Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
OR2M4	26245	broad.mit.edu	37	1	248402311	248402311	+	Silent	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248402311T>C	uc010pzh.1	+	1	81	c.81T>C	c.(79-81)CTT>CTC	p.L27L		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	27	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACACCTTCCTTTTTTCTCTGG	0.463																0.326446	266.351115	272.812226	79	163	KEEP	---	---	---	---	42	52	92	103	-1	capture	Silent	SNP	248402311	248402311	OR2M4	1	T	C	C	C	1	0	0	0	0	0	0	0	1	821	64	3	3	10916	52
ZNF672	79894	broad.mit.edu	37	1	249142450	249142450	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249142450T>G	uc001iex.2	+	4	1672	c.977T>G	c.(976-978)CTC>CGC	p.L326R		NM_024836	NP_079112	Q499Z4	ZN672_HUMAN	zinc finger protein 672	326	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CGCTCGGACCTCACCAAGCAC	0.697																0.375	24.568736	24.897944	9	15	KEEP	---	---	---	---	6	4	8	11	-1	capture	Missense_Mutation	SNP	249142450	249142450	ZNF672	1	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	17957	52
ZNF692	55657	broad.mit.edu	37	1	249151478	249151478	+	Silent	SNP	G	T	T	rs141085159	byFrequency	TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249151478G>T	uc001ifc.1	-	4	597	c.430C>A	c.(430-432)CGG>AGG	p.R144R	ZNF692_uc001iez.1_5'Flank|ZNF692_uc001ifa.1_5'UTR|ZNF692_uc001ifb.1_5'UTR|ZNF692_uc001ifd.1_Silent_p.R144R|ZNF692_uc001ife.1_RNA|ZNF692_uc001iff.1_Silent_p.R144R|ZNF692_uc010pzr.1_Silent_p.R149R	NM_017865	NP_060335	Q9BU19	ZN692_HUMAN	zinc finger protein 692 isoform 2	144					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CAACTTCTCCGAGTAGTATGT	0.547																0.304348	116.899516	121.612102	42	96	KEEP	---	---	---	---	32	25	76	61	0.561403508772	capture	Silent	SNP	249151478	249151478	ZNF692	1	G	T	T	T	1	0	0	0	0	0	0	0	1	480	37	4	4	17975	52
LIPK	643414	broad.mit.edu	37	10	90497505	90497505	+	Silent	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:90497505T>C	uc010qmv.1	+	6	783	c.783T>C	c.(781-783)ACT>ACC	p.T261T		NM_001080518	NP_001073987	Q5VXJ0	LIPK_HUMAN	lipase, family member K precursor	261					lipid catabolic process	extracellular region	hydrolase activity			ovary(2)	2		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TCCTATTTACTCTGAGTGGAT	0.383																0.47205	273.492008	273.60127	76	85	KEEP	---	---	---	---	44	40	35	63	-1	capture	Silent	SNP	90497505	90497505	LIPK	10	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	8747	52
MUC5B	727897	broad.mit.edu	37	11	1272821	1272821	+	Missense_Mutation	SNP	G	A	A	rs56353324		TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1272821G>A	uc009ycr.1	+	52	15803	c.15677G>A	c.(15676-15678)CGC>CAC	p.R5226H	MUC5B_uc001ltb.2_Missense_Mutation_p.R4907H	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	4904	Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGGACCACCCGCACCCCTGCA	0.652																0.393939	35.954686	36.2828	13	20	KEEP	---	---	---	---	6	11	13	19	-1	capture	Missense_Mutation	SNP	1272821	1272821	MUC5B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9889	52
OR51D1	390038	broad.mit.edu	37	11	4661423	4661423	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4661423C>T	uc010qyk.1	+	1	403	c.403C>T	c.(403-405)CGC>TGC	p.R135C		NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCTTTTGACCGCTTTGTGGC	0.542																0.251572	111.760477	120.650046	40	119	KEEP	---	---	---	---	25	20	60	64	-1	capture	Missense_Mutation	SNP	4661423	4661423	OR51D1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10997	52
RBMXL2	27288	broad.mit.edu	37	11	7110545	7110545	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7110545C>T	uc001mfc.2	+	1	381	c.194C>T	c.(193-195)GCC>GTC	p.A65V		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	65	RRM.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCCAAGGCCGCCGCCAGAGAC	0.647																0.272727	14.338283	15.36407	6	16	KEEP	---	---	---	---	4	4	9	12	-1	capture	Missense_Mutation	SNP	7110545	7110545	RBMXL2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13049	52
