Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CELA3A	10136	broad.mit.edu	37	1	22333423	22333423	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22333423G>A	uc001bfl.2	+	5	434	c.415G>A	c.(415-417)GTC>ATC	p.V139I		NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	139	Peptidase S1.				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						GGGAGATGCCGTCCAGCTCGC	0.627																0.387755	158.347976	159.967705	57	90	KEEP	---	---	---	---	27	33	42	72	-1	capture	Missense_Mutation	SNP	22333423	22333423	CELA3A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3181	87
EPB41	2035	broad.mit.edu	37	1	29344851	29344851	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:29344851G>A	uc001brm.1	+	6	1028	c.1021G>A	c.(1021-1023)GAC>AAC	p.D341N	EPB41_uc001brg.1_Missense_Mutation_p.D132N|EPB41_uc001brh.1_Missense_Mutation_p.D132N|EPB41_uc001bri.1_Missense_Mutation_p.D306N|EPB41_uc001brj.1_Missense_Mutation_p.D132N|EPB41_uc009vtk.1_Missense_Mutation_p.D306N|EPB41_uc001brk.2_Missense_Mutation_p.D341N|EPB41_uc001brl.1_Missense_Mutation_p.D341N|EPB41_uc009vtl.1_Missense_Mutation_p.D132N|EPB41_uc009vtm.1_5'UTR	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	341	FERM.				blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GGGAGACTACGACCCAGAACT	0.468																0.342466	213.156808	217.95941	75	144	KEEP	---	---	---	---	27	49	75	82	-1	capture	Missense_Mutation	SNP	29344851	29344851	EPB41	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5106	87
EIF2C3	192669	broad.mit.edu	37	1	36505436	36505436	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36505436G>A	uc001bzp.2	+	15	2144	c.1888G>A	c.(1888-1890)GTA>ATA	p.V630I	EIF2C3_uc001bzq.2_Missense_Mutation_p.V396I	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	630	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTGTGCCACAGTAAGAGTTCA	0.383	Colon(144;60 2363 31043 40539)															0.380952	155.270637	156.836904	48	78	KEEP	---	---	---	---	33	23	47	46	-1	capture	Missense_Mutation	SNP	36505436	36505436	EIF2C3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	4962	87
EPHA10	284656	broad.mit.edu	37	1	38197175	38197175	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38197175C>T	uc009vvi.2	-	7	1657	c.1571G>A	c.(1570-1572)CGC>CAC	p.R524H	EPHA10_uc009vvh.1_RNA|EPHA10_uc001cbu.2_RNA|EPHA10_uc001cbv.1_RNA	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	524	Fibronectin type-III 2.|Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAAGACGTAGCGGGTAGCCGG	0.592					328											0.385057	181.358831	183.380801	67	107	KEEP	---	---	---	---	49	42	73	75	-1	capture	Missense_Mutation	SNP	38197175	38197175	EPHA10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5121	87
GBP1	2633	broad.mit.edu	37	1	89525904	89525904	+	Silent	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89525904G>A	uc001dmx.2	-	3	514	c.294C>T	c.(292-294)ACC>ACT	p.T98T		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	98	GTP.				interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		CCAGACCCTCGGTGTCCAGCA	0.507																0.426415	369.90113	371.136544	113	152	KEEP	---	---	---	---	59	63	94	79	-1	capture	Silent	SNP	89525904	89525904	GBP1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6213	87
TXNIP	10628	broad.mit.edu	37	1	145440909	145440909	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145440909C>T	uc001enn.3	+	7	1337	c.996C>T	c.(994-996)CCC>CCT	p.P332P	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Silent_p.P277P	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	332					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TAGCTCCTCCCTGCTATATGG	0.443																0.275862	235.273806	248.390039	80	210	KEEP	---	---	---	---	49	43	124	119	-1	capture	Silent	SNP	145440909	145440909	TXNIP	1	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	16685	87
FLG	2312	broad.mit.edu	37	1	152278855	152278855	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152278855C>T	uc001ezu.1	-	3	8543	c.8507G>A	c.(8506-8508)AGT>AAT	p.S2836N		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2836	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGCTTGCACTTCTGGATCC	0.557												Ichthyosis				0.150538	165.892882	242.115682	98	553	KEEP	---	---	---	---	67	72	419	442	-1	capture	Missense_Mutation	SNP	152278855	152278855	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	5867	87
PRRG4	79056	broad.mit.edu	37	11	32875008	32875008	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32875008C>T	uc001mtx.2	+	6	869	c.616C>T	c.(616-618)CCA>TCA	p.P206S		NM_024081	NP_076986	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4	206	Cytoplasmic (Potential).|Poly-Pro.					extracellular region|Golgi apparatus|integral to membrane	calcium ion binding				0	Breast(20;0.206)					ACCACCACCACCATATCCTGG	0.438																0.387755	110.728883	111.810243	38	60	KEEP	---	---	---	---	17	23	36	38	-1	capture	Missense_Mutation	SNP	32875008	32875008	PRRG4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	12503	87
TRIM49	57093	broad.mit.edu	37	11	89531694	89531694	+	Silent	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89531694G>A	uc001pdb.2	-	8	1292	c.963C>T	c.(961-963)TTC>TTT	p.F321F		NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18	321	B30.2/SPRY.					intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GTGTTGCAGTGAAATAGGGTA	0.418																0.191176	27.831586	33.894928	13	55	KEEP	---	---	---	---	19	5	48	44	-1	capture	Silent	SNP	89531694	89531694	TRIM49	11	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	16407	87
ENO2	2026	broad.mit.edu	37	12	7026819	7026819	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7026819C>G	uc001qru.1	+	6	607	c.385C>G	c.(385-387)CCC>GCC	p.P129A	ENO2_uc009zfi.1_Missense_Mutation_p.P129A|ENO2_uc010sfq.1_Missense_Mutation_p.P86A|ENO2_uc001qrv.1_Missense_Mutation_p.P129A	NM_001975	NP_001966	P09104	ENOG_HUMAN	enolase 2	129					gluconeogenesis|glycolysis	phosphopyruvate hydratase complex|plasma membrane	magnesium ion binding|phosphopyruvate hydratase activity				0						GCGGGAACTGCCCCTGTATCG	0.617																0.469388	69.505692	69.553094	23	26	KEEP	---	---	---	---	17	8	14	15	-1	capture	Missense_Mutation	SNP	7026819	7026819	ENO2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	5077	87
