Missense_Mutation_p.A188T	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase A2 precursor	188					apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)|skin(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				CGAGGACGTGGCCACCTTCTT	0.672																0.066667	-2.310592	6.447678	3	42	KEEP	---	---	---	---	2	1	18	27	-1	capture	Missense_Mutation	SNP	334899	334899	PDIA2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11571	8
MYH13	8735	broad.mit.edu	37	17	10212612	10212612	+	Missense_Mutation	SNP	C	T	T	rs142532419	by1000genomes	TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10212612C>T	uc002gmk.1	-	35	5198	c.5108G>A	c.(5107-5109)CGC>CAC	p.R1703H		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1703	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TGACAGCCTGCGGGTCCGCTC	0.667																0.352941	50.735497	51.707745	18	33	KEEP	---	---	---	---	13	12	23	25	-1	capture	Missense_Mutation	SNP	10212612	10212612	MYH13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9942	8
STAT5A	6776	broad.mit.edu	37	17	40458321	40458321	+	Silent	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40458321C>T	uc002hzj.1	+	14	2178	c.1536C>T	c.(1534-1536)AAC>AAT	p.N512N	STAT5A_uc010cya.1_Silent_p.N512N|STAT5A_uc010cyb.1_Silent_p.N481N|STAT5A_uc010cyc.1_Silent_p.N482N|STAT5A_uc010cyd.1_5'UTR|STAT5A_uc010cye.1_5'UTR	NM_003152	NP_003143	P42229	STA5A_HUMAN	signal transducer and activator of transcription	512					2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|oxaloacetate metabolic process|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		AGGCGCTCAACATGAAATTCA	0.572					465											0.382114	127.988341	129.489737	47	76	KEEP	---	---	---	---	30	22	48	40	-1	capture	Silent	SNP	40458321	40458321	STAT5A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	15158	8
MPP3	4356	broad.mit.edu	37	17	41888484	41888484	+	Missense_Mutation	SNP	T	G	G			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41888484T>G	uc002iei.3	-	17	1511	c.1345A>C	c.(1345-1347)AAC>CAC	p.N449H	MPP3_uc002ieh.2_Missense_Mutation_p.N474H|MPP3_uc002iej.2_RNA	NM_001932	NP_001923	Q13368	MPP3_HUMAN	palmitoylated membrane protein 3	449	Guanylate kinase-like.				signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)|skin(1)	2		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		ACGTACTTGTTGTGATGTAAG	0.483																0.294118	151.214086	157.018406	45	108	KEEP	---	---	---	---	20	27	56	62	-1	capture	Missense_Mutation	SNP	41888484	41888484	MPP3	17	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	9647	8
ASXL3	80816	broad.mit.edu	37	18	31320334	31320334	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:31320334G>A	uc010dmg.1	+	11	3021	c.2966G>A	c.(2965-2967)CGG>CAG	p.R989Q	ASXL3_uc002kxq.2_Missense_Mutation_p.R696Q	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	989					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						CAGTCAACCCGGAACATATCA	0.433																0.32	23.693874	24.412103	8	17	KEEP	---	---	---	---	4	4	10	7	-1	capture	Missense_Mutation	SNP	31320334	31320334	ASXL3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1059	8
ZNF516	9658	broad.mit.edu	37	18	74154420	74154420	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74154420G>T	uc010dqx.1	-	2	826	c.591C>A	c.(589-591)CAC>CAA	p.H197Q	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	197	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		TGAACGGCTTGTGCGCCTGGT	0.667																0.088889	1.162725	8.849518	4	41	KEEP	---	---	---	---	7	12	31	30	0.368421052632	capture	Missense_Mutation	SNP	74154420	74154420	ZNF516	18	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	17839	8
CCDC105	126402	broad.mit.edu	37	19	15132195	15132195	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15132195G>A	uc002nae.2	+	4	1004	c.905G>A	c.(904-906)CGG>CAG	p.R302Q		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	302	Potential.				microtubule cytoskeleton organization	microtubule				ovary(1)	1						GAAGCCAAGCGGTTGTTGGTC	0.597																0.363636	56.382556	57.283306	20	35	KEEP	---	---	---	---	11	9	19	20	-1	capture	Missense_Mutation	SNP	15132195	15132195	CCDC105	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2714	8
