Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DMBX1	127343	broad.mit.edu	37	1	46972778	46972778	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46972778G>A	uc001cpx.2	+	1	111	c.96G>A	c.(94-96)CAG>CAA	p.Q32Q	DMBX1_uc001cpw.2_Silent_p.Q32Q	NM_147192	NP_671725	Q8NFW5	DMBX1_HUMAN	diencephalon/mesencephalon homeobox 1 isoform b	32	Interacts with OXT2 and is required for repressor activity (By similarity).				brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					AGCAGGCCCAGCATGCCCCCG	0.642																0.363636	125.163569	127.144517	44	77	KEEP	---	---	---	---	23	23	43	43	-1	capture	Silent	SNP	46972778	46972778	DMBX1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	4536	157
ZCCHC11	23318	broad.mit.edu	37	1	52981638	52981638	+	Missense_Mutation	SNP	C	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:52981638C>G	uc001ctx.2	-	3	1041	c.807G>C	c.(805-807)TTG>TTC	p.L269F	ZCCHC11_uc001cty.2_Missense_Mutation_p.L269F|ZCCHC11_uc001ctz.2_Missense_Mutation_p.L269F|ZCCHC11_uc009vze.1_Missense_Mutation_p.L269F|ZCCHC11_uc009vzf.1_Missense_Mutation_p.L28F|ZCCHC11_uc001cub.2_Missense_Mutation_p.L269F|ZCCHC11_uc001cuc.2_RNA|ZCCHC11_uc001cud.2_Missense_Mutation_p.L269F	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	269					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						GCTCAGGTGTCAATGCAGATT	0.343																0.030303	-33.336819	14.589196	6	192	KEEP	---	---	---	---	3	3	134	80	-1	capture	Missense_Mutation	SNP	52981638	52981638	ZCCHC11	1	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	17460	157
LRRC7	57554	broad.mit.edu	37	1	70477511	70477511	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70477511T>C	uc001dep.2	+	10	952	c.922T>C	c.(922-924)TGT>CGT	p.C308R	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	308	LRR 13.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TGACTGTAGCTGTAATGAACT	0.328					783											0.294737	89.362279	92.943696	28	67	KEEP	---	---	---	---	11	20	36	45	-1	capture	Missense_Mutation	SNP	70477511	70477511	LRRC7	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8935	157
FAM46C	54855	broad.mit.edu	37	1	118166577	118166577	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118166577G>A	uc001ehe.2	+	2	1286	c.1087G>A	c.(1087-1089)GTC>ATC	p.V363I		NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855	363											0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		GGCCCCTTACGTCAGTGATGG	0.557													Multiple Myeloma(3;1.13e-06)			0.297872	38.432591	40.148653	14	33	KEEP	---	---	---	---	6	10	23	14	-1	capture	Missense_Mutation	SNP	118166577	118166577	FAM46C	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5515	157
RGS4	5999	broad.mit.edu	37	1	163044147	163044147	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:163044147C>T	uc009wuy.2	+	5	926	c.415C>T	c.(415-417)CGG>TGG	p.R139W	RGS4_uc001gcl.3_Missense_Mutation_p.R236W|RGS4_uc009wuz.2_Missense_Mutation_p.P83L|RGS4_uc009wva.2_Missense_Mutation_p.R121W	NM_005613	NP_005604	P49798	RGS4_HUMAN	regulator of G-protein signaling 4 isoform 2	139	RGS.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(2)|central_nervous_system(1)	3						AGAGACAAGCCGGAACATGCT	0.507	Ovarian(76;1257 1738 3039 6086)															0.317308	510.808227	526.22872	165	355	KEEP	---	---	---	---	91	87	208	189	-1	capture	Missense_Mutation	SNP	163044147	163044147	RGS4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13199	157
C1orf112	55732	broad.mit.edu	37	1	169811564	169811564	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169811564G>A	uc001ggp.2	+	19	2042	c.1732G>A	c.(1732-1734)GTA>ATA	p.V578I	C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggq.2_Missense_Mutation_p.V578I|C1orf112_uc009wvt.2_Missense_Mutation_p.V255I|C1orf112_uc009wvu.1_Missense_Mutation_p.V454I|C1orf112_uc001ggr.2_Missense_Mutation_p.V443I|C1orf112_uc010plv.1_Missense_Mutation_p.V520I	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732	578											0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TCAGAACACAGTACTGTCTGC	0.403																0.073955	-4.731629	53.269148	23	288	KEEP	---	---	---	---	14	11	182	163	-1	capture	Missense_Mutation	SNP	169811564	169811564	C1orf112	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	1967	157
CEP350	9857	broad.mit.edu	37	1	180063490	180063490	+	Silent	SNP	A	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180063490A>G	uc001gnt.2	+	34	8633	c.8250A>G	c.(8248-8250)AAA>AAG	p.K2750K	CEP350_uc009wxl.2_Silent_p.K2749K|CEP350_uc001gnv.2_Silent_p.K885K|CEP350_uc001gnw.1_Silent_p.K507K|CEP350_uc001gnx.1_Silent_p.K507K	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	2750	Potential.					centrosome|nucleus|spindle				ovary(4)	4						AACTGGAAAAAATCAGCTTAC	0.358																0.357143	89.757721	91.015184	25	45	KEEP	---	---	---	---	13	15	24	24	-1	capture	Silent	SNP	180063490	180063490	CEP350	1	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	3222	157
TPR	7175	broad.mit.edu	37	1	186329081	186329081	+	Silent	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186329081T>C	uc001grv.2	-	12	1536	c.1239A>G	c.(1237-1239)AAA>AAG	p.K413K	TPR_uc010pop.1_Silent_p.K489K	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	413					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGTTCTCTAGTTTCTCCAAAA	0.363					1949	T	NTRK1	papillary thyroid								0.294686	204.596114	212.401708	61	146	KEEP	---	---	---	---	31	36	84	78	-1	capture	Silent	SNP	186329081	186329081	TPR	1	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	16299	157
PTPRC	5788	broad.mit.edu	37	1	198608459	198608459	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:198608459G>T	uc001gur.1	+	2	235	c.55G>T	c.(55-57)GTA>TTA	p.V19L	PTPRC_uc001gus.1_Missense_Mutation_p.V19L|PTPRC_uc001gut.1_Missense_Mutation_p.V19L|PTPRC_uc001guq.2_Missense_Mutation_p.V19L|PTPRC_uc009wze.1_Missense_Mutation_p.V21L|PTPRC_uc009wzf.1_Missense_Mutation_p.V21L|PTPRC_uc010ppg.1_Missense_Mutation_p.V21L|PTPRC_uc001guu.1_Missense_Mutation_p.V21L|PTPRC_uc001guv.1_RNA|PTPRC_uc001guw.1_RNA	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	19					axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						GGACACAGAAGTATTTGTGAC	0.338					815											0.088372	10.549835	47.378529	19	196	KEEP	---	---	---	---	9	14	116	98	0.391304347826	capture	Missense_Mutation	SNP	198608459	198608459	PTPRC	1	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	12692	157
RAB3GAP2	25782	broad.mit.edu	37	1	220325030	220325030	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:220325030G>A	uc010puk.1	-	34	4108	c.3944C>T	c.(3943-3945)GCG>GTG	p.A1315V	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.A895V|RAB3GAP2_uc001hmh.2_Missense_Mutation_p.A259V	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	1315					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GTGGAGAAGCGCATGAGCCAG	0.507																0.017857	-65.936364	7.420277	5	275	KEEP	---	---	---	---	3	2	149	144	-1	capture	Missense_Mutation	SNP	220325030	220325030	RAB3GAP2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12831	157
ZP4	57829	broad.mit.edu	37	1	238053168	238053168	+	Silent	SNP	T	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:238053168T>A	uc001hym.2	-	3	399	c.399A>T	c.(397-399)CTA>CTT	p.L133L	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	133	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGCCTTTACCTAGAAGATCCA	0.547	NSCLC(166;160 2029 11600 18754 19936)															0.113594	75.901754	154.979351	61	476	KEEP	---	---	---	---	31	37	257	288	-1	capture	Silent	SNP	238053168	238053168	ZP4	1	T	A	A	A	1	0	0	0	0	0	0	0	1	678	53	4	4	18094	157
PTEN	5728	broad.mit.edu	37	10	89720852	89720852	+	Nonsense_Mutation	SNP	C	T	T	rs121909231		TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720852C>T	uc001kfb.2	+	9	2034	c.1003C>T	c.(1003-1005)CGA>TGA	p.R335*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	335	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R335*(21)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.R335fs*8(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.R335fs*4(1)|p.R335fs*7(1)|p.W274_F341del(1)|p.R335R(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAAAGCCAACCGATACTTTTC	0.333			31	p.R335*(SNU1040-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.45	210.614249	210.918378	63	77	KEEP	---	---	---	---	29	46	47	42	-1	capture	Nonsense_Mutation	SNP	89720852	89720852	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	12633	157
COL17A1	1308	broad.mit.edu	37	10	105813706	105813706	+	Silent	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105813706T>C	uc001kxr.2	-	22	1975	c.1806A>G	c.(1804-1806)CAA>CAG	p.Q602Q	COL17A1_uc010qqv.1_Silent_p.Q586Q	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	602	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CCTTTGGTCCTTGTGGACCTG	0.408																0.042857	-9.338786	6.358567	3	67	KEEP	---	---	---	---	1	2	36	40	-1	capture	Silent	SNP	105813706	105813706	COL17A1	10	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	3639	157
WDR11	55717	broad.mit.edu	37	10	122645345	122645345	+	Missense_Mutation	SNP	A	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:122645345A>G	uc010qtf.1	+	15	2106	c.1868A>G	c.(1867-1869)AAC>AGC	p.N623S	WDR11_uc010qte.1_Missense_Mutation_p.N225S|WDR11_uc001lfd.1_Missense_Mutation_p.N141S|WDR11_uc009xzn.2_5'Flank	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	623						integral to membrane					0						CCATCTCACAACTTGAAGAGC	0.488																0.433498	310.660674	311.444256	88	115	KEEP	---	---	---	---	44	50	63	62	-1	capture	Missense_Mutation	SNP	122645345	122645345	WDR11	10	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	17154	157
OR51A2	401667	broad.mit.edu	37	11	4976146	4976146	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4976146G>A	uc010qyt.1	-	1	798	c.798C>T	c.(796-798)GCC>GCT	p.A266A		NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A,	266	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGACATGCCCGGCAAAGCGGT	0.453																0.162791	105.423072	137.920332	49	252	KEEP	---	---	---	---	24	30	150	144	-1	capture	Silent	SNP	4976146	4976146	OR51A2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10990	157