MLL2	8085	broad.mit.edu	37	12	49448322	49448322	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49448322C>T	uc001rta.3	-	3	389	c.389G>A	c.(388-390)GGA>GAA	p.G130E		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	130					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCCAGGTTCTCCTAGGTGGGC	0.557						N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			0.52	41.975442	41.984096	13	12	KEEP	---	---	---	---	4	9	8	5	-1	capture	Missense_Mutation	SNP	49448322	49448322	MLL2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9533	87
LRRIQ1	84125	broad.mit.edu	37	12	85492269	85492269	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85492269C>T	uc001tac.2	+	12	3135	c.3024C>T	c.(3022-3024)GGC>GGT	p.G1008G	LRRIQ1_uc001tab.1_Silent_p.G1008G	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1008	LRR 6.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		ATGTAGAGGGCGTTGAAAATT	0.343																0.363636	89.47222	90.913436	32	56	KEEP	---	---	---	---	21	19	23	43	-1	capture	Silent	SNP	85492269	85492269	LRRIQ1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8944	87
GPR81	27198	broad.mit.edu	37	12	123214178	123214178	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123214178C>T	uc001ucz.2	-	1	952	c.709G>A	c.(709-711)GTG>ATG	p.V237M	GPR81_uc001ucw.1_RNA	NM_032554	NP_115943	Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81	237	Helical; Name=6; (Potential).				response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CTAGCAGACACGCTGGGCAGG	0.582																0.516129	142.685271	142.706047	48	45	KEEP	---	---	---	---	23	28	28	27	-1	capture	Missense_Mutation	SNP	123214178	123214178	GPR81	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6644	87
ZNF10	7556	broad.mit.edu	37	12	133732279	133732279	+	Silent	SNP	A	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133732279A>G	uc009zzb.2	+	5	894	c.447A>G	c.(445-447)CAA>CAG	p.Q149Q	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Silent_p.Q149Q	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	149				Missing (in Ref. 1).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ATTTGAGGCAAGTGGCATTCA	0.428																0.324786	122.609138	125.796828	38	79	KEEP	---	---	---	---	14	26	34	52	-1	capture	Silent	SNP	133732279	133732279	ZNF10	12	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	17592	87
ZNF10	7556	broad.mit.edu	37	12	133732444	133732444	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133732444T>A	uc009zzb.2	+	5	1059	c.612T>A	c.(610-612)CAT>CAA	p.H204Q	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Missense_Mutation_p.H204Q	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	204				Missing (in Ref. 1).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TTAATGGTCATCAGGACAGTT	0.363																0.294479	130.737974	136.898109	48	115	KEEP	---	---	---	---	25	30	45	81	-1	capture	Missense_Mutation	SNP	133732444	133732444	ZNF10	12	T	A	A	A	1	0	0	0	0	1	0	0	0	647	50	4	4	17592	87
ZNF10	7556	broad.mit.edu	37	12	133732460	133732460	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133732460A>G	uc009zzb.2	+	5	1075	c.628A>G	c.(628-630)AGT>GGT	p.S210G	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Missense_Mutation_p.S210G	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	210	C2H2-type 1; atypical.			Missing (in Ref. 1).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CAGTTGTGCAAGTAACAGTAA	0.358																0.267081	136.454448	144.340777	43	118	KEEP	---	---	---	---	22	29	53	83	-1	capture	Missense_Mutation	SNP	133732460	133732460	ZNF10	12	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	17592	87
POTEG	404785	broad.mit.edu	37	14	19553826	19553826	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19553826G>A	uc001vuz.1	+	1	462	c.410G>A	c.(409-411)CGA>CAA	p.R137Q	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	137										ovary(1)	1						CACGTCCGTCGAGAAGATCTG	0.577																0.074661	-10.58039	71.507824	33	409	KEEP	---	---	---	---	35	23	486	453	-1	capture	Missense_Mutation	SNP	19553826	19553826	POTEG	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12167	87
POTEG	404785	broad.mit.edu	37	14	19566060	19566060	+	Silent	SNP	C	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19566060C>G	uc001vuz.1	+	6	1156	c.1104C>G	c.(1102-1104)GTC>GTG	p.V368V	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA|uc001vvb.2_Intron	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	368										ovary(1)	1						TGCTAAAAGTCTCTTCTGAAA	0.214																0.074627	7.801505	70.016715	25	310	KEEP	---	---	---	---	22	10	191	191	-1	capture	Silent	SNP	19566060	19566060	POTEG	14	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	12167	87
ADCY4	196883	broad.mit.edu	37	14	24801072	24801072	+	Silent	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24801072G>A	uc001wov.2	-	4	597	c.591C>T	c.(589-591)CGC>CGT	p.R197R	ADCY4_uc001wow.2_Silent_p.R197R|ADCY4_uc010toh.1_5'UTR|ADCY4_uc001wox.2_Silent_p.R197R|ADCY4_uc001woy.2_Silent_p.R197R	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	197	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		CCCGCAGGGCGCGCTCCATCA	0.667					1											0.377778	43.953514	44.546671	17	28	KEEP	---	---	---	---	8	12	14	16	-1	capture	Silent	SNP	24801072	24801072	ADCY4	14	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	296	87
SYT16	83851	broad.mit.edu	37	14	62547865	62547865	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62547865G>A	uc001xfu.1	+	4	1504	c.1307G>A	c.(1306-1308)CGC>CAC	p.R436H	SYT16_uc010tsd.1_3'UTR|SYT16_uc010tse.1_5'UTR	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	436	C2 1.									central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GTCCGCTTCCGCCTGTACGCT	0.562																0.475	53.329079	53.349721	19	21	KEEP	---	---	---	---	12	8	11	14	-1	capture	Missense_Mutation	SNP	62547865	62547865	SYT16	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15360	87
C15orf48	84419	broad.mit.edu	37	15	45723253	45723253	+	Missense_Mutation	SNP	G	A	A	rs143173357		TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45723253G>A	uc001zvg.2	+	3	209	c.91G>A	c.(91-93)GCT>ACT	p.A31T	C15orf48_uc001zvh.2_Missense_Mutation_p.A31T|MIR147B_hsa-mir-147b|MI0005544_5'Flank	NM_197955	NP_922946	Q9C002	NMES1_HUMAN	normal mucosa of esophagus specific 1	31						nucleus		p.A31P(1)		ovary(1)	1		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		CTCATCTTTCGCTGTGTATTC	0.413																0.280612	138.042012	146.523064	55	141	KEEP	---	---	---	---	34	28	81	73	-1	capture	Missense_Mutation	SNP	45723253	45723253	C15orf48	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1785	87