SLC17A6	57084	broad.mit.edu	37	11	22391734	22391734	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22391734G>C	uc001mqk.2	+	8	1454	c.1041G>C	c.(1039-1041)AAG>AAC	p.K347N		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	347	Vesicular (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						AAATTAGCAAGGTATGTAAAA	0.279																0.263636	77.621379	83.180646	29	81	KEEP	---	---	---	---	21	16	57	42	-1	capture	Missense_Mutation	SNP	22391734	22391734	SLC17A6	11	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	14314	52
MPEG1	219972	broad.mit.edu	37	11	58978613	58978613	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58978613A>G	uc001nnu.3	-	1	1882	c.1726T>C	c.(1726-1728)TAT>CAT	p.Y576H		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	576	Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				TTGACGCAATAGGACACTTGG	0.602																0.021645	-50.038199	9.065451	5	226	KEEP	---	---	---	---	3	2	130	126	-1	capture	Missense_Mutation	SNP	58978613	58978613	MPEG1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	9635	52
KCNJ8	3764	broad.mit.edu	37	12	21918727	21918727	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21918727T>C	uc001rff.2	-	3	1543	c.1205A>G	c.(1204-1206)AAT>AGT	p.N402S		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	402	Cytoplasmic (By similarity).					voltage-gated potassium channel complex					0					Levosimendan(DB00922)	GAGGGAAGAATTGTTCCTTCG	0.408																0.32	257.119593	264.311907	80	170	KEEP	---	---	---	---	45	38	103	82	-1	capture	Missense_Mutation	SNP	21918727	21918727	KCNJ8	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	7978	52
NTN4	59277	broad.mit.edu	37	12	96052972	96052972	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96052972C>T	uc001tei.2	-	10	2226	c.1777G>A	c.(1777-1779)GAG>AAG	p.E593K	NTN4_uc009ztf.2_Missense_Mutation_p.E570K|NTN4_uc009ztg.2_Missense_Mutation_p.E556K	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	593	NTR.				axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CTTATATCCTCATGTCCTGCT	0.368																0.3	95.046966	99.33925	36	84	KEEP	---	---	---	---	16	23	38	52	-1	capture	Missense_Mutation	SNP	96052972	96052972	NTN4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	10609	52
GLT8D2	83468	broad.mit.edu	37	12	104390581	104390581	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104390581C>T	uc001tkh.1	-	8	938	c.532G>A	c.(532-534)GCG>ACG	p.A178T	GLT8D2_uc001tki.1_Missense_Mutation_p.A178T	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	178	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						AAAGCCGCCGCGTGGCCCAGG	0.478																0.26087	94.740747	101.880904	36	102	KEEP	---	---	---	---	24	23	57	66	-1	capture	Missense_Mutation	SNP	104390581	104390581	GLT8D2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6406	52
ACACB	32	broad.mit.edu	37	12	109696853	109696853	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109696853C>T	uc001tob.2	+	47	6555	c.6436C>T	c.(6436-6438)CGG>TGG	p.R2146W	ACACB_uc001toc.2_Missense_Mutation_p.R2146W|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.R812W	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	2146	Carboxyltransferase.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	GGACTTCAACCGGGAGAAGTT	0.572					1843											0.258667	265.105305	284.888536	97	278	KEEP	---	---	---	---	49	53	160	159	-1	capture	Missense_Mutation	SNP	109696853	109696853	ACACB	12	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	107	52
ACAD10	80724	broad.mit.edu	37	12	112182642	112182642	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112182642G>C	uc001tsq.2	+	13	2110	c.1910G>C	c.(1909-1911)AGC>ACC	p.S637T	ACAD10_uc001tsp.2_Missense_Mutation_p.S637T|ACAD10_uc009zvx.2_Missense_Mutation_p.S668T|ACAD10_uc001tss.1_RNA	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	637							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						AGGAGTTATAGCTCCGTTCCA	0.562																0.365217	133.802645	135.646062	42	73	KEEP	---	---	---	---	27	18	42	41	-1	capture	Missense_Mutation	SNP	112182642	112182642	ACAD10	12	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	108	52