TRIM5	85363	broad.mit.edu	37	11	5699638	5699638	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5699638G>A	uc001mbm.1	-	4	797	c.540C>T	c.(538-540)AAC>AAT	p.N180N	TRIM5_uc001mbq.1_Silent_p.N180N|TRIM5_uc001mbl.1_RNA|TRIM5_uc001mbn.2_Silent_p.N180N|TRIM5_uc001mbo.2_Silent_p.N180N|TRIM5_uc001mbp.2_Silent_p.N180N	NM_033034	NP_149023	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform alpha	180	Potential.				interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		CTGCCAAGACGTTGGTTTTGT	0.473																0.201794	101.541241	119.973613	45	178	KEEP	---	---	---	---	34	21	84	117	-1	capture	Silent	SNP	5699638	5699638	TRIM5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16408	157
NAV2	89797	broad.mit.edu	37	11	20065530	20065530	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20065530G>A	uc010rdm.1	+	14	3341	c.2980G>A	c.(2980-2982)GAT>AAT	p.D994N	NAV2_uc001mpp.2_Missense_Mutation_p.D907N|NAV2_uc001mpr.3_Missense_Mutation_p.D971N|NAV2_uc001mpt.2_Missense_Mutation_p.D57N|NAV2_uc009yhx.2_Missense_Mutation_p.D57N|NAV2_uc009yhy.1_5'UTR	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	994						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TCCACAGACTGATGCTGAGAA	0.507																0.109827	17.592556	43.670371	19	154	KEEP	---	---	---	---	10	11	84	86	-1	capture	Missense_Mutation	SNP	20065530	20065530	NAV2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	10091	157
OR10AG1	282770	broad.mit.edu	37	11	55735214	55735214	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55735214G>T	uc010rit.1	-	1	726	c.726C>A	c.(724-726)TTC>TTA	p.F242L		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					CTGCTCCAAAGAATAAGATTA	0.388																0.126214	16.106294	30.150916	13	90	KEEP	---	---	---	---	9	6	49	55	0.6	capture	Missense_Mutation	SNP	55735214	55735214	OR10AG1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	10801	157
OR5B2	390190	broad.mit.edu	37	11	58189829	58189829	+	Silent	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58189829C>A	uc010rkg.1	-	1	906	c.906G>T	c.(904-906)GTG>GTT	p.V302V		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GCCTTCTCAACACTTTCTTGA	0.383																0.028777	-25.631086	8.337598	4	135	KEEP	---	---	---	---	4	0	82	71	-1	capture	Silent	SNP	58189829	58189829	OR5B2	11	C	A	A	A	1	0	0	0	0	0	0	0	1	210	17	4	4	11054	157
WDR74	54663	broad.mit.edu	37	11	62602979	62602979	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62602979C>T	uc001nvm.1	-	7	710	c.542G>A	c.(541-543)CGG>CAG	p.R181Q	WDR74_uc001nvk.1_Missense_Mutation_p.R124Q|WDR74_uc001nvl.1_Missense_Mutation_p.R181Q|WDR74_uc001nvn.1_Missense_Mutation_p.R233Q|WDR74_uc009yoi.1_Missense_Mutation_p.R181Q|WDR74_uc010rmk.1_3'UTR	NM_018093	NP_060563	Q6RFH5	WDR74_HUMAN	WD repeat domain 74	181	WD 4.					nucleolus				ovary(1)	1						GATGGGAACCCGCAAGTCCAG	0.607																0.081967	0.13291	10.982344	5	56	KEEP	---	---	---	---	2	5	34	42	-1	capture	Missense_Mutation	SNP	62602979	62602979	WDR74	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17205	157
HTR3B	9177	broad.mit.edu	37	11	113813844	113813844	+	Silent	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113813844G>T	uc001pok.2	+	7	904	c.837G>T	c.(835-837)GTG>GTT	p.V279V	HTR3B_uc001pol.2_Silent_p.V268V	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B	279	Helical; Name=2; (Potential).				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		GTGTGCTGGTGGGCTACACCG	0.572																0.045455	-7.928381	6.634159	3	63	KEEP	---	---	---	---	0	3	41	40	-1	capture	Silent	SNP	113813844	113813844	HTR3B	11	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	7370	157
VWF	7450	broad.mit.edu	37	12	6058287	6058287	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6058287G>A	uc001qnn.1	-	52	8586	c.8336C>T	c.(8335-8337)ACG>ATG	p.T2779M	ANO2_uc001qnm.2_5'Flank|VWF_uc010set.1_3'UTR	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2779	CTCK.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CATGGGCTCCGTCCGTGTCGG	0.562																0.159091	25.89366	35.639873	14	74	KEEP	---	---	---	---	8	7	34	45	-1	capture	Missense_Mutation	SNP	6058287	6058287	VWF	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17128	157
GYS2	2998	broad.mit.edu	37	12	21733300	21733300	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21733300G>A	uc001rfb.2	-	2	534	c.279C>T	c.(277-279)GAC>GAT	p.D93D		NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2	93					glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2						TATTCATTGCGTCCACTGCTC	0.403	Colon(149;9 1820 3690 10544 50424)															0.316923	298.817767	308.498856	103	222	KEEP	---	---	---	---	55	62	139	131	-1	capture	Silent	SNP	21733300	21733300	GYS2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6842	157
MBD6	114785	broad.mit.edu	37	12	57922312	57922312	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57922312C>T	uc001soj.1	+	10	3013	c.2789C>T	c.(2788-2790)CCC>CTC	p.P930L	MBD6_uc001sok.1_Missense_Mutation_p.P798L|MBD6_uc001sol.1_RNA	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	930						chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						AAGGATCCACCCCCTCCCGGG	0.577																0.031746	-34.328202	11.007976	6	183	KEEP	---	---	---	---	3	3	92	119	-1	capture	Missense_Mutation	SNP	57922312	57922312	MBD6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	9261	157
ZFC3H1	196441	broad.mit.edu	37	12	72025622	72025622	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:72025622T>C	uc001swo.2	-	16	3765	c.3406A>G	c.(3406-3408)ATG>GTG	p.M1136V		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	1136					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						TTCACTTCCATTGTTTTACTT	0.358																0.300469	211.323972	218.895074	64	149	KEEP	---	---	---	---	46	35	83	90	-1	capture	Missense_Mutation	SNP	72025622	72025622	ZFC3H1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	17513	157
SSH1	54434	broad.mit.edu	37	12	109212060	109212060	+	Missense_Mutation	SNP	T	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109212060T>A	uc001tnm.2	-	4	331	c.244A>T	c.(244-246)ATC>TTC	p.I82F	SSH1_uc010sxg.1_Missense_Mutation_p.I93F|SSH1_uc001tnn.3_Missense_Mutation_p.I82F|SSH1_uc001tno.1_5'Flank	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1	82					actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						AGAAGGTTGATCATCACCTGA	0.338																0.15873	79.441366	107.409939	40	212	KEEP	---	---	---	---	26	19	118	142	-1	capture	Missense_Mutation	SNP	109212060	109212060	SSH1	12	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	15076	157
ACACB	32	broad.mit.edu	37	12	109639415	109639415	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109639415G>A	uc001tob.2	+	19	2941	c.2822G>A	c.(2821-2823)CGG>CAG	p.R941Q	ACACB_uc001toc.2_Missense_Mutation_p.R941Q	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	941	Biotinyl-binding.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	GAAAGAGGCCGGGTGAAGTAC	0.542					1843											0.016393	-57.783357	6.661065	4	240	KEEP	---	---	---	---	3	2	124	131	-1	capture	Missense_Mutation	SNP	109639415	109639415	ACACB	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	107	157
CUX2	23316	broad.mit.edu	37	12	111772383	111772383	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111772383C>T	uc001tsa.1	+	19	3218	c.3065C>T	c.(3064-3066)TCG>TTG	p.S1022L		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	1022						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						TCCAGCTCCTCGTTGAGCGGG	0.647																0.255556	59.272846	64.160108	23	67	KEEP	---	---	---	---	13	12	39	40	-1	capture	Missense_Mutation	SNP	111772383	111772383	CUX2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4025	157
DNAH10	196385	broad.mit.edu	37	12	124333280	124333280	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124333280G>A	uc001uft.3	+	33	5624	c.5599G>A	c.(5599-5601)GTG>ATG	p.V1867M		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1867	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTCCTAGGCCGTGGGGAAGAT	0.443																0.204819	41.630292	48.337677	17	66	KEEP	---	---	---	---	11	8	37	42	-1	capture	Missense_Mutation	SNP	124333280	124333280	DNAH10	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4556	157
RIMBP2	23504	broad.mit.edu	37	12	130935764	130935764	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130935764G>A	uc001uil.2	-	5	593	c.429C>T	c.(427-429)AGC>AGT	p.S143S	RIMBP2_uc001uim.2_Silent_p.S51S	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	143						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGCATCTTGCGCTACCGGATC	0.637																0.062016	-8.255132	17.503743	8	121	KEEP	---	---	---	---	3	5	58	83	-1	capture	Silent	SNP	130935764	130935764	RIMBP2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	13255	157
GPR133	283383	broad.mit.edu	37	12	131620612	131620612	+	Silent	SNP	G	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131620612G>C	uc001uit.3	+	22	2857	c.2298G>C	c.(2296-2298)CTG>CTC	p.L766L	GPR133_uc010tbm.1_Silent_p.L798L|GPR133_uc009zyo.2_Silent_p.L48L|GPR133_uc009zyp.2_RNA	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	766	Helical; Name=6; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCGTGCTGCTGCCCATCCTGG	0.592																0.088235	0.692698	12.371771	6	62	KEEP	---	---	---	---	2	4	32	47	-1	capture	Silent	SNP	131620612	131620612	GPR133	12	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	6577	157
ZNF140	7699	broad.mit.edu	37	12	133682985	133682985	+	Silent	SNP	A	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133682985A>G	uc001ulo.2	+	5	1792	c.1122A>G	c.(1120-1122)CAA>CAG	p.Q374Q	ZNF140_uc001ulp.2_Silent_p.Q271Q|ZNF140_uc010tbu.1_Silent_p.Q271Q	NM_003440	NP_003431	P52738	ZN140_HUMAN	zinc finger protein 140	374	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.114)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CCCTTATTCAACATACGAAGA	0.408																0.320346	249.075971	255.695419	74	157	KEEP	---	---	---	---	41	37	86	86	-1	capture	Silent	SNP	133682985	133682985	ZNF140	12	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	17609	157