TMEM161A	54929	broad.mit.edu	37	19	19232455	19232455	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19232455T>C	uc002nlg.2	-	8	709	c.679A>G	c.(679-681)ATC>GTC	p.I227V	TMEM161A_uc010eca.2_RNA|TMEM161A_uc002nlh.2_Missense_Mutation_p.I202V|TMEM161A_uc002nli.2_Missense_Mutation_p.I124V|TMEM161A_uc002nlj.2_Missense_Mutation_p.I102V	NM_017814	NP_060284	Q9NX61	T161A_HUMAN	transmembrane protein 161A precursor	227	Helical; (Potential).				cellular response to oxidative stress|cellular response to UV|negative regulation of apoptosis|positive regulation of DNA repair|response to retinoic acid	integral to membrane				breast(2)	2			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			CCCACGCGGATAGCCAGCTTG	0.677																0.375	59.036855	59.695543	18	30	KEEP	---	---	---	---	10	18	18	22	-1	capture	Missense_Mutation	SNP	19232455	19232455	TMEM161A	19	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	15959	8
NUP62	23636	broad.mit.edu	37	19	50411934	50411934	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50411934G>A	uc002pqx.2	-	2	1235	c.1131C>T	c.(1129-1131)CGC>CGT	p.R377R	IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_Silent_p.R377R|NUP62_uc002pqz.2_Silent_p.R377R|NUP62_uc002pra.2_Silent_p.R377R|NUP62_uc002prb.2_Silent_p.R377R|NUP62_uc002prc.2_Silent_p.R301R	NM_153719	NP_714941	P37198	NUP62_HUMAN	nucleoporin 62kDa	377	Potential.				carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding				0		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TCTCCACCTCGCGGTGCAGGC	0.612																0.386364	245.745543	248.22724	85	135	KEEP	---	---	---	---	47	53	98	83	-1	capture	Silent	SNP	50411934	50411934	NUP62	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10675	8
CAD	790	broad.mit.edu	37	2	27446562	27446562	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27446562A>G	uc002rji.2	+	7	1103	c.941A>G	c.(940-942)AAC>AGC	p.N314S	CAD_uc010eyw.2_Missense_Mutation_p.N314S	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	314	Glutamine amidotransferase type-1.|GATase (Glutamine amidotransferase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CTCTTCACCAACGCCAATGAT	0.537					653											0.239092	416.362694	452.007313	137	436	KEEP	---	---	---	---	72	91	250	262	-1	capture	Missense_Mutation	SNP	27446562	27446562	CAD	2	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	2541	8
RHOQ	23433	broad.mit.edu	37	2	46803312	46803312	+	Missense_Mutation	SNP	T	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46803312T>A	uc002rva.2	+	3	607	c.288T>A	c.(286-288)TTT>TTA	p.F96L	uc002rvb.2_Intron	NM_012249	NP_036381	P17081	RHOQ_HUMAN	ras-like protein TC10 precursor	96					cortical actin cytoskeleton organization|insulin receptor signaling pathway|negative regulation of establishment of protein localization in plasma membrane|positive regulation of filopodium assembly|positive regulation of glucose import|positive regulation of transcription from RNA polymerase II promoter|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	actin filament|cytosol|plasma membrane	GBD domain binding|GTP binding|GTPase activity|profilin binding			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CAGCCTCATTTCAAAATGTGA	0.418																0.343284	125.605854	128.5147	46	88	KEEP	---	---	---	---	38	15	42	57	-1	capture	Missense_Mutation	SNP	46803312	46803312	RHOQ	2	T	A	A	A	1	0	0	0	0	1	0	0	0	803	62	4	4	13234	8
LRP2	4036	broad.mit.edu	37	2	170060768	170060768	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170060768G>A	uc002ues.2	-	42	7942	c.7729C>T	c.(7729-7731)CGC>TGC	p.R2577C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2577	LDL-receptor class B 28.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AGAGTGCTGCGTTCAATCCTC	0.433					2055											0.374286	368.606656	373.473954	131	219	KEEP	---	---	---	---	66	90	121	136	-1	capture	Missense_Mutation	SNP	170060768	170060768	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8872	8