CCDC33	80125	broad.mit.edu	37	15	74564064	74564064	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74564064C>T	uc002axo.2	+	6	961	c.567C>T	c.(565-567)AAC>AAT	p.N189N	CCDC33_uc002axp.2_Silent_p.N11N	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1	392							protein binding			ovary(3)|skin(2)	5						GGGGAGTCAACGAGCCCCTGG	0.592																0.254545	32.843082	35.838007	14	41	KEEP	---	---	---	---	10	6	24	23	-1	capture	Silent	SNP	74564064	74564064	CCDC33	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2780	87
CCDC33	80125	broad.mit.edu	37	15	74573074	74573074	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74573074C>T	uc002axo.2	+	9	1349	c.955C>T	c.(955-957)CGT>TGT	p.R319C	CCDC33_uc002axp.2_Missense_Mutation_p.R141C	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1	522							protein binding			ovary(3)|skin(2)	5						GCTAAAGAGCCGTTTGTACCA	0.612																0.34	145.461293	148.864207	51	99	KEEP	---	---	---	---	29	31	58	68	-1	capture	Missense_Mutation	SNP	74573074	74573074	CCDC33	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2780	87
ITGAX	3687	broad.mit.edu	37	16	31374348	31374348	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31374348C>T	uc002ebu.1	+	13	1519	c.1452C>T	c.(1450-1452)TAC>TAT	p.Y484Y	ITGAX_uc002ebt.2_Silent_p.Y484Y|ITGAX_uc010vfk.1_Silent_p.Y134Y	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	484	FG-GAP 5.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CCCATTACTACGAGCAGACCC	0.677																0.357798	109.901868	111.839788	39	70	KEEP	---	---	---	---	22	24	40	34	-1	capture	Silent	SNP	31374348	31374348	ITGAX	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7812	87
MYLK3	91807	broad.mit.edu	37	16	46755087	46755087	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:46755087C>T	uc002eei.3	-	9	2049	c.1933G>A	c.(1933-1935)GTC>ATC	p.V645I	MYLK3_uc010vge.1_Missense_Mutation_p.V304I	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	645	Protein kinase.				cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GTCTGATTGACGCACAATATG	0.448					207											0.305419	170.977461	177.831093	62	141	KEEP	---	---	---	---	29	44	76	84	-1	capture	Missense_Mutation	SNP	46755087	46755087	MYLK3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9968	87
SLC2A4	6517	broad.mit.edu	37	17	7187697	7187697	+	Silent	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7187697G>A	uc002gfp.2	+	6	926	c.726G>A	c.(724-726)AAG>AAA	p.K242K	SLC2A4_uc002gfo.2_Silent_p.K242K|SLC2A4_uc010cmd.2_RNA	NM_001042	NP_001033	P14672	GTR4_HUMAN	glucose transporter 4	242	Cytoplasmic (Potential).				carbohydrate metabolic process|glucose homeostasis|glucose import	external side of plasma membrane|integral to plasma membrane|perinuclear region of cytoplasm	D-glucose transmembrane transporter activity|protein binding				0						CTGCCAGAAAGAGTAAGCTCT	0.632																0.357143	41.411062	42.166983	15	27	KEEP	---	---	---	---	4	14	18	17	-1	capture	Silent	SNP	7187697	7187697	SLC2A4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	14438	87
MYOCD	93649	broad.mit.edu	37	17	12666835	12666835	+	Silent	SNP	G	A	A	rs149918258		TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:12666835G>A	uc002gnn.2	+	13	2990	c.2691G>A	c.(2689-2691)CCG>CCA	p.P897P	MYOCD_uc002gno.2_Silent_p.P945P|MYOCD_uc002gnq.2_Silent_p.P621P	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	897					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		ACCTCACTCCGCCAAATTCCA	0.512																0.533333	107.741632	107.813963	40	35	KEEP	---	---	---	---	18	23	14	26	-1	capture	Silent	SNP	12666835	12666835	MYOCD	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9997	87
KCNJ12	3768	broad.mit.edu	37	17	21319341	21319341	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21319341C>T	uc002gyv.1	+	3	1392	c.687C>T	c.(685-687)CGC>CGT	p.R229R		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	229	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CCCATGTGCGCGCGCAGCTCA	0.642													Prostate(3;0.18)			0.160714	13.241029	19.383676	9	47	KEEP	---	---	---	---	5	6	24	31	-1	capture	Silent	SNP	21319341	21319341	KCNJ12	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7968	87
RHBDF2	79651	broad.mit.edu	37	17	74473065	74473065	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74473065C>T	uc002jrq.1	-	9	1342	c.1049G>A	c.(1048-1050)GGC>GAC	p.G350D	RHBDF2_uc002jrp.1_Missense_Mutation_p.G321D|RHBDF2_uc002jrr.1_Missense_Mutation_p.G202D|RHBDF2_uc010wtf.1_Missense_Mutation_p.G321D|RHBDF2_uc002jrs.1_Missense_Mutation_p.G345D	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	350	Cytoplasmic (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						GATGCGCTTGCCGCGCCGGGG	0.647																0.394161	149.516475	150.860409	54	83	KEEP	---	---	---	---	38	29	46	52	-1	capture	Missense_Mutation	SNP	74473065	74473065	RHBDF2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13212	87
POLI	11201	broad.mit.edu	37	18	51809324	51809324	+	Missense_Mutation	SNP	G	A	A	rs146107490		TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:51809324G>A	uc002lfj.3	+	6	982	c.914G>A	c.(913-915)CGT>CAT	p.R305H	POLI_uc010xds.1_Missense_Mutation_p.R226H|POLI_uc002lfk.3_Missense_Mutation_p.R202H|POLI_uc002lfl.1_Missense_Mutation_p.R237H|POLI_uc010dpg.2_5'UTR	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	305					DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		GTTGCTCAGCGTATCCAAAAG	0.393											DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					0.266667	10.893329	11.6309	4	11	KEEP	---	---	---	---	3	2	6	7	-1	capture	Missense_Mutation	SNP	51809324	51809324	POLI	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12106	87
ZNF77	58492	broad.mit.edu	37	19	2933838	2933838	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2933838C>T	uc002lws.3	-	4	1418	c.1287G>A	c.(1285-1287)ACG>ACA	p.T429T		NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77	429	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCAGTATGCGTCCTCACGT	0.512																0.027778	-28.529539	6.884173	4	140	KEEP	---	---	---	---	0	5	78	71	-1	capture	Silent	SNP	2933838	2933838	ZNF77	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	18019	87
