Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MSH4	4438	broad.mit.edu	37	1	76288094	76288094	+	Silent	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:76288094G>A	uc001dhd.1	+	7	1031	c.990G>A	c.(988-990)AGG>AGA	p.R330R		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	330					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						GTTTTGAAAGGAATAATCACA	0.308											MMR					0.225	69.063048	77.39919	27	93	KEEP	---	---	---	---	20	12	51	57	-1	capture	Silent	SNP	76288094	76288094	MSH4	1	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	9782	169
RPL5	6125	broad.mit.edu	37	1	93303161	93303161	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93303161T>C	uc001doz.2	+	6	754	c.676T>C	c.(676-678)TAC>CAC	p.Y226H	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_Missense_Mutation_p.Y176H|RPL5_uc001dpd.2_Missense_Mutation_p.Y27H	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5	226					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		GTTCTCTCAATACATAAAGAA	0.368																0.222222	29.229843	32.420727	10	35	KEEP	---	---	---	---	3	8	23	17	-1	capture	Missense_Mutation	SNP	93303161	93303161	RPL5	1	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	13489	169
RAG2	5897	broad.mit.edu	37	11	36615451	36615451	+	Missense_Mutation	SNP	G	C	C	rs149769148		TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36615451G>C	uc001mwv.3	-	2	456	c.268C>G	c.(268-270)CAA>GAA	p.Q90E	C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	90					chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				ATGATGTATTGATGCTTTTCA	0.413												Familial_Hemophagocytic_Lymphohistiocytosis				0.198675	83.363349	96.122402	30	121	KEEP	---	---	---	---	20	12	66	70	-1	capture	Missense_Mutation	SNP	36615451	36615451	RAG2	11	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	12900	169
KDELC2	143888	broad.mit.edu	37	11	108361783	108361783	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108361783C>T	uc001pkj.2	-	2	380	c.314G>A	c.(313-315)AGG>AAG	p.R105K	KDELC2_uc001pki.2_Missense_Mutation_p.R49K	NM_153705	NP_714916	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2 precursor	105	Filamin.					endoplasmic reticulum lumen				ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TTCATACATCCTATATCTCAT	0.388																0.178571	23.726303	29.163241	10	46	KEEP	---	---	---	---	2	8	24	29	-1	capture	Missense_Mutation	SNP	108361783	108361783	KDELC2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8040	169
ESAM	90952	broad.mit.edu	37	11	124623728	124623728	+	Silent	SNP	A	C	C			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124623728A>C	uc001qav.3	-	7	1160	c.987T>G	c.(985-987)GGT>GGG	p.G329G	VSIG2_uc001qas.2_5'Flank|VSIG2_uc001qat.2_5'Flank|ESAM_uc010sao.1_Intron|ESAM_uc001qau.3_Silent_p.G256G|ESAM_uc001qaw.3_RNA|ESAM_uc001qax.3_RNA|ESAM_uc009zbi.2_Missense_Mutation_p.V328G	NM_138961	NP_620411	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule precursor	329	Cytoplasmic (Potential).				blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction					0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		GGGTCAATGCACCAGGCCTGG	0.647																0.302326	78.42867	81.490426	26	60	KEEP	---	---	---	---	13	17	30	36	-1	capture	Silent	SNP	124623728	124623728	ESAM	11	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	5202	169
ANKRD33	341405	broad.mit.edu	37	12	52284586	52284586	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52284586C>T	uc001rzf.3	+	5	1060	c.481C>T	c.(481-483)CGG>TGG	p.R161W	ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_Missense_Mutation_p.R286W|ANKRD33_uc001rze.2_Missense_Mutation_p.R182W|ANKRD33_uc001rzg.3_Missense_Mutation_p.R88W|ANKRD33_uc001rzi.3_Missense_Mutation_p.R161W	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1	161											0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		ACTCCTAGAACGGCTGCAGGC	0.552																0.206897	12.328023	14.645982	6	23	KEEP	---	---	---	---	1	5	13	10	-1	capture	Missense_Mutation	SNP	52284586	52284586	ANKRD33	12	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	657	169