LBXCOR1	390598	broad.mit.edu	37	15	68118859	68118859	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:68118859C>T	uc002aqy.1	+	2	666	c.666C>T	c.(664-666)GAC>GAT	p.D222D		NM_001031807	NP_001026977	P84550	SKOR1_HUMAN	transcriptional corepressor Corl1	231					negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity				0						GAACACCCGACGCCAAGTACA	0.572																0.116667	8.084147	16.756989	7	53	KEEP	---	---	---	---	3	7	33	33	-1	capture	Silent	SNP	68118859	68118859	LBXCOR1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8575	157
C15orf32	145858	broad.mit.edu	37	15	93015653	93015653	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:93015653T>C	uc002brc.1	+	1	747	c.275T>C	c.(274-276)GTG>GCG	p.V92A	C15orf32_uc010bod.1_RNA	NM_153040	NP_694585	Q32M92	CO032_HUMAN	hypothetical protein LOC145858	92										ovary(1)	1	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			agctcacgagtggATGGTTTG	0.279																0.046154	-15.955697	12.612985	6	124	KEEP	---	---	---	---	4	3	71	76	-1	capture	Missense_Mutation	SNP	93015653	93015653	C15orf32	15	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	1776	157
UNKL	64718	broad.mit.edu	37	16	1449391	1449391	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1449391G>A	uc010bro.1	-	5	726	c.718C>T	c.(718-720)CGG>TGG	p.R240W	UNKL_uc002clq.2_Missense_Mutation_p.R240W	NM_001037125	NP_001032202	Q9H9P5	UNKL_HUMAN	unkempt homolog (Drosophila)-like isoform 2	240						cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				TGGAACCGCCGGGGGTTGCGC	0.701																0.1875	6.115876	7.578958	3	13	KEEP	---	---	---	---	6	1	11	9	-1	capture	Missense_Mutation	SNP	1449391	1449391	UNKL	16	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16883	157
FBXO31	79791	broad.mit.edu	37	16	87368933	87368933	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:87368933G>A	uc002fjw.2	-	7	1017	c.973C>T	c.(973-975)CGT>TGT	p.R325C	FBXO31_uc010vot.1_Missense_Mutation_p.R153C|FBXO31_uc002fjv.2_Missense_Mutation_p.R217C	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31	325					cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		CCCCTGGCACGCCGGCCGTGG	0.662																0.194444	31.122779	37.382478	14	58	KEEP	---	---	---	---	7	13	42	50	-1	capture	Missense_Mutation	SNP	87368933	87368933	FBXO31	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5687	157
OR1G1	8390	broad.mit.edu	37	17	3029921	3029921	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3029921T>C	uc002fvc.1	-	1	925	c.925A>G	c.(925-927)AAA>GAA	p.K309E		NM_003555	NP_003546	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAATGAATTTTCCGAACCCAG	0.428	Colon(127;1481 1654 8243 19426 50557)															0.381818	218.793767	220.812076	63	102	KEEP	---	---	---	---	40	26	54	56	-1	capture	Missense_Mutation	SNP	3029921	3029921	OR1G1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10861	157
SLC6A4	6532	broad.mit.edu	37	17	28545202	28545202	+	Missense_Mutation	SNP	T	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:28545202T>G	uc002hey.3	-	5	1176	c.632A>C	c.(631-633)AAT>ACT	p.N211T		NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	211	Extracellular (Potential).				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			skin(3)|ovary(1)	4					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	GGAGAAGTAATTGGTGCAGTT	0.542																0.355932	135.179473	137.352837	42	76	KEEP	---	---	---	---	27	23	50	34	-1	capture	Missense_Mutation	SNP	28545202	28545202	SLC6A4	17	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	14578	157
ZNHIT3	9326	broad.mit.edu	37	17	34851065	34851065	+	Splice_Site	SNP	A	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34851065A>G	uc002hms.1	+	5	358	c.287_splice	c.e5-2	p.G96_splice	ZNHIT3_uc002hmt.1_Splice_Site|ZNHIT3_uc010cut.1_Intron	NM_004773	NP_004764	Q15649	ZNHI3_HUMAN	thyroid hormone receptor interactor 3						regulation of transcription, DNA-dependent	intracellular	metal ion binding|thyroid hormone receptor binding				0		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0188)		GTTAATTTTTAGGGGAATCTG	0.403	Pancreas(89;112 2361 26810)															0.016949	-39.732664	6.929644	3	174	KEEP	---	---	---	---	3	0	97	97	-1	capture	Splice_Site	SNP	34851065	34851065	ZNHIT3	17	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	18084	157
TNS4	84951	broad.mit.edu	37	17	38652473	38652473	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38652473C>T	uc010cxb.2	-	2	369	c.205G>A	c.(205-207)GCC>ACC	p.A69T		NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor	69					apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			ACCTGTGGGGCTTGCTGGAGT	0.652																0.333333	165.469177	169.58959	56	112	KEEP	---	---	---	---	35	23	55	68	-1	capture	Missense_Mutation	SNP	38652473	38652473	TNS4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	16228	157
MRC2	9902	broad.mit.edu	37	17	60758249	60758249	+	Silent	SNP	G	A	A	rs150592174		TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60758249G>A	uc002jad.2	+	17	2964	c.2562G>A	c.(2560-2562)ACG>ACA	p.T854T	MRC2_uc002jae.2_Translation_Start_Site|MRC2_uc002jaf.2_5'Flank	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	854	Extracellular (Potential).|C-type lectin 5.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GCATCTGCACGTGGTTCCAGG	0.637																0.372093	46.287984	46.906303	16	27	KEEP	---	---	---	---	10	8	17	12	-1	capture	Silent	SNP	60758249	60758249	MRC2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9668	157
ZNF521	25925	broad.mit.edu	37	18	22806841	22806841	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:22806841G>A	uc002kvk.2	-	4	1288	c.1041C>T	c.(1039-1041)GTC>GTT	p.V347V	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.V347V|ZNF521_uc002kvl.2_Silent_p.V127V	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	347					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AGCCCACCGTGACCAGGGAAG	0.542					266	T	PAX5	ALL								0.277778	105.236621	111.635978	40	104	KEEP	---	---	---	---	17	25	49	61	-1	capture	Silent	SNP	22806841	22806841	ZNF521	18	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	17844	157
TMPRSS9	360200	broad.mit.edu	37	19	2421886	2421886	+	Missense_Mutation	SNP	C	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2421886C>G	uc010xgx.1	+	13	2087	c.2087C>G	c.(2086-2088)GCC>GGC	p.A696G		NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	696	Extracellular (Potential).|Peptidase S1 2.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGAGGAGGCCCCTGGCGTG	0.617																0.03	-37.15546	11.296335	6	194	KEEP	---	---	---	---	3	3	126	116	-1	capture	Missense_Mutation	SNP	2421886	2421886	TMPRSS9	19	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	16136	157
HOOK2	29911	broad.mit.edu	37	19	12876795	12876795	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12876795G>A	uc002muy.2	-	16	1716	c.1545C>T	c.(1543-1545)GCC>GCT	p.A515A	HOOK2_uc010xmq.1_5'UTR|HOOK2_uc002muz.2_Silent_p.A515A	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	515	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						CCTCCACCTGGGCCCGCAGCT	0.672														OREG0025273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.02381	-25.379985	6.378301	3	123	KEEP	---	---	---	---	0	3	73	73	-1	capture	Silent	SNP	12876795	12876795	HOOK2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7208	157
RYR1	6261	broad.mit.edu	37	19	38954119	38954119	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38954119C>T	uc002oit.2	+	21	2764	c.2634C>T	c.(2632-2634)CAC>CAT	p.H878H	RYR1_uc002oiu.2_Silent_p.H878H	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	878	1.|Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGAACATCCACGAGCTCTGGG	0.662																0.09434	3.236222	11.996523	5	48	KEEP	---	---	---	---	1	5	20	39	-1	capture	Silent	SNP	38954119	38954119	RYR1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13660	157
PRKD2	25865	broad.mit.edu	37	19	47181674	47181674	+	Missense_Mutation	SNP	A	C	C	rs55933311		TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47181674A>C	uc002pfh.2	-	17	2659	c.2317T>G	c.(2317-2319)TGG>GGG	p.W773G	PRKD2_uc002pfd.2_Missense_Mutation_p.W147G|PRKD2_uc010eks.2_Missense_Mutation_p.W176G|PRKD2_uc010ekt.2_Missense_Mutation_p.W40G|PRKD2_uc002pfe.2_Missense_Mutation_p.W293G|PRKD2_uc002pff.2_Missense_Mutation_p.W293G|PRKD2_uc002pfg.2_Missense_Mutation_p.W616G|PRKD2_uc002pfi.2_Missense_Mutation_p.W773G|PRKD2_uc002pfj.2_Missense_Mutation_p.W773G|PRKD2_uc010xye.1_Missense_Mutation_p.W773G|PRKD2_uc002pfk.2_Missense_Mutation_p.W616G	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	773	Protein kinase.				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		ATGTGGCTCCAGGGGCTGGCC	0.642					242											0.192308	4.549738	6.885761	5	21	KEEP	---	---	---	---	1	8	21	38	-1	capture	Missense_Mutation	SNP	47181674	47181674	PRKD2	19	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	12415	157
SLC6A16	28968	broad.mit.edu	37	19	49812323	49812323	+	Missense_Mutation	SNP	A	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49812323A>T	uc002pmz.2	-	7	1273	c.1039T>A	c.(1039-1041)TTG>ATG	p.L347M	SLC6A16_uc002pna.2_Missense_Mutation_p.L347M|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	347	Helical; Name=6; (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GTGTTAGACAAAACTTGACCC	0.478																0.30137	291.209261	304.070501	110	255	KEEP	---	---	---	---	59	71	133	160	-1	capture	Missense_Mutation	SNP	49812323	49812323	SLC6A16	19	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	14571	157
SIGLEC9	27180	broad.mit.edu	37	19	51630344	51630344	+	Missense_Mutation	SNP	G	A	A	rs149764192		TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51630344G>A	uc002pvu.2	+	4	873	c.806G>A	c.(805-807)CGC>CAC	p.R269H	SIGLEC9_uc010yct.1_Missense_Mutation_p.R269H	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	269	Extracellular (Potential).|Ig-like C2-type 2.			R -> H (in Ref. 2; AAF87223).	cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CAGTCTCTGCGCCTGGTCTGT	0.483																0.266932	172.822176	185.131314	67	184	KEEP	---	---	---	---	34	45	100	116	-1	capture	Missense_Mutation	SNP	51630344	51630344	SIGLEC9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14208	157