ISM1	140862	broad.mit.edu	37	20	13279712	13279712	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13279712C>T	uc010gce.1	+	6	1007	c.1001C>T	c.(1000-1002)ACG>ATG	p.T334M	TASP1_uc010zri.1_Intron	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN	isthmin 1 homolog precursor	334	AMOP.					extracellular region					0						GCCTACAGCACGGCCGACATC	0.582																0.5	51.974946	51.974946	17	17	KEEP	---	---	---	---	14	4	12	6	-1	capture	Missense_Mutation	SNP	13279712	13279712	ISM1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7783	8
SCN10A	6336	broad.mit.edu	37	3	38739171	38739171	+	Missense_Mutation	SNP	C	T	T	rs148537653		TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38739171C>T	uc003ciq.2	-	27	5540	c.5540G>A	c.(5539-5541)CGA>CAA	p.R1847Q		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1847					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	TTGCTTCCATCGGAGAGTGGT	0.473																0.505051	157.052413	157.054675	50	49	KEEP	---	---	---	---	39	35	24	35	-1	capture	Missense_Mutation	SNP	38739171	38739171	SCN10A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13805	8
CCBP2	1238	broad.mit.edu	37	3	42906816	42906816	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42906816G>A	uc003cme.2	+	3	1001	c.822G>A	c.(820-822)ACG>ACA	p.T274T	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmf.2_Silent_p.T274T|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2	274	Extracellular (Potential).				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		TTCTGCATACGCTGTTGGACC	0.537																0.50996	379.492508	379.514451	128	123	KEEP	---	---	---	---	65	70	72	62	-1	capture	Silent	SNP	42906816	42906816	CCBP2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2708	8
PLXNB1	5364	broad.mit.edu	37	3	48463528	48463528	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48463528G>A	uc003csw.2	-	6	1776	c.1506C>T	c.(1504-1506)TGC>TGT	p.C502C	PLXNB1_uc003csu.2_Silent_p.C502C|PLXNB1_uc003csx.2_Silent_p.C502C|PLXNB1_uc010hjx.1_RNA	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	502	Extracellular (Potential).				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CAAGGAGCACGCACCACCCAC	0.557																0.460526	105.413928	105.517176	35	41	KEEP	---	---	---	---	16	28	23	30	-1	capture	Silent	SNP	48463528	48463528	PLXNB1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	12026	8
SOX14	8403	broad.mit.edu	37	3	137484152	137484152	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137484152G>A	uc003erm.1	+	1	574	c.526G>A	c.(526-528)GCC>ACC	p.A176T		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	176					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						CCAGAACGGCGCCTTCGGCAG	0.667																0.3	7.120204	7.478223	3	7	KEEP	---	---	---	---	1	2	2	9	-1	capture	Missense_Mutation	SNP	137484152	137484152	SOX14	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14837	8
ATR	545	broad.mit.edu	37	3	142183989	142183989	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142183989C>A	uc003eux.3	-	41	7113	c.6991G>T	c.(6991-6993)GAC>TAC	p.D2331Y	ATR_uc003euy.1_Missense_Mutation_p.D217Y	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2331	PI3K/PI4K.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TTTCTCAGGTCATCTTTTGGC	0.299					936						Other_conserved_DNA_damage_response_genes					0.15625	24.454876	35.293195	15	81	KEEP	---	---	---	---	7	9	40	55	0.5625	capture	Missense_Mutation	SNP	142183989	142183989	ATR	3	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	1195	8
NSUN7	79730	broad.mit.edu	37	4	40800851	40800851	+	Nonsense_Mutation	SNP	G	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40800851G>T	uc003gvj.3	+	10	1825	c.1330G>T	c.(1330-1332)GAA>TAA	p.E444*	NSUN7_uc003gvi.3_Nonsense_Mutation_p.E444*	NM_024677	NP_078953			NOL1/NOP2/Sun domain family, member 7												0						AGTTTTTCCAGAAGAAAATGA	0.343																0.285714	104.477717	110.54284	42	105	KEEP	---	---	---	---	24	21	53	59	0.533333333333	capture	Nonsense_Mutation	SNP	40800851	40800851	NSUN7	4	G	T	T	T	1	0	0	0	0	0	1	0	0	429	33	5	4	10590	8