IGDCC3	9543	broad.mit.edu	37	15	65621380	65621380	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65621380T>A	uc002aos.2	-	14	2564	c.2312A>T	c.(2311-2313)GAG>GTG	p.E771V	IGDCC3_uc002aor.1_Missense_Mutation_p.E57V	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	771	Cytoplasmic (Potential).									ovary(3)	3						AGCCGTGGCCTCTGTGGTCTT	0.716																0.107143	2.449349	6.69851	3	25	KEEP	---	---	---	---	3	2	11	15	-1	capture	Missense_Mutation	SNP	65621380	65621380	IGDCC3	15	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	7493	169
CES3	23491	broad.mit.edu	37	16	66997813	66997813	+	Missense_Mutation	SNP	C	T	T	rs148620443	byFrequency	TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66997813C>T	uc002eqt.2	+	4	608	c.535C>T	c.(535-537)CGC>TGC	p.R179C	CES3_uc010cdz.2_Missense_Mutation_p.R179C|CES3_uc010cea.2_RNA	NM_024922	NP_079198	Q6UWW8	EST3_HUMAN	carboxylesterase 3 precursor	179						endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity			ovary(3)|central_nervous_system(2)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		AGTCCAGTACCGCCTTGGGGT	0.607																0.066667	-4.078842	19.258597	8	112	KEEP	---	---	---	---	0	8	60	69	-1	capture	Missense_Mutation	SNP	66997813	66997813	CES3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3239	169
SSTR2	6752	broad.mit.edu	37	17	71166297	71166297	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:71166297T>C	uc002jje.2	+	2	1199	c.839T>C	c.(838-840)GTC>GCC	p.V280A		NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2	280	Extracellular (Potential).				digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)			GTTTCTTCCGTCTCCATGGCC	0.512																0.294521	135.808169	141.300559	43	103	KEEP	---	---	---	---	15	33	56	57	-1	capture	Missense_Mutation	SNP	71166297	71166297	SSTR2	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	15090	169
ZNF516	9658	broad.mit.edu	37	18	74091275	74091275	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74091275G>A	uc010dqx.1	-	3	3030	c.2795C>T	c.(2794-2796)ACG>ATG	p.T932M	ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	932					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GACGGTGGGCGTAGGGGTGGC	0.726																0.279412	46.494335	49.471741	19	49	KEEP	---	---	---	---	11	10	25	28	-1	capture	Missense_Mutation	SNP	74091275	74091275	ZNF516	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17839	169
ZNF135	7694	broad.mit.edu	37	19	58578313	58578313	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58578313C>T	uc010yhq.1	+	5	593	c.497C>T	c.(496-498)ACG>ATG	p.T166M	ZNF135_uc002qre.2_Missense_Mutation_p.T154M|ZNF135_uc002qrd.1_Missense_Mutation_p.T112M|ZNF135_uc002qrf.2_Missense_Mutation_p.T112M|ZNF135_uc002qrg.2_Missense_Mutation_p.T124M|ZNF135_uc010yhr.1_Translation_Start_Site	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	166					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCTGTGAAGACGCCTGTTCTG	0.557																0.350877	56.449529	57.538171	20	37	KEEP	---	---	---	---	10	12	22	18	-1	capture	Missense_Mutation	SNP	58578313	58578313	ZNF135	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17605	169
GALNT14	79623	broad.mit.edu	37	2	31360949	31360949	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31360949G>A	uc002rnr.2	-	1	623	c.4C>T	c.(4-6)CGG>TGG	p.R2W	GALNT14_uc002rns.2_Missense_Mutation_p.R2W|GALNT14_uc010ymr.1_5'UTR|GALNT14_uc010ezo.1_Missense_Mutation_p.R2W|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14	2	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GTCAGGCGCCGCATGGTCCCC	0.682																0.056604	-4.618001	6.327918	3	50	KEEP	---	---	---	---	3	1	23	35	-1	capture	Missense_Mutation	SNP	31360949	31360949	GALNT14	2	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	6152	169
ZAK	51776	broad.mit.edu	37	2	174104210	174104210	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174104210G>A	uc002uhz.2	+	16	1545	c.1345G>A	c.(1345-1347)GGA>AGA	p.G449R	uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1	449					activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			CTTGAAACCAGGAACTGGCCC	0.398					532											0.315789	56.829413	58.549771	18	39	KEEP	---	---	---	---	8	11	20	24	-1	capture	Missense_Mutation	SNP	174104210	174104210	ZAK	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	17393	169
