Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AADACL4	343066	broad.mit.edu	37	1	12726619	12726619	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12726619G>C	uc001auf.2	+	4	1097	c.1097G>C	c.(1096-1098)CGC>CCC	p.R366P		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	366	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CAGGGGGTCCGCGTGACATGG	0.488													17	268	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22921715	22921715	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22921715C>A	uc001bfx.1	+							NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCTGGCTTTCCCCTGCAGGGC	0.652													15	35	---	---	---	---	PASS
CD164L2	388611	broad.mit.edu	37	1	27709155	27709155	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27709155T>A	uc001boc.2	-	2	167	c.91A>T	c.(91-93)AAA>TAA	p.K31*		NM_207397	NP_997280	Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	31	Extracellular (Potential).					integral to membrane					0		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CGAGCTCCTTTACCTGGTAGT	0.642													22	31	---	---	---	---	PASS
KHDRBS1	10657	broad.mit.edu	37	1	32504202	32504202	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32504202A>G	uc001bub.2	+	7	1263	c.1157A>G	c.(1156-1158)TAT>TGT	p.Y386C	KHDRBS1_uc001bua.1_Missense_Mutation_p.Y347C|KHDRBS1_uc001buc.1_RNA	NM_006559	NP_006550	Q07666	KHDR1_HUMAN	KH domain containing, RNA binding, signal	386					cell cycle arrest|cell proliferation|cell surface receptor linked signaling pathway|G2/M transition of mitotic cell cycle|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of RNA export from nucleus|transcription, DNA-dependent	membrane|nucleus	DNA binding|RNA binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TACGAAGGCTATTACAGCCAG	0.403													9	81	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	33987099	33987099	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33987099C>A	uc001bxn.1	-	67	10158	c.10129G>T	c.(10129-10131)GGC>TGC	p.G3377C	CSMD2_uc001bxm.1_Missense_Mutation_p.G3521C	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3377	Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AAGCCTTGGCCCTTGACAGAG	0.602													19	67	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34038220	34038220	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34038220T>A	uc001bxn.1	-	51	7683	c.7654A>T	c.(7654-7656)AAG>TAG	p.K2552*	CSMD2_uc001bxm.1_Nonsense_Mutation_p.K2550*	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2552	Extracellular (Potential).|Sushi 15.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TACATGGCCTTGGTTCCCACT	0.552													63	107	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34254260	34254260	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34254260C>A	uc001bxn.1	-	12	1513	c.1484G>T	c.(1483-1485)TGG>TTG	p.W495L	CSMD2_uc001bxm.1_Missense_Mutation_p.W535L	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	495	CUB 3.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAAGAGGAGCCACATTTGATG	0.517													6	86	---	---	---	---	PASS
C1orf94	84970	broad.mit.edu	37	1	34666588	34666588	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34666588C>A	uc001bxs.3	+	3	1054	c.655C>A	c.(655-657)CCG>ACG	p.P219T	C1orf94_uc001bxt.2_Missense_Mutation_p.P409T	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN	hypothetical protein LOC84970 isoform b	219							protein binding				0		Myeloproliferative disorder(586;0.0393)				AAGCGGGCAGCCGAGACTTCG	0.582													25	10	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37271862	37271862	+	Silent	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37271862C>G	uc001caz.2	-	14	2292	c.2157G>C	c.(2155-2157)GTG>GTC	p.V719V	GRIK3_uc001cba.1_Silent_p.V719V	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	719	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CGTTGTTCTTCACCAGCGCCG	0.597													5	139	---	---	---	---	PASS
ZNF642	339559	broad.mit.edu	37	1	40947448	40947448	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40947448G>C	uc001cfo.2	+	3	435	c.141G>C	c.(139-141)CAG>CAC	p.Q47H	ZNF642_uc009vwb.2_Missense_Mutation_p.Q47H|ZNF642_uc010ojk.1_Missense_Mutation_p.Q47H	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642	47					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)			TGCTGTCTCAGGATGCTGAGG	0.502													12	190	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51829589	51829589	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51829589C>A	uc001csq.1	-	23	2400	c.2308G>T	c.(2308-2310)GCA>TCA	p.A770S	EPS15_uc009vyz.1_Missense_Mutation_p.A636S|EPS15_uc001csp.3_Missense_Mutation_p.A456S	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	770	15 X 3 AA repeats of D-P-F.|Pro-rich.|SH3-binding.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						GGTGGCAGTGCTGGGGGTTCA	0.453			T	MLL	ALL								12	120	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53569103	53569103	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53569103C>A	uc001cuy.2	-	5	780	c.612G>T	c.(610-612)CCG>CCT	p.P204P		NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	204	Extracellular (Potential).					integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	CCTCGGGCGGCGGGGTCAGGT	0.627													8	12	---	---	---	---	PASS
C1orf83	127428	broad.mit.edu	37	1	54562010	54562010	+	Missense_Mutation	SNP	C	G	G	rs41294786	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54562010C>G	uc001cwt.1	+	5	691	c.491C>G	c.(490-492)TCC>TGC	p.S164C	C1orf83_uc001cwu.1_RNA	NM_153035	NP_694580	Q96MN5	TEAN2_HUMAN	hypothetical protein LOC127428	164	TFIIS central.				transcription, DNA-dependent	nucleus	DNA binding				0						CATCTCTGCTCCCGCCTCATT	0.488													9	178	---	---	---	---	PASS
ANGPTL3	27329	broad.mit.edu	37	1	63064458	63064458	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63064458T>A	uc001das.1	+	2	638	c.587T>A	c.(586-588)ATA>AAA	p.I196K	DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001daq.2_Intron|DOCK7_uc009wah.1_Intron	NM_014495	NP_055310	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3 precursor	196	Potential.				acylglycerol homeostasis|artery morphogenesis|cell-matrix adhesion|cholesterol homeostasis|cholesterol metabolic process|fatty acid metabolic process|glycerol metabolic process|integrin-mediated signaling pathway|lipid storage|negative regulation of lipoprotein lipase activity|negative regulation of phospholipase activity|phospholipid catabolic process|phospholipid homeostasis|positive regulation of angiogenesis|positive regulation of cell migration|positive regulation of lipid catabolic process|triglyceride homeostasis	extracellular space	cell surface binding|growth factor activity|integrin binding|phospholipase inhibitor activity				0						CATAGTCAAATAAAAGAAATA	0.318													9	81	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71477951	71477951	+	Intron	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71477951G>C	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_Intron|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Intron|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Intron|PTGER3_uc001dfq.2_Missense_Mutation_p.Q372E	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	TGCCCTTTCTGTCCATCATTA	0.403													44	103	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75693523	75693523	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75693523C>G	uc001dgu.2	-	13	1017	c.873G>C	c.(871-873)CAG>CAC	p.Q291H	SLC44A5_uc001dgt.2_Missense_Mutation_p.Q291H|SLC44A5_uc001dgs.2_Missense_Mutation_p.Q249H|SLC44A5_uc001dgr.2_Missense_Mutation_p.Q249H|SLC44A5_uc010oqz.1_Missense_Mutation_p.Q330H|SLC44A5_uc010ora.1_Missense_Mutation_p.Q285H|SLC44A5_uc010orb.1_Missense_Mutation_p.Q161H	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	291	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						TGGTGTACTGCTGGTAACAGT	0.338													26	55	---	---	---	---	PASS
AK5	26289	broad.mit.edu	37	1	77759531	77759531	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77759531A>G	uc001dhn.2	+	3	558	c.301A>G	c.(301-303)ATC>GTC	p.I101V	AK5_uc001dho.2_Missense_Mutation_p.I75V|AK5_uc001dhm.1_Intron	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1	101					ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						GCTCCCTCCAATCCATCAATT	0.408													3	74	---	---	---	---	PASS
NEXN	91624	broad.mit.edu	37	1	78392091	78392091	+	Intron	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78392091T>C	uc001dic.3	+						NEXN_uc001dia.3_Intron|NEXN_uc009wcb.1_Intron|NEXN_uc001dib.3_Intron|NEXN_uc001did.1_Intron|NEXN_uc001dif.1_Intron	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)						regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		ATCTATTTTATAAAATAGGAA	0.294													16	39	---	---	---	---	PASS
GNG5	2787	broad.mit.edu	37	1	84967627	84967627	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84967627T>A	uc001djw.3	-	3	462	c.108A>T	c.(106-108)AAA>AAT	p.K36N		NM_005274	NP_005265	P63218	GBG5_HUMAN	guanine nucleotide binding protein (G protein),	36					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0				all cancers(265;0.00634)|Epithelial(280;0.0175)|OV - Ovarian serous cystadenocarcinoma(397;0.159)		GACAGAACTGTTTCAAGTCTG	0.438													12	50	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86523622	86523622	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86523622C>T	uc001dlj.2	-	10	1885	c.1843G>A	c.(1843-1845)GGT>AGT	p.G615S	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.G615S	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	615					cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		ACTTGTGCACCTTTAGGACCT	0.338													15	66	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86529415	86529415	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86529415C>T	uc001dlj.2	-	8	1777	c.1735G>A	c.(1735-1737)GGA>AGA	p.G579R	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.G579R	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	579	Collagen-like 2.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CCTGGAAGTCCTGGGAGTCCA	0.388													11	193	---	---	---	---	PASS
STXBP3	6814	broad.mit.edu	37	1	109319046	109319046	+	Splice_Site	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109319046G>C	uc001dvy.2	+	8	759	c.684_splice	c.e8+1	p.K228_splice	STXBP3_uc001dvz.2_Splice_Site	NM_007269	NP_009200	O00186	STXB3_HUMAN	syntaxin binding protein 3						negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		CCTAATAAAGGTAATGTATGC	0.338													6	29	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111966324	111966324	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111966324G>T	uc001eba.2	-	5	380	c.324C>A	c.(322-324)ACC>ACA	p.T108T	OVGP1_uc001eaz.2_Silent_p.T70T|OVGP1_uc010owb.1_5'UTR|OVGP1_uc010owc.1_Silent_p.T98T	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	108					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		ACAACATAGTGGTGAATCTGT	0.463													9	91	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145563028	145563028	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145563028G>C	uc001eob.1	+	10	2824	c.2716G>C	c.(2716-2718)GAG>CAG	p.E906Q	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.E749Q	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	906	Potential.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CGAGCAGTTTGAGAAAACGGC	0.657													19	62	---	---	---	---	PASS
SETDB1	9869	broad.mit.edu	37	1	150936113	150936113	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150936113G>C	uc001evu.2	+	20	3755	c.3565G>C	c.(3565-3567)GAG>CAG	p.E1189Q	SETDB1_uc001evv.2_Missense_Mutation_p.E1189Q|SETDB1_uc009wmg.1_Missense_Mutation_p.E1189Q	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1189	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGACAAGGGGGAGAGCGCACC	0.498													44	436	---	---	---	---	PASS
LASS2	29956	broad.mit.edu	37	1	150940899	150940899	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150940899T>C	uc001evy.2	-	3	650	c.263A>G	c.(262-264)TAC>TGC	p.Y88C	LASS2_uc001evz.2_Missense_Mutation_p.Y88C|LASS2_uc009wmh.2_5'UTR	NM_181746	NP_859530	Q96G23	CERS2_HUMAN	LAG1 longevity assurance 2	88	Cytoplasmic (Potential).|Homeobox.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0	all_lung(15;8.07e-35)|Lung NSC(24;7.93e-31)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACTGGTCAGGTAGAAATGTTC	0.567													19	59	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152127228	152127228	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152127228G>T	uc001ezs.1	-	3	2412	c.2347C>A	c.(2347-2349)CAG>AAG	p.Q783K		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	783	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						TCTCATCTCTGATGGTTCTGC	0.458													200	703	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152192255	152192255	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152192255G>A	uc001ezt.1	-	3	1926	c.1850C>T	c.(1849-1851)TCA>TTA	p.S617L		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	617	6.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACTGTCCTGATGTAGAACC	0.552													157	448	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152328470	152328470	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152328470A>T	uc001ezw.3	-	3	1865	c.1792T>A	c.(1792-1794)TCT>ACT	p.S598T	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	598	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGAGCCAGACCCATGTTGT	0.512													159	489	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154316387	154316387	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154316387C>T	uc001fex.2	+	18	1876	c.1876C>T	c.(1876-1878)CTG>TTG	p.L626L		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	612	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGGGGAAGGGCTGAGGACCCT	0.463													30	89	---	---	---	---	PASS
RHBG	57127	broad.mit.edu	37	1	156352620	156352620	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156352620T>C	uc010pho.1	+	8	1232	c.1194T>C	c.(1192-1194)TTT>TTC	p.F398F	RHBG_uc010phm.1_3'UTR|RHBG_uc010phn.1_RNA|RHBG_uc001fos.2_Silent_p.F329F|RHBG_uc009wrz.2_Silent_p.F366F|RHBG_uc001for.2_Silent_p.F368F	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein	398	Helical; (Potential).				transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					TCGGGCTGTTTGTCACACTGA	0.562											OREG0013870	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	48	171	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158389791	158389791	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158389791A>G	uc010pii.1	-	1	866	c.866T>C	c.(865-867)ATT>ACT	p.I289T		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	289	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					CAAGCTATAAATCATTGGGTT	0.323													38	128	---	---	---	---	PASS
OR6Y1	391112	broad.mit.edu	37	1	158517456	158517456	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158517456C>G	uc010pil.1	-	1	440	c.440G>C	c.(439-441)GGC>GCC	p.G147A		NM_001005189	NP_001005189	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					AGCCAGTGTGCCACAGAGCTG	0.473													17	68	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158617474	158617474	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158617474C>T	uc001fst.1	-	27	3950	c.3751G>A	c.(3751-3753)GAG>AAG	p.E1251K		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1251	Spectrin 12.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGATGGGACTCACTGAGCCGC	0.532													26	100	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158653176	158653176	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158653176G>T	uc001fst.1	-	3	574	c.375C>A	c.(373-375)GCC>GCA	p.A125A		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	125	Spectrin 2.			Missing (in Ref. 3; AAA60575).	actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TTTCTTCGTGGGCAGAATGAC	0.378													75	222	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908901	158908901	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908901G>C	uc001ftb.2	+	4	688	c.443G>C	c.(442-444)GGA>GCA	p.G148A	PYHIN1_uc001fta.3_Missense_Mutation_p.G148A|PYHIN1_uc001ftc.2_Missense_Mutation_p.G139A|PYHIN1_uc001ftd.2_Missense_Mutation_p.G148A|PYHIN1_uc001fte.2_Missense_Mutation_p.G139A	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	148					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GAAGAGACTGGAACCAAAAGG	0.453													35	81	---	---	---	---	PASS
OR10J3	441911	broad.mit.edu	37	1	159283906	159283906	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159283906C>A	uc010piu.1	-	1	544	c.544G>T	c.(544-546)GTG>TTG	p.V182L		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					AGGTGTCTCACATCACAGAAG	0.498													23	98	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160769666	160769666	+	Missense_Mutation	SNP	C	A	A	rs147015580	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160769666C>A	uc001fwu.2	+	2	298	c.248C>A	c.(247-249)CCC>CAC	p.P83H	LY9_uc001fwt.2_Missense_Mutation_p.P83H|LY9_uc010pjs.1_Missense_Mutation_p.P83H|LY9_uc001fwv.2_Missense_Mutation_p.P83H|LY9_uc001fww.2_Missense_Mutation_p.P83H|LY9_uc001fwx.2_Missense_Mutation_p.P83H|LY9_uc001fwy.1_5'UTR	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	83	Extracellular (Potential).|Ig-like V-type 1.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TGGATTGGTCCCAAAAATGCT	0.498													28	144	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165380292	165380292	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165380292C>T	uc001gda.2	-	5	977	c.677G>A	c.(676-678)TGT>TAT	p.C226Y		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	226	Hinge.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	ACTGGTAGCACATTCTGCCTC	0.493													27	112	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097814	167097814	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097814G>T	uc001geb.1	+	5	3446	c.3446G>T	c.(3445-3447)AGG>ATG	p.R1149M		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1149					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						GAAGAAACCAGGACCAAGCTG	0.542													17	52	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170959017	170959017	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170959017A>C	uc001ghg.2	+	11	1031	c.901A>C	c.(901-903)ATT>CTT	p.I301L	C1orf129_uc009wvy.2_Missense_Mutation_p.I108L|C1orf129_uc010plz.1_Missense_Mutation_p.I301L	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	301							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CGTGGATGCTATTTACAGGCA	0.403													56	231	---	---	---	---	PASS
