Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CSMD2	114784	broad.mit.edu	37	1	34070881	34070881	+	Splice_Site	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:34070881C>T	uc001bxn.1	-	43	6567	c.6538_splice	c.e43+1	p.V2180_splice	CSMD2_uc001bxm.1_Splice_Site_p.V2178_splice|CSMD2_uc001bxo.1_Splice_Site_p.V1051_splice	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAGCGACATACCTTCACACTT	0.587																0.25	27.007095	29.504811	11	33	KEEP	---	---	---	---	6	7	21	14	-1	capture	Splice_Site	SNP	34070881	34070881	CSMD2	1	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	3910	72
LRRC8B	23507	broad.mit.edu	37	1	90050043	90050043	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:90050043G>A	uc001dni.2	+	7	2341	c.1834G>A	c.(1834-1836)GAG>AAG	p.E612K	LRRC8B_uc001dnh.2_Missense_Mutation_p.E612K|LRRC8B_uc001dnj.2_Missense_Mutation_p.E612K	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	612	LRR 7.					integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TAATTTGCATGAGTTAGACCT	0.388																0.322368	132.517578	136.778555	49	103	KEEP	---	---	---	---	24	26	75	43	-1	capture	Missense_Mutation	SNP	90050043	90050043	LRRC8B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	8937	72
EPS8L3	79574	broad.mit.edu	37	1	110304367	110304367	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110304367G>A	uc001dyr.1	-	2	150	c.5C>T	c.(4-6)TCA>TTA	p.S2L	EPS8L3_uc001dys.1_Missense_Mutation_p.S2L|EPS8L3_uc001dyq.1_Missense_Mutation_p.S2L|EPS8L3_uc009wfm.1_Intron|EPS8L3_uc009wfn.1_5'UTR|EPS8L3_uc009wfo.1_Missense_Mutation_p.S2L	NM_133181	NP_573444	Q8TE67	ES8L3_HUMAN	epidermal growth factor receptor pathway	2						cytoplasm	protein binding			ovary(2)|skin(1)	3		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GCTGGGCCTTGACATGTTGAC	0.612																0.313725	40.574003	42.153218	16	35	KEEP	---	---	---	---	14	3	24	16	-1	capture	Missense_Mutation	SNP	110304367	110304367	EPS8L3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	5152	72
VTCN1	79679	broad.mit.edu	37	1	117699295	117699295	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117699295G>A	uc001ehb.2	-	3	418	c.346C>T	c.(346-348)CGG>TGG	p.R116W	VTCN1_uc001ehc.2_Missense_Mutation_p.R21W|VTCN1_uc009whf.1_Intron	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN	V-set domain containing T cell activation	116	Ig-like V-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane					0	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		TTTTTCAGCCGCAAAGAGGCA	0.458																0.032	-22.410661	7.527929	4	121	KEEP	---	---	---	---	3	2	71	61	-1	capture	Missense_Mutation	SNP	117699295	117699295	VTCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	17116	72
ITGA10	8515	broad.mit.edu	37	1	145528649	145528649	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145528649T>C	uc001eoa.2	+	5	522	c.446T>C	c.(445-447)TTC>TCC	p.F149S	NBPF10_uc001emp.3_Intron|ITGA10_uc001enz.1_3'UTR|ITGA10_uc010oyv.1_Intron|ITGA10_uc009wiw.2_Intron|ITGA10_uc010oyw.1_Missense_Mutation_p.F94S	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	149	FG-GAP 2.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GATGCTTCATTCCAGCCTCAG	0.572					450											0.151515	1.53506	9.618986	10	56	KEEP	---	---	---	---	19	3	41	24	-1	capture	Missense_Mutation	SNP	145528649	145528649	ITGA10	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	7796	72
DPT	1805	broad.mit.edu	37	1	168670256	168670256	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168670256T>A	uc001gfp.2	-	3	554	c.538A>T	c.(538-540)AGG>TGG	p.R180W		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	180	2 X 53-55 AA tandem repeats.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].				cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					CTTTCTCACCTTTCCACTGCA	0.408																0.370968	201.813325	204.53921	69	117	KEEP	---	---	---	---	44	32	85	45	-1	capture	Missense_Mutation	SNP	168670256	168670256	DPT	1	T	A	A	A	1	0	0	0	0	1	0	0	0	726	56	4	4	4694	72
HHAT	55733	broad.mit.edu	37	1	210637955	210637955	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:210637955C>T	uc009xcx.2	+	8	1129	c.963C>T	c.(961-963)CTC>CTT	p.L321L	HHAT_uc010psq.1_Silent_p.L184L|HHAT_uc001hhz.3_Silent_p.L321L|HHAT_uc010psr.1_Silent_p.L322L|HHAT_uc010pss.1_Silent_p.L276L|HHAT_uc009xcy.2_Silent_p.L256L|HHAT_uc010pst.1_Silent_p.L258L|HHAT_uc010psu.1_Silent_p.L256L|HHAT_uc001hia.3_Silent_p.L11L	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	321					multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		CACCCGCCCTCCCCCGCTGCG	0.592																0.331126	139.010057	142.820285	50	101	KEEP	---	---	---	---	28	24	64	41	-1	capture	Silent	SNP	210637955	210637955	HHAT	1	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	7014	72
CENPF	1063	broad.mit.edu	37	1	214819979	214819979	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214819979G>A	uc001hkm.2	+	13	7240	c.7066G>A	c.(7066-7068)GCT>ACT	p.A2356T		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	2452	2-2.|Potential.|2 X 177 AA tandem repeats.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGAGCATGCAGCTCTTGAGGC	0.438	Colon(80;575 1284 11000 14801 43496)															0.304348	58.246474	60.604552	21	48	KEEP	---	---	---	---	9	14	28	26	-1	capture	Missense_Mutation	SNP	214819979	214819979	CENPF	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	3199	72
ANKRD30A	91074	broad.mit.edu	37	10	37508365	37508365	+	Missense_Mutation	SNP	C	T	T	rs116869285	by1000genomes	TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:37508365C>T	uc001iza.1	+	34	3656	c.3557C>T	c.(3556-3558)ACG>ATG	p.T1186M		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1242						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GTGAGTAGTACGATATATAAC	0.363																0.7	110.313778	112.09245	35	15	KEEP	---	---	---	---	22	14	10	5	-1	capture	Missense_Mutation	SNP	37508365	37508365	ANKRD30A	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	654	72
CHAT	1103	broad.mit.edu	37	10	50873009	50873009	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50873009T>C	uc001jhz.2	+	15	2317	c.2164T>C	c.(2164-2166)TGC>CGC	p.C722R	CHAT_uc001jhv.1_Missense_Mutation_p.C604R|CHAT_uc001jhx.1_Missense_Mutation_p.C604R|CHAT_uc001jhy.1_Missense_Mutation_p.C604R|CHAT_uc001jia.2_Missense_Mutation_p.C604R|CHAT_uc010qgs.1_Intron	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	722					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GAGAGACCTCTGCAGTCTGCT	0.502																0.680982	368.204792	372.933244	111	52	KEEP	---	---	---	---	47	69	33	21	-1	capture	Missense_Mutation	SNP	50873009	50873009	CHAT	10	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	3279	72
PTEN	5728	broad.mit.edu	37	10	89653838	89653838	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89653838T>C	uc001kfb.2	+	3	1167	c.136T>C	c.(136-138)TAC>CAC	p.Y46H		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	46	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(4)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G44fs*8(1)|p.Y46*(1)|p.G44fs*11(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGAAGGCGTATACAGGAACAA	0.294			31	p.Y46H(HEC59-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.701493	181.355252	183.788413	47	20	KEEP	---	---	---	---	41	11	13	11	-1	capture	Missense_Mutation	SNP	89653838	89653838	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	12633	72