ZNF581	51545	broad.mit.edu	37	19	56155985	56155985	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56155985C>T	uc002qln.2	+	2	764	c.48C>T	c.(46-48)TCC>TCT	p.S16S	ZNF581_uc002qlq.2_Silent_p.S16S|CCDC106_uc002qlr.2_5'Flank	NM_016535	NP_057619	Q9P0T4	ZN581_HUMAN	zinc finger protein 581	16					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CATTTTCCTCCGTTGAGACCA	0.617																0.4375	45.348718	45.457001	14	18	KEEP	---	---	---	---	7	7	12	11	-1	capture	Silent	SNP	56155985	56155985	ZNF581	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17891	157
LOXL3	84695	broad.mit.edu	37	2	74761513	74761513	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74761513G>A	uc002smp.1	-	11	1941	c.1869C>T	c.(1867-1869)ACC>ACT	p.T623T	LOXL3_uc002smo.1_Silent_p.T262T|LOXL3_uc010ffm.1_Silent_p.T567T|LOXL3_uc002smq.1_Silent_p.T478T|LOXL3_uc010ffn.1_Silent_p.T478T	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	623	Lysyl-oxidase like.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						TGCCATTTGGGGTGAGGATAT	0.527																0.023392	-34.519934	8.673234	4	167	KEEP	---	---	---	---	1	3	102	97	-1	capture	Silent	SNP	74761513	74761513	LOXL3	2	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	8817	157
CTNNA2	1496	broad.mit.edu	37	2	80801323	80801323	+	Missense_Mutation	SNP	A	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:80801323A>T	uc010ysh.1	+	12	1782	c.1777A>T	c.(1777-1779)ATT>TTT	p.I593F	CTNNA2_uc010yse.1_Missense_Mutation_p.I593F|CTNNA2_uc010ysf.1_Missense_Mutation_p.I593F|CTNNA2_uc010ysg.1_Missense_Mutation_p.I593F|CTNNA2_uc010ysi.1_Missense_Mutation_p.I225F	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	593					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AGAGGTTGCCATTGAAGCCCT	0.483					489											0.017986	-62.773876	10.0165	5	273	KEEP	---	---	---	---	2	3	140	156	-1	capture	Missense_Mutation	SNP	80801323	80801323	CTNNA2	2	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	3976	157
POTEF	728378	broad.mit.edu	37	2	130877801	130877801	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130877801G>T	uc010fmh.2	-	3	688	c.288C>A	c.(286-288)AAC>AAA	p.N96K		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	96						cell cortex	ATP binding			skin(3)|ovary(2)	5						TGCCCATCTTGTTCCTGAGTG	0.612																0.059801	-20.344736	40.609784	18	283	KEEP	---	---	---	---	13	16	206	207	0.448275862069	capture	Missense_Mutation	SNP	130877801	130877801	POTEF	2	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	12166	157
POTEE	445582	broad.mit.edu	37	2	131976263	131976263	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131976263C>A	uc002tsn.2	+	1	340	c.288C>A	c.(286-288)AAC>AAA	p.N96K	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	96							ATP binding				0						CACTCAGGAACAAGATGGGGA	0.617																0.114583	12.552592	26.612667	11	85	KEEP	---	---	---	---	15	7	106	92	0.318181818182	capture	Missense_Mutation	SNP	131976263	131976263	POTEE	2	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	12165	157
KLF7	8609	broad.mit.edu	37	2	207988812	207988812	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207988812G>A	uc002vbz.1	-	2	741	c.419C>T	c.(418-420)TCG>TTG	p.S140L	KLF7_uc002vca.1_Missense_Mutation_p.S140L|KLF7_uc010zix.1_Missense_Mutation_p.S112L	NM_003709	NP_003700	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)	140					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		CTCAGGGGACGATGGGGGCGT	0.597																0.387324	157.011997	158.616232	55	87	KEEP	---	---	---	---	22	36	41	55	-1	capture	Missense_Mutation	SNP	207988812	207988812	KLF7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8271	157
DOCK10	55619	broad.mit.edu	37	2	225666723	225666723	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:225666723G>A	uc010fwz.1	-	40	4542	c.4303C>T	c.(4303-4305)CAG>TAG	p.Q1435*	DOCK10_uc002vob.2_Nonsense_Mutation_p.Q1429*|DOCK10_uc002voa.2_Nonsense_Mutation_p.Q91*|DOCK10_uc002voc.2_Nonsense_Mutation_p.Q289*	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1435							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GATCTGTGCTGCTTATGGCCT	0.378																0.303167	174.363667	181.994255	67	154	KEEP	---	---	---	---	31	36	82	79	-1	capture	Nonsense_Mutation	SNP	225666723	225666723	DOCK10	2	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	4641	157
CAPN10	11132	broad.mit.edu	37	2	241556394	241556394	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241556394C>T	uc002vzq.1	+	4	576	c.399C>T	c.(397-399)GCC>GCT	p.A133A	GPR35_uc010fzh.1_Intron|GPR35_uc010fzi.1_Intron	NM_023089	NP_075577	Q9HC96	CAN10_HUMAN	calpain 10 isoform g	Error:Variant_position_missing_in_Q9HC96_after_alignment					actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		taccaacagccacctggggga	0.000																0.384615	30.149565	30.450916	10	16	KEEP	---	---	---	---	5	6	10	9	-1	capture	Silent	SNP	241556394	241556394	CAPN10	2	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	2599	157
C20orf194	25943	broad.mit.edu	37	20	3274853	3274853	+	Missense_Mutation	SNP	G	A	A	rs145634255	by1000genomes	TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3274853G>A	uc002wii.2	-	25	2221	c.2170C>T	c.(2170-2172)CGG>TGG	p.R724W	C20orf194_uc002wij.3_Missense_Mutation_p.R463W|C20orf194_uc002wik.2_Missense_Mutation_p.R398W	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943	724											0						AGATGGGTCCGCATCACAGGC	0.468																0.031496	-22.808316	7.70048	4	123	KEEP	---	---	---	---	4	0	56	75	-1	capture	Missense_Mutation	SNP	3274853	3274853	C20orf194	20	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2081	157
SEC23B	10483	broad.mit.edu	37	20	18534935	18534935	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:18534935C>A	uc002wqz.1	+	18	2492	c.2049C>A	c.(2047-2049)TTC>TTA	p.F683L	SEC23B_uc002wra.1_Missense_Mutation_p.F683L|SEC23B_uc002wrb.1_Missense_Mutation_p.F683L|SEC23B_uc010zsb.1_Missense_Mutation_p.F665L|SEC23B_uc002wrc.1_Missense_Mutation_p.F683L	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	683					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						ATGAAAACTTCAAGCACCTTC	0.493																0.265537	118.940294	127.736288	47	130	KEEP	---	---	---	---	21	28	66	71	0.571428571429	capture	Missense_Mutation	SNP	18534935	18534935	SEC23B	20	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	13885	157
BPI	671	broad.mit.edu	37	20	36932754	36932754	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36932754C>T	uc002xib.2	+	1	203	c.141C>T	c.(139-141)TAC>TAT	p.Y47Y		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	47					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				GCCTGGACTACGGTAACTGGA	0.458																0.035088	-18.595945	8.188449	4	110	KEEP	---	---	---	---	4	1	57	64	-1	capture	Silent	SNP	36932754	36932754	BPI	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1478	157
SLC9A8	23315	broad.mit.edu	37	20	48503378	48503378	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48503378C>T	uc002xuv.1	+	15	1791	c.1581C>T	c.(1579-1581)TTC>TTT	p.F527F	SLC9A8_uc010zym.1_Silent_p.F227F|SLC9A8_uc010gid.2_Silent_p.F151F	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8	527						Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTAAGGGCTTCGTGTGGCTGG	0.627																0.090909	7.4037	31.494525	13	130	KEEP	---	---	---	---	10	9	73	78	-1	capture	Silent	SNP	48503378	48503378	SLC9A8	20	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	14612	157
BRWD1	54014	broad.mit.edu	37	21	40571510	40571510	+	Nonsense_Mutation	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:40571510G>T	uc002yxk.1	-	40	4971	c.4832C>A	c.(4831-4833)TCA>TAA	p.S1611*	BRWD1_uc010goc.1_Nonsense_Mutation_p.S254*|BRWD1_uc002yxl.2_Nonsense_Mutation_p.S1611*	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1611					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AGTCTCCAATGAATTGTTATC	0.378	Melanoma(170;988 1986 4794 16843 39731)													OREG0003861	type=REGULATORY REGION|Gene=BRWD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.353175	252.987537	257.783258	89	163	KEEP	---	---	---	---	40	57	90	86	0.412371134021	capture	Nonsense_Mutation	SNP	40571510	40571510	BRWD1	21	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	1513	157
CABIN1	23523	broad.mit.edu	37	22	24466765	24466765	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24466765G>A	uc002zzi.1	+	17	2374	c.2247G>A	c.(2245-2247)CGG>CGA	p.R749R	CABIN1_uc002zzj.1_Silent_p.R699R|CABIN1_uc002zzl.1_Silent_p.R749R	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	749					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CCTTGCTCCGGCTGAAGGACT	0.562																0.020513	-43.637838	6.554774	4	191	KEEP	---	---	---	---	4	1	107	122	-1	capture	Silent	SNP	24466765	24466765	CABIN1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	2504	157
RANGAP1	5905	broad.mit.edu	37	22	41654011	41654011	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41654011G>A	uc003azs.2	-	6	2185	c.715C>T	c.(715-717)CGG>TGG	p.R239W	RANGAP1_uc003azt.2_Missense_Mutation_p.R239W|RANGAP1_uc003azu.2_Missense_Mutation_p.R239W|RANGAP1_uc011aoz.1_Missense_Mutation_p.R184W	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	239	LRR 4.				mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						TTGATGACCCGCAGCAGGGGG	0.627																0.028369	-27.420254	7.118621	4	137	KEEP	---	---	---	---	4	0	82	73	-1	capture	Missense_Mutation	SNP	41654011	41654011	RANGAP1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	12928	157
IL5RA	3568	broad.mit.edu	37	3	3139898	3139898	+	Silent	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:3139898T>C	uc011ask.1	-	7	1088	c.444A>G	c.(442-444)TCA>TCG	p.S148S	IL5RA_uc010hbq.2_Silent_p.S148S|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Silent_p.S148S|IL5RA_uc011asl.1_Silent_p.S148S|IL5RA_uc011asm.1_Silent_p.S148S|IL5RA_uc010hbt.2_Silent_p.S148S|IL5RA_uc011asn.1_Silent_p.S148S|IL5RA_uc010hbu.2_Silent_p.S148S	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	148	Extracellular (Potential).				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		AAACTTGGTATGACCTTAAAC	0.413	GBM(169;430 2801 24955 28528)															0.086093	4.962037	31.171926	13	138	KEEP	---	---	---	---	6	8	68	80	-1	capture	Silent	SNP	3139898	3139898	IL5RA	3	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	7623	157