NUFIP1	26747	broad.mit.edu	37	13	45554922	45554922	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:45554922C>T	uc001uzp.2	-	3	571	c.529G>A	c.(529-531)GAT>AAT	p.D177N		NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein	177	C2H2-type.				box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TCACAGGTATCACAAAAAAAG	0.313																0.423913	114.506018	114.971565	39	53	KEEP	---	---	---	---	25	19	27	36	-1	capture	Missense_Mutation	SNP	45554922	45554922	NUFIP1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	10655	52
ESRRB	2103	broad.mit.edu	37	14	76905790	76905790	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:76905790C>T	uc001xsq.1	+	2	161	c.94C>T	c.(94-96)CAC>TAC	p.H32Y	ESRRB_uc001xsr.2_Missense_Mutation_p.H32Y|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	32						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TGCCCTCAGCCACCACAGCCC	0.682																0.52	40.474597	40.483234	13	12	KEEP	---	---	---	---	14	11	15	13	-1	capture	Missense_Mutation	SNP	76905790	76905790	ESRRB	14	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5216	52
RYR3	6263	broad.mit.edu	37	15	34130561	34130561	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34130561C>T	uc001zhi.2	+	89	12450	c.12380C>T	c.(12379-12381)GCG>GTG	p.A4127V	RYR3_uc010bar.2_Missense_Mutation_p.A4122V	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4127					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTAGAAATTGCGGGTGAAGAG	0.483																0.021505	-61.300354	10.103714	6	273	KEEP	---	---	---	---	1	6	169	145	-1	capture	Missense_Mutation	SNP	34130561	34130561	RYR3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13662	52
AMAC1	146861	broad.mit.edu	37	17	33521189	33521189	+	Silent	SNP	A	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33521189A>C	uc002hjd.2	-	1	224	c.138T>G	c.(136-138)GGT>GGG	p.G46G		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	46	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		GCAGGCCCCCACCCAGCAGGG	0.682																0.060976	-10.326345	6.465038	5	77	KEEP	---	---	---	---	6	5	66	51	-1	capture	Silent	SNP	33521189	33521189	AMAC1	17	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	559	52
CDC42EP4	23580	broad.mit.edu	37	17	71282053	71282053	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:71282053G>A	uc002jjn.2	-	2	734	c.587C>T	c.(586-588)GCC>GTC	p.A196V	CDC42EP4_uc002jjo.2_Missense_Mutation_p.A196V|CDC42EP4_uc002jjp.1_Missense_Mutation_p.A126V	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	196					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			CCCGTACGTGGCCTTGGGCAC	0.632																0.083333	-1.080622	26.391178	13	143	KEEP	---	---	---	---	6	7	85	87	-1	capture	Missense_Mutation	SNP	71282053	71282053	CDC42EP4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3049	52
EPB41L3	23136	broad.mit.edu	37	18	5428421	5428421	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5428421C>G	uc002kmt.1	-	9	1042	c.956G>C	c.(955-957)GGT>GCT	p.G319A	EPB41L3_uc010wzh.1_Missense_Mutation_p.G319A|EPB41L3_uc002kmu.1_Missense_Mutation_p.G319A|EPB41L3_uc010dkq.1_Missense_Mutation_p.G210A|EPB41L3_uc010dks.1_Missense_Mutation_p.G341A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	319	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TATCAACAGACCACTTGCACA	0.393																0.047273	-26.422538	33.570553	13	262	KEEP	---	---	---	---	4	11	134	168	-1	capture	Missense_Mutation	SNP	5428421	5428421	EPB41L3	18	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	5109	52
ATCAY	85300	broad.mit.edu	37	19	3907818	3907818	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3907818G>A	uc002lyy.3	+	5	875	c.445G>A	c.(445-447)GCC>ACC	p.A149T	ATCAY_uc010xhz.1_Missense_Mutation_p.A155T|ATCAY_uc010dts.2_5'Flank	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	149					transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		CGGCAGCGCCGCCAACGGGCG	0.642																0.291667	37.330659	39.196721	14	34	KEEP	---	---	---	---	8	11	15	32	-1	capture	Missense_Mutation	SNP	3907818	3907818	ATCAY	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1068	52