NPY5R	4889	broad.mit.edu	37	4	164271493	164271493	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164271493G>A	uc003iqn.2	+	4	250	c.68G>A	c.(67-69)CGG>CAG	p.R23Q		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	23	Extracellular (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				GCTGCCACTCGGAATTCTGAT	0.378	Melanoma(139;1287 1774 9781 19750 25599)															0.368794	159.763499	161.896823	52	89	KEEP	---	---	---	---	35	36	60	53	-1	capture	Missense_Mutation	SNP	164271493	164271493	NPY5R	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10517	8
ADAM29	11086	broad.mit.edu	37	4	175897289	175897289	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175897289G>A	uc003iuc.2	+	5	1283	c.613G>A	c.(613-615)GTC>ATC	p.V205I	ADAM29_uc003iud.2_Missense_Mutation_p.V205I|ADAM29_uc010irr.2_Missense_Mutation_p.V205I|ADAM29_uc011cki.1_Missense_Mutation_p.V205I	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	205	Peptidase M12B.|Extracellular (Potential).		V -> I (in a colorectal cancer sample; somatic mutation).		proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding	p.V205I(1)		skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AATTGTAGTCGTCATTGATAA	0.348	Ovarian(140;1727 1835 21805 25838 41440)			p.V205I(SNUC5-Tumor)|p.V205I(HCC2279-Tumor)	106											0.340659	175.903636	179.983361	62	120	KEEP	---	---	---	---	40	31	57	73	-1	capture	Missense_Mutation	SNP	175897289	175897289	ADAM29	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	247	8
IL31RA	133396	broad.mit.edu	37	5	55206410	55206410	+	Nonsense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:55206410C>T	uc003jql.2	+	12	1617	c.1552C>T	c.(1552-1554)CGA>TGA	p.R518*	IL31RA_uc003jqm.2_Nonsense_Mutation_p.R486*|IL31RA_uc003jqn.2_Nonsense_Mutation_p.R518*|IL31RA_uc010iwa.1_Nonsense_Mutation_p.R481*|IL31RA_uc003jqo.2_Nonsense_Mutation_p.R376*	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	486	Extracellular (Potential).|Fibronectin type-III 5.				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				GTCCCTGAAACGAAAGACCTC	0.458																0.4	212.314618	213.931287	74	111	KEEP	---	---	---	---	42	36	53	65	-1	capture	Nonsense_Mutation	SNP	55206410	55206410	IL31RA	5	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	7614	8
GABRB2	2561	broad.mit.edu	37	5	160721153	160721153	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160721153G>A	uc003lys.1	-	11	1692	c.1474C>T	c.(1474-1476)CGC>TGC	p.R492C	GABRB2_uc011deh.1_Missense_Mutation_p.R293C|GABRB2_uc003lyr.1_Missense_Mutation_p.R454C|GABRB2_uc003lyt.1_Missense_Mutation_p.R454C|GABRB2_uc010jiu.1_Missense_Mutation_p.R391C	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	492	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	AAGAATATGCGGGACCACCGA	0.468																0.299065	90.460868	94.320035	32	75	KEEP	---	---	---	---	16	20	34	53	-1	capture	Missense_Mutation	SNP	160721153	160721153	GABRB2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6109	8
GABRA6	2559	broad.mit.edu	37	5	161113291	161113291	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161113291G>T	uc003lyu.2	+	2	432	c.94G>T	c.(94-96)GTC>TTC	p.V32F		NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	32	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTCAGAAAACGTCAGTCGGAT	0.488													TCGA Ovarian(5;0.080)			0.303797	144.853599	150.273569	48	110	KEEP	---	---	---	---	29	22	66	49	0.56862745098	capture	Missense_Mutation	SNP	161113291	161113291	GABRA6	5	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	6107	8
GABRP	2568	broad.mit.edu	37	5	170222299	170222299	+	Missense_Mutation	SNP	C	T	T	rs145233692		TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170222299C>T	uc003mau.2	+	5	526	c.328C>T	c.(328-330)CGC>TGC	p.R110C	GABRP_uc011dev.1_Missense_Mutation_p.R110C	NM_014211	NP_055026	O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	110	Extracellular (Potential).					cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			breast(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCTGGATGCCCGCCTCGTGGA	0.562																0.378007	328.318185	332.102855	110	181	KEEP	---	---	---	---	50	64	85	102	-1	capture	Missense_Mutation	SNP	170222299	170222299	GABRP	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6116	8