OR4X2	119764	broad.mit.edu	37	11	48266856	48266856	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48266856C>T	uc001ngs.1	+	1	201	c.201C>T	c.(199-201)TCC>TCT	p.S67S		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCTACTCCTCCGCTACAGCCC	0.502																0.35119	179.624897	182.884163	59	109	KEEP	---	---	---	---	38	24	65	48	-1	capture	Silent	SNP	48266856	48266856	OR4X2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10989	72
CTSW	1521	broad.mit.edu	37	11	65647754	65647754	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65647754G>A	uc001ogc.1	+	2	211	c.169G>A	c.(169-171)GAA>AAA	p.E57K	CTSW_uc001ogb.1_Missense_Mutation_p.E57K	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	57					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)		CCTGAGCccagaaggtatcac	0.269																0.4	65.738516	66.219665	22	33	KEEP	---	---	---	---	11	12	17	17	-1	capture	Missense_Mutation	SNP	65647754	65647754	CTSW	11	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4003	72
OR6C70	390327	broad.mit.edu	37	12	55863703	55863703	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55863703C>A	uc010spn.1	-	1	220	c.220G>T	c.(220-222)GCT>TCT	p.A74S		NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GGAATGCAAGCAGTTGTGAAT	0.398																0.409091	108.681872	109.317781	36	52	KEEP	---	---	---	---	20	16	34	20	0.444444444444	capture	Missense_Mutation	SNP	55863703	55863703	OR6C70	12	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	11101	72
IFNG	3458	broad.mit.edu	37	12	68551725	68551725	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68551725G>A	uc001stw.1	-	3	460	c.334C>T	c.(334-336)CGA>TGA	p.R112*		NM_000619	NP_000610	P01579	IFNG_HUMAN	interferon, gamma precursor	112					cell cycle arrest|interferon-gamma-mediated signaling pathway|negative regulation of interleukin-17 production|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of metanephric nephron tubule epithelial cell differentiation|negative regulation of smooth muscle cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity|positive regulation of fructose 1,6-bisphosphate metabolic process|positive regulation of interleukin-12 production|positive regulation of interleukin-23 production|positive regulation of killing of cells of other organism|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mesenchymal cell proliferation|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of smooth muscle cell apoptosis|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|regulation of insulin secretion|regulation of interferon-gamma-mediated signaling pathway|response to virus	extracellular space	cytokine activity|interferon-gamma receptor binding				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Interferon gamma-1b(DB00033)|Simvastatin(DB00641)	AAGTCATCTCGTTTCTTTTTG	0.358					63											0.36019	217.53821	221.170534	76	135	KEEP	---	---	---	---	49	37	94	63	-1	capture	Nonsense_Mutation	SNP	68551725	68551725	IFNG	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	7473	72
PXN	5829	broad.mit.edu	37	12	120651689	120651689	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120651689A>C	uc001txt.2	-	11	1596	c.1465T>G	c.(1465-1467)TCA>GCA	p.S489A	PXN_uc001txu.2_Missense_Mutation_p.S301A|PXN_uc001txv.2_Missense_Mutation_p.S370A|PXN_uc001txx.2_Missense_Mutation_p.S322A|PXN_uc001txy.2_Missense_Mutation_p.S455A|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	489	LIM zinc-binding 3.				cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTGAGGGCTGAGATATAGTTC	0.617					115											0.3	9.52125	9.878511	3	7	KEEP	---	---	---	---	2	1	4	3	-1	capture	Missense_Mutation	SNP	120651689	120651689	PXN	12	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	12747	72
N4BP2L2	10443	broad.mit.edu	37	13	33017656	33017656	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:33017656G>A	uc010abe.1	-	7	1040	c.1018C>T	c.(1018-1020)CAA>TAA	p.Q340*	N4BP2L2_uc001uug.2_Nonsense_Mutation_p.Q223*|N4BP2L2_uc010abd.1_Nonsense_Mutation_p.Q253*|N4BP2L2_uc001uuh.2_Nonsense_Mutation_p.Q171*|N4BP2L2_uc001uuj.2_Intron|N4BP2L2_uc010tdz.1_Nonsense_Mutation_p.Q325*	NM_033111	NP_149102	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5	Error:Variant_position_missing_in_Q92802_after_alignment											0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		ATTCCATGTTGATGGCACAGA	0.353																0.282609	31.353741	33.308049	13	33	KEEP	---	---	---	---	8	6	21	13	-1	capture	Nonsense_Mutation	SNP	33017656	33017656	N4BP2L2	13	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	10022	72
COL4A1	1282	broad.mit.edu	37	13	110817226	110817226	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:110817226C>T	uc001vqw.3	-	46	4255	c.4133G>A	c.(4132-4134)GGC>GAC	p.G1378D	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1378	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCCTTTCGGGCCTGGCAGTCC	0.642																0.433333	39.270697	39.386888	13	17	KEEP	---	---	---	---	2	11	14	5	-1	capture	Missense_Mutation	SNP	110817226	110817226	COL4A1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3654	72
ANKDD1A	348094	broad.mit.edu	37	15	65209682	65209682	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65209682C>T	uc002aoa.2	+	3	265	c.236C>T	c.(235-237)GCG>GTG	p.A79V	ANKDD1A_uc002anx.1_Missense_Mutation_p.A79V|ANKDD1A_uc002any.2_5'UTR|ANKDD1A_uc002anz.2_Intron|ANKDD1A_uc002aob.2_Missense_Mutation_p.A49V	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	79					signal transduction					ovary(1)	1						GAGGAGGATGCGGTAGGGGCC	0.592																0.266667	20.487779	21.962322	8	22	KEEP	---	---	---	---	6	2	12	10	-1	capture	Missense_Mutation	SNP	65209682	65209682	ANKDD1A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	621	72
MAN2A2	4122	broad.mit.edu	37	15	91454400	91454400	+	Splice_Site	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91454400G>A	uc010bnz.2	+	13	1991	c.1876_splice	c.e13-1	p.D626_splice	MAN2A2_uc010boa.2_Splice_Site_p.D668_splice|MAN2A2_uc002bqc.2_Splice_Site_p.D626_splice|MAN2A2_uc010uql.1_Splice_Site_p.D288_splice|MAN2A2_uc010uqm.1_Splice_Site_p.D205_splice|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CTGAATTCCAGGATGACACTC	0.612																0.053571	-5.023568	6.753259	3	53	KEEP	---	---	---	---	2	1	41	18	-1	capture	Splice_Site	SNP	91454400	91454400	MAN2A2	15	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	9129	72
CLDN9	9080	broad.mit.edu	37	16	3063836	3063836	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3063836G>A	uc010uwo.1	+	1	1380	c.473G>A	c.(472-474)CGG>CAG	p.R158Q		NM_020982	NP_066192	O95484	CLD9_HUMAN	claudin 9	158	Extracellular (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						GCCCTCAAGCGGGAGCTGGGG	0.701																0.033898	-20.302005	7.629849	4	114	KEEP	---	---	---	---	3	1	70	55	-1	capture	Missense_Mutation	SNP	3063836	3063836	CLDN9	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3457	72