ZNF536	9745	broad.mit.edu	37	19	30935903	30935903	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:30935903C>G	uc002nsu.1	+	2	1572	c.1434C>G	c.(1432-1434)CAC>CAG	p.H478Q	ZNF536_uc010edd.1_Missense_Mutation_p.H478Q	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	478					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GCATGGCCCACGGCGTCCCGG	0.662																0.270833	79.417147	83.957713	26	70	KEEP	---	---	---	---	22	10	43	40	-1	capture	Missense_Mutation	SNP	30935903	30935903	ZNF536	19	C	G	G	G	1	0	0	0	0	1	0	0	0	246	19	4	4	17853	52
MLL4	9757	broad.mit.edu	37	19	36214780	36214780	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36214780C>G	uc010eei.2	+	9	3206	c.3206C>G	c.(3205-3207)TCC>TGC	p.S1069C		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1069					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGCAGGACTCCCTCCTGCAG	0.716																0.5	38.324761	38.324761	11	11	KEEP	---	---	---	---	9	4	4	7	-1	capture	Missense_Mutation	SNP	36214780	36214780	MLL4	19	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9535	52
MARK4	57787	broad.mit.edu	37	19	45774954	45774954	+	Silent	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45774954G>A	uc002pbb.1	+	8	779	c.774G>A	c.(772-774)GGG>GGA	p.G258G	MARK4_uc002paz.1_Missense_Mutation_p.G69D|MARK4_uc002pba.1_Silent_p.G258G|MARK4_uc002pbc.1_Silent_p.G124G			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;	258	Protein kinase.				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCTTCGACGGGCACAACCTCA	0.657					167											0.037383	-17.67897	7.105432	4	103	KEEP	---	---	---	---	1	3	61	64	-1	capture	Silent	SNP	45774954	45774954	MARK4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	9228	52
SIGLEC6	946	broad.mit.edu	37	19	52034451	52034451	+	Silent	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52034451G>A	uc002pwy.2	-	2	552	c.390C>T	c.(388-390)TAC>TAT	p.Y130Y	SIGLEC6_uc002pwz.2_Silent_p.Y130Y|SIGLEC6_uc002pxa.2_Silent_p.Y130Y|SIGLEC6_uc010ydb.1_Silent_p.Y83Y|SIGLEC6_uc010ydc.1_Silent_p.Y119Y|SIGLEC6_uc010eoz.1_Silent_p.Y119Y|SIGLEC6_uc010epb.1_Silent_p.Y83Y|SIGLEC6_uc010epa.1_Silent_p.Y119Y	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1	130	Extracellular (Potential).				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		ATGTATAACCGTATTTCATCC	0.547																0.016461	-57.920419	6.367634	4	239	KEEP	---	---	---	---	2	2	127	136	-1	capture	Silent	SNP	52034451	52034451	SIGLEC6	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14205	52
HS1BP3	64342	broad.mit.edu	37	2	20840922	20840922	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:20840922C>A	uc002rdw.1	-	3	258	c.217G>T	c.(217-219)GAG>TAG	p.E73*	HS1BP3_uc002rdx.2_Nonsense_Mutation_p.E73*|HS1BP3_uc002rdy.2_Nonsense_Mutation_p.E73*	NM_022460	NP_071905	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	73	PX.				cell communication		phosphatidylinositol binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTCAATCTCGCTGTACTTT	0.547																0.274725	215.824257	228.290885	75	198	KEEP	---	---	---	---	44	40	116	92	0.47619047619	capture	Nonsense_Mutation	SNP	20840922	20840922	HS1BP3	2	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	7286	52
SLC4A10	57282	broad.mit.edu	37	2	162804208	162804208	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:162804208T>C	uc002ubx.3	+	17	2420	c.2236T>C	c.(2236-2238)TTC>CTC	p.F746L	SLC4A10_uc002uby.3_Missense_Mutation_p.F716L|SLC4A10_uc010zcs.1_Missense_Mutation_p.F727L	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	746	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						CCTGAAGCAGTTCAAGACTAG	0.383																0.340909	305.474635	311.37765	90	174	KEEP	---	---	---	---	48	63	103	105	-1	capture	Missense_Mutation	SNP	162804208	162804208	SLC4A10	2	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	14543	52