HRH2	3274	broad.mit.edu	37	5	175110333	175110333	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:175110333G>A	uc003mdd.2	+	1	1870	c.97G>A	c.(97-99)GTT>ATT	p.V33I	HRH2_uc003mdc.3_Missense_Mutation_p.V33I	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2	33	Helical; Name=1; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)	CCTCATCACCGTTGCTGGCAA	0.572																0.32987	343.28424	353.16681	127	258	KEEP	---	---	---	---	76	66	170	127	-1	capture	Missense_Mutation	SNP	175110333	175110333	HRH2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7281	8
C6orf15	29113	broad.mit.edu	37	6	31079167	31079167	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31079167C>A	uc003nsk.1	-	2	969	c.969G>T	c.(967-969)CAG>CAT	p.Q323H		NM_014070	NP_054789	Q6UXA7	CF015_HUMAN	STG protein precursor	323											0						TCTAGCCCCACTGCAACCTAG	0.562																0.066667	-1.612932	7.146525	3	42	KEEP	---	---	---	---	2	1	19	27	0.333333333333	capture	Missense_Mutation	SNP	31079167	31079167	C6orf15	6	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	2313	8
KCNQ5	56479	broad.mit.edu	37	6	73787150	73787150	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:73787150G>A	uc003pgk.2	+	4	1069	c.722G>A	c.(721-723)CGC>CAC	p.R241H	KCNQ5_uc003pgj.3_Missense_Mutation_p.R241H|KCNQ5_uc011dyh.1_Missense_Mutation_p.R241H|KCNQ5_uc011dyi.1_Missense_Mutation_p.R241H|KCNQ5_uc010kat.2_Missense_Mutation_p.R241H|KCNQ5_uc011dyj.1_Missense_Mutation_p.R241H|KCNQ5_uc011dyk.1_5'UTR	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	241	Helical; Voltage-sensor; Name=Segment S4; (Potential).				protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity	p.R241H(1)		ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		CAGATCCTCCGCATGGTGCGC	0.443	GBM(142;1375 1859 14391 23261 44706)															0.387324	154.48681	156.068294	55	87	KEEP	---	---	---	---	34	26	48	46	-1	capture	Missense_Mutation	SNP	73787150	73787150	KCNQ5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8008	8
PRDM13	59336	broad.mit.edu	37	6	100062050	100062050	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100062050G>A	uc003pqg.1	+	4	1800	c.1539G>A	c.(1537-1539)GGG>GGA	p.G513G		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	513					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CCGAGCTGGGGTCGCTGGCCA	0.662																0.459459	49.876057	49.928177	17	20	KEEP	---	---	---	---	9	11	14	14	-1	capture	Silent	SNP	100062050	100062050	PRDM13	6	G	A	A	A	1	0	0	0	0	0	0	0	1	561	44	2	2	12350	8
BEND3	57673	broad.mit.edu	37	6	107391831	107391831	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:107391831G>A	uc003prs.2	-	5	1214	c.564C>T	c.(562-564)AAC>AAT	p.N188N		NM_001080450	NP_001073919	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	188										ovary(3)	3						TGTTGGGGTCGTTGTCAGTGC	0.577																0.4375	116.315622	116.644188	42	54	KEEP	---	---	---	---	24	21	32	24	-1	capture	Silent	SNP	107391831	107391831	BEND3	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1388	8
KIAA1244	57221	broad.mit.edu	37	6	138612912	138612912	+	Silent	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138612912C>T	uc003qhu.2	+	19	3090	c.3090C>T	c.(3088-3090)AGC>AGT	p.S1030S		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	1030					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		ACCACTTCAGCGATGGTGCCT	0.647																0.444444	22.996623	23.045161	8	10	KEEP	---	---	---	---	4	7	7	5	-1	capture	Silent	SNP	138612912	138612912	KIAA1244	6	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	8139	8
DNAH11	8701	broad.mit.edu	37	7	21583201	21583201	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21583201C>T	uc003svc.2	+	1	369	c.338C>T	c.(337-339)GCG>GTG	p.A113V		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	113	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGGCGCCTTGCGGCTTCCCAG	0.617												Kartagener_syndrome				0.142857	4.711644	7.292312	3	18	KEEP	---	---	---	---	3	0	9	10	-1	capture	Missense_Mutation	SNP	21583201	21583201	DNAH11	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4557	8