FAM86A	196483	broad.mit.edu	37	16	5135684	5135684	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5135684C>T	uc002cyo.2	-	8	991	c.942G>A	c.(940-942)CTG>CTA	p.L314L	ALG1_uc002cyj.2_3'UTR|ALG1_uc002cym.2_3'UTR|ALG1_uc002cyn.2_3'UTR|ALG1_uc010bue.2_3'UTR|ALG1_uc010uxy.1_3'UTR|FAM86A_uc002cyp.2_Silent_p.L280L	NM_201400	NP_958802	Q96G04	FA86A_HUMAN	hypothetical protein LOC196483 isoform 1	314											0						CGTAGGGAAACAGTTTCTGCT	0.527																0.033113	-27.860178	8.068526	5	146	KEEP	---	---	---	---	5	2	115	56	-1	capture	Silent	SNP	5135684	5135684	FAM86A	16	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	5589	72
AIPL1	23746	broad.mit.edu	37	17	6338338	6338338	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6338338G>A	uc002gcp.2	-	1	182	c.87C>T	c.(85-87)ACC>ACT	p.T29T	AIPL1_uc002gcq.2_Silent_p.T29T|AIPL1_uc002gcr.2_Silent_p.T29T|AIPL1_uc010clk.2_Silent_p.T29T|AIPL1_uc010cll.2_Silent_p.T29T|AIPL1_uc002gcs.2_Silent_p.T29T	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting	29					protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		CTCGGGATCCGGTGATGAAGT	0.597																0.347222	71.887572	73.355292	25	47	KEEP	---	---	---	---	21	8	38	18	-1	capture	Silent	SNP	6338338	6338338	AIPL1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	436	72
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	A	A	rs121912651		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577539G>A	uc002gim.2	-	7	936	c.742C>T	c.(742-744)CGG>TGG	p.R248W	TP53_uc002gig.1_Missense_Mutation_p.R248W|TP53_uc002gih.2_Missense_Mutation_p.R248W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116W|TP53_uc010cng.1_Missense_Mutation_p.R116W|TP53_uc002gii.1_Missense_Mutation_p.R116W|TP53_uc010cnh.1_Missense_Mutation_p.R248W|TP53_uc010cni.1_Missense_Mutation_p.R248W|TP53_uc002gij.2_Missense_Mutation_p.R248W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155W|TP53_uc002gio.2_Missense_Mutation_p.R116W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(516)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGGGCCTCCGGTTCATGCCG	0.577	Pancreas(47;798 1329 9957 10801)	R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO680N_OESOPHAGUS)|R248W(SW837_LARGE_INTESTINE)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(RD_SOFT_TISSUE)|R248W(VCAP_PROSTATE)|R248W(JIMT1_BREAST)|R248W(GCT_SOFT_TISSUE)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(786O_KIDNEY)|R248W(COLO320_LARGE_INTESTINE)|R248W(LXF289_LUNG)|R248W(LUDLU1_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(HCC2157_BREAST)	111	p.R248W(SW837-Tumor)|p.R248W(786O-Tumor)|p.R248W(LUDLU1-Tumor)|p.R248W(VCAP-Tumor)|p.R248*(DB-Tumor)|p.R248W(MIAPACA2-Tumor)|p.R248W(HCC2157-Tumor)|p.R248W(LXF289-Tumor)|p.R248G(8505C-Tumor)|p.R248A(SF126-Tumor)|p.R248W(SET2-Tumor)|p.R248W(KO52-Tumor)|p.R248W(SNU1040-Tumor)|p.R248W(GCT-Tumor)|p.R248W(JIMT1-Tumor)|p.R248W(COLO320-Tumor)|p.R248W(CAS1-Tumor)|p.R248W(NCIH2106-Tumor)|p.R248W(SNUC5-Tumor)|p.R248W(COLO680N-Tumor)|p.R248W(RD-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.366197	77.140044	78.253874	26	45	KEEP	---	---	---	---	21	8	31	19	-1	capture	Missense_Mutation	SNP	7577539	7577539	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	72
KCNJ12	3768	broad.mit.edu	37	17	21319710	21319710	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21319710C>T	uc002gyv.1	+	3	1761	c.1056C>T	c.(1054-1056)CCC>CCT	p.P352P		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	352	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	ATGAGGTGCCCTCTACGCCCC	0.567													Prostate(3;0.18)			0.13369	41.54042	65.89034	25	162	KEEP	---	---	---	---	21	6	89	100	-1	capture	Silent	SNP	21319710	21319710	KCNJ12	17	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	7968	72
C18orf26	284254	broad.mit.edu	37	18	52265157	52265157	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:52265157C>A	uc002lfq.1	+	3	460	c.414C>A	c.(412-414)AAC>AAA	p.N138K	C18orf26_uc002lfp.1_Missense_Mutation_p.N86K	NM_173629	NP_775900	Q8N1N2	CR026_HUMAN	hypothetical protein LOC284254	138						integral to membrane					0				Colorectal(16;0.0193)|READ - Rectum adenocarcinoma(59;0.178)		TGGTGAATAACAAAGGATCGG	0.453																0.365854	133.144654	135.090113	45	78	KEEP	---	---	---	---	31	18	49	29	0.367346938776	capture	Missense_Mutation	SNP	52265157	52265157	C18orf26	18	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	1884	72
SERPINB12	89777	broad.mit.edu	37	18	61223463	61223463	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61223463G>A	uc010xen.1	+	1	71	c.71G>A	c.(70-72)CGT>CAT	p.R24H	SERPINB12_uc010xeo.1_Missense_Mutation_p.R24H	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	24					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0						AAAGATGATCGTCATAAAAAC	0.393																0.372152	421.024628	426.695154	147	248	KEEP	---	---	---	---	104	49	178	92	-1	capture	Missense_Mutation	SNP	61223463	61223463	SERPINB12	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13992	72
ADAMTS10	81794	broad.mit.edu	37	19	8661023	8661023	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8661023A>G	uc002mkj.1	-	11	1545	c.1271T>C	c.(1270-1272)ATT>ACT	p.I424T	ADAMTS10_uc002mkk.1_Missense_Mutation_p.I56T	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	424	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						CTTCATGGTAATGTGGGCAGC	0.592																0.36	261.198316	265.086007	81	144	KEEP	---	---	---	---	60	34	93	61	-1	capture	Missense_Mutation	SNP	8661023	8661023	ADAMTS10	19	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	256	72
ADAMTS10	81794	broad.mit.edu	37	19	8661031	8661031	+	Silent	SNP	A	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8661031A>G	uc002mkj.1	-	11	1537	c.1263T>C	c.(1261-1263)GCT>GCC	p.A421A	ADAMTS10_uc002mkk.1_Silent_p.A53A	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	421	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						TAATGTGGGCAGCCATGAGCT	0.592																0.327731	229.048281	235.322546	78	160	KEEP	---	---	---	---	57	32	110	69	-1	capture	Silent	SNP	8661031	8661031	ADAMTS10	19	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	256	72
KLF1	10661	broad.mit.edu	37	19	12996209	12996209	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12996209G>A	uc002mvo.2	-	2	898	c.835C>T	c.(835-837)CAC>TAC	p.H279Y		NM_006563	NP_006554	Q13351	KLF1_HUMAN	erythroid Kruppel-like factor	279	C2H2-type 1.				erythrocyte differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCACGTGTGCGCTGCCTGC	0.692																0.205128	15.676404	18.82434	8	31	KEEP	---	---	---	---	6	5	23	12	-1	capture	Missense_Mutation	SNP	12996209	12996209	KLF1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	8258	72
ZNF208	7757	broad.mit.edu	37	19	22155610	22155610	+	Silent	SNP	A	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22155610A>G	uc002nqp.2	-	5	2075	c.1926T>C	c.(1924-1926)ATT>ATC	p.I642I	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTCCAGTATGAATTACCTTAT	0.363																0.25	96.7996	104.310622	33	99	KEEP	---	---	---	---	24	11	81	37	-1	capture	Silent	SNP	22155610	22155610	ZNF208	19	A	G	G	G	1	0	0	0	0	0	0	0	1	112	9	3	3	17646	72
RAB4B	53916	broad.mit.edu	37	19	41289974	41289974	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41289974G>A	uc002opd.1	+	5	534	c.424G>A	c.(424-426)GAG>AAG	p.E142K	RAB4B_uc002opc.1_RNA|RAB4B_uc002ope.1_Intron|EGLN2_uc010ehd.2_5'UTR|RAB4B_uc002opf.1_Missense_Mutation_p.E168K	NM_016154	NP_057238	P61018	RAB4B_HUMAN	ras-related GTP-binding protein 4b	142					protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	intracellular|plasma membrane	GTP binding|GTPase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CTTTGCCCAGGAGAATGGTGA	0.627																0.05102	-10.909264	10.016388	5	93	KEEP	---	---	---	---	4	1	72	29	-1	capture	Missense_Mutation	SNP	41289974	41289974	RAB4B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12842	72