C20orf152	140894	broad.mit.edu	37	20	34572591	34572591	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34572591G>A	uc002xes.1	+	6	763	c.607G>A	c.(607-609)GTC>ATC	p.V203I	C20orf152_uc002xer.1_Missense_Mutation_p.V203I|C20orf152_uc010gfp.1_RNA			Q96M20	CT152_HUMAN	SubName: Full=C20orf152 protein;	203	cNMP.										0	Breast(12;0.00631)					GTCCACCATCGTCTGTATGGA	0.527																0.40708	137.429686	138.281857	46	67	KEEP	---	---	---	---	23	23	42	38	-1	capture	Missense_Mutation	SNP	34572591	34572591	C20orf152	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2074	52
RPL15	6138	broad.mit.edu	37	3	23959481	23959481	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:23959481G>A	uc003ccn.2	+	2	167	c.131G>A	c.(130-132)CGG>CAG	p.R44Q	NKIRAS1_uc003cck.2_Intron|NKIRAS1_uc003ccj.2_5'Flank|NKIRAS1_uc003ccl.2_5'Flank|NKIRAS1_uc003ccm.2_5'Flank|RPL15_uc011awi.1_Missense_Mutation_p.R44Q|RPL15_uc011awj.1_Missense_Mutation_p.R44Q|RPL15_uc003cco.2_Missense_Mutation_p.R44Q|RPL15_uc003ccp.2_Missense_Mutation_p.R44Q|RPL15_uc003ccq.2_Missense_Mutation_p.R44Q|RPL15_uc003ccr.2_Missense_Mutation_p.R44Q	NM_002948	NP_002939	P61313	RL15_HUMAN	ribosomal protein L15	44					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome			ovary(1)	1						CGCCCCACCCGGCCTGATAAA	0.557																0.351648	96.892985	98.650304	32	59	KEEP	---	---	---	---	20	19	47	29	-1	capture	Missense_Mutation	SNP	23959481	23959481	RPL15	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13454	52
TRAT1	50852	broad.mit.edu	37	3	108568057	108568057	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108568057G>T	uc003dxi.1	+	5	403	c.259G>T	c.(259-261)GAG>TAG	p.E87*	TRAT1_uc010hpx.1_Nonsense_Mutation_p.E50*	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	87	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						AGCCCGACCAGAGAAATCTGT	0.353																0.298969	77.433387	80.938983	29	68	KEEP	---	---	---	---	20	16	52	29	0.555555555556	capture	Nonsense_Mutation	SNP	108568057	108568057	TRAT1	3	G	T	T	T	1	0	0	0	0	0	1	0	0	429	33	5	4	16349	52
UROC1	131669	broad.mit.edu	37	3	126236443	126236443	+	Silent	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126236443C>T	uc003eiz.1	-	1	152	c.120G>A	c.(118-120)GAG>GAA	p.E40E	UROC1_uc010hsi.1_Silent_p.E40E	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	40					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		TTACCTGTTTCTCCACAGGGC	0.677																0.363636	74.481733	75.5617	24	42	KEEP	---	---	---	---	11	17	24	24	-1	capture	Silent	SNP	126236443	126236443	UROC1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	16910	52
CLCN2	1181	broad.mit.edu	37	3	184071135	184071135	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184071135C>T	uc003foi.2	-	17	2055	c.1931G>A	c.(1930-1932)CGC>CAC	p.R644H	CLCN2_uc003foh.2_Missense_Mutation_p.R168H|CLCN2_uc010hya.1_Missense_Mutation_p.R627H|CLCN2_uc011brl.1_Missense_Mutation_p.R644H|CLCN2_uc011brm.1_Missense_Mutation_p.R600H	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	644	Cytoplasmic (By similarity).		R -> C (no effect).			chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	CTGCCGCCGGCGGGCTGGGCT	0.627																0.323944	64.524536	66.465415	23	48	KEEP	---	---	---	---	14	17	19	31	-1	capture	Missense_Mutation	SNP	184071135	184071135	CLCN2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3428	52
LPP	4026	broad.mit.edu	37	3	188327129	188327129	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:188327129C>T	uc003frs.1	+	6	856	c.610C>T	c.(610-612)CAG>TAG	p.Q204*	LPP_uc011bsg.1_Nonsense_Mutation_p.Q204*|LPP_uc011bsi.1_Nonsense_Mutation_p.Q204*|LPP_uc003frt.2_Nonsense_Mutation_p.Q204*|LPP_uc011bsj.1_Nonsense_Mutation_p.Q41*	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation	204	Pro-rich.				cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		ACCCCAGCCTCAGCCAGTCCC	0.567					184	T	HMGA2|MLL|C12orf9	lipoma|leukemia								0.373984	120.70754	122.426747	46	77	KEEP	---	---	---	---	34	28	53	70	-1	capture	Nonsense_Mutation	SNP	188327129	188327129	LPP	3	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	8839	52