STK31	56164	broad.mit.edu	37	7	23802525	23802525	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23802525C>T	uc003sws.3	+	11	1466	c.1399C>T	c.(1399-1401)CGC>TGC	p.R467C	STK31_uc003swt.3_Missense_Mutation_p.R444C|STK31_uc011jze.1_Missense_Mutation_p.R467C|STK31_uc010kuq.2_Missense_Mutation_p.R444C	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	467							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TCTTAATAAACGCTTAAAAAC	0.289				p.R467G(NB1-Tumor)	598											0.222222	43.309068	49.057005	18	63	KEEP	---	---	---	---	11	8	36	29	-1	capture	Missense_Mutation	SNP	23802525	23802525	STK31	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15186	8
TXNDC3	51314	broad.mit.edu	37	7	37923916	37923916	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37923916C>T	uc003tfn.2	+	13	1378	c.1006C>T	c.(1006-1008)CGT>TGT	p.R336C		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	336	NDK 2.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TGATGTTTTGCGTATTATTAA	0.303	Ovarian(108;903 1537 27096 29907 47400)											Kartagener_syndrome				0.259615	67.989617	73.424226	27	77	KEEP	---	---	---	---	16	12	36	46	-1	capture	Missense_Mutation	SNP	37923916	37923916	TXNDC3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16680	8
HECW1	23072	broad.mit.edu	37	7	43360248	43360248	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43360248G>A	uc003tid.1	+	5	972	c.367G>A	c.(367-369)GAA>AAA	p.E123K	HECW1_uc011kbi.1_Missense_Mutation_p.E123K|HECW1_uc003tie.1_Missense_Mutation_p.E155K	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	123					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GGTCTTGTCCGAAAACTTTCT	0.428					944											0.215054	47.765795	54.724327	20	73	KEEP	---	---	---	---	9	12	37	45	-1	capture	Missense_Mutation	SNP	43360248	43360248	HECW1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6968	8
SRCRB4D	136853	broad.mit.edu	37	7	76019569	76019569	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76019569C>T	uc003ufb.2	-	11	1883	c.1535G>A	c.(1534-1536)CGC>CAC	p.R512H	SRCRB4D_uc003ufa.2_Missense_Mutation_p.A14T	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	512	SRCR 4.					extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						GCCCAGCTGGCGGCACAGGAC	0.667																0.183908	30.958436	39.108372	16	71	KEEP	---	---	---	---	10	9	45	52	-1	capture	Missense_Mutation	SNP	76019569	76019569	SRCRB4D	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15029	8
KIAA1324L	222223	broad.mit.edu	37	7	86521158	86521158	+	Missense_Mutation	SNP	T	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86521158T>A	uc011kha.1	-	21	3097	c.2912A>T	c.(2911-2913)GAG>GTG	p.E971V	KIAA1324L_uc003uif.1_Missense_Mutation_p.E731V|KIAA1324L_uc011kgz.1_Missense_Mutation_p.E857V|KIAA1324L_uc003uie.2_Missense_Mutation_p.E804V	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	971	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					GAGTTCACACTCTTTTGAGTT	0.323																0.149425	20.855016	31.081138	13	74	KEEP	---	---	---	---	6	9	36	41	-1	capture	Missense_Mutation	SNP	86521158	86521158	KIAA1324L	7	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	8146	8
MCM7	4176	broad.mit.edu	37	7	99693629	99693629	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99693629G>A	uc003usw.1	-	11	1873	c.1363C>T	c.(1363-1365)CGC>TGC	p.R455C	MCM7_uc003usv.1_Missense_Mutation_p.R279C|MCM7_uc003usx.1_Missense_Mutation_p.R279C|uc003usy.1_5'Flank|MIR25_hsa-mir-25|MI0000082_5'Flank|uc003usz.1_5'Flank|MIR93_hsa-mir-93|MI0000095_5'Flank|uc003uta.1_5'Flank|MIR106B_hsa-mir-106b|MI0000734_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	455	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	ATGGCTGTGCGGTCGGCCTCA	0.612																0.064286	-7.525209	20.095984	9	131	KEEP	---	---	---	---	9	2	58	78	-1	capture	Missense_Mutation	SNP	99693629	99693629	MCM7	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9305	8