GADL1	339896	broad.mit.edu	37	3	30885739	30885739	+	Missense_Mutation	SNP	T	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:30885739T>A	uc003cep.2	-	8	796	c.749A>T	c.(748-750)GAG>GTG	p.E250V	GADL1_uc003ceq.1_Missense_Mutation_p.E250V	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	250					carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	CTCCAGTTCCTCAGGTATCAT	0.438																0.320359	290.39422	299.977215	107	227	KEEP	---	---	---	---	44	69	109	134	-1	capture	Missense_Mutation	SNP	30885739	30885739	GADL1	3	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	6127	157
PLXNB1	5364	broad.mit.edu	37	3	48462792	48462792	+	Missense_Mutation	SNP	A	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48462792A>C	uc003csw.2	-	8	1925	c.1655T>G	c.(1654-1656)GTT>GGT	p.V552G	PLXNB1_uc003csu.2_Missense_Mutation_p.V552G|PLXNB1_uc003csx.2_Missense_Mutation_p.V552G|PLXNB1_uc010hjx.1_RNA	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	552	Extracellular (Potential).				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGATAGGAAAACCTGCCAAGA	0.577																0.092784	-9.815957	6.88542	9	88	KEEP	---	---	---	---	11	10	53	61	-1	capture	Missense_Mutation	SNP	48462792	48462792	PLXNB1	3	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	12026	157
FLNB	2317	broad.mit.edu	37	3	58135696	58135696	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58135696G>A	uc003djj.2	+	37	6376	c.6211G>A	c.(6211-6213)GTC>ATC	p.V2071I	FLNB_uc010hne.2_Missense_Mutation_p.V2102I|FLNB_uc003djk.2_Missense_Mutation_p.V2060I|FLNB_uc010hnf.2_Missense_Mutation_p.V2047I|FLNB_uc003djl.2_Missense_Mutation_p.V1891I|FLNB_uc003djm.2_Missense_Mutation_p.V1878I|FLNB_uc010hng.1_RNA	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	2071	Interaction with FLNA 1.|Filamin 19.|Interaction with the cytoplasmic tail of GP1BA.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGTTTATATCGTCTCCACCAA	0.562					676											0.107724	53.8289	128.82446	53	439	KEEP	---	---	---	---	38	25	261	244	-1	capture	Missense_Mutation	SNP	58135696	58135696	FLNB	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5878	157
PHLDB2	90102	broad.mit.edu	37	3	111632476	111632476	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111632476G>A	uc010hqa.2	+	3	2057	c.1646G>A	c.(1645-1647)CGG>CAG	p.R549Q	PHLDB2_uc003dyc.2_Missense_Mutation_p.R576Q|PHLDB2_uc003dyd.2_Missense_Mutation_p.R549Q|PHLDB2_uc003dyg.2_Missense_Mutation_p.R549Q|PHLDB2_uc003dyh.2_Missense_Mutation_p.R549Q|PHLDB2_uc003dyi.2_Missense_Mutation_p.R135Q|PHLDB2_uc003dyf.3_Missense_Mutation_p.R549Q	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	549						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						GACCTCACCCGGACTCCTCCA	0.522																0.121154	91.013958	164.144088	63	457	KEEP	---	---	---	---	23	45	212	282	-1	capture	Missense_Mutation	SNP	111632476	111632476	PHLDB2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11755	157
PCCB	5096	broad.mit.edu	37	3	135980854	135980854	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:135980854G>A	uc003eqy.1	+	5	541	c.490G>A	c.(490-492)GCA>ACA	p.A164T	PCCB_uc003eqz.1_Missense_Mutation_p.A164T|PCCB_uc011bmc.1_Missense_Mutation_p.A184T|PCCB_uc011bmd.1_Missense_Mutation_p.A81T	NM_000532	NP_000523	P05166	PCCB_HUMAN	propionyl Coenzyme A carboxylase, beta	164	Carboxyltransferase.				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)	CTCTGGGGGAGCACGGATCCA	0.458																0.5	19.849774	19.849774	6	6	KEEP	---	---	---	---	3	5	3	4	-1	capture	Missense_Mutation	SNP	135980854	135980854	PCCB	3	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	11408	157
MECOM	2122	broad.mit.edu	37	3	168845829	168845829	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168845829G>A	uc003ffi.3	-	4	338	c.69C>T	c.(67-69)TGC>TGT	p.C23C	MECOM_uc010hwk.1_Silent_p.C46C|MECOM_uc003ffj.3_Silent_p.C87C|MECOM_uc011bpi.1_Silent_p.C23C|MECOM_uc003ffn.3_Silent_p.C23C|MECOM_uc003ffk.2_Silent_p.C23C|MECOM_uc003ffl.2_Silent_p.C183C|MECOM_uc011bpj.1_Silent_p.C211C|MECOM_uc011bpk.1_Silent_p.C13C|MECOM_uc010hwn.2_Silent_p.C211C|MECOM_uc003ffm.1_Silent_p.C87C	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	23	C2H2-type 1.|Interaction with MAPK9, SMAD3 and probably SUV39H1.				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CACAGTCTTCGCAGCGATATT	0.433					646											0.309804	218.126548	226.34704	79	176	KEEP	---	---	---	---	48	37	113	76	-1	capture	Silent	SNP	168845829	168845829	MECOM	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	9335	157
MUC4	4585	broad.mit.edu	37	3	195498599	195498599	+	Missense_Mutation	SNP	C	T	T	rs145772547		TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195498599C>T	uc011bto.1	-	6	13242	c.12782G>A	c.(12781-12783)CGG>CAG	p.R4261Q	MUC4_uc003fuz.2_Missense_Mutation_p.G69R|MUC4_uc003fva.2_5'UTR|MUC4_uc003fvb.2_5'UTR|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_5'UTR|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_5'UTR|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_5'UTR|MUC4_uc011bti.1_5'UTR|MUC4_uc011btj.1_Missense_Mutation_p.R130Q|MUC4_uc011btk.1_5'UTR|MUC4_uc011btl.1_5'UTR|MUC4_uc011btm.1_Missense_Mutation_p.R130Q|MUC4_uc011btn.1_5'UTR|MUC4_uc003fvo.2_Missense_Mutation_p.R153Q|MUC4_uc003fvp.2_Missense_Mutation_p.R102Q|MUC4_uc010hzu.1_Missense_Mutation_p.R1001Q	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1146					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACAGGGTCCCGGCCTGTGAA	0.562																0.327731	116.889156	120.018399	39	80	KEEP	---	---	---	---	20	24	46	43	-1	capture	Missense_Mutation	SNP	195498599	195498599	MUC4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9888	157
SLC10A4	201780	broad.mit.edu	37	4	48486116	48486116	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48486116G>A	uc003gyc.2	+	1	757	c.538G>A	c.(538-540)GGC>AGC	p.G180S		NM_152679	NP_689892	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	180	Helical; (Potential).					integral to membrane	bile acid:sodium symporter activity			central_nervous_system(1)	1						CTGTCCCGGCGGCAATCTCTC	0.632																0.315789	34.890637	36.035254	12	26	KEEP	---	---	---	---	6	7	16	15	-1	capture	Missense_Mutation	SNP	48486116	48486116	SLC10A4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14269	157
YTHDC1	91746	broad.mit.edu	37	4	69184554	69184554	+	Nonsense_Mutation	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69184554C>A	uc003hdx.2	-	13	2064	c.1711G>T	c.(1711-1713)GAA>TAA	p.E571*	YTHDC1_uc003hdy.2_Nonsense_Mutation_p.E553*	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	571	Arg-rich.									upper_aerodigestive_tract(1)|ovary(1)	2						CTGTCCACTTCCTGGTATCGT	0.318																0.282051	143.838057	152.163522	55	140	KEEP	---	---	---	---	35	34	69	102	0.492753623188	capture	Nonsense_Mutation	SNP	69184554	69184554	YTHDC1	4	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	17377	157
SGMS2	166929	broad.mit.edu	37	4	108831540	108831540	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:108831540C>T	uc003hyl.3	+	7	1484	c.929C>T	c.(928-930)TCT>TTT	p.S310F	uc003hym.1_Intron|SGMS2_uc003hyn.2_Missense_Mutation_p.S310F|SGMS2_uc003hyo.2_Missense_Mutation_p.S310F	NM_001136258	NP_001129730	Q8NHU3	SMS2_HUMAN	sphingomyelin synthase 2	310	Cytoplasmic (Potential).				sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)	AATTTCTTATCTCGAGCATGG	0.388																0.088235	9.781666	44.755202	18	186	KEEP	---	---	---	---	6	16	110	105	-1	capture	Missense_Mutation	SNP	108831540	108831540	SGMS2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	14108	157
MAML3	55534	broad.mit.edu	37	4	140810713	140810713	+	Missense_Mutation	SNP	T	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:140810713T>G	uc003ihz.1	-	3	2617	c.1865A>C	c.(1864-1866)AAC>ACC	p.N622T	MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	622	Gln-rich.				Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					CATCAAGGGGTTTTTGTTGGG	0.393					182											0.061224	-55.155773	6.960778	18	276	KEEP	---	---	---	---	23	24	158	136	-1	capture	Missense_Mutation	SNP	140810713	140810713	MAML3	4	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	9121	157
TBC1D9	23158	broad.mit.edu	37	4	141545490	141545490	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:141545490C>T	uc010ioj.2	-	19	3224	c.2952G>A	c.(2950-2952)ACG>ACA	p.T984T		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	984						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TTAGGCTCACCGTAACAAAGC	0.373																0.24359	53.705725	58.365872	19	59	KEEP	---	---	---	---	10	10	28	38	-1	capture	Silent	SNP	141545490	141545490	TBC1D9	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15514	157
SLC6A18	348932	broad.mit.edu	37	5	1225635	1225635	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1225635G>A	uc003jby.1	+	1	166	c.43G>A	c.(43-45)GGG>AGG	p.G15R		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	15	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CTGCGACCTCGGGGATGAGAG	0.642																0.092308	2.024079	12.897518	6	59	KEEP	---	---	---	---	17	12	33	37	-1	capture	Missense_Mutation	SNP	1225635	1225635	SLC6A18	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14573	157
LHFPL2	10184	broad.mit.edu	37	5	77784877	77784877	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:77784877C>T	uc003kfo.2	-	5	1206	c.530G>A	c.(529-531)GGA>GAA	p.G177E		NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	177						integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		GGAGCAGTCTCCAGGTTTGTA	0.512																0.238342	113.46229	125.526492	46	147	KEEP	---	---	---	---	19	34	76	91	-1	capture	Missense_Mutation	SNP	77784877	77784877	LHFPL2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8685	157
ARSK	153642	broad.mit.edu	37	5	94918696	94918696	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94918696C>T	uc003kld.2	+	4	651	c.493C>T	c.(493-495)CGT>TGT	p.R165C	ARSK_uc010jbg.2_Missense_Mutation_p.R6C|ARSK_uc011cum.1_RNA	NM_198150	NP_937793	Q6UWY0	ARSK_HUMAN	arylsulfatase K precursor	165						extracellular region	arylsulfatase activity|metal ion binding			pancreas(1)	1		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		TAATCTTATCCGTAACAGGAC	0.418																0.105802	34.419649	79.640521	31	262	KEEP	---	---	---	---	16	18	141	132	-1	capture	Missense_Mutation	SNP	94918696	94918696	ARSK	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	989	157