SIGLEC9	27180	broad.mit.edu	37	19	51629378	51629378	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51629378C>T	uc002pvu.2	+	3	808	c.741C>T	c.(739-741)GAC>GAT	p.D247D	SIGLEC9_uc010yct.1_Silent_p.D247D	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	247	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		TCCAAGGAGACGGCACAGGTA	0.597																0.363636	125.368805	127.347593	44	77	KEEP	---	---	---	---	34	20	52	38	-1	capture	Silent	SNP	51629378	51629378	SIGLEC9	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14208	72
CD33	945	broad.mit.edu	37	19	51728757	51728757	+	Silent	SNP	C	T	T	rs141721735		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51728757C>T	uc002pwa.2	+	2	361	c.321C>T	c.(319-321)GAC>GAT	p.D107D	CD33_uc010eos.1_Silent_p.D107D|CD33_uc010eot.1_Intron|CD33_uc010eou.1_5'Flank	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	107	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	GCATCGTAGACGCCAGGAGGA	0.507																0.455285	172.289375	172.503089	56	67	KEEP	---	---	---	---	37	19	42	29	-1	capture	Silent	SNP	51728757	51728757	CD33	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2976	72
ZNF841	284371	broad.mit.edu	37	19	52568811	52568811	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52568811C>T	uc002pyl.1	-	5	2528	c.1976G>A	c.(1975-1977)CGT>CAT	p.R659H	ZNF841_uc010ydh.1_Missense_Mutation_p.R775H|ZNF841_uc010epk.1_Missense_Mutation_p.R351H	NM_001136499	NP_001129971	Q6ZN19	ZN841_HUMAN	zinc finger protein 841	659	C2H2-type 19.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGAGCGATAACGGAAGACCTT	0.438																0.306122	41.307398	42.949534	15	34	KEEP	---	---	---	---	11	4	16	19	-1	capture	Missense_Mutation	SNP	52568811	52568811	ZNF841	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18065	72
C2orf65	130951	broad.mit.edu	37	2	74787316	74787316	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74787316G>A	uc002smy.2	-	9	1501	c.1384C>T	c.(1384-1386)CGG>TGG	p.R462W	C2orf65_uc010ysa.1_Missense_Mutation_p.R462W|C2orf65_uc010ffp.2_Missense_Mutation_p.R111W|C2orf65_uc002smx.2_Missense_Mutation_p.R218W	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	462					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						GGGTGGAGCCGCCCCTGAGGC	0.473																0.104167	2.745565	10.226632	5	43	KEEP	---	---	---	---	6	0	51	20	-1	capture	Missense_Mutation	SNP	74787316	74787316	C2orf65	2	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2164	72
AMMECR1L	83607	broad.mit.edu	37	2	128631554	128631554	+	Silent	SNP	C	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128631554C>A	uc002tpl.2	-	3	506	c.255G>T	c.(253-255)GCG>GCT	p.A85A	AMMECR1L_uc002tpm.2_Silent_p.A85A	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like	85										central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		GAGGGCTCAGCGCTCCCGATG	0.547																0.283654	163.87028	172.593538	59	149	KEEP	---	---	---	---	38	26	118	47	0.40625	capture	Silent	SNP	128631554	128631554	AMMECR1L	2	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	579	72
LPIN3	64900	broad.mit.edu	37	20	39977494	39977494	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39977494C>T	uc002xjx.2	+	4	615	c.524C>T	c.(523-525)TCC>TTC	p.S175F	LPIN3_uc010ggh.2_Missense_Mutation_p.S175F|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3	175					fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				AGTGAGCTATCCCTGCCGGAA	0.398																0.333333	15.035304	15.482488	6	12	KEEP	---	---	---	---	3	4	10	5	-1	capture	Missense_Mutation	SNP	39977494	39977494	LPIN3	20	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8836	72
SEMG1	6406	broad.mit.edu	37	20	43837052	43837052	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43837052C>T	uc002xni.2	+	2	1171	c.1114C>T	c.(1114-1116)CGC>TGC	p.R372C	SEMG1_uc002xnj.2_Missense_Mutation_p.R312C|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Intron	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	372	58 AA repeat 2.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				TGTATCCCAACGCAGTATTTA	0.418																0.38961	86.523816	87.34826	30	47	KEEP	---	---	---	---	18	17	29	20	-1	capture	Missense_Mutation	SNP	43837052	43837052	SEMG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13937	72
ARFGEF2	10564	broad.mit.edu	37	20	47605879	47605879	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47605879C>A	uc002xtx.3	+	19	2743	c.2591C>A	c.(2590-2592)GCT>GAT	p.A864D	ARFGEF2_uc010zyf.1_Missense_Mutation_p.A157D	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	864					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GAGCAAATGGCTAAAACAGCC	0.468	Esophageal Squamous(176;1738 1974 26285 33069 35354)															0.0625	-5.255805	7.517644	4	60	KEEP	---	---	---	---	2	2	36	31	0.5	capture	Missense_Mutation	SNP	47605879	47605879	ARFGEF2	20	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	846	72
ZNFX1	57169	broad.mit.edu	37	20	47865786	47865786	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47865786T>G	uc002xui.2	-	14	4022	c.3775A>C	c.(3775-3777)ATG>CTG	p.M1259L		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1259							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AGCCGGAGCATGGGGCCTATT	0.527																0.33121	161.097481	165.086805	52	105	KEEP	---	---	---	---	41	11	72	36	-1	capture	Missense_Mutation	SNP	47865786	47865786	ZNFX1	20	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	18081	72
MX2	4600	broad.mit.edu	37	21	42771150	42771150	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42771150G>A	uc002yzf.1	+	10	1404	c.1300G>A	c.(1300-1302)GAA>AAA	p.E434K	MX2_uc002yzg.1_Missense_Mutation_p.E157K|MX2_uc010gop.1_Intron	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	434					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				TCAGGACATCGAAAAGTTAGT	0.373																0.049587	-13.548452	12.502211	6	115	KEEP	---	---	---	---	5	1	79	45	-1	capture	Missense_Mutation	SNP	42771150	42771150	MX2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9908	72
KRTAP10-8	386681	broad.mit.edu	37	21	46032419	46032419	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46032419C>T	uc002zfo.1	+	1	424	c.402C>T	c.(400-402)TGC>TGT	p.C134C	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	134	19 X 5 AA repeats of C-C-X(3).|8.					keratin filament				large_intestine(1)|breast(1)	2						CCGTGTGCTGCGTGTCCATCT	0.627																0.080769	-1.511319	45.052879	21	239	KEEP	---	---	---	---	15	9	153	99	-1	capture	Silent	SNP	46032419	46032419	KRTAP10-8	21	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	8435	72
PI4KA	5297	broad.mit.edu	37	22	21174060	21174060	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21174060G>C	uc002zsz.3	-	6	715	c.484C>G	c.(484-486)CTG>GTG	p.L162V	PI4KA_uc010gsq.1_Missense_Mutation_p.L220V	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	162					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			AGCTCTTCCAGGACACGGAGG	0.522	GBM(136;1332 1831 3115 23601 50806)				873											0.30916	229.566413	238.075351	81	181	KEEP	---	---	---	---	50	36	124	68	-1	capture	Missense_Mutation	SNP	21174060	21174060	PI4KA	22	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	11776	72