SERPINC1	462	broad.mit.edu	37	1	173883815	173883815	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173883815T>C	uc001gjt.2	-	2	403	c.284A>G	c.(283-285)TAT>TGT	p.Y95C		NM_000488	NP_000479	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C, member 1	95			Y -> S (in AT3D; type-I).|Y -> C (in AT3D; type-I).		blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(1)	1					Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)	CAGGTGCTGATAGAAAGTGGT	0.517											OREG0013990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	94	271	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175092565	175092565	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175092565G>A	uc001gkl.1	+	12	2793	c.2680G>A	c.(2680-2682)GAC>AAC	p.D894N		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	894	Fibronectin type-III 8.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CCTAGTGACTGACTGGGTGAC	0.483													28	103	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175335049	175335049	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175335049C>G	uc001gkp.1	-	9	2360	c.2279G>C	c.(2278-2280)CGG>CCG	p.R760P	TNR_uc009wwu.1_Missense_Mutation_p.R760P	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	760	Fibronectin type-III 5.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					GCTCTGCTGCCGACCCCTCTC	0.532													54	133	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176668231	176668231	+	Intron	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176668231C>T	uc001gkz.2	+						PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CTAATCTCCCCCCAGGGCCTC	0.522													25	146	---	---	---	---	PASS
C1orf220	400798	broad.mit.edu	37	1	178514779	178514779	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178514779G>T	uc001glx.1	+	2	522	c.165G>T	c.(163-165)TGG>TGT	p.W55C	C1orf49_uc001glv.1_Intron	NM_207467	NP_997350			hypothetical protein LOC400798												0						CAAGTGAGTGGGCCACGAAGG	0.498													34	88	---	---	---	---	PASS
LHX4	89884	broad.mit.edu	37	1	180235536	180235536	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180235536C>A	uc001goe.1	+	3	481	c.258C>A	c.(256-258)GGC>GGA	p.G86G		NM_033343	NP_203129	Q969G2	LHX4_HUMAN	LIM homeobox protein 4	86	LIM zinc-binding 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						GGCGCTTCGGCACAAAATGCA	0.607													38	126	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186277377	186277377	+	Silent	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277377T>A	uc001gru.3	+	7	2577	c.2526T>A	c.(2524-2526)CCT>CCA	p.P842P	PRG4_uc001grt.3_Silent_p.P801P|PRG4_uc009wyl.2_Silent_p.P749P|PRG4_uc009wym.2_Silent_p.P708P|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	842	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|58.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CCAAGAAGCCTGCTCCAACTA	0.552													107	401	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190250753	190250753	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190250753G>T	uc001gse.1	-	3	596	c.364C>A	c.(364-366)CAA>AAA	p.Q122K	FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	122						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TCTGTGATTTGCTGAAGGGTA	0.463													39	160	---	---	---	---	PASS
FAM58B	339521	broad.mit.edu	37	1	200183141	200183141	+	Silent	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200183141C>G	uc009wzi.1	+	1	486	c.450C>G	c.(448-450)CTC>CTG	p.L150L		NM_001105517	NP_001098987	P0C7Q3	FA58B_HUMAN	family with sequence similarity 58 member B	150					regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	Prostate(682;0.19)					AGTACCTGCTCTACTACCTGG	0.612													43	101	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201839870	201839870	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201839870C>T	uc001gwz.2	+	18	2343	c.2293C>T	c.(2293-2295)CGC>TGC	p.R765C		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	765					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						CTTTGTGGGCCGCCTTGTTTC	0.582													39	137	---	---	---	---	PASS
KLHL12	59349	broad.mit.edu	37	1	202888999	202888999	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202888999C>G	uc001gyo.1	-	3	433	c.233G>C	c.(232-234)GGT>GCT	p.G78A	KLHL12_uc001gyn.1_5'Flank|KLHL12_uc010pqc.1_Missense_Mutation_p.G116A|KLHL12_uc009xah.1_Missense_Mutation_p.G78A	NM_021633	NP_067646	Q53G59	KLH12_HUMAN	kelch-like 12	78	BTB.				Wnt receptor signaling pathway		protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			GGCAGTCAAACCTTGGATGTC	0.393													25	99	---	---	---	---	PASS
CDK18	5129	broad.mit.edu	37	1	205495906	205495906	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205495906A>T	uc001hcr.2	+	8	979	c.760A>T	c.(760-762)AGT>TGT	p.S254C	CDK18_uc010pri.1_3'UTR|CDK18_uc001hcp.2_Missense_Mutation_p.S224C|CDK18_uc001hcq.2_Missense_Mutation_p.S224C|CDK18_uc010prj.1_Missense_Mutation_p.S135C|CDK18_uc001hcs.2_Missense_Mutation_p.S135C|CDK18_uc009xbm.1_Missense_Mutation_p.S149C|CDK18_uc001hct.2_5'Flank	NM_212503	NP_997668	Q07002	CDK18_HUMAN	PCTAIRE protein kinase 3 isoform a	222	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|protein binding|signal transducer activity			stomach(2)	2						GTTCCAGGACAGTGACCTGAA	0.632													73	259	---	---	---	---	PASS
SLC45A3	85414	broad.mit.edu	37	1	205632558	205632558	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205632558C>G	uc001hda.1	-	3	700	c.361G>C	c.(361-363)GAG>CAG	p.E121Q	SLC45A3_uc010prn.1_5'Flank|SLC45A3_uc010pro.1_5'UTR|SLC45A3_uc010prp.1_Intron|ELK4_uc010prq.1_Intron	NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	121	Helical; Name=4; (Potential).				transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			AGTGCCAGCTCCAGGGGCCTG	0.652			T	ETV1|ETV5|ELK4|ERG	prostate 								15	25	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222716923	222716923	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222716923C>T	uc001hnh.1	-	2	988	c.930G>A	c.(928-930)AAG>AAA	p.K310K		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	310					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		CCCGAGAAACCTTCATCTCAC	0.443													20	785	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232561495	232561495	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232561495C>G	uc001hvg.2	-	16	4628	c.4470G>C	c.(4468-4470)GAG>GAC	p.E1490D	SIPA1L2_uc001hvf.2_Missense_Mutation_p.E564D	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1490					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGCAGATGCTCTCGTCAGACA	0.552													6	92	---	---	---	---	PASS
KIAA1383	54627	broad.mit.edu	37	1	232942722	232942722	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232942722G>T	uc001hvh.2	+	1	2085	c.1953G>T	c.(1951-1953)CTG>CTT	p.L651L		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	509										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)				GTTTAAAGCTGACAAATCCTG	0.353													11	53	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237494253	237494253	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237494253C>A	uc001hyl.1	+	3	364	c.244C>A	c.(244-246)CTG>ATG	p.L82M		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	82	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCAGGAGATGCTGGCTAACAC	0.493													28	125	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237608766	237608766	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237608766A>T	uc001hyl.1	+	14	1356	c.1236A>T	c.(1234-1236)GAA>GAT	p.E412D		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	412	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCATGAAGAATCACGCACAG	0.403													30	147	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238045744	238045744	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238045744C>G	uc001hym.2	-	12	1601	c.1601G>C	c.(1600-1602)TGC>TCC	p.C534S	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	534	Cytoplasmic (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TTGGTCTGGGCAACTCTTCTG	0.443													64	221	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247588146	247588146	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247588146G>C	uc001icr.2	+	5	1539	c.1401G>C	c.(1399-1401)TGG>TGC	p.W467C	NLRP3_uc001ics.2_Missense_Mutation_p.W467C|NLRP3_uc001icu.2_Missense_Mutation_p.W467C|NLRP3_uc001icw.2_Missense_Mutation_p.W467C|NLRP3_uc001icv.2_Missense_Mutation_p.W467C|NLRP3_uc010pyw.1_Missense_Mutation_p.W465C|NLRP3_uc001ict.1_Missense_Mutation_p.W465C	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	467	NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CCCACCTCTGGGGGCTCTGCT	0.587													16	68	---	---	---	---	PASS
OR1C1	26188	broad.mit.edu	37	1	247920935	247920935	+	Silent	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247920935G>C	uc010pza.1	-	1	774	c.774C>G	c.(772-774)GTC>GTG	p.V258V		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GGCTGAAATAGACGGCGATGG	0.517													17	82	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248550957	248550957	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248550957G>T	uc001iei.1	+	1	48	c.48G>T	c.(46-48)GGG>GGT	p.G16G		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTCATGGGGCTCTTCACTC	0.423													11	131	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551209	248551209	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551209G>T	uc001iei.1	+	1	300	c.300G>T	c.(298-300)CAG>CAT	p.Q100H		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCACTGCTCAGTGCTTTCTCT	0.532													39	92	---	---	---	---	PASS
OR2T34	127068	broad.mit.edu	37	1	248737471	248737471	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248737471G>C	uc001iep.1	-	1	588	c.588C>G	c.(586-588)GAC>GAG	p.D196E		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAGGGAGACGTCAGAGCAGG	0.517													65	524	---	---	---	---	PASS
SMC6	79677	broad.mit.edu	37	2	17902509	17902509	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17902509C>A	uc002rco.2	-	10	1042	c.746G>T	c.(745-747)CGC>CTC	p.R249L	SMC6_uc010exo.2_Missense_Mutation_p.R249L|SMC6_uc002rcn.2_Missense_Mutation_p.R249L|SMC6_uc002rcp.1_Missense_Mutation_p.R275L|SMC6_uc002rcq.2_Missense_Mutation_p.R275L|SMC6_uc002rcr.1_Missense_Mutation_p.R249L	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein	249	Potential.				DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TACACACTGGCGCTTTAGTTC	0.328													11	130	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21246424	21246424	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21246424C>G	uc002red.2	-	17	2705	c.2577G>C	c.(2575-2577)AAG>AAC	p.K859N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	859					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TTACTCCAGCCTTGGCTCCGG	0.413													22	183	---	---	---	---	PASS
DPYSL5	56896	broad.mit.edu	37	2	27156171	27156171	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27156171G>C	uc002rhu.3	+	7	918	c.760G>C	c.(760-762)GGT>CGT	p.G254R	DPYSL5_uc002rhv.3_Missense_Mutation_p.G254R	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	254					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATCTCGGCTGGTGACGTTAT	0.517													14	147	---	---	---	---	PASS
MPV17	4358	broad.mit.edu	37	2	27545374	27545374	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27545374C>A	uc002rjr.2	-	1	58	c.11G>T	c.(10-12)TGG>TTG	p.W4L	MPV17_uc002rjq.2_Missense_Mutation_p.W4L|MPV17_uc002rjs.2_Missense_Mutation_p.W4L|MPV17_uc002rjt.2_Intron	NM_002437	NP_002428	P39210	MPV17_HUMAN	Mpv17 protein	4					cellular response to reactive oxygen species|glomerular basement membrane development|homeostatic process|inner ear development|mitochondrial genome maintenance|regulation of reactive oxygen species metabolic process	integral to peroxisomal membrane|mitochondrial inner membrane					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTATGCCCGCCAGAGTGCCAT	0.627													14	136	---	---	---	---	PASS
GTF3C2	2976	broad.mit.edu	37	2	27565913	27565913	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27565913G>T	uc002rjv.1	-	4	712	c.349C>A	c.(349-351)CCT>ACT	p.P117T	GTF3C2_uc002rju.1_Missense_Mutation_p.P128T|GTF3C2_uc002rjw.1_Missense_Mutation_p.P117T|GTF3C2_uc010eyz.1_Missense_Mutation_p.P117T	NM_001521	NP_001512	Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide	117						transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGGATTAGGCTGTTGGGGC	0.537													36	200	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27799431	27799431	+	5'UTR	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27799431G>A	uc002rkz.3	+	1						NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226											large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CTTTCAAGATGTAAAACCTAT	0.438													36	47	---	---	---	---	PASS
SUPT7L	9913	broad.mit.edu	37	2	27884013	27884013	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27884013T>C	uc002rlh.1	-	3	600	c.257A>G	c.(256-258)CAG>CGG	p.Q86R	SUPT7L_uc002rli.1_Missense_Mutation_p.Q86R|SUPT7L_uc010ymf.1_Intron|SUPT7L_uc002rlj.1_Missense_Mutation_p.Q84R|SUPT7L_uc010ezh.1_Missense_Mutation_p.Q84R|SLC4A1AP_uc002rlk.3_5'Flank	NM_014860	NP_055675	O94864	ST65G_HUMAN	SPTF-associated factor 65 gamma	86					histone H3 acetylation|maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CTGCTGATTCTGGGCCTGAGC	0.522													13	140	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32774500	32774500	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32774500C>G	uc010ezu.2	+	65	13230	c.13096C>G	c.(13096-13098)CAG>GAG	p.Q4366E		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4366					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GCTTCTCAGTCAGTCCTGCCT	0.433													8	157	---	---	---	---	PASS
PRKD3	23683	broad.mit.edu	37	2	37543626	37543626	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37543626T>C	uc002rqd.2	-	1	597	c.42A>G	c.(40-42)GTA>GTG	p.V14V	PRKD3_uc002rqf.1_Silent_p.V14V	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	14					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				CTGTGGGTAATACAGACTTCT	0.448													30	185	---	---	---	---	PASS
COX7A2L	9167	broad.mit.edu	37	2	42588252	42588252	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42588252G>T	uc002rsk.2	-	1	105	c.50C>A	c.(49-51)GCT>GAT	p.A17D	COX7A2L_uc002rsl.2_RNA	NM_004718	NP_004709	O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2	17					respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0						GGCCTCCGAAGCCCATGCTCC	0.647													4	41	---	---	---	---	PASS
FBXO11	80204	broad.mit.edu	37	2	48066854	48066854	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48066854T>C	uc010fbl.2	-	2	149	c.35A>G	c.(34-36)AAT>AGT	p.N12S	FBXO11_uc002rwe.2_Missense_Mutation_p.N12S|FBXO11_uc002rwf.2_Missense_Mutation_p.N12S|FBXO11_uc002rwg.1_Missense_Mutation_p.N12S	NM_025133	NP_079409	Q86XK2	FBX11_HUMAN	F-box only protein 11 isoform 1	96					ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTATGGACTATTTTGTGCACC	0.363													38	200	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48925804	48925804	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48925804C>A	uc002rwu.3	-	9	886	c.816G>T	c.(814-816)ACG>ACT	p.T272T	GTF2A1L_uc002rwt.2_Intron|LHCGR_uc002rwv.2_RNA	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	272	Extracellular (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GGTAAGTCAACGTGGCCTCCA	0.438									Familial_Male-Limited_Precocious_Puberty				61	113	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56420411	56420411	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56420411C>G	uc002rzn.2	+	2	1578	c.1076C>G	c.(1075-1077)CCG>CGG	p.P359R		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	359	His-rich.									breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGCACCAGCCCGGAGCACCTC	0.637													15	47	---	---	---	---	PASS
APLF	200558	broad.mit.edu	37	2	68794484	68794484	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68794484A>T	uc002sep.2	+	9	1471	c.1298A>T	c.(1297-1299)CAG>CTG	p.Q433L	APLF_uc002seq.1_RNA|APLF_uc002ser.1_Missense_Mutation_p.Q164L	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	433	PBZ-type 2.				double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						AAGAATCCCCAGCACAAGATA	0.313													21	81	---	---	---	---	PASS
CD207	50489	broad.mit.edu	37	2	71060794	71060794	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71060794T>C	uc002shg.2	-	3	595	c.548A>G	c.(547-549)AAG>AGG	p.K183R		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	183	Potential.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						TTTGAGCAACTTGCTCATATT	0.463													17	47	---	---	---	---	PASS
CD207	50489	broad.mit.edu	37	2	71061107	71061107	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71061107G>C	uc002shg.2	-	3	282	c.235C>G	c.(235-237)CAG>GAG	p.Q79E		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	79	Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						TTCAGCAACTGGACATTGGTC	0.512													9	47	---	---	---	---	PASS
VAX2	25806	broad.mit.edu	37	2	71148347	71148347	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71148347C>A	uc002shh.2	+	2	399	c.367C>A	c.(367-369)CGC>AGC	p.R123S		NM_012476	NP_036608	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	123	Homeobox.				ectoderm development|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGAGTTCCAGCGCTGCCAGTA	0.637													13	53	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71591167	71591167	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71591167C>T	uc002shx.2	+	5	1821	c.1502C>T	c.(1501-1503)TCA>TTA	p.S501L	ZNF638_uc010fec.2_Missense_Mutation_p.S607L|ZNF638_uc010yqw.1_Missense_Mutation_p.S80L|ZNF638_uc002shw.2_Missense_Mutation_p.S501L|ZNF638_uc002shy.2_Missense_Mutation_p.S501L|ZNF638_uc002shz.2_Missense_Mutation_p.S501L|ZNF638_uc002sia.2_Missense_Mutation_p.S501L|ZNF638_uc002sib.1_Missense_Mutation_p.S501L|ZNF638_uc010fed.2_5'Flank	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	501	Arg-rich.				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						AGATCAAGCTCAAGTCACAGA	0.463													18	175	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71839822	71839822	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71839822G>T	uc002sie.2	+	39	4595	c.4219G>T	c.(4219-4221)GAT>TAT	p.D1407Y	DYSF_uc010feg.2_Missense_Mutation_p.D1438Y|DYSF_uc010feh.2_Missense_Mutation_p.D1393Y|DYSF_uc002sig.3_Missense_Mutation_p.D1393Y|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.D1407Y|DYSF_uc010fef.2_Missense_Mutation_p.D1424Y|DYSF_uc010fei.2_Missense_Mutation_p.D1424Y|DYSF_uc010fek.2_Missense_Mutation_p.D1425Y|DYSF_uc010fej.2_Missense_Mutation_p.D1394Y|DYSF_uc010fel.2_Missense_Mutation_p.D1394Y|DYSF_uc010feo.2_Missense_Mutation_p.D1439Y|DYSF_uc010fem.2_Missense_Mutation_p.D1408Y|DYSF_uc010fen.2_Missense_Mutation_p.D1425Y|DYSF_uc002sif.2_Missense_Mutation_p.D1408Y|DYSF_uc010yqy.1_Missense_Mutation_p.D288Y|DYSF_uc010yqz.1_Missense_Mutation_p.D147Y	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1407	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CAAGGTCATCGATAACCGCCA	0.637													16	58	---	---	---	---	PASS