PHF15	23338	broad.mit.edu	37	5	133902013	133902013	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:133902013C>T	uc003kzo.1	+	9	1356	c.1177C>T	c.(1177-1179)CGC>TGC	p.R393C	PHF15_uc011cxt.1_Missense_Mutation_p.R393C|PHF15_uc003kzk.2_Missense_Mutation_p.R409C|PHF15_uc003kzl.2_Missense_Mutation_p.R393C|PHF15_uc003kzm.2_Missense_Mutation_p.R393C|PHF15_uc003kzn.2_Missense_Mutation_p.R393C|PHF15_uc003kzp.2_Missense_Mutation_p.R101C	NM_015288	NP_056103	Q9NQC1	JADE2_HUMAN	PHD finger protein 15	393					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGTGACCCTGCGCAAGCAGCG	0.642																0.039216	-16.029554	7.29298	4	98	KEEP	---	---	---	---	1	3	90	88	-1	capture	Missense_Mutation	SNP	133902013	133902013	PHF15	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11729	157
EBF1	1879	broad.mit.edu	37	5	158523369	158523369	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:158523369G>T	uc010jip.2	-	3	639	c.337C>A	c.(337-339)CAG>AAG	p.Q113K	EBF1_uc011ddw.1_5'UTR|EBF1_uc011ddx.1_Missense_Mutation_p.Q113K|EBF1_uc003lxl.3_Missense_Mutation_p.Q113K	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	113					multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAGAGAAGCTGAAGCCGGTAG	0.592						T	HMGA2	lipoma								0.368421	39.337575	39.916639	14	24	KEEP	---	---	---	---	7	8	14	14	0.466666666667	capture	Missense_Mutation	SNP	158523369	158523369	EBF1	5	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	4835	157
WWC1	23286	broad.mit.edu	37	5	167841446	167841446	+	Silent	SNP	C	T	T	rs61730020	byFrequency;by1000genomes	TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167841446C>T	uc003lzu.2	+	9	1128	c.1035C>T	c.(1033-1035)AAC>AAT	p.N345N	WWC1_uc003lzv.2_Silent_p.N345N|WWC1_uc011den.1_Silent_p.N345N|WWC1_uc003lzw.2_Silent_p.N144N	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	345	Potential.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		TCCTTATCAACGAGAAGGAGG	0.627																0.285714	16.043313	16.907459	6	15	KEEP	---	---	---	---	2	4	6	9	-1	capture	Silent	SNP	167841446	167841446	WWC1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17292	157
TDP2	51567	broad.mit.edu	37	6	24666809	24666809	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24666809C>T	uc003nej.2	-	2	221	c.196G>A	c.(196-198)GTG>ATG	p.V66M	TDP2_uc003nei.2_Translation_Start_Site|TDP2_uc010jpu.1_Missense_Mutation_p.V66M|ACOT13_uc010jpv.2_5'Flank|ACOT13_uc003nek.2_5'Flank	NM_016614	NP_057698	O95551	TYDP2_HUMAN	TRAF and TNF receptor-associated protein	66					cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity			ovary(1)|lung(1)	2						CTCTCCTCCACCGGAGGCTCG	0.582											Direct_reversal_of_damage|Editing_and_processing_nucleases					0.257426	264.499569	286.061671	104	300	KEEP	---	---	---	---	53	61	148	184	-1	capture	Missense_Mutation	SNP	24666809	24666809	TDP2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	15614	157
UHRF1BP1	54887	broad.mit.edu	37	6	34839664	34839664	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34839664G>A	uc003oju.3	+	20	4393	c.4159G>A	c.(4159-4161)GTG>ATG	p.V1387M	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1387										ovary(3)	3						AAAAGAACAGGTGTTTTTGGT	0.468																0.373333	84.198661	85.248452	28	47	KEEP	---	---	---	---	15	19	26	31	-1	capture	Missense_Mutation	SNP	34839664	34839664	UHRF1BP1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	16850	157
TREML4	285852	broad.mit.edu	37	6	41196175	41196175	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41196175G>A	uc003oqc.2	+	1	114	c.10G>A	c.(10-12)GGT>AGT	p.G4S	TREML4_uc003oqd.2_5'Flank	NM_198153	NP_937796	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid	4						extracellular region				breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					AATGGCCTGGGGTGGGGTCCA	0.597																0.307692	20.177878	21.042778	8	18	KEEP	---	---	---	---	4	5	10	15	-1	capture	Missense_Mutation	SNP	41196175	41196175	TREML4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16357	157
FAM83B	222584	broad.mit.edu	37	6	54804576	54804576	+	Missense_Mutation	SNP	T	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54804576T>G	uc003pck.2	+	5	923	c.807T>G	c.(805-807)TTT>TTG	p.F269L		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	269										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TTGAGTCCTTTGATGAAGAAT	0.398																0.013333	-54.280959	6.51542	3	222	KEEP	---	---	---	---	0	3	124	115	-1	capture	Missense_Mutation	SNP	54804576	54804576	FAM83B	6	T	G	G	G	1	0	0	0	0	1	0	0	0	816	63	4	4	5580	157
ADAP1	11033	broad.mit.edu	37	7	959664	959664	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:959664C>T	uc003sjo.3	-	4	505	c.329G>A	c.(328-330)CGG>CAG	p.R110Q	ADAP1_uc011jvs.1_Missense_Mutation_p.R15Q|ADAP1_uc003sjn.3_Missense_Mutation_p.R38Q|ADAP1_uc010ksc.2_Missense_Mutation_p.R38Q	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1	110	Arf-GAP.				cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding	p.R110Q(1)		upper_aerodigestive_tract(1)	1						GTACTTGGCCCGGATCCACTG	0.682																0.102564	3.87465	10.01031	4	35	KEEP	---	---	---	---	1	4	18	21	-1	capture	Missense_Mutation	SNP	959664	959664	ADAP1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	279	157
MAD1L1	8379	broad.mit.edu	37	7	2255803	2255803	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2255803G>A	uc003slh.1	-	8	1064	c.798C>T	c.(796-798)AGC>AGT	p.S266S	MAD1L1_uc003sle.1_5'Flank|MAD1L1_uc003slf.1_Silent_p.S266S|MAD1L1_uc003slg.1_Silent_p.S266S|MAD1L1_uc010ksh.1_Silent_p.S266S|MAD1L1_uc003sli.1_Silent_p.S174S|MAD1L1_uc010ksi.1_Silent_p.S219S|MAD1L1_uc010ksj.2_Silent_p.S266S	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	266	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GCAGGTGCGCGCTCTCCTCCC	0.637																0.07438	-7.495263	15.041143	9	112	KEEP	---	---	---	---	4	5	61	73	-1	capture	Silent	SNP	2255803	2255803	MAD1L1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	9062	157
ELMO1	9844	broad.mit.edu	37	7	36917679	36917679	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36917679C>T	uc003tfk.1	-	19	2065	c.1758G>A	c.(1756-1758)CTG>CTA	p.L586L	ELMO1_uc003tfi.1_Silent_p.L106L|ELMO1_uc003tfj.1_Silent_p.L106L|ELMO1_uc011kbb.1_RNA|ELMO1_uc011kbc.1_Silent_p.L490L|ELMO1_uc010kxg.1_Silent_p.L586L	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	586	PH.				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CTCCGTAATGCAGGACTTTGT	0.453																0.066667	-11.196074	26.776327	13	182	KEEP	---	---	---	---	14	5	101	105	-1	capture	Silent	SNP	36917679	36917679	ELMO1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	5020	157
ELMO1	9844	broad.mit.edu	37	7	37172811	37172811	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37172811G>A	uc003tfk.1	-	14	1422	c.1115C>T	c.(1114-1116)ACG>ATG	p.T372M	ELMO1_uc011kbc.1_Missense_Mutation_p.T276M|ELMO1_uc010kxg.1_Missense_Mutation_p.T372M	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	372	ELMO.				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						TGGAGTCTGCGTGAAGTCCAT	0.463																0.258065	80.535748	87.118136	32	92	KEEP	---	---	---	---	26	12	44	65	-1	capture	Missense_Mutation	SNP	37172811	37172811	ELMO1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5020	157
DDC	1644	broad.mit.edu	37	7	50596925	50596925	+	Missense_Mutation	SNP	A	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50596925A>G	uc003tpf.3	-	5	637	c.551T>C	c.(550-552)GTG>GCG	p.V184A	DDC_uc010kza.2_Intron|DDC_uc003tpg.3_Missense_Mutation_p.V184A	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	184					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding	p.V184V(1)		ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	TGAGTAAGCCACCAGCTTCTC	0.547																0.224719	140.042269	158.662376	60	207	KEEP	---	---	---	---	27	48	116	122	-1	capture	Missense_Mutation	SNP	50596925	50596925	DDC	7	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	4284	157
EGFR	1956	broad.mit.edu	37	7	55221743	55221743	+	Missense_Mutation	SNP	A	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221743A>C	uc003tqk.2	+	7	1033	c.787A>C	c.(787-789)ACC>CCC	p.T263P	EGFR_uc003tqh.2_Missense_Mutation_p.T263P|EGFR_uc003tqi.2_Missense_Mutation_p.T263P|EGFR_uc003tqj.2_Missense_Mutation_p.T263P|EGFR_uc010kzg.1_Missense_Mutation_p.T218P|EGFR_uc011kco.1_Missense_Mutation_p.T210P|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	263	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.T263P(4)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGCAAGGACACCTGCCCCCC	0.577			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.918771	3178.572842	3330.022321	837	74	KEEP	---	---	---	---	429	480	41	50	-1	capture	Missense_Mutation	SNP	55221743	55221743	EGFR	7	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	4922	157
CACNA2D1	781	broad.mit.edu	37	7	81589046	81589046	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81589046C>T	uc003uhr.1	-	37	3322	c.3066G>A	c.(3064-3066)GCG>GCA	p.A1022A	CACNA2D1_uc011kgy.1_Silent_p.A234A	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	1034	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	AAGTCTGCTCCGCTTGTATGA	0.368																0.447761	207.096018	207.41262	60	74	KEEP	---	---	---	---	29	38	34	42	-1	capture	Silent	SNP	81589046	81589046	CACNA2D1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2524	157
ABCB1	5243	broad.mit.edu	37	7	87214993	87214993	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87214993G>A	uc003uiz.1	-	5	539	c.121C>T	c.(121-123)CGC>TGC	p.R41C	ABCB1_uc011khc.1_Missense_Mutation_p.R41C	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	41	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TTTGAATAGCGAAACTAAAAA	0.328																0.051282	-7.56874	9.059517	4	74	KEEP	---	---	---	---	2	4	54	62	-1	capture	Missense_Mutation	SNP	87214993	87214993	ABCB1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	40	157