FRAS1	80144	broad.mit.edu	37	4	79385647	79385647	+	Silent	SNP	C	T	T	rs150936204	by1000genomes	TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79385647C>T	uc003hlb.2	+	49	7379	c.6939C>T	c.(6937-6939)CCC>CCT	p.P2313P		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2312	CSPG 11.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ATTCGCTGCCCGTCGTACAGA	0.537																0.393162	143.349264	144.510006	46	71	KEEP	---	---	---	---	25	25	51	27	-1	capture	Silent	SNP	79385647	79385647	FRAS1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5986	72
POU4F2	5458	broad.mit.edu	37	4	147561389	147561389	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:147561389C>T	uc003ikv.2	+	2	907	c.659C>T	c.(658-660)CCG>CTG	p.P220L		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	220					estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					GCTCACGCGCCGCACATGGCC	0.726																0.321429	25.265047	26.058166	9	19	KEEP	---	---	---	---	4	5	11	8	-1	capture	Missense_Mutation	SNP	147561389	147561389	POU4F2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12180	72
NR3C2	4306	broad.mit.edu	37	4	149357273	149357273	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:149357273C>T	uc003ilj.3	-	2	1074	c.740G>A	c.(739-741)AGG>AAG	p.R247K	NR3C2_uc003ilk.3_Missense_Mutation_p.R247K|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	247	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	GCTGTGCGACCTGGAGCCTCG	0.532	Melanoma(27;428 957 40335 51025 51111)															0.383333	146.027092	147.457416	46	74	KEEP	---	---	---	---	38	11	62	19	-1	capture	Missense_Mutation	SNP	149357273	149357273	NR3C2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10538	72
FHDC1	85462	broad.mit.edu	37	4	153881733	153881733	+	Missense_Mutation	SNP	C	T	T	rs149221149		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:153881733C>T	uc003inf.2	+	4	755	c.680C>T	c.(679-681)GCG>GTG	p.A227V		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	227	FH2.				actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AAGTTAAAAGCGTTTAGTGGC	0.363																0.441441	143.356887	143.68901	49	62	KEEP	---	---	---	---	38	17	59	9	-1	capture	Missense_Mutation	SNP	153881733	153881733	FHDC1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5822	72
PLEKHG4B	153478	broad.mit.edu	37	5	143328	143328	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:143328C>T	uc003jak.2	+	2	626	c.576C>T	c.(574-576)GAC>GAT	p.D192D		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	192					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGGTGCTGGACGTCAGTCAGG	0.662																0.28169	103.658587	109.730655	40	102	KEEP	---	---	---	---	21	26	55	61	-1	capture	Silent	SNP	143328	143328	PLEKHG4B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11975	72
FTMT	94033	broad.mit.edu	37	5	121187738	121187738	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:121187738C>T	uc003kss.2	+	1	89	c.80C>T	c.(79-81)GCG>GTG	p.A27V		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	27					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TGCTGCTTCGCGCTCCCGCTG	0.741																0.403846	62.467868	62.887149	21	31	KEEP	---	---	---	---	15	6	17	19	-1	capture	Missense_Mutation	SNP	121187738	121187738	FTMT	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6027	72
PCDHA2	56146	broad.mit.edu	37	5	140175903	140175903	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140175903G>A	uc003lhd.2	+	1	1460	c.1354G>A	c.(1354-1356)GCG>ACG	p.A452T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A452T|PCDHA2_uc011czy.1_Missense_Mutation_p.A452T	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	452	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGACAACGCGCCGGCGTT	0.647																0.369792	199.984865	202.841219	71	121	KEEP	---	---	---	---	46	44	89	68	-1	capture	Missense_Mutation	SNP	140175903	140175903	PCDHA2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11427	72
ADRA1B	147	broad.mit.edu	37	5	159344026	159344026	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:159344026C>T	uc003lxt.1	+	1	287	c.114C>T	c.(112-114)CCC>CCT	p.P38P		NM_000679	NP_000670	P35368	ADA1B_HUMAN	alpha-1B-adrenergic receptor	38	Extracellular (By similarity).				cell proliferation|cell-cell signaling|G-protein signaling, coupled to cAMP nucleotide second messenger|intracellular protein kinase cascade	integral to plasma membrane	alpha1-adrenergic receptor activity			lung(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Modafinil(DB00745)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Olanzapine(DB00334)|Phendimetrazine(DB01579)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Trazodone(DB00656)	CCACACTGCCCCAGCTGGACA	0.587																0.408867	263.290306	264.762551	83	120	KEEP	---	---	---	---	48	43	81	51	-1	capture	Silent	SNP	159344026	159344026	ADRA1B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	335	72
RGS14	10636	broad.mit.edu	37	5	176795734	176795734	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176795734T>C	uc003mgf.2	+	9	1048	c.866T>C	c.(865-867)CTT>CCT	p.L289P	RGS14_uc003mgg.1_Missense_Mutation_p.L136P|RGS14_uc003mgh.2_Missense_Mutation_p.L136P|RGS14_uc003mgi.2_Missense_Mutation_p.L59P|RGS14_uc003mgj.2_5'Flank	NM_006480	NP_006471	O43566	RGS14_HUMAN	regulator of G-protein signalling 14	289					chromosome segregation|long-term memory|long-term synaptic potentiation|negative regulation of ERK1 and ERK2 cascade|negative regulation of MAP kinase activity|negative regulation of synaptic plasticity|nucleocytoplasmic transport|platelet-derived growth factor receptor signaling pathway|positive regulation of neurogenesis|regulation of DNA-dependent transcription in response to stress|regulation of G-protein coupled receptor protein signaling pathway|response to oxidative stress|spindle organization|visual learning|zygote asymmetric cell division	cell junction|centrosome|dendritic spine|microtubule|PML body|postsynaptic density|postsynaptic membrane|spindle pole	GDP-dissociation inhibitor activity|GTPase activator activity|microtubule binding|receptor signaling complex scaffold activity|receptor signaling protein activity			lung(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGAAGAGCCTTGGGAGCACG	0.582	NSCLC(47;353 1896 28036)													OREG0017086	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.346154	90.004847	91.633282	27	51	KEEP	---	---	---	---	15	16	28	35	-1	capture	Missense_Mutation	SNP	176795734	176795734	RGS14	5	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	13189	72
ZKSCAN4	387032	broad.mit.edu	37	6	28213024	28213024	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28213024A>G	uc003nks.1	-	5	1752	c.1508T>C	c.(1507-1509)ATT>ACT	p.I503T	ZKSCAN4_uc011dlb.1_Missense_Mutation_p.I348T	NM_019110	NP_061983	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	503	C2H2-type 6.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CTGATGTTCAATAAGACTTCT	0.428																0.408284	242.452769	243.69254	69	100	KEEP	---	---	---	---	39	30	65	37	-1	capture	Missense_Mutation	SNP	28213024	28213024	ZKSCAN4	6	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17569	72