RETSAT	54884	broad.mit.edu	37	2	85573109	85573109	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85573109C>A	uc002spd.2	-	6	1297	c.1106G>T	c.(1105-1107)CGC>CTC	p.R369L	RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Missense_Mutation_p.R308L|RETSAT_uc010fgf.2_Missense_Mutation_p.R160L	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	369					retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	TGGCAGGCAGCGGGCGTTCCC	0.587													42	181	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89292131	89292131	+	RNA	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89292131C>A	uc010ytr.1	-	82		c.7075G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		CTGCTAATACCCTGACTCGCC	0.507													62	252	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89326663	89326663	+	RNA	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89326663G>T	uc010ytr.1	-	68		c.6515C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TGGAATCACTGTGGGAGGCCA	0.483													24	111	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90248923	90248923	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90248923G>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		ACACAGCATGGACATGAGGGT	0.547													32	178	---	---	---	---	PASS
FER1L5	90342	broad.mit.edu	37	2	97365350	97365350	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97365350C>A	uc010fia.2	+	42	4755	c.4755C>A	c.(4753-4755)TTC>TTA	p.F1585L	FER1L5_uc002sws.3_Missense_Mutation_p.F303L|FER1L5_uc002swt.3_Missense_Mutation_p.F303L|FER1L5_uc010yus.1_Missense_Mutation_p.F302L	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	1585	C2 5.					integral to membrane				ovary(1)	1						TCTATGACTTCGACCTATTTT	0.493													110	379	---	---	---	---	PASS
TSGA10	80705	broad.mit.edu	37	2	99697854	99697854	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99697854C>A	uc002szg.3	-	9	1246	c.618G>T	c.(616-618)TTG>TTT	p.L206F	TSGA10_uc002szh.3_Missense_Mutation_p.L206F|TSGA10_uc002szi.3_Missense_Mutation_p.L206F|TSGA10_uc010fin.1_Missense_Mutation_p.L206F|TSGA10_uc010yvn.1_Missense_Mutation_p.L206F	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	206					spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						TGTTTTCATACAAAAGTCTGC	0.289													17	75	---	---	---	---	PASS
IL18R1	8809	broad.mit.edu	37	2	102988470	102988470	+	Silent	SNP	C	T	T	rs140709578		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102988470C>T	uc002tbw.3	+	4	510	c.360C>T	c.(358-360)TTC>TTT	p.F120F	IL18R1_uc010ywb.1_Silent_p.F120F|IL18R1_uc010ywc.1_Silent_p.F120F|IL18R1_uc010ywd.1_5'UTR|IL18R1_uc010fiy.2_Silent_p.F120F	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor	120	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						ACAGCTGTTTCACTGAAAGAC	0.289													26	71	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109381368	109381368	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109381368A>G	uc002tem.3	+	20	4499	c.4373A>G	c.(4372-4374)AAA>AGA	p.K1458R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1458					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GCTTCATTTAAATTTGGCCAG	0.368													34	93	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	124999829	124999829	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124999829G>T	uc002tno.2	+	3	604	c.240G>T	c.(238-240)ATG>ATT	p.M80I	CNTNAP5_uc010flu.2_Missense_Mutation_p.M80I	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	80	F5/8 type C.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGCTCCAGATGGACCTGGGAA	0.522													3	14	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	124999830	124999830	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124999830G>T	uc002tno.2	+	3	605	c.241G>T	c.(241-243)GAC>TAC	p.D81Y	CNTNAP5_uc010flu.2_Missense_Mutation_p.D81Y	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	81	F5/8 type C.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCTCCAGATGGACCTGGGAAA	0.522													3	14	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125405502	125405502	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125405502C>A	uc002tno.2	+	13	2405	c.2041C>A	c.(2041-2043)CAC>AAC	p.H681N	CNTNAP5_uc010flu.2_Missense_Mutation_p.H682N	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	681	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGTGGCCTACCACTGCAGGAG	0.602													4	18	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128335741	128335741	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128335741G>T	uc002top.2	+	9	936	c.883G>T	c.(883-885)GCC>TCC	p.A295S		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	295	Myosin head-like.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCTCAACGACGCCAAGGACTA	0.632													12	59	---	---	---	---	PASS
TMEM163	81615	broad.mit.edu	37	2	135308236	135308236	+	Intron	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135308236G>A	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		CATCAAACTAGGAGAAGGAGA	0.502													17	68	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141253223	141253223	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141253223C>A	uc002tvj.1	-	56	9917	c.8945G>T	c.(8944-8946)TGC>TTC	p.C2982F		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2982	Extracellular (Potential).|EGF-like 7.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTATTGATGCATTGCTGGCT	0.458										TSP Lung(27;0.18)			34	117	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149806919	149806919	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149806919G>C	uc010zbu.1	+	10	1279	c.911G>C	c.(910-912)TGT>TCT	p.C304S	KIF5C_uc002tws.1_RNA	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	304	Kinesin-motor.|Microtubule-binding.				microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		GTCATTTGCTGTTCTCCTTCT	0.502													29	35	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149840133	149840133	+	Splice_Site	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149840133G>T	uc010zbu.1	+	15	1938	c.1570_splice	c.e15-1	p.T524_splice	KIF5C_uc002tws.1_Splice_Site|KIF5C_uc002twt.2_Splice_Site_p.T76_splice	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		TTGTTTTTCAGACTACATTGA	0.388													16	36	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152325193	152325193	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152325193A>G	uc002txm.2	+	33	6994	c.6864A>G	c.(6862-6864)ACA>ACG	p.T2288T	RIF1_uc002txl.2_Silent_p.T2262T|RIF1_uc002txn.2_Silent_p.T2262T|RIF1_uc002txo.2_Silent_p.T2262T|RIF1_uc002txp.2_RNA	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	2288	Interaction with condensed chromosomes in telophase.				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CATGCCCAACAGAAAGTGTTT	0.378													56	172	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158406731	158406731	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158406731G>T	uc002tzk.3	-	4	961	c.718C>A	c.(718-720)CAG>AAG	p.Q240K	ACVR1C_uc002tzl.3_Missense_Mutation_p.Q160K|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Missense_Mutation_p.Q190K	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	240	Protein kinase.|Cytoplasmic (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						ATGACCGTCTGGTAAATTTCT	0.428													44	186	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163031482	163031482	+	Intron	SNP	G	C	C	rs76573542		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163031482G>C	uc002ucd.2	-						FAP_uc010fpc.2_Intron|FAP_uc010zct.1_Intron|FAP_uc010fpd.2_Intron	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit						endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						TAGGACTGTAGAGACATTGTT	0.443													9	70	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166770088	166770088	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166770088A>G	uc002udk.2	-	16	2340	c.2207T>C	c.(2206-2208)CTA>CCA	p.L736P		NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	736	TPR 9.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TTTTACCTCTAGAATATTCAT	0.303													16	82	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167085253	167085253	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167085253A>T	uc010fpl.2	-	22	4462	c.4121T>A	c.(4120-4122)CTG>CAG	p.L1374Q	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1385	III.		Missing (in CIPAR; significant reduction in membrane localization of the mutant protein compared to the wild-type; complete loss of function of the sodium channel).			voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	GTTCACTTTCAGGTTTTTCCA	0.398													34	244	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170150710	170150710	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170150710A>G	uc002ues.2	-	6	813	c.600T>C	c.(598-600)TAT>TAC	p.Y200Y	LRP2_uc010zdf.1_Silent_p.Y200Y	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	200	LDL-receptor class A 5.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GGTCACAGACATAAGCACGAG	0.428													23	176	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175624292	175624292	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175624292A>T	uc002ujd.2	-	2	191	c.113T>A	c.(112-114)GTG>GAG	p.V38E	uc002uiw.2_Intron|CHRNA1_uc002uje.2_Missense_Mutation_p.V38E|CHRNA1_uc002ujf.3_Missense_Mutation_p.V38E	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	38	Extracellular.				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TGGCCGCACCACGCTGCTGTA	0.587													37	273	---	---	---	---	PASS
ATF2	1386	broad.mit.edu	37	2	175939423	175939423	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175939423T>A	uc002ujl.2	-	14	1694	c.1432A>T	c.(1432-1434)ACC>TCC	p.T478S	ATF2_uc010fqv.2_Missense_Mutation_p.T429S|ATF2_uc002ujv.2_Missense_Mutation_p.T225S|ATF2_uc002ujm.2_Missense_Mutation_p.T420S|ATF2_uc002ujn.2_RNA|ATF2_uc002ujo.2_Missense_Mutation_p.T117S|ATF2_uc002ujp.2_RNA|ATF2_uc002ujq.2_Missense_Mutation_p.T478S|ATF2_uc002ujr.2_RNA|ATF2_uc010fqu.2_Missense_Mutation_p.T460S|ATF2_uc002ujs.2_Missense_Mutation_p.T420S|ATF2_uc002ujt.2_RNA|ATF2_uc002uju.2_RNA|ATF2_uc002ujw.1_3'UTR|ATF2_uc002ujx.1_RNA|uc002ujk.2_5'Flank	NM_001880	NP_001871	P15336	ATF2_HUMAN	activating transcription factor 2	478					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(1)|breast(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.125)			GCCATCTGGGTGAGGACTGAA	0.507													12	39	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178494266	178494266	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178494266G>C	uc002ulq.2	-	20	2989	c.2671C>G	c.(2671-2673)CTG>GTG	p.L891V	PDE11A_uc010zfd.1_Missense_Mutation_p.L82V|PDE11A_uc002ulp.2_Missense_Mutation_p.L447V|PDE11A_uc002ulr.2_Missense_Mutation_p.L641V|PDE11A_uc002uls.1_Missense_Mutation_p.L533V|PDE11A_uc002ult.1_Missense_Mutation_p.L641V|PDE11A_uc002ulu.1_Missense_Mutation_p.L533V	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	891	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			ATCGGCTTCAGTTTCACGTTG	0.443									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				77	148	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179399048	179399048	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179399048G>C	uc010zfg.1	-	307	94814	c.94590C>G	c.(94588-94590)ATC>ATG	p.I31530M	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I25225M|TTN_uc010zfi.1_Missense_Mutation_p.I25158M|TTN_uc010zfj.1_Missense_Mutation_p.I25033M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32457							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTCTTTCTTGATCAGGGTGT	0.468													19	152	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179449428	179449428	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179449428G>T	uc010zfg.1	-	259	57460	c.57236C>A	c.(57235-57237)ACA>AAA	p.T19079K	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T12774K|TTN_uc010zfi.1_Missense_Mutation_p.T12707K|TTN_uc010zfj.1_Missense_Mutation_p.T12582K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20006							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTGGAGATGTGAGAGGCTC	0.433													46	373	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179730587	179730587	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179730587C>G	uc002unf.1	-	7	963	c.906G>C	c.(904-906)GAG>GAC	p.E302D		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	302	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCATGCTGTCCTCCTCAAGGA	0.512													130	319	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182423307	182423307	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182423307C>G	uc002unx.2	-	6	985	c.884G>C	c.(883-885)GGC>GCC	p.G295A	CERKL_uc002uny.2_Missense_Mutation_p.G269A|CERKL_uc010zfm.1_Missense_Mutation_p.G251A|CERKL_uc002unz.2_Missense_Mutation_p.G17A|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Missense_Mutation_p.G17A|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Missense_Mutation_p.G64A|CERKL_uc002uoe.2_Missense_Mutation_p.G269A	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	295	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGGTATTAAGCCAAGTGGAAG	0.443													8	119	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802007	185802007	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802007A>G	uc002uph.2	+	4	2478	c.1884A>G	c.(1882-1884)GAA>GAG	p.E628E		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	628						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GTTACACTGAAAATGCTGGGA	0.343													63	200	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189901512	189901512	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189901512G>T	uc002uqk.2	-	52	4218	c.3943C>A	c.(3943-3945)CCT>ACT	p.P1315T	COL5A2_uc010frx.2_Missense_Mutation_p.P891T	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1315	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCTTGGTTAGGATCAATCCAG	0.338													9	50	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196728947	196728947	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196728947T>C	uc002utj.3	-	41	7533	c.7432A>G	c.(7432-7434)ATT>GTT	p.I2478V		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2478	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						GCATCTCCAATGGGACTCATG	0.438													31	107	---	---	---	---	PASS
CCDC150	284992	broad.mit.edu	37	2	197593928	197593928	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197593928C>T	uc002utp.1	+	23	2703	c.2568C>T	c.(2566-2568)GCC>GCT	p.A856A	CCDC150_uc010zgs.1_Silent_p.A503A|CCDC150_uc010zgt.1_Silent_p.A273A|CCDC150_uc002utr.1_Silent_p.A171A	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	856	Potential.										0						TGAAGAAAGCCCTTGATGAAG	0.378													5	33	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198498558	198498558	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198498558G>T	uc002uuo.3	-	4	1004	c.602C>A	c.(601-603)ACG>AAG	p.T201K		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	201						plasma membrane					0						CCCACTTAACGTCCCTTCATT	0.413													60	295	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207460779	207460779	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207460779G>T	uc002vbq.2	+	24	2475	c.2252G>T	c.(2251-2253)TGT>TTT	p.C751F	ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	751	EGF-like.|Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TCACAGGTGTGTAGTAATGAA	0.448													12	60	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209138764	209138764	+	Intron	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209138764C>T	uc002vcz.2	+						PIKFYVE_uc010fun.1_Intron|PIKFYVE_uc002vcy.1_Intron|PIKFYVE_uc002vcv.2_Intron|PIKFYVE_uc002vcw.2_Intron|PIKFYVE_uc002vcx.2_Silent_p.P114P	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type						cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TGCAACATCCCCAGGAGAACA	0.403													7	30	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211502425	211502425	+	Splice_Site	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211502425G>A	uc002vee.3	+	22	2820	c.2688_splice	c.e22-1	p.S896_splice	CPS1_uc010fur.2_Splice_Site_p.S902_splice|CPS1_uc010fus.2_Splice_Site_p.S445_splice	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TTAAATCCTAGTGAGTCCATG	0.408													25	120	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215645361	215645361	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215645361C>T	uc002veu.2	-	4	1372	c.1237G>A	c.(1237-1239)GCA>ACA	p.A413T	BARD1_uc010zjm.1_Missense_Mutation_p.A269T	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	413					cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGCTTCATTGCTGAGGGACTA	0.403									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				24	146	---	---	---	---	PASS
TTLL4	9654	broad.mit.edu	37	2	219602936	219602936	+	Silent	SNP	A	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219602936A>C	uc002viy.2	+	3	907	c.537A>C	c.(535-537)ACA>ACC	p.T179T	TTLL4_uc010zkl.1_Silent_p.T14T|TTLL4_uc010fvx.2_Silent_p.T179T	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	179					protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		CCTCATCCACAGAACCATACC	0.567													72	147	---	---	---	---	PASS
DNAJB2	3300	broad.mit.edu	37	2	220144589	220144589	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220144589C>G	uc002vkx.1	+	2	271	c.34C>G	c.(34-36)CGA>GGA	p.R12G	DNAJB2_uc010zla.1_Missense_Mutation_p.R12G|DNAJB2_uc002vkw.1_Missense_Mutation_p.R12G|DNAJB2_uc002vky.2_5'Flank|DNAJB2_uc010zlb.1_5'Flank	NM_006736	NP_006727	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	12	J.				ER-associated protein catabolic process|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of inclusion body assembly|negative regulation of protein deubiquitination|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding|response to unfolded protein	inclusion body	heat shock protein binding|Hsp70 protein binding|polyubiquitin binding|proteasome binding|protein binding|unfolded protein binding				0		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGACGTGCCGCGAAGTGCGTC	0.587													6	65	---	---	---	---	PASS