TJP3	27134	broad.mit.edu	37	19	3735631	3735631	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3735631C>T	uc010xhv.1	+	8	1153	c.1153C>T	c.(1153-1155)CGG>TGG	p.R385W	TJP3_uc010xhs.1_Missense_Mutation_p.R352W|TJP3_uc010xht.1_Missense_Mutation_p.R316W|TJP3_uc010xhu.1_Missense_Mutation_p.R361W|TJP3_uc010xhw.1_Missense_Mutation_p.R371W	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	366						tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATGAGCAACGGTCAGGTGG	0.602																0.044444	-26.545155	13.470432	8	172	KEEP	---	---	---	---	1	7	82	98	-1	capture	Missense_Mutation	SNP	3735631	3735631	TJP3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	15816	87
SH2D3A	10045	broad.mit.edu	37	19	6760704	6760704	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6760704G>A	uc002mft.2	-	3	558	c.364C>T	c.(364-366)CGC>TGC	p.R122C	SH2D3A_uc010xjg.1_Intron	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	122					JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						CTAAAGCTGCGTCGCAGAGGC	0.612																0.392157	58.491253	59.009738	20	31	KEEP	---	---	---	---	7	14	14	18	-1	capture	Missense_Mutation	SNP	6760704	6760704	SH2D3A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14126	87
FBN3	84467	broad.mit.edu	37	19	8154483	8154483	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8154483G>A	uc002mjf.2	-	50	6343	c.6322C>T	c.(6322-6324)CGC>TGC	p.R2108C	FBN3_uc002mje.2_5'UTR	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2108	EGF-like 33; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CACTCACAGCGGAAGGATCCA	0.607																0.345133	233.073784	237.863835	78	148	KEEP	---	---	---	---	49	41	75	102	-1	capture	Missense_Mutation	SNP	8154483	8154483	FBN3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5650	87
DDX49	54555	broad.mit.edu	37	19	19030579	19030579	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19030579C>T	uc002nkq.1	+	1	86	c.29C>T	c.(28-30)TCA>TTA	p.S10L	COPE_uc002nkk.2_5'Flank|COPE_uc002nkl.2_5'Flank|COPE_uc002nkm.2_5'Flank|COPE_uc002nkn.2_5'Flank|HOMER3_uc002nko.1_Intron|HOMER3_uc002nkp.1_Intron|DDX49_uc002nkr.1_RNA|DDX49_uc002nks.1_5'UTR|DDX49_uc002nkt.1_5'Flank	NM_019070	NP_061943	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	10	Q motif.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			Epithelial(12;0.0289)			CTCGGGCTGTCATCGTGGCTC	0.677																0.35	38.537887	39.33196	14	26	KEEP	---	---	---	---	11	10	19	24	-1	capture	Missense_Mutation	SNP	19030579	19030579	DDX49	19	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4324	87
TSHZ3	57616	broad.mit.edu	37	19	31767726	31767726	+	Silent	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:31767726G>A	uc002nsy.3	-	2	3038	c.2973C>T	c.(2971-2973)TAC>TAT	p.Y991Y		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	991	C2H2-type 4.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GGTGACTGATGTACGTGGAAG	0.488																0.33	87.536913	90.100532	33	67	KEEP	---	---	---	---	14	23	34	38	-1	capture	Silent	SNP	31767726	31767726	TSHZ3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	16508	87
VASP	7408	broad.mit.edu	37	19	46027874	46027874	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46027874A>G	uc002pcg.2	+	11	1345	c.1003A>G	c.(1003-1005)ACG>GCG	p.T335A	VASP_uc010eki.2_Missense_Mutation_p.T169A|VASP_uc002pci.2_Missense_Mutation_p.T321A	NM_003370	NP_003361	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	335	EVH2.				axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		CCAACCCTGCACGCCCAGCTC	0.498																0.044643	-14.116837	10.723444	5	107	KEEP	---	---	---	---	2	4	56	66	-1	capture	Missense_Mutation	SNP	46027874	46027874	VASP	19	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	17010	87
NT5C1B	93034	broad.mit.edu	37	2	18765378	18765378	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:18765378C>T	uc002rcz.2	-	6	1151	c.1047G>A	c.(1045-1047)CCG>CCA	p.P349P	NT5C1B_uc002rcy.2_Silent_p.P349P|NT5C1B_uc010exr.2_Silent_p.P291P|NT5C1B_uc010yju.1_Silent_p.P289P|NT5C1B_uc002rda.2_Silent_p.P289P|NT5C1B_uc010yjv.1_Silent_p.P366P|NT5C1B_uc010yjw.1_Silent_p.P332P|NT5C1B_uc010exs.2_Silent_p.P351P|NT5C1B_uc002rdb.1_Silent_p.P141P	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	349					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				ACGCCGGGCCCGGGGTCAGGA	0.587																0.029289	-45.165303	12.931597	7	232	KEEP	---	---	---	---	5	4	117	131	-1	capture	Silent	SNP	18765378	18765378	NT5C1B	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10593	87
TBC1D8	11138	broad.mit.edu	37	2	101650173	101650173	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:101650173C>G	uc010fiv.2	-	10	1737	c.1606G>C	c.(1606-1608)GTG>CTG	p.V536L	TBC1D8_uc010yvw.1_Missense_Mutation_p.V551L|TBC1D8_uc002tau.3_Missense_Mutation_p.V293L	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	536	Rab-GAP TBC.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						GACTCCTCCACCAGATTCCCG	0.542																0.328767	78.688109	80.579161	24	49	KEEP	---	---	---	---	13	13	29	28	-1	capture	Missense_Mutation	SNP	101650173	101650173	TBC1D8	2	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	15512	87
SAP130	79595	broad.mit.edu	37	2	128707447	128707447	+	Silent	SNP	G	C	C			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128707447G>C	uc002tpp.2	-	17	2898	c.2766C>G	c.(2764-2766)GTC>GTG	p.V922V	SAP130_uc002tpn.2_Silent_p.V682V|SAP130_uc002tpo.2_Silent_p.V702V|SAP130_uc010fmd.2_Silent_p.V957V	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	922	Interactions with SIN3A and HDAC1.				histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ACTAACCTTTGACCCGGACGT	0.433																0.216495	62.320218	69.511901	21	76	KEEP	---	---	---	---	11	14	44	43	-1	capture	Silent	SNP	128707447	128707447	SAP130	2	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	13723	87
KBTBD10	10324	broad.mit.edu	37	2	170382111	170382111	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170382111A>G	uc002ueu.1	+	6	1803	c.1726A>G	c.(1726-1728)AAA>GAA	p.K576E	KBTBD10_uc010zdh.1_Missense_Mutation_p.K514E	NM_006063	NP_006054	O60662	KBTBA_HUMAN	kelch repeat and BTB (POZ) domain containing 10	576	Kelch 5.				striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						AGATGATAAAAAAGAATGGGC	0.373																0.022901	-26.496663	6.725965	3	128	KEEP	---	---	---	---	3	0	68	78	-1	capture	Missense_Mutation	SNP	170382111	170382111	KBTBD10	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	7913	87