SYNE1	23345	broad.mit.edu	37	6	152461140	152461140	+	Missense_Mutation	SNP	C	T	T	rs143049227		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152461140C>T	uc010kiw.2	-	140	26005	c.25403G>A	c.(25402-25404)CGT>CAT	p.R8468H	SYNE1_uc010kiv.2_Missense_Mutation_p.R2992H|SYNE1_uc003qos.3_Missense_Mutation_p.R2992H|SYNE1_uc003qot.3_Missense_Mutation_p.R8420H|SYNE1_uc003qou.3_Missense_Mutation_p.R8468H|SYNE1_uc003qop.3_Missense_Mutation_p.R653H|SYNE1_uc011eez.1_Missense_Mutation_p.R670H|SYNE1_uc003qoq.3_Missense_Mutation_p.R670H|SYNE1_uc003qor.3_Missense_Mutation_p.R1391H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8468	Cytoplasmic (Potential).|Spectrin 31.		R -> H (in a colorectal cancer sample; somatic mutation).		cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	p.R8468H(1)		central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGTTCCAGACGCTGGAGCTG	0.557													HNSCC(10;0.0054)			0.352459	118.081688	120.426479	43	79	KEEP	---	---	---	---	33	16	53	39	-1	capture	Missense_Mutation	SNP	152461140	152461140	SYNE1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15333	72
AHR	196	broad.mit.edu	37	7	17367444	17367444	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:17367444C>A	uc011jxz.1	+	4	1035	c.422C>A	c.(421-423)ACT>AAT	p.T141N	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	141	PAS 1.				apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					GCTTCTTCTACTATACAAGAT	0.264																0.279762	121.449077	128.779209	47	121	KEEP	---	---	---	---	34	20	88	45	0.37037037037	capture	Missense_Mutation	SNP	17367444	17367444	AHR	7	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	416	72
RAPGEF5	9771	broad.mit.edu	37	7	22165268	22165268	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:22165268G>A	uc003svg.2	-	25	2344	c.2031C>T	c.(2029-2031)ATC>ATT	p.I677I		NM_012294	NP_036426	Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	527	Ras-GEF.				nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1						CAGTGTCTGCGATCATATGCT	0.463																0.3	110.989574	115.996601	42	98	KEEP	---	---	---	---	28	15	73	33	-1	capture	Silent	SNP	22165268	22165268	RAPGEF5	7	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	12942	72
EGFR	1956	broad.mit.edu	37	7	55211080	55211080	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55211080G>A	uc003tqk.2	+	3	569	c.323G>A	c.(322-324)AGA>AAA	p.R108K	EGFR_uc003tqh.2_Missense_Mutation_p.R108K|EGFR_uc003tqi.2_Missense_Mutation_p.R108K|EGFR_uc003tqj.2_Missense_Mutation_p.R108K|EGFR_uc010kzg.1_Missense_Mutation_p.R108K|EGFR_uc011kco.1_Missense_Mutation_p.R55K	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	108	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.R108K(7)|p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGATCATCAGAGGAAATATG	0.423			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.307377	838.081723	870.39798	300	676	KEEP	---	---	---	---	205	103	416	275	-1	capture	Missense_Mutation	SNP	55211080	55211080	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4922	72
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	A	A	rs149840192		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>A	uc003tqk.2	+	7	1112	c.866C>A	c.(865-867)GCC>GAC	p.A289D	EGFR_uc003tqh.2_Missense_Mutation_p.A289D|EGFR_uc003tqi.2_Missense_Mutation_p.A289D|EGFR_uc003tqj.2_Missense_Mutation_p.A289D|EGFR_uc010kzg.1_Missense_Mutation_p.A244D|EGFR_uc011kco.1_Missense_Mutation_p.A236D|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.09205	31.680544	191.726689	88	868	KEEP	---	---	---	---	41	35	505	417	0.460526315789	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	4922	72
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.327064	789.170344	814.597173	313	644	KEEP	---	---	---	---	184	136	372	305	0.575	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	72
ZKSCAN1	7586	broad.mit.edu	37	7	99621816	99621816	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99621816G>A	uc003usk.1	+	3	685	c.466G>A	c.(466-468)GGG>AGG	p.G156R	ZKSCAN1_uc003usj.2_Missense_Mutation_p.G155R|ZKSCAN1_uc003usl.1_Missense_Mutation_p.G120R|ZKSCAN1_uc003usm.1_Intron	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	156					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GCTCGCAAGGGGGATGGTGCC	0.507																0.165	68.449316	89.750651	33	167	KEEP	---	---	---	---	24	11	110	70	-1	capture	Missense_Mutation	SNP	99621816	99621816	ZKSCAN1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	17566	72
DOCK4	9732	broad.mit.edu	37	7	111395650	111395650	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:111395650C>T	uc003vfx.2	-	41	4579	c.4310G>A	c.(4309-4311)TGG>TAG	p.W1437*	DOCK4_uc011kml.1_Nonsense_Mutation_p.W318*|DOCK4_uc011kmm.1_Nonsense_Mutation_p.W344*|DOCK4_uc003vfw.2_Nonsense_Mutation_p.W887*|DOCK4_uc003vfy.2_Nonsense_Mutation_p.W1482*	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1437	DHR-2.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				TCTCTCCACCCAGAGACTCTA	0.453																0.158537	21.416984	30.535993	13	69	KEEP	---	---	---	---	10	3	51	30	-1	capture	Nonsense_Mutation	SNP	111395650	111395650	DOCK4	7	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	4645	72
WNT2	7472	broad.mit.edu	37	7	116960624	116960624	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116960624G>A	uc003viz.2	-	2	607	c.307C>T	c.(307-309)CGA>TGA	p.R103*	WNT2_uc003vja.2_Missense_Mutation_p.P28L	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	103					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GACTTACTTCGGAGTAGGACC	0.537																0.15625	18.311742	25.528404	10	54	KEEP	---	---	---	---	8	3	39	18	-1	capture	Nonsense_Mutation	SNP	116960624	116960624	WNT2	7	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	17267	72
TMEM209	84928	broad.mit.edu	37	7	129813714	129813714	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129813714G>A	uc003vpn.2	-	12	1533	c.1410C>T	c.(1408-1410)GAC>GAT	p.D470D	TMEM209_uc010lmc.1_Silent_p.D428D	NM_032842	NP_116231	Q96SK2	TM209_HUMAN	transmembrane protein 209	470						integral to membrane				ovary(2)|large_intestine(1)	3	Melanoma(18;0.0435)					AAGTTTTTCCGTCGGGATACT	0.363																0.036111	-61.638044	22.455611	13	347	KEEP	---	---	---	---	9	4	251	157	-1	capture	Silent	SNP	129813714	129813714	TMEM209	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16017	72
RAB19	401409	broad.mit.edu	37	7	140107592	140107592	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140107592C>T	uc010lni.2	+	2	344	c.146C>T	c.(145-147)ACG>ATG	p.T49M	RAB19_uc011krc.1_Missense_Mutation_p.T49M	NM_001008749	NP_001008749	A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family	49	Effector region (By similarity).				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0	Melanoma(164;0.0142)					CAGCAGAACACGATTGGAGTG	0.468																0.033333	-21.796875	6.708259	4	116	KEEP	---	---	---	---	4	0	76	47	-1	capture	Missense_Mutation	SNP	140107592	140107592	RAB19	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12799	72