MLPH	79083	broad.mit.edu	37	2	238461036	238461036	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238461036A>T	uc002vwt.2	+	15	1959	c.1732A>T	c.(1732-1734)AGA>TGA	p.R578*	MLPH_uc002vws.2_Nonsense_Mutation_p.R435*|MLPH_uc002vwu.2_Nonsense_Mutation_p.R550*|MLPH_uc002vwv.2_Nonsense_Mutation_p.R458*|MLPH_uc002vww.2_Nonsense_Mutation_p.R474*|MLPH_uc002vwx.2_Nonsense_Mutation_p.R434*|MLPH_uc010fyu.2_Nonsense_Mutation_p.R330*	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1	578							metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		GCTGACACAGAGAAACCCCAA	0.458													16	79	---	---	---	---	PASS
TRAF3IP1	26146	broad.mit.edu	37	2	239306324	239306324	+	Intron	SNP	G	T	T	rs147792234	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239306324G>T	uc002vye.2	+						TRAF3IP1_uc002vyf.2_Intron	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting							cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		AGCAGAGGTGGGGGGTAGTAA	0.632													16	64	---	---	---	---	PASS
C2orf85	285093	broad.mit.edu	37	2	242815303	242815303	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242815303C>T	uc010fzu.1	+	2	1619	c.1596C>T	c.(1594-1596)GCC>GCT	p.A532A		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	532						integral to membrane				ovary(1)	1						CTGGCCGTGCCTGCCGTAGGC	0.647													63	116	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9788954	9788954	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9788954A>T	uc003bse.2	+	14	3965	c.3566A>T	c.(3565-3567)CAG>CTG	p.Q1189L	BRPF1_uc003bsf.2_Missense_Mutation_p.Q1195L|BRPF1_uc003bsg.2_Missense_Mutation_p.Q1188L|BRPF1_uc011ati.1_Missense_Mutation_p.Q1094L|OGG1_uc003bsh.2_5'Flank|OGG1_uc003bsi.2_5'Flank|OGG1_uc003bsj.2_5'Flank|OGG1_uc003bsk.2_5'Flank|OGG1_uc003bsl.2_5'Flank|OGG1_uc003bsm.2_5'Flank|OGG1_uc003bsn.2_5'Flank|OGG1_uc003bso.2_5'Flank	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	1189					histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					AAGTCAGTACAGATCGCCTAC	0.577													69	133	---	---	---	---	PASS
ALS2CL	259173	broad.mit.edu	37	3	46728560	46728560	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46728560C>A	uc003cqa.1	-	5	637	c.447G>T	c.(445-447)TCG>TCT	p.S149S	ALS2CL_uc003cqb.1_Silent_p.S149S|ALS2CL_uc003cqc.1_RNA	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1	149					endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CCTGGCCCAGCGATGCGCCCA	0.682													5	7	---	---	---	---	PASS
PTH1R	5745	broad.mit.edu	37	3	46943361	46943361	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46943361C>A	uc003cqm.2	+						PTH1R_uc003cqn.2_Intron	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor							cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association			breast(1)	1						GTGAGCCCACCATGCCTGCCA	0.617									Ollier_disease_/_Maffuci_syndrome				10	17	---	---	---	---	PASS
DHX30	22907	broad.mit.edu	37	3	47882519	47882519	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47882519T>G	uc003cru.2	+	7	945	c.519T>G	c.(517-519)ATT>ATG	p.I173M	DHX30_uc003crs.2_Missense_Mutation_p.I134M|DHX30_uc003crt.2_Missense_Mutation_p.I134M|DHX30_uc010hjr.1_Missense_Mutation_p.I201M	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	173						mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CAGAGAGTATTCGACCAGGGG	0.602													22	41	---	---	---	---	PASS
RRP9	9136	broad.mit.edu	37	3	51970535	51970535	+	Missense_Mutation	SNP	G	A	A	rs146452464	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51970535G>A	uc003dbw.1	-	7	593	c.554C>T	c.(553-555)CCT>CTT	p.P185L		NM_004704	NP_004695	O43818	U3IP2_HUMAN	RNA, U3 small nucleolar interacting protein 2	185					rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding			breast(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CTTGGCTCGAGGAATCACATG	0.637													26	52	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	86010798	86010798	+	Splice_Site	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86010798G>T	uc003dqj.2	+	7	1569	c.943_splice	c.e7+1	p.D315_splice	CADM2_uc003dqk.2_Splice_Site_p.D324_splice|CADM2_uc003dql.2_Splice_Site_p.D317_splice	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ATTGTGCATGGTGAGTAAATT	0.328													55	86	---	---	---	---	PASS
OR5H14	403273	broad.mit.edu	37	3	97868594	97868594	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97868594G>A	uc003dsg.1	+	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GCATATGATCGCTATGTAGCC	0.398													8	76	---	---	---	---	PASS
DCBLD2	131566	broad.mit.edu	37	3	98600525	98600525	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98600525C>A	uc003dtd.2	-	2	655	c.292G>T	c.(292-294)GTT>TTT	p.V98F	DCBLD2_uc003dte.2_Missense_Mutation_p.V98F|DCBLD2_uc003dtf.1_RNA	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	98	Extracellular (Potential).|CUB.				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						CATTCACAAACAGTGCTGTTG	0.418													81	286	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107447613	107447613	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107447613A>G	uc010hpr.2	+	6	734	c.407A>G	c.(406-408)TAT>TGT	p.Y136C	BBX_uc003dwk.3_Missense_Mutation_p.Y136C|BBX_uc003dwl.3_Missense_Mutation_p.Y136C|BBX_uc010hps.1_Missense_Mutation_p.Y157C|BBX_uc003dwm.3_Missense_Mutation_p.Y136C	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	136	HMG box.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TATTTATAGTATAAGGATGCA	0.378													72	202	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108133227	108133227	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108133227C>A	uc003dxa.1	-	31	4114	c.4057G>T	c.(4057-4059)GAC>TAC	p.D1353Y		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1353	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CGTAGAAGGTCACAGTCACGC	0.507													25	79	---	---	---	---	PASS
BTLA	151888	broad.mit.edu	37	3	112198582	112198582	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112198582C>A	uc003dza.3	-	2	326	c.123G>T	c.(121-123)AAG>AAT	p.K41N	BTLA_uc003dzb.3_Missense_Mutation_p.K41N	NM_181780	NP_861445	Q7Z6A9	BTLA_HUMAN	B and T lymphocyte associated isoform 1	41	Extracellular (Potential).				T cell costimulation		receptor activity				0		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)				CAGATTGTCTCTTTATATAAA	0.368													43	118	---	---	---	---	PASS
GRAMD1C	54762	broad.mit.edu	37	3	113652396	113652396	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113652396G>T	uc003eaq.3	+	12	1324	c.1248G>T	c.(1246-1248)TTG>TTT	p.L416F	GRAMD1C_uc011bil.1_RNA|GRAMD1C_uc011bim.1_RNA|GRAMD1C_uc003ear.2_Missense_Mutation_p.L249F|GRAMD1C_uc003eas.2_Missense_Mutation_p.L211F|GRAMD1C_uc003eat.2_Missense_Mutation_p.L75F	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	416						integral to membrane				ovary(2)|skin(1)	3						GATTTTATTTGGTAGATTCAG	0.358													59	193	---	---	---	---	PASS
GRAMD1C	54762	broad.mit.edu	37	3	113652397	113652397	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113652397G>T	uc003eaq.3	+	12	1325	c.1249G>T	c.(1249-1251)GTA>TTA	p.V417L	GRAMD1C_uc011bil.1_RNA|GRAMD1C_uc011bim.1_RNA|GRAMD1C_uc003ear.2_Missense_Mutation_p.V250L|GRAMD1C_uc003eas.2_Missense_Mutation_p.V212L|GRAMD1C_uc003eat.2_Missense_Mutation_p.V76L	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	417						integral to membrane				ovary(2)|skin(1)	3						ATTTTATTTGGTAGATTCAGA	0.358													59	194	---	---	---	---	PASS
LSAMP	4045	broad.mit.edu	37	3	115738364	115738364	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115738364G>T	uc003ebt.2	-	3	1012	c.512C>A	c.(511-513)ACT>AAT	p.T171N	LSAMP_uc011bis.1_Missense_Mutation_p.T171N	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	171	Ig-like C2-type 2.				cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TTGCTTACCAGTTGGTGTAAG	0.458													20	77	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118621725	118621725	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118621725G>A	uc003ebw.2	-	7	1185	c.938C>T	c.(937-939)TCT>TTT	p.S313F	IGSF11_uc011biv.1_Missense_Mutation_p.S285F|IGSF11_uc003ebx.2_Missense_Mutation_p.S289F|IGSF11_uc003eby.2_Missense_Mutation_p.S312F|IGSF11_uc003ebz.2_Missense_Mutation_p.S288F|IGSF11_uc010hqs.2_Missense_Mutation_p.S312F	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	313	Cytoplasmic (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						GGCATTGGAAGAGGTTAGTGT	0.438													45	208	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	121980430	121980430	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121980430T>A	uc003eev.3	+	4	920	c.548T>A	c.(547-549)TTC>TAC	p.F183Y	CASR_uc003eew.3_Missense_Mutation_p.F183Y	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	183	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TTCAAGTCTTTCCTCCGAACC	0.453													93	271	---	---	---	---	PASS
KBTBD12	166348	broad.mit.edu	37	3	127648994	127648994	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127648994G>A	uc010hsr.2	+	3	1363	c.1360G>A	c.(1360-1362)GAA>AAA	p.E454K	KBTBD12_uc003ejy.3_Missense_Mutation_p.E61K|KBTBD12_uc010hsq.2_Intron|KBTBD12_uc003eka.3_Missense_Mutation_p.E29K	NM_207335	NP_997218	Q3ZCT8	KBTBC_HUMAN	kelch domain containing 6	454	Kelch 2.									ovary(1)	1						TCCTGATGAAGAACCTGATCG	0.393													9	22	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130437364	130437364	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130437364G>A	uc003enj.2	-	8	2577	c.1996C>T	c.(1996-1998)CAT>TAT	p.H666Y		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	666					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						AAATTGGGATGACACAGGAAG	0.383													41	137	---	---	---	---	PASS
TMEM108	66000	broad.mit.edu	37	3	133098644	133098644	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133098644A>G	uc003eph.2	+	4	363	c.89A>G	c.(88-90)CAG>CGG	p.Q30R	TMEM108_uc003epi.2_Missense_Mutation_p.Q30R|TMEM108_uc003epj.1_Missense_Mutation_p.Q30R|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_5'UTR	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	30	Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)	4						TTTGCCATCCAGGAACCATCT	0.537													165	631	---	---	---	---	PASS
CP	1356	broad.mit.edu	37	3	148928125	148928125	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148928125C>A	uc003ewy.3	-	3	689	c.436G>T	c.(436-438)GAT>TAT	p.D146Y	CP_uc011bnr.1_RNA|CP_uc003ewx.3_5'Flank|CP_uc003ewz.2_Missense_Mutation_p.D146Y|CP_uc010hvf.1_5'Flank	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	146	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	ACTTTGTCATCTGCTCTTTGA	0.418													67	161	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167033628	167033628	+	Intron	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167033628T>G	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2						Cttattaaattaatgttatat	0.254													6	73	---	---	---	---	PASS
GOLIM4	27333	broad.mit.edu	37	3	167750315	167750315	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167750315C>A	uc003ffe.2	-	9	1513	c.1169G>T	c.(1168-1170)CGT>CTT	p.R390L	GOLIM4_uc011bpe.1_Missense_Mutation_p.R390L|GOLIM4_uc011bpf.1_Missense_Mutation_p.R362L|GOLIM4_uc011bpg.1_Missense_Mutation_p.R362L	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	390	Glu-rich.|Lumenal (Potential).				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TACCTCAGCACGCGCGTGCCC	0.483													124	741	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169539958	169539958	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169539958G>T	uc003fgb.2	+	1	249	c.249G>T	c.(247-249)CTG>CTT	p.L83L		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	83	LRR 3.										0						AGAACAACCTGAGGAGCCTGT	0.527													363	216	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169548372	169548372	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169548372G>A	uc003fgb.2	+	3	1287	c.1287G>A	c.(1285-1287)CGG>CGA	p.R429R		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	429	LRR 18.										0						TTGATTGCCGGCACAATTTGC	0.443													20	119	---	---	---	---	PASS
GNB4	59345	broad.mit.edu	37	3	179119032	179119032	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119032G>T	uc003fjv.3	-	10	1272	c.992C>A	c.(991-993)TCT>TAT	p.S331Y	GNB4_uc003fju.3_3'UTR	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4	331	WD 7.				cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			ACTGTCCCAAGAGCCTGTTGC	0.398													33	142	---	---	---	---	PASS
ACTL6A	86	broad.mit.edu	37	3	179292256	179292256	+	Splice_Site	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179292256G>T	uc003fjw.2	+	5	649	c.476_splice	c.e5+1	p.A159_splice	ACTL6A_uc003fjx.2_Splice_Site_p.A117_splice|ACTL6A_uc003fjy.2_Splice_Site_p.A117_splice	NM_004301	NP_004292	O96019	ACL6A_HUMAN	actin-like 6A isoform 1						chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			TTTTGACAGCGTATCCTTGAA	0.388													100	557	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180364857	180364857	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180364857G>T	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ATGTATTTTGGCTAAGTTACA	0.348													68	117	---	---	---	---	PASS
ETV5	2119	broad.mit.edu	37	3	185769884	185769884	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185769884C>A	uc003fpz.2	-	12	1493	c.1246G>T	c.(1246-1248)GCC>TCC	p.A416S	ETV5_uc003fpy.2_Missense_Mutation_p.A458S	NM_004454	NP_004445	P41161	ETV5_HUMAN	ets variant gene 5 (ets-related molecule)	416	ETS.				cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TAGTTCATGGCTGGCCGGTTC	0.532			T	TMPRSS2|SCL45A3	Prostate 								82	111	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186440291	186440291	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186440291G>T	uc011bsa.1	+	3	584	c.372G>T	c.(370-372)CAG>CAT	p.Q124H	KNG1_uc003fqr.2_Missense_Mutation_p.Q124H	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	124	Cystatin 1.|O-glycosylated at one site only.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	TGGCTACCCAGACCTGCCAGA	0.493													19	35	---	---	---	---	PASS
OTOP1	133060	broad.mit.edu	37	4	4198988	4198988	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4198988G>T	uc003ghp.1	-	5	1603	c.1573C>A	c.(1573-1575)CCA>ACA	p.P525T		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	525					biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACTGGGCTTGGGCTCCCTCCC	0.537													44	72	---	---	---	---	PASS
ZBTB49	166793	broad.mit.edu	37	4	4304612	4304612	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4304612G>T	uc003ghu.2	+	3	1224	c.1049G>T	c.(1048-1050)AGC>ATC	p.S350I	ZBTB49_uc003ghv.2_5'UTR|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_Missense_Mutation_p.S50I	NM_145291	NP_660334	Q6ZSB9	ZBT49_HUMAN	zinc finger protein 509	350					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						AAAGCTAGCAGCCAAAGTGCT	0.438													35	51	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5624376	5624376	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5624376C>A	uc003gij.2	-	14	2443	c.2389G>T	c.(2389-2391)GAC>TAC	p.D797Y	EVC2_uc011bwb.1_Missense_Mutation_p.D237Y|EVC2_uc003gik.2_Missense_Mutation_p.D717Y	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	797	Potential.					integral to membrane				large_intestine(3)|ovary(2)	5						TGGTCCCTGTCCCTCTCCTCC	0.662													18	53	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20555464	20555464	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20555464C>A	uc003gpr.1	+	26	2802	c.2598C>A	c.(2596-2598)AAC>AAA	p.N866K	SLIT2_uc003gps.1_Missense_Mutation_p.N858K	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	866	LRRCT 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						GTGATTGTAACATGCAGTGGT	0.358													44	95	---	---	---	---	PASS
KCNIP4	80333	broad.mit.edu	37	4	21305524	21305524	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305524G>C	uc003gqf.1	-	1	6	c.6C>G	c.(4-6)AAC>AAG	p.N2K	KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_147183	NP_671712	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 4	Error:Variant_position_missing_in_Q6PIL6_after_alignment						plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				GCCCTTCCAAGTTCATGGTCA	0.433													22	42	---	---	---	---	PASS
TLR1	7096	broad.mit.edu	37	4	38798565	38798565	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38798565C>A	uc003gtl.2	-	4	2162	c.1888G>T	c.(1888-1890)GAA>TAA	p.E630*		NM_003263	NP_003254	Q15399	TLR1_HUMAN	toll-like receptor 1 precursor	630	Cytoplasmic (Potential).				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity			lung(2)|skin(2)|prostate(1)	5						CTTTGGAGTTCTTCTAAGGGT	0.483													91	165	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68928301	68928301	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68928301G>T	uc003hdt.1	-						LOC550112_uc003hdl.3_Intron|uc011cak.1_RNA|SYT14L_uc010ihn.2_RNA	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						CGTACTTGCCGTCCTTTTGAC	0.403													61	187	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72121047	72121047	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72121047G>T	uc003hfy.2	+	3	301	c.184G>T	c.(184-186)GAG>TAG	p.E62*	SLC4A4_uc010iic.2_Nonsense_Mutation_p.E62*|SLC4A4_uc010iib.2_Nonsense_Mutation_p.E62*|SLC4A4_uc003hfz.2_Nonsense_Mutation_p.E62*|SLC4A4_uc003hga.2_5'UTR	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	62	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			GAGAATCTCTGAGAACTACTC	0.448													59	116	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87622436	87622436	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87622436C>T	uc003hpz.2	+	7	1157	c.677C>T	c.(676-678)CCA>CTA	p.P226L	PTPN13_uc003hpy.2_Missense_Mutation_p.P226L|PTPN13_uc003hqa.2_Missense_Mutation_p.P226L|PTPN13_uc003hqb.2_Missense_Mutation_p.P226L	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	226						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CAAAAGCCTCCACTCTCTCAT	0.338													9	28	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111470932	111470932	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111470932G>T	uc003iab.3	+	17	2733	c.2391G>T	c.(2389-2391)GAG>GAT	p.E797D		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	797	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	CTGGCAATGAGATTTCATGGA	0.403													47	122	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113353197	113353197	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113353197T>A	uc003iap.3	+	11	2773	c.2494T>A	c.(2494-2496)TCC>ACC	p.S832T	ALPK1_uc003ian.3_Missense_Mutation_p.S832T|ALPK1_uc011cfx.1_Missense_Mutation_p.S754T|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.S660T	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	832							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		AAATCCTGACTCCAGAAAAAG	0.537													19	33	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113353198	113353198	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113353198C>A	uc003iap.3	+	11	2774	c.2495C>A	c.(2494-2496)TCC>TAC	p.S832Y	ALPK1_uc003ian.3_Missense_Mutation_p.S832Y|ALPK1_uc011cfx.1_Missense_Mutation_p.S754Y|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.S660Y	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	832							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		AATCCTGACTCCAGAAAAAGT	0.542													19	33	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114120241	114120241	+	Silent	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114120241A>T	uc003ibe.3	+	4	460	c.360A>T	c.(358-360)GGA>GGT	p.G120G	ANK2_uc003ibd.3_Silent_p.G99G|ANK2_uc003ibf.3_Silent_p.G120G|ANK2_uc003ibc.2_Silent_p.G96G|ANK2_uc011cgb.1_Silent_p.G135G	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	120	ANK 3.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTAAGGAAGGAGCCAATATTA	0.343													31	67	---	---	---	---	PASS