ZNF518B	85460	broad.mit.edu	37	4	10445311	10445311	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10445311G>T	uc003gmn.2	-	3	3129	c.2642C>A	c.(2641-2643)TCC>TAC	p.S881Y		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	881					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						AAGACTTCTGGAAAGCAGTCT	0.403																0.389535	184.504337	186.335958	67	105	KEEP	---	---	---	---	40	30	56	55	0.571428571429	capture	Missense_Mutation	SNP	10445311	10445311	ZNF518B	4	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	17842	52
PRDM9	56979	broad.mit.edu	37	5	23527628	23527628	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23527628C>T	uc003jgo.2	+	11	2613	c.2431C>T	c.(2431-2433)CGG>TGG	p.R811W		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	811	C2H2-type 12.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GGAGTGTGGGCGGGGCTTTAG	0.572													HNSCC(3;0.000094)			0.189474	66.112114	83.249726	36	154	KEEP	---	---	---	---	23	22	99	116	-1	capture	Missense_Mutation	SNP	23527628	23527628	PRDM9	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12359	52
TRIM23	373	broad.mit.edu	37	5	64887666	64887666	+	Missense_Mutation	SNP	A	G	G	rs150920611		TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:64887666A>G	uc003jty.2	-	11	1741	c.1655T>C	c.(1654-1656)ATG>ACG	p.M552T	TRIM23_uc003jtw.2_Intron|TRIM23_uc003jtx.2_Intron	NM_001656	NP_001647	P36406	TRI23_HUMAN	ADP-ribosylation factor domain protein 1 isoform	552	ARF-like.				interspecies interaction between organisms|small GTPase mediated signal transduction	Golgi membrane|lysosomal membrane	enzyme activator activity|GDP binding|GTP binding|GTPase activity|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		ATACAGTCCCATACCACTTCG	0.458																0.347518	141.132701	144.026308	49	92	KEEP	---	---	---	---	28	27	51	54	-1	capture	Missense_Mutation	SNP	64887666	64887666	TRIM23	5	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	16380	52
SLCO6A1	133482	broad.mit.edu	37	5	101834438	101834438	+	Silent	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101834438T>C	uc003knn.2	-	1	283	c.111A>G	c.(109-111)GGA>GGG	p.G37G	SLCO6A1_uc003kno.2_Silent_p.G37G|SLCO6A1_uc003knp.2_Silent_p.G37G|SLCO6A1_uc003knq.2_Silent_p.G37G	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	37	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ACTTCGGGGTTCCCTTGGCCC	0.602																0.30791	332.758408	344.393228	109	245	KEEP	---	---	---	---	52	69	156	129	-1	capture	Silent	SNP	101834438	101834438	SLCO6A1	5	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	14624	52
PCDHGA2	56113	broad.mit.edu	37	5	140719925	140719925	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140719925G>A	uc003ljk.1	+	1	1572	c.1387G>A	c.(1387-1389)GAA>AAA	p.E463K	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.E463K	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	463	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACATTCCCGAAAACAACCC	0.562																0.342342	107.111097	109.551135	38	73	KEEP	---	---	---	---	26	15	50	40	-1	capture	Missense_Mutation	SNP	140719925	140719925	PCDHGA2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11457	52
COL11A2	1302	broad.mit.edu	37	6	33152017	33152017	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33152017C>A	uc003ocx.1	-	8	1252	c.1024G>T	c.(1024-1026)GGG>TGG	p.G342W	COL11A2_uc003ocy.1_Intron|COL11A2_uc003ocz.1_Intron	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	342	Nonhelical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						TCGTAGGGCCCTTCAGGGGGG	0.612	Melanoma(1;90 116 3946 5341 17093)															0.055556	-19.414755	18.103	10	170	KEEP	---	---	---	---	7	4	89	99	0.363636363636	capture	Missense_Mutation	SNP	33152017	33152017	COL11A2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	3633	52