TTN	7273	broad.mit.edu	37	2	179419816	179419816	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179419816G>A	uc010zfg.1	-	280	80890	c.80666C>T	c.(80665-80667)TCT>TTT	p.S26889F	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S20584F|TTN_uc010zfi.1_Missense_Mutation_p.S20517F|TTN_uc010zfj.1_Missense_Mutation_p.S20392F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27816							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGCTTCACAGATGTACCTGC	0.373					8722											0.375	119.997891	121.424985	39	65	KEEP	---	---	---	---	21	26	32	39	-1	capture	Missense_Mutation	SNP	179419816	179419816	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16617	87
PLCL1	5334	broad.mit.edu	37	2	198966043	198966043	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198966043C>T	uc010fsp.2	+	4	3245	c.2954C>T	c.(2953-2955)GCG>GTG	p.A985V	PLCL1_uc002uuv.3_Missense_Mutation_p.A906V	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	985					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	ATAGAAATGGCGGACACAGTC	0.318																0.357955	185.182628	188.307182	63	113	KEEP	---	---	---	---	36	33	56	62	-1	capture	Missense_Mutation	SNP	198966043	198966043	PLCL1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11942	87
COL4A4	1286	broad.mit.edu	37	2	227872085	227872085	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227872085G>A	uc010zlt.1	-	47	5683	c.5029C>T	c.(5029-5031)CGC>TGC	p.R1677C		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1677	Collagen IV NC1.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ATTTTCTGGCGTTGGGCCTGG	0.493																0.376019	905.112363	916.699526	323	536	KEEP	---	---	---	---	182	191	322	304	-1	capture	Missense_Mutation	SNP	227872085	227872085	COL4A4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3658	87
CSE1L	1434	broad.mit.edu	37	20	47688965	47688965	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47688965C>T	uc002xty.2	+	9	1045	c.911C>T	c.(910-912)ACG>ATG	p.T304M	CSE1L_uc010zyg.1_Missense_Mutation_p.T87M|CSE1L_uc010ghx.2_Intron|CSE1L_uc010ghy.2_Translation_Start_Site|CSE1L_uc010zyh.1_5'Flank	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	304					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CTAGTTACAACGGGTCAAGAG	0.383																0.309392	153.719833	159.587302	56	125	KEEP	---	---	---	---	28	39	71	75	-1	capture	Missense_Mutation	SNP	47688965	47688965	CSE1L	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3895	87
UCKL1	54963	broad.mit.edu	37	20	62571796	62571796	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62571796C>T	uc010gkn.2	-	13	1388	c.1345G>A	c.(1345-1347)GTG>ATG	p.V449M	UCKL1_uc002yhj.2_Missense_Mutation_p.V92M|UCKL1_uc011abm.1_Missense_Mutation_p.V434M|UCKL1_uc011abn.1_RNA	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	449					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ATGAGGATCACGTGGTCATCG	0.677																0.333333	21.498577	22.085714	8	16	KEEP	---	---	---	---	4	4	8	10	-1	capture	Missense_Mutation	SNP	62571796	62571796	UCKL1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16807	87
KRTAP10-4	386672	broad.mit.edu	37	21	45993777	45993777	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45993777G>A	uc002zfk.1	+	1	172	c.142G>A	c.(142-144)GCC>ACC	p.A48T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	48	3.|36 X 5 AA repeats of C-C-X(3).					keratin filament					0						CAGCTGCTGCGCCCCGGCCCC	0.701																0.227273	20.151212	23.141074	10	34	KEEP	---	---	---	---	7	10	39	37	-1	capture	Missense_Mutation	SNP	45993777	45993777	KRTAP10-4	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8431	87
BPIL2	254240	broad.mit.edu	37	22	32829708	32829708	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32829708G>A	uc003amn.2	-	9	976	c.976C>T	c.(976-978)CGG>TGG	p.R326W	BPIL2_uc010gwo.2_Missense_Mutation_p.R140W|BPIL2_uc011amb.1_Missense_Mutation_p.R50W	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	326						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						GCACTTACCCGGGAGAGCACG	0.418																0.058824	-3.512891	6.878703	3	48	KEEP	---	---	---	---	3	1	18	37	-1	capture	Missense_Mutation	SNP	32829708	32829708	BPIL2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	1480	87
CACNA1I	8911	broad.mit.edu	37	22	40080363	40080363	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40080363G>T	uc003ayc.2	+	36	5887	c.5887G>T	c.(5887-5889)GAG>TAG	p.E1963*	CACNA1I_uc003ayd.2_Nonsense_Mutation_p.E1928*|CACNA1I_uc003aye.2_Nonsense_Mutation_p.E1878*|CACNA1I_uc003ayf.2_Nonsense_Mutation_p.E1843*	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	1963	Cytoplasmic (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CATGCCAGCCGAGTTCTTCCA	0.637																0.4	29.844453	30.063228	10	15	KEEP	---	---	---	---	6	6	12	9	0.5	capture	Nonsense_Mutation	SNP	40080363	40080363	CACNA1I	22	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	2522	87
CSDC2	27254	broad.mit.edu	37	22	41969718	41969718	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41969718C>T	uc003bak.1	+	3	533	c.236C>T	c.(235-237)TCA>TTA	p.S79L		NM_014460	NP_055275	Q9Y534	CSDC2_HUMAN	RNA-binding protein pippin	79	CSD.				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|RNA binding				0						TTCTCACGCTCACAGGGCCAT	0.612	NSCLC(181;294 2110 12667 14717 31090)															0.050955	-20.445846	13.139481	8	149	KEEP	---	---	---	---	3	5	79	90	-1	capture	Missense_Mutation	SNP	41969718	41969718	CSDC2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	3893	87
ATP2B2	491	broad.mit.edu	37	3	10387792	10387792	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10387792G>A	uc003bvt.2	-	17	2873	c.2434C>T	c.(2434-2436)CGG>TGG	p.R812W	ATP2B2_uc003bvv.2_Missense_Mutation_p.R767W|ATP2B2_uc003bvw.2_Missense_Mutation_p.R767W|ATP2B2_uc010hdo.2_Missense_Mutation_p.R517W	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	812	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						ACCACCTGCCGCTGCTCAGTG	0.682	Ovarian(125;1619 1709 15675 19819 38835)															0.314286	28.014483	29.087519	11	24	KEEP	---	---	---	---	10	10	19	18	-1	capture	Missense_Mutation	SNP	10387792	10387792	ATP2B2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	1131	87