SEMG2	6407	broad.mit.edu	37	20	43851147	43851147	+	Missense_Mutation	SNP	C	T	T	rs140069155		TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43851147C>T	uc010ggz.2	+	2	931	c.874C>T	c.(874-876)CGT>TGT	p.R292C	SEMG2_uc002xnk.2_Missense_Mutation_p.R292C|SEMG2_uc002xnl.2_Missense_Mutation_p.R292C	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	292	Repeat-rich region.|4 X 60 AA tandem repeats, type I.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				CCCGTCTTCACGTACAGAAGA	0.393																0.197674	37.126363	44.446138	17	69	KEEP	---	---	---	---	14	5	32	39	-1	capture	Missense_Mutation	SNP	43851147	43851147	SEMG2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13938	169
LMCD1	29995	broad.mit.edu	37	3	8574487	8574487	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:8574487C>T	uc003bqq.2	+	2	221	c.107C>T	c.(106-108)TCG>TTG	p.S36L	LMCD1_uc011atd.1_Intron|LMCD1_uc011ate.1_Silent_p.F9F	NM_014583	NP_055398	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	36	Cys-rich.				positive regulation of calcineurin-NFAT signaling pathway|regulation of cardiac muscle hypertrophy|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	transcription corepressor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(96;0.124)		GGGACGTGTTCGGGCTTCGAG	0.537																0.242268	107.770916	119.50518	47	147	KEEP	---	---	---	---	30	23	93	77	-1	capture	Missense_Mutation	SNP	8574487	8574487	LMCD1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8764	169
TLR9	54106	broad.mit.edu	37	3	52257538	52257538	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52257538C>A	uc003dda.1	-	2	1428	c.794G>T	c.(793-795)TGC>TTC	p.C265F	TLR9_uc003ddb.2_Missense_Mutation_p.C362F	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	265	LRR 8.|Extracellular (Potential).				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)	GCACTCCATGCAGGGGTTGGG	0.617					82											0.066667	-1.911856	6.846818	3	42	KEEP	---	---	---	---	3	1	21	25	0.25	capture	Missense_Mutation	SNP	52257538	52257538	TLR9	3	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	15843	169
SR140	23350	broad.mit.edu	37	3	142773820	142773820	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142773820G>A	uc003evh.1	+	27	2909	c.2810G>A	c.(2809-2811)CGC>CAC	p.R937H	SR140_uc003evi.1_Missense_Mutation_p.R528H|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Missense_Mutation_p.R936H	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	937	Arg/Ser-rich.				RNA processing	nucleus	nucleotide binding|RNA binding				0						AGCCCATCTCGCAGTAGCAGT	0.478	Colon(87;897 1320 15089 19747 35974)															0.235294	9.893438	10.981391	4	13	KEEP	---	---	---	---	3	1	7	9	-1	capture	Missense_Mutation	SNP	142773820	142773820	SR140	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15023	169
PIK3CA	5290	broad.mit.edu	37	3	178921548	178921548	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178921548G>A	uc003fjk.2	+	5	1187	c.1030G>A	c.(1030-1032)GTG>ATG	p.V344M		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	344					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.V344A(1)|p.V344G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGCAACCTACGTGAATGTAAA	0.308	Colon(199;1504 1750 3362 26421 31210 32040)		57	p.V344M(SKMES1-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.236364	63.090608	70.082835	26	84	KEEP	---	---	---	---	18	15	39	57	-1	capture	Missense_Mutation	SNP	178921548	178921548	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11816	169
PCDHA6	56142	broad.mit.edu	37	5	140209539	140209539	+	Silent	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140209539G>A	uc003lho.2	+	1	1890	c.1863G>A	c.(1861-1863)CCG>CCA	p.P621P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.P621P	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	621	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGCTTCCCGTTTCGCGTGG	0.657																0.28866	72.871148	76.74934	28	69	KEEP	---	---	---	---	11	20	27	54	-1	capture	Silent	SNP	140209539	140209539	PCDHA6	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11431	169