C6orf167	253714	broad.mit.edu	37	6	97702431	97702431	+	Splice_Site	SNP	A	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:97702431A>C	uc003ppb.2	-	10	1385	c.1119_splice	c.e10+1	p.M373_splice	C6orf167_uc011eaf.1_Splice_Site_p.M373_splice|C6orf167_uc010kcn.1_Splice_Site_p.M147_splice|C6orf167_uc010kco.1_Splice_Site_p.M109_splice|C6orf167_uc003ppc.2_Missense_Mutation_p.V374G	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		ATGAAGTCTTACCATTTCATC	0.313																0.25	46.593162	50.212821	16	48	KEEP	---	---	---	---	11	6	32	25	-1	capture	Splice_Site	SNP	97702431	97702431	C6orf167	6	A	C	C	C	1	0	0	0	0	0	0	1	0	182	14	5	4	2319	52
RSBN1L	222194	broad.mit.edu	37	7	77408002	77408002	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77408002G>A	uc010ldt.1	+	8	2102	c.2058G>A	c.(2056-2058)TGG>TGA	p.W686*	RSBN1L_uc003ugm.2_Nonsense_Mutation_p.W468*	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	686						nucleus				ovary(1)	1						GTTTAGCATGGCATATTCGGC	0.388																0.015748	-60.927217	6.588232	4	250	KEEP	---	---	---	---	4	1	155	130	-1	capture	Nonsense_Mutation	SNP	77408002	77408002	RSBN1L	7	G	A	A	A	1	0	0	0	0	0	1	0	0	546	42	5	2	13589	52
TSGA13	114960	broad.mit.edu	37	7	130365809	130365809	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130365809C>T	uc003vqi.2	-	4	606	c.149G>A	c.(148-150)CGG>CAG	p.R50Q	TSGA13_uc003vqj.2_Missense_Mutation_p.R50Q	NM_052933	NP_443165	Q96PP4	TSG13_HUMAN	testis specific, 13	50										ovary(2)	2	Melanoma(18;0.0435)					TGTGTAATGCCGAAGGTTCTC	0.433																0.264901	114.768271	122.287888	40	111	KEEP	---	---	---	---	27	20	64	71	-1	capture	Missense_Mutation	SNP	130365809	130365809	TSGA13	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16502	52
MLL3	58508	broad.mit.edu	37	7	151962220	151962220	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151962220C>A	uc003wla.2	-	8	1306	c.1087G>T	c.(1087-1089)GGT>TGT	p.G363C		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	363	PHD-type 1.|RING-type.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TAGTGCTGACCACAAGTAGTA	0.448	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.046709	-58.169893	45.024639	22	449	KEEP	---	---	---	---	14	15	262	295	0.51724137931	capture	Missense_Mutation	SNP	151962220	151962220	MLL3	7	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	9534	52
ADAM7	8756	broad.mit.edu	37	8	24339684	24339684	+	Silent	SNP	G	A	A	rs147649440		TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24339684G>A	uc003xeb.2	+	9	848	c.735G>A	c.(733-735)ACG>ACA	p.T245T	ADAM7_uc003xec.2_Silent_p.T17T	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	245	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TCCATGTGACGTTGGTTGGCA	0.303																0.293478	73.089733	76.601462	27	65	KEEP	---	---	---	---	15	13	38	36	-1	capture	Silent	SNP	24339684	24339684	ADAM7	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	251	52
OPRK1	4986	broad.mit.edu	37	8	54163341	54163341	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:54163341C>T	uc003xrh.1	-	1	632	c.257G>A	c.(256-258)CGA>CAA	p.R86Q	OPRK1_uc003xri.1_Missense_Mutation_p.R86Q|OPRK1_uc010lyc.1_5'UTR	NM_000912	NP_000903	P41145	OPRK_HUMAN	opioid receptor, kappa 1	86	Cytoplasmic (Potential).				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)	CCGCGCTCACCGGATGATCAC	0.682																0.295455	39.157711	40.804462	13	31	KEEP	---	---	---	---	6	7	10	26	-1	capture	Missense_Mutation	SNP	54163341	54163341	OPRK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10789	52
KCNS2	3788	broad.mit.edu	37	8	99441436	99441436	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:99441436T>C	uc003yin.2	+	2	1579	c.1229T>C	c.(1228-1230)TTC>TCC	p.F410S		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	410	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			ACCTTGATCTTCAATAAGTTC	0.552	Pancreas(138;844 2489 9202 24627)															0.259067	148.162371	158.308585	50	143	KEEP	---	---	---	---	31	32	78	84	-1	capture	Missense_Mutation	SNP	99441436	99441436	KCNS2	8	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	8011	52