SLC6A20	54716	broad.mit.edu	37	3	45814090	45814090	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45814090C>T	uc011bai.1	-	5	724	c.600G>A	c.(598-600)GCG>GCA	p.A200A	SLC6A20_uc003cow.2_5'Flank|SLC6A20_uc011baj.1_Intron	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1	200	Helical; Name=5; (Potential).				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		AGGGCAGTGACGCCGTGAAAT	0.597																0.307692	44.487213	46.1978	16	36	KEEP	---	---	---	---	8	9	23	16	-1	capture	Silent	SNP	45814090	45814090	SLC6A20	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	14576	87
GHSR	2693	broad.mit.edu	37	3	172165997	172165997	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172165997C>T	uc003fib.1	-	1	207	c.207G>A	c.(205-207)TCG>TCA	p.S69S	GHSR_uc011bpv.1_Silent_p.S69S	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	69	Cytoplasmic (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CGCGGAAGCGCGACACCACCA	0.657	Esophageal Squamous(93;641 1401 20883 29581 34638)															0.470588	67.918889	67.954529	24	27	KEEP	---	---	---	---	16	13	12	15	-1	capture	Silent	SNP	172165997	172165997	GHSR	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6314	87
SULT1B1	27284	broad.mit.edu	37	4	70599914	70599914	+	Silent	SNP	A	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70599914A>G	uc003hen.2	-	5	742	c.444T>C	c.(442-444)AAT>AAC	p.N148N		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	148					3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						AAGGCTGTAAATTATTCATTA	0.353																0.378378	47.839269	48.320102	14	23	KEEP	---	---	---	---	10	4	12	13	-1	capture	Silent	SNP	70599914	70599914	SULT1B1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	15264	87
SEPT11	55752	broad.mit.edu	37	4	77949846	77949846	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77949846G>A	uc003hkj.2	+	8	1180	c.1018G>A	c.(1018-1020)GAA>AAA	p.E340K	SEPT11_uc010ijh.1_Missense_Mutation_p.E332K|SEPT11_uc011cca.1_Missense_Mutation_p.E350K	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11	340	Potential.				cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						GAAAGAAGAAGAAATGAGACA	0.403																0.395522	161.943118	163.224489	53	81	KEEP	---	---	---	---	26	28	35	47	-1	capture	Missense_Mutation	SNP	77949846	77949846	SEPT11	4	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	13954	87
FSTL4	23105	broad.mit.edu	37	5	132652162	132652162	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:132652162C>T	uc003kyn.1	-	5	810	c.592G>A	c.(592-594)GAA>AAA	p.E198K		NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor	198	Potential.|EF-hand.					extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGAGCCAGTTCGGAGCTGCTG	0.557																0.391304	105.484063	106.434347	36	56	KEEP	---	---	---	---	16	23	32	35	-1	capture	Missense_Mutation	SNP	132652162	132652162	FSTL4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6021	87
NPM1	4869	broad.mit.edu	37	5	170819769	170819769	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170819769A>C	uc011dex.1	+	6	543	c.408A>C	c.(406-408)TTA>TTC	p.L136F	NPM1_uc003mbh.2_Missense_Mutation_p.L136F|NPM1_uc003mbi.2_Missense_Mutation_p.L136F|NPM1_uc003mbj.2_Missense_Mutation_p.L136F	NM_002520	NP_002511	P06748	NPM_HUMAN	nucleophosmin 1 isoform 1	136	Required for interaction with SENP3.				anti-apoptosis|cell aging|CenH3-containing nucleosome assembly at centromere|centrosome cycle|DNA repair|interspecies interaction between organisms|intracellular protein transport|negative regulation of cell proliferation|negative regulation of centrosome duplication|nucleocytoplasmic transport|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|regulation of endodeoxyribonuclease activity|regulation of endoribonuclease activity|ribosome assembly|signal transduction	nucleolus|nucleoplasm|ribonucleoprotein complex|spindle pole centrosome	histone binding|NF-kappaB binding|protein binding|protein heterodimerization activity|protein homodimerization activity|ribosomal large subunit binding|ribosomal small subunit binding|RNA binding|Tat protein binding|transcription coactivator activity|unfolded protein binding		NPM1/ALK(632)	haematopoietic_and_lymphoid_tissue(3109)|skin(1)	3110	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGAAACTCTTAAGTATATCTG	0.388					244	T|F 	ALK|RARA|MLF1	NHL|APL|AML								0.331754	235.099026	240.380539	70	141	KEEP	---	---	---	---	24	49	60	93	-1	capture	Missense_Mutation	SNP	170819769	170819769	NPM1	5	A	C	C	C	1	0	0	0	0	1	0	0	0	167	13	4	4	10494	87
NUP153	9972	broad.mit.edu	37	6	17629357	17629357	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17629357C>T	uc003ncd.1	-	18	3273	c.3073G>A	c.(3073-3075)GGT>AGT	p.G1025S	NUP153_uc011dje.1_Missense_Mutation_p.G1056S|NUP153_uc010jpl.1_Missense_Mutation_p.G983S	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	1025					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			ACACCTGTACCAAAGCTAAAA	0.443					1004											0.355422	171.574645	174.633568	59	107	KEEP	---	---	---	---	23	38	48	63	-1	capture	Missense_Mutation	SNP	17629357	17629357	NUP153	6	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10662	87
SLC26A8	116369	broad.mit.edu	37	6	35923059	35923059	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35923059G>A	uc003olm.2	-	17	2213	c.2102C>T	c.(2101-2103)GCG>GTG	p.A701V	SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Missense_Mutation_p.A283V|SLC26A8_uc003oln.2_Missense_Mutation_p.A701V|SLC26A8_uc003oll.2_Missense_Mutation_p.A596V	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	701	Interaction with RACGAP1.|STAS.|Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						CTGGCTTTCCGCCACATCAGG	0.502																0.365672	138.835329	140.963129	49	85	KEEP	---	---	---	---	23	28	45	42	-1	capture	Missense_Mutation	SNP	35923059	35923059	SLC26A8	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14415	87
FRK	2444	broad.mit.edu	37	6	116263659	116263659	+	Missense_Mutation	SNP	G	A	A	rs142072444		TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116263659G>A	uc003pwi.1	-	8	1883	c.1436C>T	c.(1435-1437)ACA>ATA	p.T479I		NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase	479	Protein kinase.				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)		TGTCTCAAATGTAGGTCGTTC	0.398					355											0.339506	150.065058	153.759063	55	107	KEEP	---	---	---	---	26	30	60	55	-1	capture	Missense_Mutation	SNP	116263659	116263659	FRK	6	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5991	87