BBS7	55212	broad.mit.edu	37	4	122754443	122754443	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122754443C>T	uc003ied.2	-	15	1793	c.1619G>A	c.(1618-1620)TGT>TAT	p.C540Y	BBS7_uc003iee.1_Missense_Mutation_p.C540Y	NM_176824	NP_789794	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7 protein isoform a	540					cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1						AAATGTCACACATTCTCCTGC	0.388									Bardet-Biedl_syndrome				52	84	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151336617	151336617	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151336617T>C	uc010ipj.2	-	48	7674	c.7200A>G	c.(7198-7200)TCA>TCG	p.S2400S	LRBA_uc010ipi.2_Intron|LRBA_uc003ils.3_Silent_p.S290S|LRBA_uc003ilt.3_Silent_p.S1048S|LRBA_uc003ilu.3_Silent_p.S2389S	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2400	BEACH.					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					CAAATTCTTCTGAGGTTTTGG	0.378													27	62	---	---	---	---	PASS
NPY2R	4887	broad.mit.edu	37	4	156135714	156135714	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156135714C>T	uc003ioq.2	+	2	1118	c.623C>T	c.(622-624)CCT>CTT	p.P208L	NPY2R_uc003ior.2_Missense_Mutation_p.P208L	NM_000910	NP_000901	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	208	Extracellular (Potential).				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity			lung(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0854)				GAAAAGTGGCCTGGCGAGGAG	0.488													34	140	---	---	---	---	PASS
RXFP1	59350	broad.mit.edu	37	4	159533290	159533290	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159533290G>C	uc003ipz.2	+	7	627	c.545G>C	c.(544-546)AGT>ACT	p.S182T	RXFP1_uc010iqj.1_Missense_Mutation_p.S11T|RXFP1_uc011cja.1_Missense_Mutation_p.S101T|RXFP1_uc010iqo.2_Missense_Mutation_p.S182T|RXFP1_uc011cjb.1_Missense_Mutation_p.S128T|RXFP1_uc010iqk.2_Missense_Mutation_p.S50T|RXFP1_uc011cjc.1_Missense_Mutation_p.S101T|RXFP1_uc011cjd.1_Missense_Mutation_p.S101T|RXFP1_uc010iql.2_Missense_Mutation_p.S50T|RXFP1_uc011cje.1_Missense_Mutation_p.S209T|RXFP1_uc010iqm.2_Missense_Mutation_p.S149T|RXFP1_uc011cjf.1_Missense_Mutation_p.S52T|RXFP1_uc010iqn.2_Missense_Mutation_p.S128T	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	182	Extracellular (Potential).|LRR 2.					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		AGGTATCTCAGTCATAACAGA	0.299													15	151	---	---	---	---	PASS
ANXA10	11199	broad.mit.edu	37	4	169102890	169102890	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169102890C>A	uc003irm.2	+	10	926	c.781C>A	c.(781-783)CAT>AAT	p.H261N	ANXA10_uc003irn.2_Missense_Mutation_p.H133N	NM_007193	NP_009124	Q9UJ72	ANX10_HUMAN	annexin A10	261	Annexin 4.						calcium ion binding|calcium-dependent phospholipid binding				0		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		TAGTGCAATTCATGTAAGTAA	0.299													33	91	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175898963	175898963	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175898963G>A	uc003iuc.2	+	5	2957	c.2287G>A	c.(2287-2289)GTG>ATG	p.V763M	ADAM29_uc003iud.2_Missense_Mutation_p.V763M|ADAM29_uc010irr.2_Missense_Mutation_p.V763M|ADAM29_uc011cki.1_Missense_Mutation_p.V763M	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	763	Cytoplasmic (Potential).|9 X 9 AA approximate repeats.|3.				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TCAACCTCCTGTGACACCCTC	0.567													7	217	---	---	---	---	PASS
UFSP2	55325	broad.mit.edu	37	4	186336339	186336339	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186336339T>C	uc003ixo.2	-	6	771	c.654A>G	c.(652-654)ATA>ATG	p.I218M	UFSP2_uc003ixn.2_Missense_Mutation_p.I108M|UFSP2_uc003ixq.2_Missense_Mutation_p.I108M|UFSP2_uc003ixp.2_RNA	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	218						endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		GGCCATCTGGTATTCCTGAAG	0.323													4	104	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189013004	189013004	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189013004A>G	uc003izl.2	-	7	723	c.687T>C	c.(685-687)GAT>GAC	p.D229D	TRIML2_uc003izj.1_Silent_p.D57D|TRIML2_uc003izk.1_Silent_p.D37D|TRIML2_uc011cle.1_Silent_p.D304D	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	229	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TGCCAGCCCCATCCTGCTGCC	0.532													10	143	---	---	---	---	PASS
BRD9	65980	broad.mit.edu	37	5	878484	878484	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:878484C>A	uc003jbq.2	-	11	1424	c.1257G>T	c.(1255-1257)GTG>GTT	p.V419V	BRD9_uc003jbl.2_Silent_p.V303V|BRD9_uc003jbm.2_RNA|BRD9_uc003jbn.2_RNA|BRD9_uc011cmb.1_Silent_p.V366V|BRD9_uc003jbo.2_Silent_p.V323V|BRD9_uc003jbp.2_Silent_p.V80V|BRD9_uc011cmc.1_RNA	NM_023924	NP_076413	Q9H8M2	BRD9_HUMAN	bromodomain containing 9 isoform 1	419							nucleic acid binding				0			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GCGCACACTGCACGCCTGTCT	0.592													26	296	---	---	---	---	PASS
TRIP13	9319	broad.mit.edu	37	5	904320	904320	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:904320T>G	uc003jbr.2	+	6	703	c.593T>G	c.(592-594)ATT>AGT	p.I198S	TRIP13_uc010ite.1_Missense_Mutation_p.I198S	NM_004237	NP_004228	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	198					double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity				0			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			AAATTGACAATTAGACTTTCA	0.383													123	132	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5463893	5463893	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5463893G>A	uc003jdm.3	+	13	4668	c.4446G>A	c.(4444-4446)GAG>GAA	p.E1482E		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1482										ovary(1)|central_nervous_system(1)	2						CATTTCAGGAGGCTCCATGTG	0.498													144	170	---	---	---	---	PASS
FASTKD3	79072	broad.mit.edu	37	5	7867909	7867909	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867909A>C	uc003jeb.2	-	2	425	c.288T>G	c.(286-288)AAT>AAG	p.N96K	FASTKD3_uc011cmp.1_Intron|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	96					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4						GACTCTCCTCATTTTTAACAT	0.413													28	167	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9054296	9054296	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9054296C>A	uc003jek.2	-	19	3304	c.2592G>T	c.(2590-2592)AGG>AGT	p.R864S		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	864	TSP type-1 6.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						AAGAGCGGGTCCTCATATAGT	0.582													33	143	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19473548	19473548	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19473548C>A	uc003jgc.2	-	12	2537	c.2160G>T	c.(2158-2160)CTG>CTT	p.L720L	CDH18_uc003jgd.2_Silent_p.L720L|CDH18_uc011cnm.1_3'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	720	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTGCTTCTGCCAGTCTTTGCT	0.498													33	131	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19473613	19473613	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19473613G>C	uc003jgc.2	-	12	2472	c.2095C>G	c.(2095-2097)CCC>GCC	p.P699A	CDH18_uc003jgd.2_Missense_Mutation_p.P699A|CDH18_uc011cnm.1_3'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	699	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TGGTGTCTGGGAGTGAGCTTC	0.502													46	193	---	---	---	---	PASS
ZFR	51663	broad.mit.edu	37	5	32395264	32395264	+	Splice_Site	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32395264C>T	uc003jhr.1	-	11	2059	c.1979_splice	c.e11+1	p.R660_splice	MIR579_hsa-mir-579|MI0003586_5'Flank	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein						multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		AAAGATATTACCTCATTTCCA	0.403													69	215	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35867558	35867558	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35867558C>A	uc003jjs.2	+	3	461	c.372C>A	c.(370-372)ACC>ACA	p.T124T	IL7R_uc011coo.1_Silent_p.T124T|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	124	Extracellular (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TAGACCTAACCACTATAGGTA	0.343													24	86	---	---	---	---	PASS
C9	735	broad.mit.edu	37	5	39306792	39306792	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39306792G>T	uc003jlv.3	-	9	1432	c.1343C>A	c.(1342-1344)ACC>AAC	p.T448N		NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor	448	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			ATCAATCACGGTTCCTCGGAG	0.383													32	153	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40852457	40852457	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40852457G>T	uc003jmg.2	+	3	1098	c.1023G>T	c.(1021-1023)AGG>AGT	p.R341S		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	341					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						TGACCGCTAGGGATTCAATCC	0.453													14	50	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40979897	40979897	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40979897C>A	uc003jmh.2	+	17	2350	c.2236C>A	c.(2236-2238)CAT>AAT	p.H746N	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	746	Complement control factor I module 1.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TTGCAAGATGCATGTTCTCCA	0.453													24	86	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41000864	41000864	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41000864C>T	uc003jmj.3	-	38	4756	c.4266G>A	c.(4264-4266)TGG>TGA	p.W1422*	HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.W977*	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1422							binding			ovary(6)|central_nervous_system(2)	8						AAAAAATCTTCCACCTTCTTC	0.453													7	33	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41019017	41019017	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41019017C>A	uc003jmj.3	-	25	3035	c.2545G>T	c.(2545-2547)GGC>TGC	p.G849C	HEATR7B2_uc003jmi.3_Missense_Mutation_p.G404C	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	849							binding			ovary(6)|central_nervous_system(2)	8						TCTGTCTGGCCTTCACTTTTC	0.502													24	64	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41057275	41057275	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41057275G>T	uc003jmj.3	-	9	1345	c.855C>A	c.(853-855)TGC>TGA	p.C285*	HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	285	HEAT 3.						binding			ovary(6)|central_nervous_system(2)	8						CTGGAGCTCTGCAGATCTGAA	0.413													13	59	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45353210	45353210	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45353210G>T	uc003jok.2	-	5	1394	c.1369C>A	c.(1369-1371)CTG>ATG	p.L457M		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	457	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ACCTCTCTCAGAGGATCATTG	0.348													32	118	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86633842	86633842	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86633842G>A	uc003kiw.2	+	5	1069	c.951G>A	c.(949-951)TGG>TGA	p.W317*	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Nonsense_Mutation_p.W140*|RASA1_uc011ctv.1_Nonsense_Mutation_p.W150*|RASA1_uc011ctw.1_Nonsense_Mutation_p.W151*|RASA1_uc010jaw.2_Nonsense_Mutation_p.W140*	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	317	SH3.				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AAGATGGATGGATGTGGGTTA	0.274													39	101	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90040857	90040857	+	Intron	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90040857C>G	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCTTTCCTTCCTGCAGCCCAC	0.418													139	325	---	---	---	---	PASS
SNX24	28966	broad.mit.edu	37	5	122337129	122337129	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122337129C>A	uc011cwo.1	+	5	543	c.374C>A	c.(373-375)TCA>TAA	p.S125*	SNX24_uc003ktf.2_Nonsense_Mutation_p.S125*|SNX24_uc010jcy.2_Nonsense_Mutation_p.S125*	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein	125	PX.				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		TCTGAAGAGTCAAGGTAAGGA	0.328													17	59	---	---	---	---	PASS
RAPGEF6	51735	broad.mit.edu	37	5	130834235	130834235	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130834235T>C	uc003kvn.1	-	12	1526	c.1320A>G	c.(1318-1320)ATA>ATG	p.I440M	RAPGEF6_uc003kvp.1_Missense_Mutation_p.I490M|RAPGEF6_uc003kvo.1_Missense_Mutation_p.I440M|RAPGEF6_uc010jdi.1_Missense_Mutation_p.I440M|RAPGEF6_uc010jdj.1_Missense_Mutation_p.I440M|RAPGEF6_uc003kvq.2_Missense_Mutation_p.I157M|RAPGEF6_uc003kvr.2_Missense_Mutation_p.I440M|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Missense_Mutation_p.I440M	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide	440	N-terminal Ras-GEF.				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GAAAATCTTCTATATAAGTTG	0.348													56	91	---	---	---	---	PASS
CAMLG	819	broad.mit.edu	37	5	134076787	134076787	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134076787C>T	uc003kzt.2	+	2	312	c.207C>T	c.(205-207)GAC>GAT	p.D69D	CAMLG_uc003kzu.2_Intron	NM_001745	NP_001736	P49069	CAMLG_HUMAN	calcium modulating ligand	69	Cytoplasmic (Potential).				defense response	endoplasmic reticulum|integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	AGCAGCAGGACAGTGATAAAC	0.423													35	65	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137903390	137903390	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137903390G>T	uc003ldf.2	-	6	665	c.557C>A	c.(556-558)GCA>GAA	p.A186E	HSPA9_uc011cyw.1_Missense_Mutation_p.A117E	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor	186					anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGCATTTTTTGCTGTGTGCCC	0.388													3	56	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140187880	140187880	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140187880G>T	uc003lhi.2	+	1	1209	c.1108G>T	c.(1108-1110)GCC>TCC	p.A370S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.A370S|PCDHA4_uc011daa.1_Missense_Mutation_p.A370S	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	370	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAGTCATCGCCCTGATCAG	0.493													41	88	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140563000	140563000	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140563000G>T	uc003liv.2	+	1	2021	c.866G>T	c.(865-867)AGT>ATT	p.S289I	PCDHB16_uc010jfw.1_Intron	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	289	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGATATTAGTAAAACTTTG	0.468													38	111	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140603567	140603567	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140603567A>T	uc003ljb.2	+	1	490	c.490A>T	c.(490-492)AGC>TGC	p.S164C	PCDHB14_uc011dal.1_Missense_Mutation_p.S11C	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	164	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGATGTCGGAAGCAACAGTCT	0.403													47	98	---	---	---	---	PASS
PCDHGA7	56108	broad.mit.edu	37	5	140763975	140763975	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140763975C>A	uc003lka.1	+	1	1509	c.1509C>A	c.(1507-1509)TCC>TCA	p.S503S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003ljz.1_Silent_p.S503S	NM_018920	NP_061743	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7 isoform 1	503	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTGTCCTCCTATGTCTCCA	0.488													24	45	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153030074	153030074	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153030074G>T	uc003lva.3	+	4	1010	c.645G>T	c.(643-645)CAG>CAT	p.Q215H	GRIA1_uc003luy.3_Missense_Mutation_p.Q215H|GRIA1_uc003luz.3_Missense_Mutation_p.Q120H|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.Q135H|GRIA1_uc011dcx.1_Missense_Mutation_p.Q146H|GRIA1_uc011dcy.1_Missense_Mutation_p.Q225H|GRIA1_uc011dcz.1_Missense_Mutation_p.Q225H|GRIA1_uc010jia.1_Missense_Mutation_p.Q195H	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	215	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCTTGGGCCAGGTAGTGAAAG	0.483													32	49	---	---	---	---	PASS
C5orf40	408263	broad.mit.edu	37	5	156770220	156770220	+	Missense_Mutation	SNP	G	T	T	rs140164881		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156770220G>T	uc003lwu.2	-	2	513	c.325C>A	c.(325-327)CCC>ACC	p.P109T	CYFIP2_uc003lwq.2_Intron|CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001001343	NP_001001343	Q8TBE3	FNDC9_HUMAN	hypothetical protein LOC408263	109						integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGATCTGGGGGTCTACCAGG	0.572											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	98	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7584884	7584884	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7584884G>T	uc003mxp.1	+	24	7668	c.7389G>T	c.(7387-7389)AAG>AAT	p.K2463N	DSP_uc003mxq.1_Missense_Mutation_p.K1864N	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2463	Plectin 12.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCCTCAGGAAGCGTAGAGTGG	0.418													73	118	---	---	---	---	PASS
GMNN	51053	broad.mit.edu	37	6	24786002	24786002	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24786002C>T	uc003nem.2	+	7	812	c.605C>T	c.(604-606)TCT>TTT	p.S202F	GMNN_uc003nen.2_Missense_Mutation_p.S202F	NM_015895	NP_056979	O75496	GEMI_HUMAN	geminin	202					M/G1 transition of mitotic cell cycle|negative regulation of cell cycle|negative regulation of DNA replication|negative regulation of transcription, DNA-dependent	cytosol|nucleoplasm	histone deacetylase binding			ovary(1)	1						GTATCTTCCTCTACGGATGCA	0.388													93	169	---	---	---	---	PASS
HIST1H3D	8351	broad.mit.edu	37	6	26197080	26197080	+	Silent	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26197080C>G	uc003ngv.2	-	2	796	c.399G>C	c.(397-399)GGG>GGC	p.G133G	HIST1H2BF_uc003ngx.2_5'Flank	NM_003530	NP_003521	P68431	H31_HUMAN	histone cluster 1, H3d	133					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				ACGCCCTCTCCCCACGAATGC	0.502													7	110	---	---	---	---	PASS