SH3RF2	153769	broad.mit.edu	37	5	145439569	145439569	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145439569G>A	uc003lnt.2	+	9	1934	c.1696G>A	c.(1696-1698)GTG>ATG	p.V566M	SH3RF2_uc011dbl.1_Missense_Mutation_p.V566M|SH3RF2_uc011dbm.1_Missense_Mutation_p.V51M|SH3RF2_uc003lnu.2_Missense_Mutation_p.V57M|SH3RF2_uc011dbn.1_Missense_Mutation_p.V57M|SH3RF2_uc011dbo.1_Missense_Mutation_p.V23M	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	566							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCTCAGCCGTGGTGGTGGA	0.672																0.368932	110.526773	112.080441	38	65	KEEP	---	---	---	---	19	23	33	44	-1	capture	Missense_Mutation	SNP	145439569	145439569	SH3RF2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14152	169
RIMS1	22999	broad.mit.edu	37	6	72957754	72957754	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:72957754C>A	uc003pga.2	+	12	2242	c.2165C>A	c.(2164-2166)CCT>CAT	p.P722H	RIMS1_uc011dyb.1_Missense_Mutation_p.P348H|RIMS1_uc003pgc.2_Missense_Mutation_p.P348H|RIMS1_uc010kaq.2_Missense_Mutation_p.P196H|RIMS1_uc011dyc.1_Missense_Mutation_p.P196H|RIMS1_uc010kar.2_Missense_Mutation_p.P115H|RIMS1_uc011dyd.1_Missense_Mutation_p.P181H|RIMS1_uc003pgf.2_5'Flank|RIMS1_uc003pgg.2_5'Flank|RIMS1_uc003pgi.2_5'Flank|RIMS1_uc003pgh.2_5'Flank|RIMS1_uc003pgd.2_5'Flank|RIMS1_uc003pge.2_5'Flank|RIMS1_uc003pgb.3_Missense_Mutation_p.P348H|RIMS1_uc010kas.1_Missense_Mutation_p.P181H	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	722					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ATGGAAAGGCCTTCCATTTCT	0.333																0.147727	22.23152	32.707109	13	75	KEEP	---	---	---	---	6	8	45	46	0.571428571429	capture	Missense_Mutation	SNP	72957754	72957754	RIMS1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	13259	169
DENND2A	27147	broad.mit.edu	37	7	140301861	140301861	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140301861C>T	uc010lnj.2	-	1	482	c.337G>A	c.(337-339)GGA>AGA	p.G113R	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.G113R|DENND2A_uc003vvw.2_Missense_Mutation_p.G113R|DENND2A_uc003vvx.2_Missense_Mutation_p.G113R	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	113										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					TTCACTGCTCCTTTATTCCTC	0.587																0.25498	183.099462	196.757519	64	187	KEEP	---	---	---	---	29	42	101	112	-1	capture	Missense_Mutation	SNP	140301861	140301861	DENND2A	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	4387	169
CXorf66	347487	broad.mit.edu	37	X	139038184	139038184	+	Silent	SNP	T	C	C			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:139038184T>C	uc004fbb.2	-	3	979	c.957A>G	c.(955-957)GCA>GCG	p.A319A		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	319	Cytoplasmic (Potential).					integral to membrane					0						GATCACCGTATGCATTGTTCC	0.383																0.41844	191.907843	192.724617	59	82	KEEP	---	---	---	---	30	40	45	49	-1	capture	Silent	SNP	139038184	139038184	CXorf66	23	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	4078	169
UBE2NL	389898	broad.mit.edu	37	X	142967295	142967295	+	Silent	SNP	C	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142967295C>T	uc004fca.2	+	1	123	c.93C>T	c.(91-93)AAC>AAT	p.N31N		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	31							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					ATGAAAGCAACGCCCGTTATT	0.493																0.381579	164.283122	166.161938	58	94	KEEP	---	---	---	---	21	44	48	57	-1	capture	Silent	SNP	142967295	142967295	UBE2NL	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16749	169
RERE	473	broad.mit.edu	37	1	8424241	8424242	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8424241_8424242insT	uc001ape.2	-	16	2424_2425	c.1614_1615insA	c.(1612-1617)AAATACfs	p.K538fs	RERE_uc001apf.2_Frame_Shift_Ins_p.K538fs|RERE_uc010nzx.1_Frame_Shift_Ins_p.K270fs|RERE_uc001apd.2_5'UTR	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	538_539					multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		AGCTCACCGTATTTCTTGAAGT	0.569																0.40			48	73		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	8424241	8424242	RERE	1	-	T	T	T	1	0	1	1	0	0	0	0	0	208	16	5	5	13126	169