DFNA5	1687	broad.mit.edu	37	7	24742379	24742379	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:24742379C>T	uc010kus.1	-	9	1345	c.1257G>A	c.(1255-1257)TTG>TTA	p.L419L	DFNA5_uc003swz.2_Silent_p.L255L|DFNA5_uc003sxa.1_Silent_p.L419L|DFNA5_uc010kut.1_Silent_p.L255L	NM_001127453	NP_001120925	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5 protein isoform	419					sensory perception of sound					ovary(1)	1						GGTTGCTTACCAAGTGGCACA	0.507	GBM(78;184 1250 20134 20900 23600)				312											0.202128	134.209974	157.460068	57	225	KEEP	---	---	---	---	26	34	121	140	-1	capture	Silent	SNP	24742379	24742379	DFNA5	7	C	T	T	T	1	0	0	0	0	0	0	0	1	272	21	2	2	4412	87
TNS3	64759	broad.mit.edu	37	7	47440469	47440469	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47440469C>T	uc003tnv.2	-	14	1133	c.766G>A	c.(766-768)GTC>ATC	p.V256I	TNS3_uc003tnw.2_Missense_Mutation_p.V256I|TNS3_uc010kyo.1_3'UTR	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	256	C2 tensin-type.					focal adhesion	protein binding			ovary(4)	4						CGGAAAATGACGTCACGGGTG	0.567																0.227979	102.847141	115.918492	44	149	KEEP	---	---	---	---	22	29	85	94	-1	capture	Missense_Mutation	SNP	47440469	47440469	TNS3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16227	87
TFPI2	7980	broad.mit.edu	37	7	93516148	93516148	+	Missense_Mutation	SNP	C	T	T	rs12669450		TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93516148C>T	uc003umy.1	-	5	767	c.692G>A	c.(691-693)CGG>CAG	p.R231Q	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_3'UTR|TFPI2_uc003una.1_Missense_Mutation_p.R220Q|TFPI2_uc003unb.1_Missense_Mutation_p.R237Q|TFPI2_uc010lfg.1_Missense_Mutation_p.R107Q	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	231					blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			TTGCTTCTTCCGAATTTTCCG	0.328																0.175	81.101334	101.025885	35	165	KEEP	---	---	---	---	21	16	90	96	-1	capture	Missense_Mutation	SNP	93516148	93516148	TFPI2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15694	87
NRF1	4899	broad.mit.edu	37	7	129357140	129357140	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129357140G>A	uc003voz.2	+	9	1264	c.1147G>A	c.(1147-1149)GCA>ACA	p.A383T	NRF1_uc003vpa.2_Missense_Mutation_p.A383T|NRF1_uc011kpa.1_Missense_Mutation_p.A222T|NRF1_uc003vpb.2_Missense_Mutation_p.A383T	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	383	Required for transcriptional activation.				generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						CCAGGCGGTGGCATCGTTGGC	0.567																0.256944	86.109312	93.822902	37	107	KEEP	---	---	---	---	22	25	62	79	-1	capture	Missense_Mutation	SNP	129357140	129357140	NRF1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10553	87
ZC3HC1	51530	broad.mit.edu	37	7	129662254	129662254	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129662254C>T	uc003vpi.2	-	9	1372	c.1345G>A	c.(1345-1347)GAT>AAT	p.D449N	ZC3HC1_uc003vph.2_Missense_Mutation_p.D293N|ZC3HC1_uc010lma.2_Missense_Mutation_p.D265N	NM_016478	NP_057562	Q86WB0	NIPA_HUMAN	zinc finger, C3HC type 1	449					cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)					GCGCTGGCATCTGGTTCAGTT	0.552	Melanoma(115;540 1606 16325 28853 48167)															0.233696	106.32103	118.271219	43	141	KEEP	---	---	---	---	22	22	73	73	-1	capture	Missense_Mutation	SNP	129662254	129662254	ZC3HC1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	17457	87
ABCF2	10061	broad.mit.edu	37	7	150921937	150921937	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150921937G>A	uc003wjp.2	-	3	403	c.292C>T	c.(292-294)CAA>TAA	p.Q98*	ABCF2_uc003wjo.1_Nonsense_Mutation_p.Q98*	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	98	ABC transporter 1.					ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCAGCTCTTGACCATGAAAG	0.507																0.233766	126.519746	141.514531	54	177	KEEP	---	---	---	---	22	32	80	102	-1	capture	Nonsense_Mutation	SNP	150921937	150921937	ABCF2	7	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	66	87
RAB11FIP1	80223	broad.mit.edu	37	8	37732412	37732412	+	Missense_Mutation	SNP	C	T	T	rs140686896		TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37732412C>T	uc003xkm.1	-	3	1287	c.1243G>A	c.(1243-1245)GCA>ACA	p.A415T	RAB11FIP1_uc010lvz.1_Missense_Mutation_p.A263T|RAB11FIP1_uc003xkn.1_Missense_Mutation_p.A415T|RAB11FIP1_uc003xkl.1_5'Flank|RAB11FIP1_uc003xko.1_5'Flank|RAB11FIP1_uc003xkp.1_Missense_Mutation_p.A263T	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	415					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TCTGAGTTTGCGGGGGCCATG	0.557																0.022346	-39.045692	6.504278	4	175	KEEP	---	---	---	---	2	2	89	96	-1	capture	Missense_Mutation	SNP	37732412	37732412	RAB11FIP1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12788	87
IMPAD1	54928	broad.mit.edu	37	8	57878872	57878872	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:57878872C>T	uc003xte.3	-	4	969	c.686G>A	c.(685-687)CGC>CAC	p.R229H		NM_017813	NP_060283	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	229						Golgi apparatus|integral to membrane	inositol-1(or 4)-monophosphatase activity|metal ion binding			ovary(1)	1		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				GTAGGAAGAGCGGGCTTTCAC	0.423																0.414013	187.538501	188.553928	65	92	KEEP	---	---	---	---	35	35	50	56	-1	capture	Missense_Mutation	SNP	57878872	57878872	IMPAD1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7648	87
MTDH	92140	broad.mit.edu	37	8	98735243	98735243	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:98735243A>G	uc003yhz.2	+	11	1986	c.1658A>G	c.(1657-1659)AAT>AGT	p.N553S	MTDH_uc010mbf.2_RNA	NM_178812	NP_848927	Q86UE4	LYRIC_HUMAN	metadherin	553	Cytoplasmic (Potential).				lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity			liver(1)|central_nervous_system(1)	2	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			ACCAAGCAAAATAGTGTGCCT	0.363																0.339623	241.827065	246.651429	72	140	KEEP	---	---	---	---	27	53	72	88	-1	capture	Missense_Mutation	SNP	98735243	98735243	MTDH	8	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9827	87
VPS13B	157680	broad.mit.edu	37	8	100732741	100732741	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:100732741G>A	uc003yiv.2	+	38	7012	c.6901G>A	c.(6901-6903)GAC>AAC	p.D2301N	VPS13B_uc003yiw.2_Missense_Mutation_p.D2276N	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2301					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAGTTCAGATGACCTACGGAC	0.403	Colon(161;2205 2542 7338 31318)				1116											0.060606	-6.15704	7.16654	4	62	KEEP	---	---	---	---	3	1	22	46	-1	capture	Missense_Mutation	SNP	100732741	100732741	VPS13B	8	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	17072	87