RUNDC3B	154661	broad.mit.edu	37	7	87280179	87280179	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87280179C>A	uc003ujb.2	+	2	575	c.164C>A	c.(163-165)ACA>AAA	p.T55K	ABCB1_uc003uiz.1_Intron|ABCB1_uc003uja.1_Intron|ABCB1_uc010lei.1_Intron|RUNDC3B_uc011khd.1_Missense_Mutation_p.T55K|RUNDC3B_uc011khe.1_Missense_Mutation_p.T55K|RUNDC3B_uc003ujc.2_Missense_Mutation_p.T55K	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	55										skin(1)	1	Esophageal squamous(14;0.00164)					TGCTTTGAGACAATTGATGAT	0.338																0.152542	38.267742	51.903165	18	100	KEEP	---	---	---	---	12	13	62	59	0.52	capture	Missense_Mutation	SNP	87280179	87280179	RUNDC3B	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	13637	157
PON1	5444	broad.mit.edu	37	7	94937424	94937424	+	Silent	SNP	A	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94937424A>T	uc003uns.2	-	6	694	c.597T>A	c.(595-597)GGT>GGA	p.G199G	PON1_uc011kih.1_Silent_p.G199G	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	199					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	ACCACGCTAAACCCAAATACA	0.418	GBM(119;715 1622 17358 22490 33240)															0.147465	54.659455	80.559394	32	185	KEEP	---	---	---	---	18	14	89	111	-1	capture	Silent	SNP	94937424	94937424	PON1	7	A	T	T	T	1	0	0	0	0	0	0	0	1	15	2	4	4	12150	157
LRCH4	4034	broad.mit.edu	37	7	100175848	100175848	+	Silent	SNP	G	A	A	rs150987161	byFrequency	TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100175848G>A	uc003uvj.2	-	7	935	c.882C>T	c.(880-882)TAC>TAT	p.Y294Y	LRCH4_uc010lgz.2_RNA|LRCH4_uc003uvi.2_RNA|LRCH4_uc011kjw.1_Translation_Start_Site|LRCH4_uc011kjx.1_RNA	NM_002319	NP_002310	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH)	294					nervous system development	PML body	protein binding			large_intestine(1)|ovary(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCCACCATCGTACCGATGTC	0.597																0.113924	10.923359	22.531052	9	70	KEEP	---	---	---	---	7	5	44	36	-1	capture	Silent	SNP	100175848	100175848	LRCH4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8851	157
PCOLCE	5118	broad.mit.edu	37	7	100201641	100201641	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100201641C>T	uc003uvo.2	+	3	462	c.264C>T	c.(262-264)CCC>CCT	p.P88P	uc011kjy.1_RNA|PCOLCE_uc011kkb.1_Silent_p.P88P|PCOLCE_uc010lhb.1_Intron|PCOLCE_uc003uvp.1_5'Flank	NM_002593	NP_002584	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	88	CUB 1.				multicellular organismal development	extracellular space	collagen binding|heparin binding|peptidase activator activity				0	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					AGCTGCACCCCGCCTGCCGCT	0.672																0.028986	-26.688463	6.97835	4	134	KEEP	---	---	---	---	5	0	99	91	-1	capture	Silent	SNP	100201641	100201641	PCOLCE	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11497	157
SH2D4A	63898	broad.mit.edu	37	8	19190497	19190497	+	Silent	SNP	A	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:19190497A>G	uc003wzb.2	+	3	549	c.213A>G	c.(211-213)GGA>GGG	p.G71G	SH2D4A_uc011kym.1_Silent_p.G26G|SH2D4A_uc003wzc.2_Silent_p.G71G	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	71						cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		GGAAACTTGGAGCTGATAAGG	0.408																0.020747	-56.441745	6.4898	5	236	KEEP	---	---	---	---	2	4	134	145	-1	capture	Silent	SNP	19190497	19190497	SH2D4A	8	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	14128	157
CPSF1	29894	broad.mit.edu	37	8	145623823	145623823	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145623823G>A	uc003zcj.2	-	19	1838	c.1763C>T	c.(1762-1764)ACG>ATG	p.T588M		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	588					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CTCCTGCCCCGTCTGCAGGAT	0.672	NSCLC(133;1088 1848 27708 34777 35269)															0.119266	29.593128	60.622607	26	192	KEEP	---	---	---	---	24	8	134	148	-1	capture	Missense_Mutation	SNP	145623823	145623823	CPSF1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3789	157
LRRC14	9684	broad.mit.edu	37	8	145745327	145745327	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145745327G>A	uc003zdk.1	+	2	364	c.218G>A	c.(217-219)CGT>CAT	p.R73H	RECQL4_uc003zdj.2_5'Flank|LRRC14_uc003zdl.1_Missense_Mutation_p.R73H|LRRC14_uc003zdo.2_5'Flank	NM_014665	NP_055480	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	73											0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CACTGCAGCCGTGCCCTCCTG	0.627																0.12844	19.289151	33.938212	14	95	KEEP	---	---	---	---	10	13	71	82	-1	capture	Missense_Mutation	SNP	145745327	145745327	LRRC14	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8884	157
VLDLR	7436	broad.mit.edu	37	9	2643641	2643641	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2643641C>T	uc003zhk.1	+	6	1231	c.834C>T	c.(832-834)TGC>TGT	p.C278C	VLDLR_uc003zhl.1_Silent_p.C278C|VLDLR_uc003zhm.1_RNA|VLDLR_uc003zhn.1_Silent_p.C237C	NM_003383	NP_003374	P98155	VLDLR_HUMAN	very low density lipoprotein receptor isoform a	278	Extracellular (Potential).|LDL-receptor class A 7.				cholesterol metabolic process|endocytosis|lipid transport|memory|very-low-density lipoprotein particle clearance	coated pit|integral to membrane|membrane fraction|plasma membrane|very-low-density lipoprotein particle	apolipoprotein binding|calcium ion binding|low-density lipoprotein receptor activity|very-low-density lipoprotein particle receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		CTCGAACTTGCCGACCTGACC	0.488																0.061728	-6.192517	10.04203	5	76	KEEP	---	---	---	---	3	2	46	43	-1	capture	Silent	SNP	2643641	2643641	VLDLR	9	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	17056	157
FAM122A	116224	broad.mit.edu	37	9	71395730	71395730	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71395730T>C	uc004agw.1	+	1	767	c.650T>C	c.(649-651)TTT>TCT	p.F217S	PIP5K1B_uc004agu.2_Intron|PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_138333	NP_612206	Q96E09	F122A_HUMAN	hypothetical protein LOC116224	217											0						CCAAAGAGATTTTTCCAGGGC	0.453																0.438144	304.960501	305.605336	85	109	KEEP	---	---	---	---	42	49	67	51	-1	capture	Missense_Mutation	SNP	71395730	71395730	FAM122A	9	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	5373	157
NFIL3	4783	broad.mit.edu	37	9	94172272	94172272	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:94172272C>T	uc004arh.2	-	2	1140	c.745G>A	c.(745-747)GGG>AGG	p.G249R		NM_005384	NP_005375	Q16649	NFIL3_HUMAN	nuclear factor, interleukin 3 regulated	249					circadian rhythm|immune response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0						AAAGAATTCCCCATATAGTTT	0.498	Esophageal Squamous(152;732 1832 10053 26981 51762)															0.412371	248.060349	249.362538	80	114	KEEP	---	---	---	---	40	48	59	64	-1	capture	Missense_Mutation	SNP	94172272	94172272	NFIL3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10280	157
FGD3	89846	broad.mit.edu	37	9	95768391	95768391	+	Nonsense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95768391C>T	uc004asw.2	+	6	1394	c.766C>T	c.(766-768)CGA>TGA	p.R256*	FGD3_uc004asx.2_Nonsense_Mutation_p.R256*|FGD3_uc004asz.2_Nonsense_Mutation_p.R256*|FGD3_uc004ata.2_Nonsense_Mutation_p.R59*	NM_001083536	NP_001077005	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	256	DH.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(1)|breast(1)	2						GAACTTTGACCGAGCCGTAGG	0.582																0.037313	-20.190854	10.630255	5	129	KEEP	---	---	---	---	3	2	78	75	-1	capture	Nonsense_Mutation	SNP	95768391	95768391	FGD3	9	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	5780	157
HEMGN	55363	broad.mit.edu	37	9	100700360	100700360	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100700360T>C	uc004axy.2	-	1	167	c.59A>G	c.(58-60)CAA>CGA	p.Q20R	HEMGN_uc004axz.2_Missense_Mutation_p.Q20R	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	20	Necessary for nuclear localization.				cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GTTCTCTTCTTGATGAGGGTC	0.423																0.013274	-54.687636	6.409876	3	223	KEEP	---	---	---	---	1	2	141	120	-1	capture	Missense_Mutation	SNP	100700360	100700360	HEMGN	9	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	6976	157
KLF4	9314	broad.mit.edu	37	9	110249362	110249362	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:110249362C>T	uc004bdh.2	-	3	1907	c.1286G>A	c.(1285-1287)GGC>GAC	p.G429D	KLF4_uc004bdf.1_Missense_Mutation_p.G354D|KLF4_uc004bdg.2_Missense_Mutation_p.G404D	NM_004235	NP_004226	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	438	C2H2-type 1.				fat cell differentiation|mesodermal cell fate determination|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|stem cell maintenance|transcription from RNA polymerase II promoter	nucleus	RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor recruiting transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(2)|lung(1)	3						GTAGGTTTTGCCGCAGCCCGC	0.602																0.018382	-63.456595	7.58587	5	267	KEEP	---	---	---	---	1	4	140	166	-1	capture	Missense_Mutation	SNP	110249362	110249362	KLF4	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8268	157
TPRN	286262	broad.mit.edu	37	9	140086816	140086816	+	Silent	SNP	G	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140086816G>T	uc004clt.2	-	3	1785	c.1785C>A	c.(1783-1785)GGC>GGA	p.G595G	TPRN_uc004clu.2_Silent_p.G595G	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	656					sensory perception of sound	stereocilium					0						AGCTGGACAGGCCTGTGAATG	0.672																0.142857	2.229269	6.606941	5	30	KEEP	---	---	---	---	3	4	15	20	0.428571428571	capture	Silent	SNP	140086816	140086816	TPRN	9	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	16304	157
OFD1	8481	broad.mit.edu	37	X	13786260	13786260	+	Missense_Mutation	SNP	G	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:13786260G>C	uc004cvp.3	+	21	3204	c.2845G>C	c.(2845-2847)GAC>CAC	p.D949H	OFD1_uc004cvr.3_Missense_Mutation_p.D479H|OFD1_uc011mil.1_Missense_Mutation_p.D516H|OFD1_uc004cvq.3_Missense_Mutation_p.D772H|OFD1_uc010nen.2_Missense_Mutation_p.D947H|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.D908H|OFD1_uc004cvv.3_Missense_Mutation_p.D907H	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	949	Mediates the interaction with SDCCAG8.|Potential.				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						AGAAATAAAAGACAAATCTGC	0.358																0.018405	-36.0314	6.539087	3	160	KEEP	---	---	---	---	0	4	87	75	-1	capture	Missense_Mutation	SNP	13786260	13786260	OFD1	23	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	10743	157