SCYL3	57147	broad.mit.edu	37	1	169833511	169833511	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169833511delT	uc001ggs.2	-	9	1152	c.954delA	c.(952-954)AAAfs	p.K318fs	SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Frame_Shift_Del_p.K318fs|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	318	HEAT 2.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGCATTCACCTTTTTTGGGGC	0.393					1996											0.03			7	226		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	169833511	169833511	SCYL3	1	T	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	13842	169
FOXG1	2290	broad.mit.edu	37	14	29236624	29236626	+	In_Frame_Del	DEL	CAC	-	-			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:29236624_29236626delCAC	uc001wqe.2	+	1	338_340	c.139_141delCAC	c.(139-141)CACdel	p.H57del		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	57	His-rich.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		ccacccccagcaccaccaccacc	0.241																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	29236624	29236626	FOXG1	14	CAC	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	5951	169
RBBP6	5930	broad.mit.edu	37	16	24581255	24581256	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24581255_24581256insA	uc002dmh.2	+	17	4284_4285	c.3244_3245insA	c.(3244-3246)GAAfs	p.E1082fs	RBBP6_uc010vcb.1_Frame_Shift_Ins_p.E949fs|RBBP6_uc002dmi.2_Frame_Shift_Ins_p.E1048fs|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Frame_Shift_Ins_p.E915fs	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1082	Interaction with RB1 (By similarity).				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		TCAGAAGGATGAAAAAATCACT	0.406																0.23			11	36		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	24581255	24581256	RBBP6	16	-	A	A	A	1	0	1	1	0	0	0	0	0	585	45	5	5	12998	169
CDH19	28513	broad.mit.edu	37	18	64178924	64178925	+	Splice_Site	INS	-	A	A			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:64178924_64178925insA	uc002lkc.1	-	10	1597	c.1459_splice	c.e10-1	p.V487_splice	CDH19_uc010dql.1_Splice_Site|CDH19_uc010xey.1_Intron	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				CTGAATTACCTAAAAAAAAAGG	0.317																0.06			9	137		---	---	---	---						capture_indel	Splice_Site	INS	64178924	64178925	CDH19	18	-	A	A	A	1	0	1	1	0	0	0	1	0	689	53	5	5	3075	169
PIK3R1	5295	broad.mit.edu	37	5	67591152	67591152	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591152delT	uc003jva.2	+	13	2305	c.1745delT	c.(1744-1746)ATGfs	p.M582fs	PIK3R1_uc003jvb.2_Frame_Shift_Del_p.M582fs|PIK3R1_uc003jvc.2_Frame_Shift_Del_p.M282fs|PIK3R1_uc003jvd.2_Frame_Shift_Del_p.M312fs|PIK3R1_uc003jve.2_Frame_Shift_Del_p.M261fs|PIK3R1_uc011crb.1_Frame_Shift_Del_p.M252fs	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	582					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.M582_D605>I(4)|p.R577_M582>K(1)|p.Y580fs*1(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CAATACTTGATGTAAGTATTT	0.373					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.22			24	87		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	67591152	67591152	PIK3R1	5	T	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	11821	169
AFF4	27125	broad.mit.edu	37	5	132227876	132227877	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:132227876_132227877insG	uc003kyd.2	-	13	3024_3025	c.2616_2617insC	c.(2614-2619)TCCAGTfs	p.S872fs	AFF4_uc011cxk.1_Frame_Shift_Ins_p.S550fs|AFF4_uc003kye.1_Frame_Shift_Ins_p.S872fs	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31	872_873	Ser-rich.				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGGAGCTACTGGAAGTCTTCC	0.470	Ovarian(126;889 1733 2942 10745 11605)				374											0.23			26	86		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	132227876	132227877	AFF4	5	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	359	169
OR13C5	138799	broad.mit.edu	37	9	107361451	107361452	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-19-5947-01	TCGA-19-5947-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107361451_107361452delGC	uc011lvp.1	-	1	243_244	c.243_244delGC	c.(241-246)ACGCTAfs	p.T81fs		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	81_82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						AAGCTCACTAGCGTGGAGGGAA	0.510																0.17			8	38		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	107361451	107361452	OR13C5	9	GC	-	-	-	1	0	1	0	1	0	0	0	0	438	34	5	5	10841	169