DLGAP2	9228	broad.mit.edu	37	8	1496906	1496906	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1496906G>A	uc003wpl.2	+	2	144	c.47G>A	c.(46-48)GGG>GAG	p.G16E	DLGAP2_uc003wpm.2_Missense_Mutation_p.G16E	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	95					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CTGTGTTCCGGGCACACGTGT	0.721																0.478261	33.720689	33.73029	11	12	KEEP	---	---	---	---	10	9	10	9	-1	capture	Missense_Mutation	SNP	1496906	1496906	DLGAP2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4518	72
ADAMDEC1	27299	broad.mit.edu	37	8	24254921	24254921	+	Silent	SNP	C	T	T	rs141288918		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24254921C>T	uc003xdz.2	+	6	799	c.579C>T	c.(577-579)GAC>GAT	p.D193D	ADAMDEC1_uc010lub.2_Silent_p.D114D|ADAMDEC1_uc011lab.1_Silent_p.D114D	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	193					integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		AGAGCACTGACGGGAAACAAG	0.443	Ovarian(147;687 1849 3699 25981 31337)															0.252788	173.776997	188.700988	68	201	KEEP	---	---	---	---	37	40	119	103	-1	capture	Silent	SNP	24254921	24254921	ADAMDEC1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	254	72
SDCBP	6386	broad.mit.edu	37	8	59492353	59492353	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59492353G>A	uc003xtn.2	+	7	900	c.750G>A	c.(748-750)AAG>AAA	p.K250K	SDCBP_uc003xto.2_Silent_p.K249K|SDCBP_uc003xtr.2_Silent_p.K249K|SDCBP_uc003xtp.2_Silent_p.K244K|SDCBP_uc003xtq.2_Silent_p.K250K|SDCBP_uc003xts.2_Silent_p.K256K|SDCBP_uc011led.1_Silent_p.K191K	NM_005625	NP_005616	O00560	SDCB1_HUMAN	syntenin isoform 1	250	PDZ 2.				actin cytoskeleton organization|axon guidance|positive regulation of phosphorylation|protein targeting to membrane|substrate-dependent cell migration, cell extension|synaptic transmission	cytoskeleton|cytosol|endoplasmic reticulum membrane|focal adhesion|interleukin-5 receptor complex|melanosome|nucleus	cytoskeletal adaptor activity|frizzled binding|interleukin-5 receptor binding|protein heterodimerization activity|protein N-terminus binding|syndecan binding				0		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TTGGATTGAAGGTAAGGAACA	0.398																0.355828	182.018861	184.997553	58	105	KEEP	---	---	---	---	44	20	78	38	-1	capture	Silent	SNP	59492353	59492353	SDCBP	8	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	13848	72
DOCK8	81704	broad.mit.edu	37	9	396909	396909	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:396909C>G	uc003zgf.2	+	25	3207	c.3095C>G	c.(3094-3096)GCA>GGA	p.A1032G	DOCK8_uc010mgu.2_Missense_Mutation_p.A334G|DOCK8_uc010mgv.2_Missense_Mutation_p.A932G|DOCK8_uc010mgw.1_Missense_Mutation_p.A334G|DOCK8_uc003zgk.2_Missense_Mutation_p.A490G	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1032					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TCGGAAATTGCAGCCCTTTTA	0.274																0.266667	100.545971	106.446385	32	88	KEEP	---	---	---	---	16	18	46	47	-1	capture	Missense_Mutation	SNP	396909	396909	DOCK8	9	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	4649	72
DOCK8	81704	broad.mit.edu	37	9	399200	399200	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:399200C>G	uc003zgf.2	+	26	3287	c.3175C>G	c.(3175-3177)CTT>GTT	p.L1059V	DOCK8_uc010mgu.2_Missense_Mutation_p.L361V|DOCK8_uc010mgv.2_Missense_Mutation_p.L959V|DOCK8_uc010mgw.1_Missense_Mutation_p.L361V|DOCK8_uc003zgk.2_Missense_Mutation_p.L517V	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1059					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CTTGTATGACCTTCTCTCCCT	0.493																0.310606	107.2167	111.439772	41	91	KEEP	---	---	---	---	27	23	59	46	-1	capture	Missense_Mutation	SNP	399200	399200	DOCK8	9	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	4649	72
DOCK8	81704	broad.mit.edu	37	9	439373	439373	+	Silent	SNP	G	A	A	rs144172375		TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:439373G>A	uc003zgf.2	+	40	5320	c.5208G>A	c.(5206-5208)GCG>GCA	p.A1736A	DOCK8_uc010mgu.2_Silent_p.A1038A|DOCK8_uc010mgv.2_Silent_p.A1636A|DOCK8_uc003zgk.2_Silent_p.A1194A	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1736	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGCAGGCCGCGGAGCTCTTCA	0.647																0.295455	112.878141	117.815583	39	93	KEEP	---	---	---	---	27	14	69	33	-1	capture	Silent	SNP	439373	439373	DOCK8	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4649	72
OR2K2	26248	broad.mit.edu	37	9	114090506	114090506	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114090506C>T	uc011lwp.1	-	1	208	c.208G>A	c.(208-210)GAT>AAT	p.D70N		NM_205859	NP_995581	Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K,	99	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TAACAAATATCCATGAAAGAG	0.418																0.421569	129.58414	130.135761	43	59	KEEP	---	---	---	---	20	29	40	25	-1	capture	Missense_Mutation	SNP	114090506	114090506	OR2K2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	10909	72
COL27A1	85301	broad.mit.edu	37	9	117020836	117020836	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117020836C>T	uc011lxl.1	+	28	3157	c.3157C>T	c.(3157-3159)CGA>TGA	p.R1053*	COL27A1_uc004bii.2_RNA	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1053	Pro-rich.|Collagen-like 7.|Triple-helical region.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						TCCAGGATCTCGAGGCCCACC	0.622																0.333333	52.40008	53.805285	19	38	KEEP	---	---	---	---	16	6	28	14	-1	capture	Nonsense_Mutation	SNP	117020836	117020836	COL27A1	9	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	3650	72
C9orf171	389799	broad.mit.edu	37	9	135374759	135374759	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135374759C>T	uc004cbn.2	+	4	452	c.404C>T	c.(403-405)GCC>GTC	p.A135V	C9orf171_uc004cbo.2_Missense_Mutation_p.A99V	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799	135										ovary(4)|large_intestine(1)	5						CTGCCCTCAGCCATCGGACGC	0.647																0.395833	107.326906	108.2392	38	58	KEEP	---	---	---	---	20	24	37	29	-1	capture	Missense_Mutation	SNP	135374759	135374759	C9orf171	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2446	72
ARSF	416	broad.mit.edu	37	X	3021960	3021960	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3021960G>A	uc004cre.1	+	9	1481	c.1260G>A	c.(1258-1260)CAG>CAA	p.Q420Q	ARSF_uc004crf.1_Silent_p.Q420Q	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	420						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GTCTCCCTCAGGACAGGTGAT	0.448																0.452174	172.99159	173.220098	52	63	KEEP	---	---	---	---	35	22	52	20	-1	capture	Silent	SNP	3021960	3021960	ARSF	23	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	984	72
BCOR	54880	broad.mit.edu	37	X	39930272	39930272	+	Silent	SNP	C	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39930272C>T	uc004den.3	-	6	3484	c.3192G>A	c.(3190-3192)TCG>TCA	p.S1064S	BCOR_uc004dep.3_Silent_p.S1064S|BCOR_uc004deo.3_Silent_p.S1046S|BCOR_uc004dem.3_Silent_p.S1064S	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1064					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CCAGGGTGACCGACTTTGGCT	0.517																0.081761	1.867335	30.167542	13	146	KEEP	---	---	---	---	6	7	120	47	-1	capture	Silent	SNP	39930272	39930272	BCOR	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1375	72