CSMD3	114788	broad.mit.edu	37	8	113256758	113256758	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113256758C>T	uc003ynu.2	-	65	10426	c.10267G>A	c.(10267-10269)GTA>ATA	p.V3423I	CSMD3_uc003yns.2_Missense_Mutation_p.V2625I|CSMD3_uc003ynt.2_Missense_Mutation_p.V3383I|CSMD3_uc011lhx.1_Missense_Mutation_p.V3254I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3423	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane		p.V3423I(1)		ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCCATCCCTACGACATTTGCA	0.393					2888								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			0.264957	81.084921	86.91862	31	86	KEEP	---	---	---	---	21	17	46	54	-1	capture	Missense_Mutation	SNP	113256758	113256758	CSMD3	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3911	52
FER1L6	654463	broad.mit.edu	37	8	125047530	125047530	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125047530C>T	uc003yqw.2	+	19	2505	c.2299C>T	c.(2299-2301)CGA>TGA	p.R767*	uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	767	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCCTGGGAAACGACCGGCTGG	0.493																0.35514	107.916638	109.896534	38	69	KEEP	---	---	---	---	22	24	46	53	-1	capture	Nonsense_Mutation	SNP	125047530	125047530	FER1L6	8	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	5761	52
EPPK1	83481	broad.mit.edu	37	8	144940504	144940504	+	Silent	SNP	G	A	A			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940504G>A	uc003zaa.1	-	2	14941	c.14928C>T	c.(14926-14928)GCC>GCT	p.A4976A		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	4976	Plectin 63.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGCCGGTGACGGCGCGCTCGG	0.701																0.041379	-23.170706	9.650334	6	139	KEEP	---	---	---	---	5	5	129	150	-1	capture	Silent	SNP	144940504	144940504	EPPK1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5145	52
FRMD3	257019	broad.mit.edu	37	9	85924522	85924522	+	Silent	SNP	T	C	C			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:85924522T>C	uc004ams.1	-	10	1057	c.855A>G	c.(853-855)GCA>GCG	p.A285A	FRMD3_uc004amr.1_Silent_p.A271A	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	285	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						AAGTATGGAATGCCAACATGG	0.333																0.2625	52.937499	57.020528	21	59	KEEP	---	---	---	---	18	9	33	33	-1	capture	Silent	SNP	85924522	85924522	FRMD3	9	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	5993	52
CYLC2	1539	broad.mit.edu	37	9	105767700	105767700	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:105767700G>T	uc004bbs.2	+	5	857	c.787G>T	c.(787-789)GAT>TAT	p.D263Y		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	263	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				TGCCAAGAAAGATGCAAAGGA	0.318																0.236364	29.343524	32.841126	13	42	KEEP	---	---	---	---	3	11	29	17	0.214285714286	capture	Missense_Mutation	SNP	105767700	105767700	CYLC2	9	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	4102	52
MXRA5	25878	broad.mit.edu	37	X	3235658	3235658	+	Missense_Mutation	SNP	C	T	T	rs140532419	byFrequency	TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3235658C>T	uc004crg.3	-	6	6221	c.6064G>A	c.(6064-6066)GTC>ATC	p.V2022I		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2022	Ig-like C2-type 4.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CACTTATAGACGCCTCTGTCT	0.642																0.653846	53.481233	54.024521	17	9	KEEP	---	---	---	---	7	10	5	6	-1	capture	Missense_Mutation	SNP	3235658	3235658	MXRA5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9913	52
FGD5	152273	broad.mit.edu	37	3	14942566	14942566	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0219-01	TCGA-06-0219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14942566delG	uc003bzc.2	+	9	3372	c.3262delG	c.(3262-3264)GGGfs	p.G1088fs	FGD5_uc011avk.1_Frame_Shift_Del_p.G1088fs|FGD5_uc003bzd.2_Frame_Shift_Del_p.G166fs	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1088					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CATGGAGCAAGGGGTGAGTGC	0.642																0.27			54	145		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	14942566	14942566	FGD5	3	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	5782	52