CPA2	1358	broad.mit.edu	37	7	129909521	129909521	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129909521A>G	uc003vpq.2	+	3	185	c.166A>G	c.(166-168)AAA>GAA	p.K56E	CPA2_uc011kpc.1_Missense_Mutation_p.K56E	NM_001869	NP_001860	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic) precursor	56					proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					TGATTTTTGGAAATCACCCAC	0.493																0.224599	116.56073	129.588573	42	145	KEEP	---	---	---	---	20	29	79	84	-1	capture	Missense_Mutation	SNP	129909521	129909521	CPA2	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	3755	8
NOS3	4846	broad.mit.edu	37	7	150699008	150699008	+	Silent	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150699008C>T	uc003wif.2	+	13	1898	c.1602C>T	c.(1600-1602)TAC>TAT	p.Y534Y	NOS3_uc011kuy.1_Silent_p.Y328Y|NOS3_uc011kuz.1_Silent_p.Y534Y|NOS3_uc011kva.1_Silent_p.Y534Y|NOS3_uc011kvb.1_Silent_p.Y534Y	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	534	Flavodoxin-like.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	CCCAGAGCTACGCACAGCAGC	0.637				p.Y534Y(SKMEL1-Tumor)	755											0.306818	138.090377	143.944073	54	122	KEEP	---	---	---	---	30	30	60	85	-1	capture	Silent	SNP	150699008	150699008	NOS3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10451	8
GFRA2	2675	broad.mit.edu	37	8	21608207	21608207	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:21608207G>A	uc003wzu.1	-	4	1362	c.687C>T	c.(685-687)TGC>TGT	p.C229C	GFRA2_uc003wzv.1_Silent_p.C124C|GFRA2_uc003wzw.1_Silent_p.C96C|DOK2_uc003wzx.1_Intron	NM_001495	NP_001486	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2 isoform a	229						anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity				0				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		GGCGCTCAGCGCACGCCTGGT	0.657																0.416667	57.240486	57.517496	20	28	KEEP	---	---	---	---	14	16	16	20	-1	capture	Silent	SNP	21608207	21608207	GFRA2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	6288	8
FAM150A	389658	broad.mit.edu	37	8	53452429	53452429	+	Missense_Mutation	SNP	C	T	T	rs145116532		TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53452429C>T	uc003xrd.2	-	3	492	c.287G>A	c.(286-288)CGA>CAA	p.R96Q	FAM150A_uc011ldt.1_Missense_Mutation_p.R96Q	NM_207413	NP_997296	Q6UXT8	F150A_HUMAN	hypothetical protein LOC389658 precursor	96						extracellular region					0		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)				GTAATAGAGTCGGTGGAAATG	0.363																0.541667	83.355696	83.428651	26	22	KEEP	---	---	---	---	15	14	19	8	-1	capture	Missense_Mutation	SNP	53452429	53452429	FAM150A	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5410	8
CSMD3	114788	broad.mit.edu	37	8	114326801	114326801	+	Missense_Mutation	SNP	T	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:114326801T>A	uc003ynu.2	-	2	559	c.400A>T	c.(400-402)AGG>TGG	p.R134W	CSMD3_uc003ynt.2_Missense_Mutation_p.R94W|CSMD3_uc011lhx.1_Missense_Mutation_p.R134W|CSMD3_uc010mcx.1_Missense_Mutation_p.R134W|CSMD3_uc003ynx.3_Missense_Mutation_p.R134W	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	134	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CACACTAACCTTGTCCTAAAG	0.303					2888								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			0.089109	3.994105	21.219205	9	92	KEEP	---	---	---	---	7	4	45	53	-1	capture	Missense_Mutation	SNP	114326801	114326801	CSMD3	8	T	A	A	A	1	0	0	0	0	1	0	0	0	726	56	4	4	3911	8
PTPN3	5774	broad.mit.edu	37	9	112185070	112185070	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112185070C>T	uc004bed.2	-	13	1176	c.1064G>A	c.(1063-1065)CGG>CAG	p.R355Q	PTPN3_uc004beb.2_Missense_Mutation_p.R224Q|PTPN3_uc004bec.2_Intron|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Intron|PTPN3_uc011lwh.1_Intron|PTPN3_uc011lwe.1_Missense_Mutation_p.R68Q|PTPN3_uc011lwf.1_Intron	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	355					negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						TAAGGATCTCCGCATGGCTGG	0.453																0.329966	294.09575	301.683012	98	199	KEEP	---	---	---	---	56	58	112	120	-1	capture	Missense_Mutation	SNP	112185070	112185070	PTPN3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12684	8