SLC38A5	92745	broad.mit.edu	37	X	48319395	48319395	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48319395G>T	uc010nid.2	-	13	1107	c.929C>A	c.(928-930)ACC>AAC	p.T310N	SLC38A5_uc004djk.3_Missense_Mutation_p.T259N	NM_033518	NP_277053	Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	310	Helical; (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane				ovary(3)	3						GTATCCAAAGGTTGCTGTGAG	0.522																0.222222	17.983415	20.537187	8	28	KEEP	---	---	---	---	5	4	16	14	0.555555555556	capture	Missense_Mutation	SNP	48319395	48319395	SLC38A5	23	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	14499	72
HUWE1	10075	broad.mit.edu	37	X	53573431	53573431	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53573431G>A	uc004dsp.2	-	70	11283	c.10881C>T	c.(10879-10881)GCC>GCT	p.A3627A	HUWE1_uc004dsn.2_Silent_p.A2435A|HUWE1_uc004dsq.1_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3627					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CCAGATGGCGGGCTCCATTCA	0.403																0.215686	28.097642	31.901235	11	40	KEEP	---	---	---	---	8	5	32	19	-1	capture	Silent	SNP	53573431	53573431	HUWE1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7386	72
ARMCX2	9823	broad.mit.edu	37	X	100911799	100911799	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100911799G>A	uc004eid.2	-	3	1131	c.776C>T	c.(775-777)GCA>GTA	p.A259V	ARMCX2_uc004eie.3_Missense_Mutation_p.A259V|ARMCX2_uc004eif.3_Missense_Mutation_p.A259V|ARMCX2_uc004eig.3_Missense_Mutation_p.A259V|ARMCX2_uc010nnt.2_Missense_Mutation_p.A259V	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	259	Ala-rich.					integral to membrane	binding			ovary(6)	6						CCCAGGGGTTGCTTTCTTGGC	0.597																0.385417	292.382379	295.685434	111	177	KEEP	---	---	---	---	81	38	112	79	-1	capture	Missense_Mutation	SNP	100911799	100911799	ARMCX2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	953	72
NRK	203447	broad.mit.edu	37	X	105153109	105153109	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105153109G>A	uc004emd.2	+	13	1779	c.1476G>A	c.(1474-1476)CAG>CAA	p.Q492Q	NRK_uc010npc.1_Silent_p.Q160Q	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	492	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GGCTTCTGCAGGTACAGTCCC	0.537					430								HNSCC(51;0.14)			0.291139	64.185303	67.278177	23	56	KEEP	---	---	---	---	16	11	37	29	-1	capture	Silent	SNP	105153109	105153109	NRK	23	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	10562	72
DCX	1641	broad.mit.edu	37	X	110644367	110644367	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:110644367G>A	uc004epd.2	-	3	971	c.799C>T	c.(799-801)CGC>TGC	p.R267C	DCX_uc011msv.1_Missense_Mutation_p.R267C|DCX_uc004epe.2_Missense_Mutation_p.R186C|DCX_uc004epf.2_Missense_Mutation_p.R186C|DCX_uc004epg.2_Missense_Mutation_p.R186C	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	267	Doublecortin 2.		R -> C (in SBHX).		axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						ACCCCACTGCGGATGATGGTA	0.537																0.398876	219.497822	221.087086	71	107	KEEP	---	---	---	---	48	27	70	40	-1	capture	Missense_Mutation	SNP	110644367	110644367	DCX	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4277	72
ANKRD58	347454	broad.mit.edu	37	X	118893488	118893488	+	Silent	SNP	G	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118893488G>A	uc010nql.2	+	1	913	c.858G>A	c.(856-858)TCG>TCA	p.S286S		NM_001105576	NP_001099046	A6NJG2	ANR58_HUMAN	ankyrin repeat domain 58	286											0						TGGCAGCGTCGCGGACCAAGG	0.642																0.421053	43.595655	43.801446	16	22	KEEP	---	---	---	---	10	8	14	11	-1	capture	Silent	SNP	118893488	118893488	ANKRD58	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	679	72
CNGA2	1260	broad.mit.edu	37	X	150912487	150912487	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150912487T>A	uc004fey.1	+	7	1736	c.1512T>A	c.(1510-1512)GAT>GAA	p.D504E		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	504	cAMP (By similarity).|Cytoplasmic (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGGCTGATGATGGTGTGA	0.398																0.317073	77.925502	80.362603	26	56	KEEP	---	---	---	---	27	9	49	26	-1	capture	Missense_Mutation	SNP	150912487	150912487	CNGA2	23	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	3562	72
CLSPN	63967	broad.mit.edu	37	1	36228771	36228775	+	Frame_Shift_Del	DEL	TTTAC	-	-			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36228771_36228775delTTTAC	uc001bzi.2	-	4	810_814	c.730_734delGTAAA	c.(730-735)GTAAAAfs	p.V244fs	CLSPN_uc009vux.2_Frame_Shift_Del_p.V244fs	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	244_245					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTTGTGCTTTTTTACTTTGTTTTTT	0.322																0.26			22	63		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	36228771	36228775	CLSPN	1	TTTAC	-	-	-	1	0	1	0	1	0	0	0	0	832	64	5	5	3525	72
TTC13	79573	broad.mit.edu	37	1	231059600	231059600	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:231059600delT	uc001huf.3	-	15	1832	c.1801delA	c.(1801-1803)ATTfs	p.I601fs	TTC13_uc009xfi.2_Frame_Shift_Del_p.I548fs|TTC13_uc009xfj.2_RNA|TTC13_uc001hug.3_Frame_Shift_Del_p.I548fs|TTC13_uc009xfk.1_Frame_Shift_Del_p.I491fs	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13 isoform a	601							binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		ATTAAATTAATGTGGTTGTTA	0.438																0.40			69	104		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	231059600	231059600	TTC13	1	T	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	16562	72
DLG5	9231	broad.mit.edu	37	10	79577582	79577582	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:79577582delA	uc001jzk.2	-	18	3807	c.3737delT	c.(3736-3738)ATGfs	p.M1246fs	DLG5_uc001jzi.2_Frame_Shift_Del_p.M1fs|DLG5_uc001jzj.2_Frame_Shift_Del_p.M661fs|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Frame_Shift_Del_p.M850fs	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	1246					cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GGTGGCTCTCATCTCGGAGTA	0.597																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	79577582	79577582	DLG5	10	A	-	-	-	1	0	1	0	1	0	0	0	0	104	8	5	5	4516	72
ATN1	1822	broad.mit.edu	37	12	7046515	7046516	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7046515_7046516insC	uc001qrw.1	+	5	2322_2323	c.2085_2086insC	c.(2083-2088)GGGCCCfs	p.G695fs	ATN1_uc001qrx.1_Frame_Shift_Ins_p.G695fs	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	695_696					cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TGGGACCTGGGCCCCTGCCACC	0.723																0.29			7	17		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	7046515	7046516	ATN1	12	-	C	C	C	1	0	1	1	0	0	0	0	0	535	42	5	5	1102	72
FA2H	79152	broad.mit.edu	37	16	74748141	74748141	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0876-01	TCGA-06-0876-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:74748141delC	uc002fde.1	-	7	1134	c.1066delG	c.(1066-1068)GATfs	p.D356fs	FA2H_uc002fdd.1_Frame_Shift_Del_p.D129fs|FA2H_uc010vmy.1_RNA	NM_024306	NP_077282	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	356				D -> G (in Ref. 1; BAB71632).	cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity				0						AAACAGTAATCCCACAATTTA	0.582																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	74748141	74748141	FA2H	16	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	5306	72