FBP2	8789	broad.mit.edu	37	9	97333780	97333780	+	Silent	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97333780G>A	uc004auv.2	-	4	598	c.531C>T	c.(529-531)TCC>TCT	p.S177S	uc004auu.2_Intron	NM_003837	NP_003828	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	177					fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)				CTTGCCCTGTGGAGAGAGCCA	0.567																0.057377	-11.546654	13.517217	7	115	KEEP	---	---	---	---	4	4	58	68	-1	capture	Silent	SNP	97333780	97333780	FBP2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	5652	87
C9orf102	375748	broad.mit.edu	37	9	98669532	98669532	+	Nonsense_Mutation	SNP	T	G	G			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:98669532T>G	uc004avt.3	+	4	1188	c.800T>G	c.(799-801)TTA>TGA	p.L267*	C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Intron|C9orf102_uc010mry.1_Intron|C9orf102_uc010mrz.2_Nonsense_Mutation_p.L78*	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein	267	Helicase ATP-binding.				DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				ACACTACGCTTATGCCTGGAT	0.303																0.361111	136.101696	137.932862	39	69	KEEP	---	---	---	---	17	25	26	50	-1	capture	Nonsense_Mutation	SNP	98669532	98669532	C9orf102	9	T	G	G	G	1	0	0	0	0	0	1	0	0	793	61	5	4	2422	87
PALM2-AKAP2	445815	broad.mit.edu	37	9	112900147	112900147	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112900147T>A	uc004bei.2	+	9	3211	c.3019T>A	c.(3019-3021)TTT>ATT	p.F1007I	PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.F775I|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.F775I|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.F585I|AKAP2_uc011lwi.1_Missense_Mutation_p.F633I|AKAP2_uc004bem.2_Missense_Mutation_p.F633I|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.F593I|AKAP2_uc011lwj.1_Missense_Mutation_p.F544I|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.F544I	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	544							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						CTCCAAGTCATTTAGTGATCA	0.542																0.396135	242.505879	244.45943	82	125	KEEP	---	---	---	---	44	52	68	73	-1	capture	Missense_Mutation	SNP	112900147	112900147	PALM2-AKAP2	9	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	11314	87
SVEP1	79987	broad.mit.edu	37	9	113189912	113189912	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113189912G>T	uc010mtz.2	-	36	6271	c.5934C>A	c.(5932-5934)AAC>AAA	p.N1978K	SVEP1_uc010mty.2_5'UTR	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1978	Sushi 10.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						TGAAAGTGAAGTTATTCCCCG	0.527														OREG0019389	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.32	282.69255	291.329341	96	204	KEEP	---	---	---	---	44	70	92	136	0.385964912281	capture	Missense_Mutation	SNP	113189912	113189912	SVEP1	9	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	15308	87
ZNF883	169834	broad.mit.edu	37	9	115759611	115759611	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115759611C>T	uc011lwy.1	-	5	2168	c.929G>A	c.(928-930)CGA>CAA	p.R310Q		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	310	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCTCTGATGTCGAATTAGTGA	0.373																0.328767	269.2213	276.801506	96	196	KEEP	---	---	---	---	59	43	113	92	-1	capture	Missense_Mutation	SNP	115759611	115759611	ZNF883	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	18074	87
NR5A1	2516	broad.mit.edu	37	9	127262849	127262849	+	Silent	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:127262849C>T	uc004boo.1	-	4	577	c.390G>A	c.(388-390)CCG>CCA	p.P130P		NM_004959	NP_004950	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	130					cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						GAGGGGGCGGCGGGGGCACCC	0.697																0.571429	55.501056	55.65819	20	15	KEEP	---	---	---	---	20	9	7	19	-1	capture	Silent	SNP	127262849	127262849	NR5A1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10542	87
P2RY8	286530	broad.mit.edu	37	X	1584460	1584460	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1584460G>A	uc004cpz.2	-	2	1240	c.992C>T	c.(991-993)ACG>ATG	p.T331M		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	331	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCGCACGGACGTGGTCCTGGC	0.701						T	CRLF2	B-ALL|Downs associated ALL								0.401961	115.477099	116.326285	41	61	KEEP	---	---	---	---	24	28	29	43	-1	capture	Missense_Mutation	SNP	1584460	1584460	P2RY8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11259	87
RGAG1	57529	broad.mit.edu	37	X	109694900	109694900	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:109694900C>T	uc004eor.1	+	3	1301	c.1055C>T	c.(1054-1056)ACG>ATG	p.T352M	RGAG1_uc011msr.1_Missense_Mutation_p.T352M	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	352										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GCACTAATGACGGCCCTACCC	0.537																0.060241	-29.756352	37.392181	20	312	KEEP	---	---	---	---	10	10	154	184	-1	capture	Missense_Mutation	SNP	109694900	109694900	RGAG1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13169	87
LRRIQ1	84125	broad.mit.edu	37	12	85546073	85546073	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85546073delG	uc001tac.2	+	20	4456	c.4345delG	c.(4345-4347)GAAfs	p.E1449fs		NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1449										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		CTTAGAAGAAGAATGGCTAGC	0.353																0.31			18	40		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	85546073	85546073	LRRIQ1	12	G	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	8944	87
FAT1	2195	broad.mit.edu	37	4	187541182	187541183	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-2564-01	TCGA-06-2564-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187541182_187541183insA	uc003izf.2	-	10	6745_6746	c.6557_6558insT	c.(6556-6558)TTCfs	p.F2186fs		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2186	Extracellular (Potential).|Cadherin 20.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CTGCACTGTAGAAAGGTTTTTC	0.510	Colon(197;1040 2055 4143 4984 49344)												HNSCC(5;0.00058)			0.37			76	129		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	187541182	187541183	FAT1	4	-	A	A	A	1	0	1	1	0	0	0	0	0	425	33	5	5	5635	87