HIST1H2AL	8332	broad.mit.edu	37	6	27833365	27833365	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27833365G>T	uc003njw.2	+	1	259	c.233G>T	c.(232-234)CGC>CTC	p.R78L		NM_003511	NP_003502	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	78					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0						AAGAAGACCCGCATTATCCCG	0.662													84	151	---	---	---	---	PASS
SLC44A4	80736	broad.mit.edu	37	6	31833676	31833676	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31833676T>G	uc010jti.2	-	14	1527	c.1461A>C	c.(1459-1461)TTA>TTC	p.L487F	NEU1_uc003nxq.3_5'Flank|NEU1_uc010jtg.2_5'Flank|NEU1_uc003nxr.3_5'Flank|NEU1_uc010jth.2_5'Flank|NEU1_uc003nxs.3_5'Flank	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	487	Cytoplasmic (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	AGGCAGAGATTAAGGGGAAGG	0.612													61	83	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32064567	32064567	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32064567C>T	uc003nzl.2	-	3	1265	c.1063G>A	c.(1063-1065)GGC>AGC	p.G355S		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	355	EGF-like 7.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						ACGCAGCGGCCGTCCACGCAG	0.731													2	1	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34004071	34004071	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34004071C>A	uc003oir.3	-	8	1986	c.1816G>T	c.(1816-1818)GTG>TTG	p.V606L	GRM4_uc011dsn.1_Missense_Mutation_p.V559L|GRM4_uc010jvh.2_Missense_Mutation_p.V606L|GRM4_uc010jvi.2_Missense_Mutation_p.V298L|GRM4_uc003oio.2_Missense_Mutation_p.V298L|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.V466L|GRM4_uc003oiq.2_Missense_Mutation_p.V473L|GRM4_uc011dsm.1_Missense_Mutation_p.V437L	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	606	Helical; Name=1; (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	AAGGTGATCACCACGAACAAC	0.637													17	33	---	---	---	---	PASS
TMEM63B	55362	broad.mit.edu	37	6	44119705	44119705	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44119705G>C	uc003owr.2	+	19	1860	c.1796G>C	c.(1795-1797)TGC>TCC	p.C599S	TMEM63B_uc003ows.2_Missense_Mutation_p.C502S|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	599						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ATCCGGCTCTGCCTGGCGCGC	0.667											OREG0017465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	51	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50740556	50740556	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50740556C>A	uc003paf.2	+	8	1850	c.1338C>A	c.(1336-1338)GGC>GGA	p.G446G	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	446							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					TGAAAGAGGGCAAAACAGAAA	0.458													12	34	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51882241	51882241	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51882241G>T	uc003pah.1	-	34	5843	c.5567C>A	c.(5566-5568)TCA>TAA	p.S1856*	PKHD1_uc003pai.2_Nonsense_Mutation_p.S1856*	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1856	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGGAAACATTGACTCTGCCCA	0.502													55	180	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55216069	55216069	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55216069C>A	uc003pcm.1	+	5	475	c.389C>A	c.(388-390)TCC>TAC	p.S130Y		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	130	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GGGATGTGGTCCTGTTTGGAA	0.443													74	310	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56434790	56434790	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56434790C>A	uc003pdf.2	-	48	7413	c.7385G>T	c.(7384-7386)TGT>TTT	p.C2462F	DST_uc003pcz.3_Missense_Mutation_p.C2284F|DST_uc011dxj.1_Missense_Mutation_p.C2313F|DST_uc011dxk.1_Missense_Mutation_p.C2324F|DST_uc003pcy.3_Missense_Mutation_p.C1958F	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	4370					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTGTTCTTGACAAGAAGTTAC	0.299													33	71	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71238128	71238128	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71238128C>G	uc003pfj.2	+	14	3881	c.3748C>G	c.(3748-3750)CTG>GTG	p.L1250V	FAM135A_uc003pfi.2_Missense_Mutation_p.L1054V|FAM135A_uc003pfh.2_Missense_Mutation_p.L1037V|FAM135A_uc003pfl.2_Missense_Mutation_p.L917V|FAM135A_uc003pfn.2_Missense_Mutation_p.L456V|FAM135A_uc003pfo.1_Missense_Mutation_p.L621V|FAM135A_uc010kan.1_Missense_Mutation_p.L29V	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c	1250										central_nervous_system(1)	1						TGGAGTACATCTGATTGTCTG	0.388													42	162	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75861915	75861915	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75861915T>G	uc003phs.2	-	19	3933	c.3767A>C	c.(3766-3768)CAC>CCC	p.H1256P	COL12A1_uc003pht.2_Missense_Mutation_p.H92P	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1256	VWFA 3.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CTTGTCTCTGTGTGCATTTAA	0.448													21	107	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84368748	84368748	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84368748C>T	uc011dze.1	-	6	833	c.516G>A	c.(514-516)CAG>CAA	p.Q172Q	SNAP91_uc003pkb.2_Silent_p.Q137Q|SNAP91_uc003pkc.2_Silent_p.Q172Q|SNAP91_uc003pkd.2_Silent_p.Q172Q|SNAP91_uc003pka.2_Silent_p.Q172Q|SNAP91_uc011dzf.1_Silent_p.Q53Q	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	172					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		CAATTTGTCCCTGTAGTATTG	0.343													14	15	---	---	---	---	PASS
CGA	1081	broad.mit.edu	37	6	87797821	87797821	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87797821G>T	uc003plj.1	-							NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide						hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		CCACAAATTTGGTCACGCACC	0.388													3	30	---	---	---	---	PASS
MAP3K7	6885	broad.mit.edu	37	6	91263279	91263279	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91263279C>A	uc003pnz.1	-	7	796	c.634G>T	c.(634-636)GTC>TTC	p.V212F	MAP3K7_uc003poa.1_Missense_Mutation_p.V212F|MAP3K7_uc003pob.1_Missense_Mutation_p.V212F|MAP3K7_uc003poc.1_Missense_Mutation_p.V212F	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	212	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		CAGCTGAAGACGTCACATTTT	0.378													43	147	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97597879	97597879	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97597879T>C	uc003ppb.2	-	24	3766	c.3500A>G	c.(3499-3501)TAT>TGT	p.Y1167C	C6orf167_uc011eaf.1_Missense_Mutation_p.Y1127C	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	1167					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		CCTCATACCATAATCCTGGAT	0.403													19	81	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97715858	97715858	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97715858G>A	uc003ppb.2	-	8	984	c.718C>T	c.(718-720)CAG>TAG	p.Q240*	C6orf167_uc011eaf.1_Nonsense_Mutation_p.Q240*|C6orf167_uc010kcn.1_Nonsense_Mutation_p.Q14*|C6orf167_uc010kco.1_Nonsense_Mutation_p.Q14*|C6orf167_uc003ppc.2_Nonsense_Mutation_p.Q240*	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	240					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TTCATAAACTGATGACCATAT	0.303													14	50	---	---	---	---	PASS
DCBLD1	285761	broad.mit.edu	37	6	117866736	117866736	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117866736G>A	uc003pxs.2	+	14	1716	c.1591G>A	c.(1591-1593)GAT>AAT	p.D531N	GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_3'UTR|DCBLD1_uc003pxt.1_Missense_Mutation_p.D186N	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	531	Cytoplasmic (Potential).				cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		ACAAAAGTTAGATCTCATCAC	0.428													44	143	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132189172	132189172	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132189172G>C	uc011ecf.1	+	12	1199	c.1179G>C	c.(1177-1179)TTG>TTC	p.L393F	ENPP1_uc003qcy.2_Missense_Mutation_p.L23F	NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	393	Phosphodiesterase.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TCAAAGCCTTGCAGAGGGTTG	0.398													38	161	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132966668	132966668	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132966668T>G	uc003qdm.1	-	1	475	c.475A>C	c.(475-477)ATC>CTC	p.I159L		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	159	Extracellular (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	TCCAGAAAGATCATTCCAAAT	0.393													29	112	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133065517	133065517	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133065517G>T	uc003qdt.2	-	7	1496	c.1485C>A	c.(1483-1485)ACC>ACA	p.T495T	VNN2_uc003qds.2_Silent_p.T204T|VNN2_uc010kgb.2_Silent_p.T274T|VNN2_uc003qdv.2_Silent_p.T442T	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	495					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTGAATTGCTGGTCCCACATG	0.393													23	143	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137330606	137330606	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137330606C>T	uc003qhj.2	-	4	860	c.427G>A	c.(427-429)GCA>ACA	p.A143T	IL20RA_uc011edl.1_Missense_Mutation_p.A94T|IL20RA_uc003qhk.2_Missense_Mutation_p.A32T|IL20RA_uc010kgy.1_Intron|IL20RA_uc003qhi.2_5'Flank	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor	143	Extracellular (Potential).|Fibronectin type-III 2.					integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		GTAGTCAGTGCCACCTCTGGT	0.418													37	135	---	---	---	---	PASS
CITED2	10370	broad.mit.edu	37	6	139694413	139694413	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139694413G>C	uc003qip.1	-	2	913	c.669C>G	c.(667-669)ATC>ATG	p.I223M		NM_006079	NP_006070	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with	223	Asp/Glu-rich (acidic).				adrenal cortex formation|anti-apoptosis|cell proliferation|determination of left/right symmetry|heart development|liver development|negative regulation of cell migration|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell cycle|positive regulation of cell-cell adhesion|positive regulation of male gonad development|positive regulation of peroxisome proliferator activated receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of organ formation|response to estrogen stimulus|response to fluid shear stress|response to hypoxia|sex determination	cytoplasm|nuclear chromatin|nucleus	chromatin binding|LBD domain binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity				0	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		CTTCCTCGTCGATGAAATCAG	0.453													45	134	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144860477	144860477	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144860477G>T	uc003qkt.2	+	44	6509	c.6417G>T	c.(6415-6417)CTG>CTT	p.L2139L		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	2139					muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCAAATGGCTGAATAGAACTG	0.348													35	125	---	---	---	---	PASS
KATNA1	11104	broad.mit.edu	37	6	149916342	149916342	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149916342G>A	uc003qmr.1	-	10	1351	c.1306C>T	c.(1306-1308)CGC>TGC	p.R436C	KATNA1_uc003qms.2_Missense_Mutation_p.R436C|KATNA1_uc003qmt.2_3'UTR	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1	436					cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		CCTTCAATGCGCCTTCTCATT	0.378													26	88	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152651009	152651009	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152651009G>C	uc010kiw.2	-	78	15413	c.14811C>G	c.(14809-14811)AGC>AGG	p.S4937R	SYNE1_uc003qot.3_Missense_Mutation_p.S4866R|SYNE1_uc003qou.3_Missense_Mutation_p.S4937R|SYNE1_uc010kiz.2_Missense_Mutation_p.S692R	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4937	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGATTCTCAAGCTGGACTGGA	0.493										HNSCC(10;0.0054)			100	368	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152651010	152651010	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152651010C>T	uc010kiw.2	-	78	15412	c.14810G>A	c.(14809-14811)AGC>AAC	p.S4937N	SYNE1_uc003qot.3_Missense_Mutation_p.S4866N|SYNE1_uc003qou.3_Missense_Mutation_p.S4937N|SYNE1_uc010kiz.2_Missense_Mutation_p.S692N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4937	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATTCTCAAGCTGGACTGGAC	0.493										HNSCC(10;0.0054)			99	359	---	---	---	---	PASS
MYCT1	80177	broad.mit.edu	37	6	153042970	153042970	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153042970G>T	uc003qpd.3	+	2	298	c.290G>T	c.(289-291)AGA>ATA	p.R97I	MYCT1_uc010kjc.1_Intron|MYCT1_uc003qpc.3_Missense_Mutation_p.R97I	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1	97	Bipartite nuclear localization signal (Potential).					nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		TCTCGAAGAAGAAGAGCCAGT	0.493													47	152	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166578358	166578358	+	Intron	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166578358C>G	uc003quu.1	-						T_uc003qut.1_Intron|T_uc003quv.1_Intron	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T						anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		ATCTGAAAAACAAGAAATTGC	0.323									Chordoma_Familial_Clustering_of				18	74	---	---	---	---	PASS
GPR31	2853	broad.mit.edu	37	6	167570656	167570656	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167570656C>T	uc011egq.1	-	1	664	c.664G>A	c.(664-666)GCA>ACA	p.A222T		NM_005299	NP_005290	O00270	GPR31_HUMAN	G protein-coupled receptor 31	222	Helical; Name=6; (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GTGACCAGTGCCTGGGCCCGC	0.582													30	161	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167752259	167752259	+	Nonsense_Mutation	SNP	C	T	T	rs146731987		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167752259C>T	uc003qvs.1	+	2	260	c.172C>T	c.(172-174)CGA>TGA	p.R58*	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	58					protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CCCTCCCAGGCGAGGCCGCCC	0.458													15	41	---	---	---	---	PASS
PSMB1	5689	broad.mit.edu	37	6	170862340	170862340	+	5'UTR	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170862340G>A	uc011ehe.1	-	1					PSMB1_uc003qxq.2_RNA|PSMB1_uc003qxr.2_5'Flank|TBP_uc003qxt.2_5'Flank|TBP_uc003qxu.2_5'Flank|TBP_uc011ehf.1_5'Flank	NM_002793	NP_002784	P20618	PSB1_HUMAN	proteasome beta 1 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cell junction|cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)	TCGCACGGCTGCGCCTGCGGA	0.617													7	10	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18688287	18688287	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18688287A>C	uc003suh.2	+	10	1480	c.1439A>C	c.(1438-1440)CAG>CCG	p.Q480P	HDAC9_uc003sue.2_Missense_Mutation_p.Q480P|HDAC9_uc011jyd.1_Missense_Mutation_p.Q480P|HDAC9_uc003sui.2_Missense_Mutation_p.Q483P|HDAC9_uc003suj.2_Missense_Mutation_p.Q439P|HDAC9_uc011jya.1_Missense_Mutation_p.Q477P|HDAC9_uc003sua.1_Missense_Mutation_p.Q458P|HDAC9_uc011jyb.1_Missense_Mutation_p.Q436P|HDAC9_uc003sud.1_Missense_Mutation_p.Q480P|HDAC9_uc011jyc.1_Missense_Mutation_p.Q439P|HDAC9_uc003suf.1_Missense_Mutation_p.Q511P|HDAC9_uc010kud.1_Missense_Mutation_p.Q483P|HDAC9_uc011jye.1_Missense_Mutation_p.Q452P|HDAC9_uc011jyf.1_Missense_Mutation_p.Q403P|HDAC9_uc010kue.1_Missense_Mutation_p.Q223P	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	480					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	CAATACCAGCAGCAGATCCAC	0.473													5	25	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18914192	18914192	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18914192C>A	uc003suh.2	+	21	2808	c.2767C>A	c.(2767-2769)CTA>ATA	p.L923I	HDAC9_uc003sue.2_Missense_Mutation_p.L923I|HDAC9_uc003sui.2_Missense_Mutation_p.L926I|HDAC9_uc003suj.2_Missense_Mutation_p.L882I|HDAC9_uc003suk.2_Missense_Mutation_p.L171I	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	923	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	CACCCCTCCTCTAGGAGGGTA	0.458													10	12	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31848707	31848707	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31848707C>A	uc003tcm.1	-	16	2298	c.1829G>T	c.(1828-1830)GGT>GTT	p.G610V	PDE1C_uc003tcn.1_Missense_Mutation_p.G610V|PDE1C_uc003tco.1_Missense_Mutation_p.G670V|PDE1C_uc003tcr.2_Missense_Mutation_p.G610V|PDE1C_uc003tcs.2_Missense_Mutation_p.G610V	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	610					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			CTTATTTTTACCATCTTTGAA	0.323													8	83	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31848708	31848708	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31848708C>A	uc003tcm.1	-	16	2297	c.1828G>T	c.(1828-1830)GGT>TGT	p.G610C	PDE1C_uc003tcn.1_Missense_Mutation_p.G610C|PDE1C_uc003tco.1_Missense_Mutation_p.G670C|PDE1C_uc003tcr.2_Missense_Mutation_p.G610C|PDE1C_uc003tcs.2_Missense_Mutation_p.G610C	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	610					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TTATTTTTACCATCTTTGAAG	0.318													8	81	---	---	---	---	PASS
DBNL	28988	broad.mit.edu	37	7	44097376	44097376	+	Intron	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44097376T>A	uc003tjp.3	+						DBNL_uc003tjn.2_Intron|DBNL_uc003tjo.3_Intron|DBNL_uc003tjr.3_Intron|DBNL_uc003tjq.3_Intron|DBNL_uc011kbm.1_Intron|DBNL_uc011kbn.1_Intron|DBNL_uc011kbo.1_Intron|DBNL_uc011kbp.1_Intron|DBNL_uc011kbq.1_Intron|DBNL_uc011kbr.1_Intron|DBNL_uc011kbs.1_Intron	NM_001014436	NP_001014436	Q9UJU6	DBNL_HUMAN	drebrin-like isoform b						activation of JUN kinase activity|cellular component disassembly involved in apoptosis|endocytosis|Rac protein signal transduction	cell cortex|cytoskeleton|cytosol|lamellipodium	actin binding|enzyme activator activity|identical protein binding			skin(1)	1						TGCTGTCCCCTACAGGGCTCT	0.562													5	76	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48353926	48353926	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48353926C>A	uc003toq.2	+	26	9804	c.9779C>A	c.(9778-9780)TCT>TAT	p.S3260Y	ABCA13_uc010kys.1_Missense_Mutation_p.S334Y|ABCA13_uc003tos.1_Missense_Mutation_p.S86Y	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3260					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTTAGCGATTCTAATATGTTT	0.363													14	38	---	---	---	---	PASS