HUWE1	10075	broad.mit.edu	37	X	53612010	53612010	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53612010G>A	uc004dsp.2	-	40	5365	c.4963C>T	c.(4963-4965)CGA>TGA	p.R1655*	HUWE1_uc004dsn.2_Nonsense_Mutation_p.R480*	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1655	WWE.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TATCTTCTTCGGCCTGCAGTG	0.378																0.278351	397.54469	418.960883	135	350	KEEP	---	---	---	---	67	91	205	202	-1	capture	Nonsense_Mutation	SNP	53612010	53612010	HUWE1	23	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	7386	157
OGT	8473	broad.mit.edu	37	X	70777507	70777507	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70777507C>A	uc004eaa.1	+	12	1804	c.1587C>A	c.(1585-1587)AAC>AAA	p.N529K	BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.N519K|OGT_uc004eac.2_Missense_Mutation_p.N390K|OGT_uc004ead.2_Missense_Mutation_p.N148K	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1	529					cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					GGCACGGCAACCTGTGCTTAG	0.284																0.292398	137.084424	143.682109	50	121	KEEP	---	---	---	---	24	32	55	81	0.571428571429	capture	Missense_Mutation	SNP	70777507	70777507	OGT	23	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	10752	157
DRP2	1821	broad.mit.edu	37	X	100511129	100511129	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100511129C>T	uc004egz.2	+	21	2638	c.2269C>T	c.(2269-2271)CGG>TGG	p.R757W	DRP2_uc011mrh.1_Missense_Mutation_p.R679W	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	757					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						GTACCTGCTGCGGCACTCCAG	0.582																0.216667	86.121836	99.461985	39	141	KEEP	---	---	---	---	21	20	83	79	-1	capture	Missense_Mutation	SNP	100511129	100511129	DRP2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4719	157
COL4A5	1287	broad.mit.edu	37	X	107939578	107939578	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107939578C>T	uc004enz.1	+	52	5248	c.5046C>T	c.(5044-5046)AGC>AGT	p.S1682S	COL4A5_uc011mso.1_Silent_p.S1679S|COL4A5_uc011msp.1_Silent_p.S358S	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1676	Collagen IV NC1.		Missing (in APSX).		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						CACGAATTAGCCGATGTCAAG	0.348												Alport_syndrome_with_Diffuse_Leiomyomatosis				0.021164	-41.469491	7.003598	4	185	KEEP	---	---	---	---	1	4	90	127	-1	capture	Silent	SNP	107939578	107939578	COL4A5	23	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	3659	157
LONRF3	79836	broad.mit.edu	37	X	118145848	118145848	+	Missense_Mutation	SNP	T	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118145848T>A	uc004eqw.2	+	8	1754	c.1723T>A	c.(1723-1725)TTT>ATT	p.F575I	LONRF3_uc004eqx.2_Missense_Mutation_p.F534I|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_Missense_Mutation_p.F319I	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger	575	Lon.				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						CCTGCACATCTTTGAGCCTTG	0.478																0.264286	291.435356	312.533342	111	309	KEEP	---	---	---	---	71	53	172	175	-1	capture	Missense_Mutation	SNP	118145848	118145848	LONRF3	23	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	8813	157
FAM70A	55026	broad.mit.edu	37	X	119410766	119410766	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119410766C>T	uc004eso.3	-	8	948	c.721G>A	c.(721-723)GCT>ACT	p.A241T	FAM70A_uc004esp.3_Missense_Mutation_p.A217T|FAM70A_uc010nqo.2_Intron	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	241	Helical; (Potential).					integral to membrane				lung(1)|breast(1)	2						CCAAGGACAGCGGCAGTGATG	0.527																0.252212	142.806172	155.383886	57	169	KEEP	---	---	---	---	37	32	86	105	-1	capture	Missense_Mutation	SNP	119410766	119410766	FAM70A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5553	157
GLUD2	2747	broad.mit.edu	37	X	120181970	120181970	+	Silent	SNP	G	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:120181970G>A	uc004eto.2	+	1	509	c.432G>A	c.(430-432)ACG>ACA	p.T144T		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	144					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	AGCACCGCACGCCCTGCAAGG	0.572																0.207143	63.604765	74.746101	29	111	KEEP	---	---	---	---	18	16	67	58	-1	capture	Silent	SNP	120181970	120181970	GLUD2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6413	157
OCRL	4952	broad.mit.edu	37	X	128701326	128701326	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128701326C>A	uc004euq.2	+	14	1617	c.1452C>A	c.(1450-1452)GAC>GAA	p.D484E	OCRL_uc004eur.2_Missense_Mutation_p.D484E	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	484					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						CTAAAACAGACCGGTGGGATT	0.393																0.114754	16.152483	33.918919	14	108	KEEP	---	---	---	---	7	10	58	57	0.588235294118	capture	Missense_Mutation	SNP	128701326	128701326	OCRL	23	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	10728	157
XPNPEP2	7512	broad.mit.edu	37	X	128887224	128887224	+	Silent	SNP	C	T	T			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128887224C>T	uc004eut.1	+	11	1351	c.1107C>T	c.(1105-1107)CAC>CAT	p.H369H		NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound	369					cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						AGGCCAGCCACGTAAGTCCAC	0.537																0.133005	45.010391	71.529648	27	176	KEEP	---	---	---	---	13	17	100	101	-1	capture	Silent	SNP	128887224	128887224	XPNPEP2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17324	157
SAGE1	55511	broad.mit.edu	37	X	134989538	134989538	+	Missense_Mutation	SNP	T	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134989538T>G	uc004ezh.2	+	9	1111	c.944T>G	c.(943-945)GTA>GGA	p.V315G	SAGE1_uc010nry.1_Missense_Mutation_p.V284G|SAGE1_uc011mvv.1_Intron	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	315										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					CCTAATAACGTATTGTCAACT	0.408																0.213115	227.075455	254.883136	78	288	KEEP	---	---	---	---	39	44	145	161	-1	capture	Missense_Mutation	SNP	134989538	134989538	SAGE1	23	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	13701	157
PDE4DIP	9659	broad.mit.edu	37	1	144863324	144863324	+	Frame_Shift_Del	DEL	G	-	-			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144863324delG	uc001elw.3	-	37	6370	c.6079delC	c.(6079-6081)CTGfs	p.L2027fs	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Frame_Shift_Del_p.L1921fs|PDE4DIP_uc001elv.3_Frame_Shift_Del_p.L1034fs|PDE4DIP_uc001ema.2_3'UTR	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2027	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATACCTTTCAGCCCCTTCTTG	0.488					595	T	PDGFRB	MPD								0.02			7	450		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	144863324	144863324	PDE4DIP	1	G	-	-	-	1	0	1	0	1	0	0	0	0	438	34	5	5	11546	157
CACNA1E	777	broad.mit.edu	37	1	181479699	181479699	+	Frame_Shift_Del	DEL	C	-	-			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:181479699delC	uc001gow.2	+	2	518	c.353delC	c.(352-354)ACCfs	p.T118fs	CACNA1E_uc009wxr.2_Frame_Shift_Del_p.T25fs|CACNA1E_uc009wxs.2_Frame_Shift_Del_p.T25fs	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	118	I.|Extracellular (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GATGACAAGACCCCCATGTCC	0.527																0.22			21	75		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	181479699	181479699	CACNA1E	1	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	2518	157
PITPNM2	57605	broad.mit.edu	37	12	123481392	123481393	+	Frame_Shift_Ins	INS	-	C	C			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123481392_123481393insC	uc001uej.1	-	11	1676_1677	c.1537_1538insG	c.(1537-1539)GCCfs	p.A513fs	PITPNM2_uc001uek.1_Frame_Shift_Ins_p.A513fs	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	513					metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CAGGGGGAGGGCAGCCAGGGGA	0.639																0.06			7	115		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	123481392	123481393	PITPNM2	12	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	11854	157
RFX7	64864	broad.mit.edu	37	15	56386880	56386881	+	Frame_Shift_Ins	INS	-	G	G			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56386880_56386881insG	uc010bfn.2	-	9	3045_3046	c.3045_3046insC	c.(3043-3048)CCCAGCfs	p.P1015fs	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Frame_Shift_Ins_p.P829fs	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	918_919					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						TCAACAGGGCTGGGGGGGACAC	0.500																0.09			13	130		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	56386880	56386881	RFX7	15	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	13163	157
RAB3GAP1	22930	broad.mit.edu	37	2	135893152	135893155	+	Frame_Shift_Del	DEL	GAAA	-	-			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135893152_135893155delGAAA	uc002tuj.2	+	17	1598_1601	c.1573_1576delGAAA	c.(1573-1578)GAAAGAfs	p.E525fs	RAB3GAP1_uc010fnf.2_Frame_Shift_Del_p.E525fs|RAB3GAP1_uc010fng.2_Frame_Shift_Del_p.E350fs|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	525_526						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		TTGTTGTATTGAAAGAAAGAAGGC	0.333																0.29			23	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	135893152	135893155	RAB3GAP1	2	GAAA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	12830	157
TTN	7273	broad.mit.edu	37	2	179500424	179500424	+	Frame_Shift_Del	DEL	A	-	-			TCGA-16-1045-01	TCGA-16-1045-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179500424delA	uc010zfg.1	-	176	34147	c.33923delT	c.(33922-33924)CTGfs	p.L11308fs	TTN_uc010zfh.1_Frame_Shift_Del_p.L5003fs|TTN_uc010zfi.1_Frame_Shift_Del_p.L4936fs|TTN_uc010zfj.1_Frame_Shift_Del_p.L4811fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12235							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGTTTCACCAGCCAATCTCT	0.353					8722											0.26			11	32		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	179500424	179500424	TTN	2	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	16617	157