PALM2-AKAP2	445815	broad.mit.edu	37	9	112900697	112900697	+	Missense_Mutation	SNP	G	A	A	rs139808664		TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112900697G>A	uc004bei.2	+	9	3761	c.3569G>A	c.(3568-3570)CGA>CAA	p.R1190Q	PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.R958Q|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.R958Q|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.R768Q|AKAP2_uc011lwi.1_Missense_Mutation_p.R816Q|AKAP2_uc004bem.2_Missense_Mutation_p.R816Q|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.R776Q|AKAP2_uc011lwj.1_Missense_Mutation_p.R727Q|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.R727Q	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	727	Potential.						enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						GAAGAGATCCGAGCAGCTCAG	0.552																0.32381	94.812463	97.706309	34	71	KEEP	---	---	---	---	18	19	40	39	-1	capture	Missense_Mutation	SNP	112900697	112900697	PALM2-AKAP2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11314	8
KIAA0649	9858	broad.mit.edu	37	9	138377609	138377609	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138377609C>A	uc004cfr.1	+	4	1802	c.1253C>A	c.(1252-1254)ACC>AAC	p.T418N		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	418						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		TTGCCCGAGACCCACAGGAAA	0.622																0.384615	85.115961	86.029907	30	48	KEEP	---	---	---	---	19	12	24	33	0.387096774194	capture	Missense_Mutation	SNP	138377609	138377609	KIAA0649	9	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8109	8
GRPR	2925	broad.mit.edu	37	X	16142187	16142187	+	Silent	SNP	G	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:16142187G>A	uc004cxj.2	+	1	764	c.111G>A	c.(109-111)CCG>CCA	p.P37P		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	37	Extracellular (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					GGTCCCACCCGGGGATCCTCT	0.488														OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.678161	610.658752	618.017163	177	84	KEEP	---	---	---	---	94	101	46	46	-1	capture	Silent	SNP	16142187	16142187	GRPR	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6741	8
CDKN2C	1031	broad.mit.edu	37	1	51439609	51439610	+	Frame_Shift_Ins	INS	-	A	A			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51439609_51439610insA	uc001csf.2	+	3	1390_1391	c.174_175insA	c.(172-177)CTTAGAfs	p.L58fs	CDKN2C_uc001csg.2_Frame_Shift_Ins_p.L58fs	NM_001262	NP_001253	P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C	58_59	ANK 2.				cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding	p.0?(4)|p.?(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(2)|thyroid(1)|lung(1)|kidney(1)	17				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		GACTGCTACTTAGAGGTGCTAA	0.441	Melanoma(47;50 1155 4767 22863 47597)				40	D		glioma|MM				Multiple_Endocrine_Neoplasia_type_1				0.51			79	76		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	51439609	51439610	CDKN2C	1	-	A	A	A	1	0	1	1	0	0	0	0	0	782	61	5	5	3134	8
KCNMB4	27345	broad.mit.edu	37	12	70793987	70793987	+	Splice_Site	DEL	A	-	-			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70793987delA	uc001svx.2	+	2	790	c.337_splice	c.e2-2	p.C113_splice		NM_014505	NP_055320	Q86W47	KCMB4_HUMAN	calcium-activated potassium channel beta 4						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			CTATTTTGTTAGTGCTCCTAT	0.333																0.34			70	138		---	---	---	---						capture_indel	Splice_Site	DEL	70793987	70793987	KCNMB4	12	A	-	-	-	1	0	1	0	1	0	0	1	0	195	15	5	5	7999	8
SGK1	6446	broad.mit.edu	37	6	134492161	134492161	+	Frame_Shift_Del	DEL	G	-	-			TCGA-02-2486-01	TCGA-02-2486-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:134492161delG	uc003qen.3	-	10	1127	c.1038delC	c.(1036-1038)TTCfs	p.F346fs	SGK1_uc003qeo.3_Frame_Shift_Del_p.F441fs|SGK1_uc011ect.1_Frame_Shift_Del_p.F336fs|SGK1_uc011ecu.1_Frame_Shift_Del_p.F302fs|SGK1_uc011ecv.1_Frame_Shift_Del_p.F360fs|SGK1_uc011ecw.1_Frame_Shift_Del_p.F374fs	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	346	Protein kinase.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CATCACTCACGAAGTCATCCT	0.527					161											0.26			22	63		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	134492161	134492161	SGK1	6	G	-	-	-	1	0	1	0	1	0	0	0	0	477	37	5	5	14100	8