ZNF713	349075	broad.mit.edu	37	7	56007350	56007350	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56007350C>G	uc003trc.1	+	4	982	c.944C>G	c.(943-945)TCC>TGC	p.S315C	ZNF713_uc003tra.1_Missense_Mutation_p.S328C|MRPS17_uc003trb.2_Intron	NM_182633	NP_872439	Q8N859	ZN713_HUMAN	zinc finger protein 713	315	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CAGCATTCATCCTTTACTCAA	0.403													59	221	---	---	---	---	PASS
ELN	2006	broad.mit.edu	37	7	73466304	73466304	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73466304G>T	uc003tzw.2	+	17	1031	c.940G>T	c.(940-942)GCC>TCC	p.A314S	RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_RNA|ELN_uc011kfe.1_Missense_Mutation_p.A283S|ELN_uc003tzn.2_Missense_Mutation_p.A314S|ELN_uc003tzz.2_Missense_Mutation_p.A278S|ELN_uc003tzo.2_Missense_Mutation_p.A300S|ELN_uc003tzp.2_Missense_Mutation_p.A270S|ELN_uc003tzq.2_Missense_Mutation_p.A197S|ELN_uc003tzr.2_RNA|ELN_uc003tzs.2_Missense_Mutation_p.A314S|ELN_uc003tzt.2_Missense_Mutation_p.A319S|ELN_uc003tzu.2_Missense_Mutation_p.A319S|ELN_uc003tzv.2_Missense_Mutation_p.A304S|ELN_uc003tzx.2_Missense_Mutation_p.A304S|ELN_uc011kff.1_Missense_Mutation_p.A314S|ELN_uc003tzy.2_Missense_Mutation_p.A309S	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	314	Ala-rich.				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	CGCTAAGGCAGCCAAGTATGG	0.622			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome				OREG0018112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	45	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81355244	81355244	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81355244C>A	uc003uhl.2	-	9	1295	c.1130G>T	c.(1129-1131)TGC>TTC	p.C377F	HGF_uc003uhm.2_Missense_Mutation_p.C372F	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	377	Kringle 3.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						AATTTGGGAGCAGTAGCCAAC	0.453													81	272	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93116264	93116264	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93116264C>T	uc003umv.1	-	3	345	c.84G>A	c.(82-84)TTG>TTA	p.L28L	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Silent_p.L10L|CALCR_uc003umw.2_Silent_p.L10L|MIR489_hsa-mir-489|MI0003124_5'Flank	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	10					activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	GAAACAGTGCCAAGCACCGGC	0.303													48	190	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94540608	94540608	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94540608G>A	uc003unp.2	+	2	1465	c.1183G>A	c.(1183-1185)GTG>ATG	p.V395M	PPP1R9A_uc010lfj.2_Missense_Mutation_p.V395M|PPP1R9A_uc011kif.1_Missense_Mutation_p.V395M|PPP1R9A_uc003unq.2_Missense_Mutation_p.V395M|PPP1R9A_uc011kig.1_Missense_Mutation_p.V395M	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	395						cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TGGTTCCCATGTGTACATGCA	0.438										HNSCC(28;0.073)			18	95	---	---	---	---	PASS
ACN9	57001	broad.mit.edu	37	7	96810378	96810378	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96810378G>C	uc003uoo.3	+	2	1360	c.229G>C	c.(229-231)GGA>CGA	p.G77R		NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN	ACN9 homolog precursor	77					regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					AAATTCAACTGGAAAAGCATG	0.363													22	77	---	---	---	---	PASS
ZNF498	221785	broad.mit.edu	37	7	99226964	99226964	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99226964G>A	uc003url.1	+	8	1283	c.956G>A	c.(955-957)GGC>GAC	p.G319D	ZNF498_uc003urm.1_Missense_Mutation_p.G155D|ZNF498_uc010lge.1_Missense_Mutation_p.G155D|ZNF498_uc003urn.2_Intron|ZNF498_uc010lgf.1_Missense_Mutation_p.G247D|ZNF498_uc003uro.1_Missense_Mutation_p.G103D	NM_145115	NP_660090	Q6NSZ9	ZN498_HUMAN	zinc finger and SCAN domain containing 25	319					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					GGCCCTGCAGGCAGTGCGCCT	0.652													37	87	---	---	---	---	PASS
AP4M1	9179	broad.mit.edu	37	7	99699370	99699370	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99699370G>A	uc003utb.3	+	1	241	c.33G>A	c.(31-33)AAG>AAA	p.K11K	MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'UTR|MCM7_uc003usx.1_5'UTR|AP4M1_uc011kjg.1_Silent_p.K11K|AP4M1_uc010lgl.1_Silent_p.K11K|AP4M1_uc003utc.3_Silent_p.K11K|AP4M1_uc010lgm.2_5'UTR|AP4M1_uc003utd.2_Silent_p.K11K|AP4M1_uc011kjh.1_5'Flank|AP4M1_uc003ute.3_5'Flank|AP4M1_uc003utf.3_5'Flank	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	11					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGTCCTCCAAGGGGGACCCGC	0.647													8	68	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106509321	106509321	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106509321C>T	uc003vdv.3	+	2	1400	c.1315C>T	c.(1315-1317)CCA>TCA	p.P439S	PIK3CG_uc003vdu.2_Missense_Mutation_p.P439S|PIK3CG_uc003vdw.2_Missense_Mutation_p.P439S	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	439					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CGGTAAAGCTCCAGCACTGTC	0.512													49	152	---	---	---	---	PASS
DLD	1738	broad.mit.edu	37	7	107557360	107557360	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107557360C>T	uc003vet.2	+	10	1107	c.997C>T	c.(997-999)CCC>TCC	p.P333S	DLD_uc011kmg.1_Missense_Mutation_p.P285S|DLD_uc011kmh.1_Missense_Mutation_p.P310S|DLD_uc011kmi.1_Missense_Mutation_p.P234S	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor	333					branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	TGAACTAGATCCCAGAGGTAG	0.353													50	167	---	---	---	---	PASS
C7orf66	154907	broad.mit.edu	37	7	108524507	108524507	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108524507C>A	uc003vfo.2	-	1	131	c.83G>T	c.(82-84)AGT>ATT	p.S28I		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	28	Helical; (Potential).					integral to membrane				ovary(2)	2						TGCAAGGCAACTGAGGCTCCA	0.383													17	77	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127569298	127569298	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127569298G>T	uc003vmi.2	+	15	1811	c.1585G>T	c.(1585-1587)GCT>TCT	p.A529S	SND1_uc010lle.2_Missense_Mutation_p.A182S	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	529	TNase-like 4.				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TCGTTCTGAAGCTGTGGTGGA	0.428													62	187	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128485140	128485140	+	Missense_Mutation	SNP	C	A	A	rs117864464	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128485140C>A	uc003vnz.3	+	21	3830	c.3621C>A	c.(3619-3621)AAC>AAA	p.N1207K	FLNC_uc003voa.3_Missense_Mutation_p.N1207K	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1207	Filamin 10.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						TCCACAACAACGCGGATGGCA	0.607													30	74	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135279324	135279324	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135279324A>T	uc003vsw.2	+	13	1891	c.1860A>T	c.(1858-1860)GAA>GAT	p.E620D		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	620					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CACTCTGTGAACACCCTCAGT	0.428													49	115	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700605	136700605	+	Silent	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700605C>G	uc003vtf.1	+	4	1616	c.993C>G	c.(991-993)ACC>ACG	p.T331T	CHRM2_uc003vtg.1_Silent_p.T331T|CHRM2_uc003vtj.1_Silent_p.T331T|CHRM2_uc003vtk.1_Silent_p.T331T|CHRM2_uc003vtl.1_Silent_p.T331T|CHRM2_uc003vtm.1_Silent_p.T331T|CHRM2_uc003vti.1_Silent_p.T331T|CHRM2_uc003vto.1_Silent_p.T331T|CHRM2_uc003vtn.1_Silent_p.T331T|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	331	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	GCACCAAGACCCCAAAAAGTG	0.453													35	102	---	---	---	---	PASS
LUC7L2	51631	broad.mit.edu	37	7	139026191	139026191	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139026191C>G	uc011kqt.1	+	1	295	c.61C>G	c.(61-63)CTG>GTG	p.L21V	LUC7L2_uc011kqs.1_Intron|C7orf55_uc003vuw.3_Missense_Mutation_p.L21V	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2	Error:Variant_position_missing_in_Q9Y383_after_alignment							enzyme binding|metal ion binding				0	Melanoma(164;0.242)					GTTGCGCTACCTGAGCGCGGC	0.652											OREG0018357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	71	---	---	---	---	PASS
RAB19	401409	broad.mit.edu	37	7	140125917	140125917	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140125917G>C	uc010lni.2	+	4	819	c.621G>C	c.(619-621)CAG>CAC	p.Q207H	RAB19_uc011krc.1_Missense_Mutation_p.Q207H	NM_001008749	NP_001008749	A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family	207					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0	Melanoma(164;0.0142)					TTATGGCCCAGGGTCCAAGTG	0.577													33	86	---	---	---	---	PASS
FAM131B	9715	broad.mit.edu	37	7	143054027	143054027	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143054027T>A	uc003wct.2	-	6	2321	c.615A>T	c.(613-615)GAA>GAT	p.E205D	FAM131B_uc010loz.2_Missense_Mutation_p.E173D|FAM131B_uc003wcu.3_Missense_Mutation_p.E205D|FAM131B_uc010lpa.2_Missense_Mutation_p.E233D	NM_014690	NP_055505	Q86XD5	F131B_HUMAN	hypothetical protein LOC9715 isoform b	205											0	Melanoma(164;0.205)					GATCGCTGGCTTCCCAGGCAT	0.552													32	64	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143098452	143098452	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143098452C>A	uc003wcz.2	-	3	484	c.397G>T	c.(397-399)GTG>TTG	p.V133L		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	133	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TGAATGCCCACATCCTGGTCA	0.607													102	179	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	148964026	148964026	+	RNA	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148964026G>T	uc003wfr.3	+	3		c.700G>T								Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		ACGAGACGCTGGTCTCCCTGG	0.562													52	139	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149129236	149129236	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149129236C>A	uc003wfv.2	-	6	2290	c.2127G>T	c.(2125-2127)CTG>CTT	p.L709L		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	709	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGTGGCGCAGCAGGTGCGAGG	0.637													35	75	---	---	---	---	PASS
ZNF746	155061	broad.mit.edu	37	7	149174139	149174139	+	Splice_Site	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149174139C>A	uc003wfw.2	-	6	984	c.713_splice	c.e6-1	p.G238_splice	ZNF746_uc010lpi.2_Splice_Site_p.G238_splice	NM_152557	NP_689770	Q6NUN9	ZN746_HUMAN	zinc finger protein 746 isoform 2						negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|breast(1)	3	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GAATGGACACCTGCGGTAAGG	0.617													21	43	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9592555	9592555	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9592555G>T	uc003wss.2	+	16	2499	c.2494G>T	c.(2494-2496)GAC>TAC	p.D832Y	TNKS_uc011kww.1_Missense_Mutation_p.D595Y|TNKS_uc010lrt.1_RNA	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	832					mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		CAACTGCAGAGACACCCAGGG	0.542													35	94	---	---	---	---	PASS
EFHA2	286097	broad.mit.edu	37	8	16962001	16962001	+	Splice_Site	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16962001G>A	uc003wxd.2	+	10	1127	c.1085_splice	c.e10+1	p.R362_splice		NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN	EF-hand domain family, member A2							integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)		ATTTTTATAGGTGAGCttatt	0.308													19	50	---	---	---	---	PASS
STC1	6781	broad.mit.edu	37	8	23708999	23708999	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23708999C>A	uc003xdw.1	-	3	591	c.307G>T	c.(307-309)GTC>TTC	p.V103F		NM_003155	NP_003146	P52823	STC1_HUMAN	stanniocalcin 1 precursor	103					cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TTGGAGGTGACCCCGTTGGCG	0.512													29	85	---	---	---	---	PASS
NEFM	4741	broad.mit.edu	37	8	24771526	24771526	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24771526A>T	uc003xed.3	+	1	253	c.220A>T	c.(220-222)AGC>TGC	p.S74C	NEFM_uc011lac.1_Missense_Mutation_p.S74C|NEFM_uc010lue.2_5'Flank|uc010luc.1_3'UTR	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	74	Head.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		CGCCGAGAGCAGCCTTGACTT	0.682													17	15	---	---	---	---	PASS
WRN	7486	broad.mit.edu	37	8	30999085	30999085	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30999085A>G	uc003xio.3	+	25	3895	c.3107A>G	c.(3106-3108)AAA>AGA	p.K1036R	WRN_uc010lvk.2_Missense_Mutation_p.K503R	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	1036					base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CGGTATAACAAATTTATGAAG	0.408			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				36	151	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35579763	35579763	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35579763G>T	uc003xjr.1	+	9	1481	c.1153G>T	c.(1153-1155)GGC>TGC	p.G385C	UNC5D_uc003xjs.1_Missense_Mutation_p.G380C|UNC5D_uc003xju.1_5'Flank|UNC5D_uc003xjt.1_Missense_Mutation_p.G143C	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	385	Helical; (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TTTGTACTCGGGCTTGGGTGC	0.522													81	252	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39521396	39521396	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39521396C>T	uc003xni.2	+	13	1313	c.1313C>T	c.(1312-1314)ACA>ATA	p.T438I	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Missense_Mutation_p.T414I	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	438	Disintegrin.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CCATGTTGTACATCAAAGTGT	0.328													29	104	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52323863	52323863	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52323863T>A	uc003xqu.3	-	16	2110	c.2009A>T	c.(2008-2010)CAG>CTG	p.Q670L	PXDNL_uc003xqt.3_5'Flank	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	670					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCGTATCAGCTGCAGCGTGTG	0.522													8	11	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52733171	52733171	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52733171C>A	uc003xqx.3	-	6	1155	c.814G>T	c.(814-816)GCT>TCT	p.A272S	PCMTD1_uc011ldm.1_Missense_Mutation_p.A142S|PCMTD1_uc003xqw.3_Missense_Mutation_p.A272S|PCMTD1_uc011ldn.1_Missense_Mutation_p.A84S|PCMTD1_uc010lya.2_Missense_Mutation_p.A196S	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	272						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTGGGTGGAGCCCTTTGAGGA	0.403													10	383	---	---	---	---	PASS
TCEA1	6917	broad.mit.edu	37	8	54891624	54891624	+	Silent	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54891624T>A	uc003xru.2	-	8	1109	c.786A>T	c.(784-786)ACA>ACT	p.T262T	TCEA1_uc003xrv.2_Silent_p.T241T|TCEA1_uc011ldw.1_Silent_p.T78T|TCEA1_uc010lyg.2_RNA	NM_006756	NP_006747	P23193	TCEA1_HUMAN	transcription elongation factor A 1 isoform 1	262	TFIIS-type.				positive regulation of viral transcription|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|translation elongation factor activity|zinc ion binding				0		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			ATTTGCCACATGTGAACAAGT	0.383			T	PLAG1	salivary adenoma								38	91	---	---	---	---	PASS
FAM110B	90362	broad.mit.edu	37	8	59059414	59059414	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059414G>C	uc003xtj.1	+	5	1505	c.625G>C	c.(625-627)GTG>CTG	p.V209L		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	209						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GGTGACCAGCGTGAAGCCCCT	0.657													37	120	---	---	---	---	PASS
COPS5	10987	broad.mit.edu	37	8	67971611	67971611	+	Silent	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67971611C>G	uc003xxe.2	-	2	544	c.213G>C	c.(211-213)TCG>TCC	p.S71S	COPS5_uc003xxd.2_Silent_p.S7S|COPS5_uc003xxf.2_Silent_p.S116S|COPS5_uc010lyu.1_5'Flank|COPS5_uc010lyv.1_Silent_p.S71S	NM_006837	NP_006828	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	71	MPN.				cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AGTTGCCTCCCGATCTGGCAT	0.428													73	203	---	---	---	---	PASS
TRAM1	23471	broad.mit.edu	37	8	71520391	71520391	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71520391C>A	uc003xyo.1	-	1	214	c.44G>T	c.(43-45)AGC>ATC	p.S15I	TRAM1_uc011lfc.1_Intron	NM_014294	NP_055109	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	15	Cytoplasmic (Potential).				cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity			ovary(1)	1			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			GAATTCGTGGCTCAGCACTGG	0.647													36	95	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95511670	95511670	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95511670T>A	uc003ygo.1	-	17	4175	c.4162A>T	c.(4162-4164)AAG>TAG	p.K1388*	KIAA1429_uc010maz.1_Intron	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1388					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CCTGTGTCCTTACTAAATGTG	0.269													17	46	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113275906	113275906	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113275906C>T	uc003ynu.2	-	61	9983	c.9824G>A	c.(9823-9825)GGG>GAG	p.G3275E	CSMD3_uc003yns.2_Missense_Mutation_p.G2477E|CSMD3_uc003ynt.2_Missense_Mutation_p.G3235E|CSMD3_uc011lhx.1_Missense_Mutation_p.G3106E	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3275	Sushi 25.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGTACCATTCCCTACACAGGT	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			21	70	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113657367	113657367	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113657367G>T	uc003ynu.2	-	20	3440	c.3281C>A	c.(3280-3282)ACA>AAA	p.T1094K	CSMD3_uc003yns.2_Missense_Mutation_p.T366K|CSMD3_uc003ynt.2_Missense_Mutation_p.T1054K|CSMD3_uc011lhx.1_Missense_Mutation_p.T990K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1094	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AACAGTCCATGTACAATTCAG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			26	88	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133899310	133899310	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133899310C>G	uc003ytw.2	+	9	1734	c.1693C>G	c.(1693-1695)CTC>GTC	p.L565V		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	565					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCAAAATGCCCTCAAATTCCT	0.448													55	170	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144996487	144996487	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144996487C>A	uc003zaf.1	-	32	8083	c.7913G>T	c.(7912-7914)AGC>ATC	p.S2638I	PLEC_uc003zab.1_Missense_Mutation_p.S2501I|PLEC_uc003zac.1_Missense_Mutation_p.S2505I|PLEC_uc003zad.2_Missense_Mutation_p.S2501I|PLEC_uc003zae.1_Missense_Mutation_p.S2469I|PLEC_uc003zag.1_Missense_Mutation_p.S2479I|PLEC_uc003zah.2_Missense_Mutation_p.S2487I|PLEC_uc003zaj.2_Missense_Mutation_p.S2528I	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2638	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CTGTAGCAGGCTGTCCTTTTC	0.592													30	59	---	---	---	---	PASS
GPR172A	79581	broad.mit.edu	37	8	145584541	145584541	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145584541C>T	uc003zcc.1	+	5	1361	c.1204C>T	c.(1204-1206)CGG>TGG	p.R402W	FBXL6_uc003zbz.2_5'Flank|FBXL6_uc003zca.2_5'Flank|FBXL6_uc003zcb.2_5'Flank|FBXL6_uc010mfx.2_5'Flank|GPR172A_uc003zcd.1_Missense_Mutation_p.R402W|GPR172A_uc003zce.1_Missense_Mutation_p.R402W|GPR172A_uc010mfy.1_Missense_Mutation_p.R402W|GPR172A_uc003zcf.1_Missense_Mutation_p.R402W|GPR172A_uc011llc.1_Missense_Mutation_p.R314W	NM_024531	NP_078807	Q9HAB3	RFT3_HUMAN	G protein-coupled receptor 172A precursor	402						integral to plasma membrane	receptor activity|riboflavin transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGGCGGGGGCCGGCCGGCATT	0.657													18	37	---	---	---	---	PASS
SLC39A4	55630	broad.mit.edu	37	8	145640760	145640760	+	Missense_Mutation	SNP	G	T	T	rs141890870	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145640760G>T	uc003zcq.2	-	3	618	c.518C>A	c.(517-519)GCG>GAG	p.A173E	SLC39A4_uc003zcm.1_5'Flank|SLC39A4_uc003zcn.2_5'Flank|SLC39A4_uc003zco.2_Splice_Site|SLC39A4_uc003zcp.2_Missense_Mutation_p.A148E	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),	173	Extracellular (Potential).					cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			CGGAGCCCCCGCCCCCACCGC	0.682													6	16	---	---	---	---	PASS
KIAA1432	57589	broad.mit.edu	37	9	5763163	5763163	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5763163A>G	uc003zji.2	+	18	1992	c.1899A>G	c.(1897-1899)GTA>GTG	p.V633V	KIAA1432_uc003zjh.2_Silent_p.V633V|KIAA1432_uc003zjl.3_Silent_p.V596V|KIAA1432_uc003zjj.1_Silent_p.V175V	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	712						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		CTCCTGTTGTACTAGCCCAGT	0.468													40	123	---	---	---	---	PASS
ACER2	340485	broad.mit.edu	37	9	19446415	19446415	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19446415T>A	uc003zny.1	+	5	798	c.640T>A	c.(640-642)TGG>AGG	p.W214R	ACER2_uc003znx.1_RNA|ACER2_uc003znz.1_Missense_Mutation_p.W165R	NM_001010887	NP_001010887	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2	214	Helical; (Potential).				ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						GCACTGCATGTGGTAAGCCCC	0.602													65	174	---	---	---	---	PASS
C9orf131	138724	broad.mit.edu	37	9	35045314	35045314	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35045314C>G	uc003zvw.2	+	2	2717	c.2688C>G	c.(2686-2688)AGC>AGG	p.S896R	C9orf131_uc003zvu.2_Missense_Mutation_p.S848R|C9orf131_uc003zvv.2_Missense_Mutation_p.S823R|C9orf131_uc003zvx.2_Missense_Mutation_p.S861R	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	896											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			AGATGGTGAGCCAGGTCCCAT	0.552													118	379	---	---	---	---	PASS
PIGO	84720	broad.mit.edu	37	9	35095564	35095564	+	Splice_Site	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35095564C>A	uc003zwd.2	-	2	396	c.0_splice	c.e2-1		PIGO_uc003zwc.1_Translation_Start_Site|PIGO_uc003zwe.2_Splice_Site|PIGO_uc003zwf.2_Splice_Site|PIGO_uc003zwg.1_Splice_Site	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TTTCTGCATCCTGATAGGGGT	0.527													13	41	---	---	---	---	PASS
RNF38	152006	broad.mit.edu	37	9	36356479	36356479	+	Intron	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36356479G>A	uc003zzh.2	-						RNF38_uc003zzi.2_Intron|RNF38_uc003zzj.2_Intron|RNF38_uc003zzk.2_Intron|RNF38_uc003zzl.2_Intron|RNF38_uc003zzm.2_Intron	NM_022781	NP_073618	Q9H0F5	RNF38_HUMAN	ring finger protein 38 isoform 1								zinc ion binding			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)			ATCTGTAAGAGAAACCATTAC	0.358													9	122	---	---	---	---	PASS
FGD3	89846	broad.mit.edu	37	9	95797692	95797692	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95797692G>T	uc004asw.2	+	18	2627	c.1999G>T	c.(1999-2001)GAC>TAC	p.D667Y	FGD3_uc004asx.2_Missense_Mutation_p.D666Y|FGD3_uc004asz.2_Missense_Mutation_p.D667Y|FGD3_uc011luc.1_Missense_Mutation_p.D270Y	NM_001083536	NP_001077005	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	667	PH 2.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(1)|breast(1)	2						GGAGAGGCTGGACTCGGGGCA	0.657													9	11	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113547183	113547183	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113547183A>G	uc004bey.2	+	11	1571	c.1473A>G	c.(1471-1473)ACA>ACG	p.T491T	MUSK_uc004bez.1_Silent_p.T71T	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	491	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						TCTCACCTACATACTCCATGA	0.428													62	127	---	---	---	---	PASS
UGCG	7357	broad.mit.edu	37	9	114685132	114685132	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114685132G>C	uc004bft.2	+	3	534	c.244G>C	c.(244-246)GAA>CAA	p.E82Q		NM_003358	NP_003349	Q16739	CEGT_HUMAN	ceramide glucosyltransferase	82	Cytoplasmic (Potential).				epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	TGACTAGTATGAAGTGCTCCT	0.313													28	68	---	---	---	---	PASS
ROD1	9991	broad.mit.edu	37	9	115038169	115038169	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115038169T>C	uc004bfw.2	-	4	430	c.243A>G	c.(241-243)CCA>CCG	p.P81P	ROD1_uc004bfv.2_Silent_p.P87P|ROD1_uc004bfx.2_Silent_p.P84P|ROD1_uc011lwu.1_Silent_p.P53P|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Silent_p.P53P	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1	81	RRM 1.				anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						CTTTGCCAAATGGTAGACCTA	0.323													49	93	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119202971	119202971	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119202971C>T	uc004bjs.1	-	22	3800	c.3699G>A	c.(3697-3699)CTG>CTA	p.L1233L	ASTN2_uc004bjr.1_Silent_p.L1229L|ASTN2_uc004bjt.1_Silent_p.L1182L|ASTN2_uc004bjp.1_Silent_p.L326L|ASTN2_uc004bjq.1_Silent_p.L285L|ASTN2_uc011lxr.1_Silent_p.L285L|ASTN2_uc011lxs.1_Silent_p.L285L|ASTN2_uc011lxt.1_Silent_p.L285L|ASTN2_uc004bjo.1_Silent_p.L14L	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	1233	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GGACTCGGAACAGCATCGAGG	0.498													54	93	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119738430	119738430	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119738430G>T	uc004bjs.1	-	9	1815	c.1714C>A	c.(1714-1716)CTG>ATG	p.L572M	ASTN2_uc004bjr.1_Missense_Mutation_p.L572M|ASTN2_uc004bjt.1_Missense_Mutation_p.L521M	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	572	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CCTGTCACCAGATCATAGCCC	0.488													22	39	---	---	---	---	PASS
NR5A1	2516	broad.mit.edu	37	9	127245163	127245163	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127245163C>T	uc004boo.1	-	7	1447	c.1260G>A	c.(1258-1260)CTG>CTA	p.L420L		NM_004959	NP_004950	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	420	Important for dimerization.				cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						CCAGGCACAGCAGCAGCTGCT	0.617													15	42	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128099688	128099688	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128099688C>T	uc010mwx.2	+	17	3021	c.2695C>T	c.(2695-2697)CGA>TGA	p.R899*	GAPVD1_uc011lzs.1_Nonsense_Mutation_p.R899*|GAPVD1_uc004bpp.2_Nonsense_Mutation_p.R926*|GAPVD1_uc004bpq.2_Nonsense_Mutation_p.R899*|GAPVD1_uc004bpr.2_Nonsense_Mutation_p.R878*|GAPVD1_uc004bps.2_Nonsense_Mutation_p.R899*|GAPVD1_uc010mwy.1_Nonsense_Mutation_p.R732*	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	899					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						gAGACTAGTTCGAAGCAGGAG	0.299													38	93	---	---	---	---	PASS
TTC16	158248	broad.mit.edu	37	9	130479668	130479668	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130479668C>T	uc004brq.1	+	3	314	c.247C>T	c.(247-249)CTC>TTC	p.L83F	PTRH1_uc004brm.2_5'Flank|PTRH1_uc004bro.2_5'Flank|PTRH1_uc010mxm.2_5'Flank|PTRH1_uc011mah.1_Intron|TTC16_uc011mai.1_Missense_Mutation_p.L83F|TTC16_uc004brr.1_Missense_Mutation_p.L76F|TTC16_uc010mxn.1_5'Flank	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	83	TPR 1.						binding				0						AGCTGTGCTGCTCTTCTCCCG	0.642													29	35	---	---	---	---	PASS
C9orf78	51759	broad.mit.edu	37	9	132593188	132593188	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132593188C>G	uc004byp.2	-	6	576	c.504G>C	c.(502-504)CAG>CAC	p.Q168H	C9orf78_uc004byo.2_Missense_Mutation_p.Q93H|C9orf78_uc004byq.1_Missense_Mutation_p.Q114H	NM_016520	NP_057604	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78	168											0		Ovarian(14;0.00556)				CACTCAGCATCTGGTTGGAAA	0.468													28	43	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1232463	1232463	+	Intron	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1232463A>T	uc009xhq.2	-						ADARB2_uc009xhp.2_Intron|ADARB2_uc001igl.3_Intron|ADARB2_uc001igm.3_Intron	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCCCAAGCCCAGCTGGCCGGG	0.607													16	52	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1405819	1405819	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1405819C>A	uc009xhq.2	-	3	855	c.481G>T	c.(481-483)GAG>TAG	p.E161*		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	161	DRBM 1.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCGTTCACCTCCACCGCTACC	0.677													7	31	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7217978	7217978	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7217978C>A	uc009xio.1	-	17	2049	c.1958G>T	c.(1957-1959)TGC>TTC	p.C653F	SFMBT2_uc001ijn.1_Missense_Mutation_p.C653F|SFMBT2_uc010qay.1_Missense_Mutation_p.C488F	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	653					regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						ATGAATGGAGCAGTTCTCTGG	0.418													36	247	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15713595	15713595	+	Intron	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15713595C>T	uc001ioc.1	-						ITGA8_uc010qcb.1_Intron	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						TCAACAGTGCCTCTCACCTTG	0.353													17	101	---	---	---	---	PASS
FAM188A	80013	broad.mit.edu	37	10	15831324	15831324	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15831324G>T	uc001iod.1	-						FAM188A_uc001ioe.1_Intron|FAM188A_uc001iof.1_Intron	NM_024948	NP_079224	Q9H8M7	F188A_HUMAN	chromosome 10 open reading frame 97						apoptosis	nucleus	calcium ion binding			ovary(1)	1						ATTATCTAGGGGGGAAAAAAT	0.333													22	88	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26569998	26569998	+	Silent	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26569998T>A	uc001isp.2	+	12	1721	c.1218T>A	c.(1216-1218)GCT>GCA	p.A406A	GAD2_uc001isq.2_Silent_p.A406A	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	406					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	AGTGCTCTGCTCTCCTGGTTA	0.488													51	180	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27702764	27702764	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27702764C>T	uc001itu.2	-	1	534	c.416G>A	c.(415-417)TGG>TAG	p.W139*		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	139	Helical; (Potential).				spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CAGGAAGATCCAGGGGTGCGC	0.657													19	73	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28225785	28225785	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28225785C>A	uc009xky.2	-	15	2220	c.2122G>T	c.(2122-2124)GAC>TAC	p.D708Y	ARMC4_uc010qds.1_Missense_Mutation_p.D233Y|ARMC4_uc010qdt.1_Missense_Mutation_p.D400Y|ARMC4_uc001itz.2_Missense_Mutation_p.D708Y	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	708							binding			ovary(4)|skin(2)	6						CTAACGAGGTCCCGGGTTTCC	0.478													43	169	---	---	---	---	PASS
LYZL1	84569	broad.mit.edu	37	10	29578038	29578038	+	5'UTR	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29578038C>T	uc001iul.2	+	1						NM_032517	NP_115906	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1						cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Breast(68;0.203)				TCAGACATGGCTTCAGGGGAT	0.483													11	30	---	---	---	---	PASS
LYZL2	119180	broad.mit.edu	37	10	30918643	30918643	+	5'UTR	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30918643G>A	uc001ivk.2	-	1						NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2						cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				ATCCCCTGAAGCCATGTCTGA	0.483													4	68	---	---	---	---	PASS
ARHGAP12	94134	broad.mit.edu	37	10	32101679	32101679	+	Missense_Mutation	SNP	C	A	A	rs146011999	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32101679C>A	uc001ivz.1	-	15	2177	c.1907G>T	c.(1906-1908)CGA>CTA	p.R636L	ARHGAP12_uc001ivy.1_Missense_Mutation_p.R582L|ARHGAP12_uc009xls.2_Missense_Mutation_p.R587L|ARHGAP12_uc001iwb.1_Missense_Mutation_p.R629L|ARHGAP12_uc001iwc.1_Missense_Mutation_p.R604L|ARHGAP12_uc009xlq.1_Missense_Mutation_p.R557L|ARHGAP12_uc001iwd.1_Missense_Mutation_p.R604L	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	636					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AGTGGGGCGTCGTGTAAGAAA	0.338													42	117	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38345387	38345387	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38345387G>T	uc001izh.2	+	5	2510	c.2332G>T	c.(2332-2334)GAA>TAA	p.E778*	ZNF33A_uc001izg.2_Nonsense_Mutation_p.E779*|ZNF33A_uc010qev.1_Nonsense_Mutation_p.E785*|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	778						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						CCTTATGAATGAAATGGATAT	0.388													22	94	---	---	---	---	PASS
TMEM72	643236	broad.mit.edu	37	10	45423393	45423393	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45423393C>G	uc001jbn.2	+	2	292	c.95C>G	c.(94-96)ACC>AGC	p.T32S	uc001jbk.1_Intron|uc001jbl.2_Intron|TMEM72_uc009xmm.1_Intron	NM_001123376	NP_001116848	A0PK05	TMM72_HUMAN	transmembrane protein 72	32	Helical; (Potential).					integral to membrane					0						GGCACTGAGACCTTCCTCCAG	0.542													34	165	---	---	---	---	PASS
ANXA8	653145	broad.mit.edu	37	10	47158894	47158894	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47158894T>G	uc001jeh.2	-	12	1049	c.927A>C	c.(925-927)GAA>GAC	p.E309D	ANXA8_uc001jed.3_Intron|ANXA8_uc010qfr.1_Missense_Mutation_p.E413D|ANXA8_uc010qfs.1_Missense_Mutation_p.E313D|ANXA8_uc010qft.1_RNA|ANXA8L1_uc010qfu.1_Missense_Mutation_p.E130D	NM_001098845	NP_001092315	P13928	ANXA8_HUMAN	annexin A8-like 1	309	Annexin 4.				blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						CGCTGGTGTCTTCCTGTGGGC	0.597													9	55	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50870730	50870730	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50870730C>G	uc001jhz.2	+	14	2032	c.1879C>G	c.(1879-1881)CTG>GTG	p.L627V	CHAT_uc001jhv.1_Missense_Mutation_p.L509V|CHAT_uc001jhx.1_Missense_Mutation_p.L509V|CHAT_uc001jhy.1_Missense_Mutation_p.L509V|CHAT_uc001jia.2_Missense_Mutation_p.L509V|CHAT_uc010qgs.1_Missense_Mutation_p.L509V	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	627					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	CCTGCTGGCACTGCGGGAGCT	0.572													41	154	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	52834598	52834598	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52834598C>A	uc001jjm.2	+						PRKG1_uc001jjn.2_Missense_Mutation_p.P83H|PRKG1_uc001jjo.2_Missense_Mutation_p.P83H|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TCCGCCGAGCCCACCGCCTTC	0.687													6	27	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61823935	61823935	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61823935C>G	uc001jky.2	-	39	12623	c.12431G>C	c.(12430-12432)AGA>ACA	p.R4144T	ANK3_uc001jkw.2_Missense_Mutation_p.R665T|ANK3_uc009xpa.2_Missense_Mutation_p.R665T|ANK3_uc001jkx.2_Missense_Mutation_p.R709T|ANK3_uc010qih.1_Missense_Mutation_p.R1532T|ANK3_uc001jkz.3_Missense_Mutation_p.R1525T|ANK3_uc001jkv.2_Missense_Mutation_p.R64T	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	4144	Death.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TTTTCCGTCTCTGGTAACCCA	0.303													34	122	---	---	---	---	PASS
PBLD	64081	broad.mit.edu	37	10	70048725	70048725	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70048725G>C	uc001jns.1	-	7	678	c.475C>G	c.(475-477)CAA>GAA	p.Q159E	PBLD_uc001jnr.1_Missense_Mutation_p.Q126E|PBLD_uc001jnt.1_Missense_Mutation_p.Q159E|PBLD_uc001jnu.1_Missense_Mutation_p.Q159E|PBLD_uc001jnv.1_Missense_Mutation_p.Q126E	NM_022129	NP_071412	P30039	PBLD_HUMAN	MAWD binding protein isoform a	159					biosynthetic process		isomerase activity			skin(2)|ovary(1)	3						AGGAGCTTTTGGGTATCTGGA	0.512													13	240	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70446379	70446379	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70446379G>T	uc001jok.3	+	11	5824	c.5319G>T	c.(5317-5319)GTG>GTT	p.V1773V		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1773					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						TAAGGGCAGTGGAAAAGAAAC	0.468													38	147	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72617373	72617373	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72617373G>T	uc001jrm.2	+	6	634	c.412G>T	c.(412-414)GCC>TCC	p.A138S		NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	138	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	CTCTGCAGACGCCTTCTGGCA	0.498													32	160	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73562740	73562740	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73562740C>G	uc001jrx.3	+	52	7945	c.7568C>G	c.(7567-7569)CCG>CGG	p.P2523R	CDH23_uc001jsg.3_Missense_Mutation_p.P283R|CDH23_uc001jsh.3_Missense_Mutation_p.P283R|CDH23_uc001jsi.3_Missense_Mutation_p.P283R	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	2523	Cadherin 24.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						GAGAATGAGCCGGCGGGCACC	0.582													31	95	---	---	---	---	PASS
DUSP13	51207	broad.mit.edu	37	10	76868782	76868782	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76868782A>G	uc001jws.2	-	1	189	c.134T>C	c.(133-135)CTT>CCT	p.L45P	DUSP13_uc001jwu.2_5'UTR|DUSP13_uc001jww.2_Missense_Mutation_p.L45P|DUSP13_uc009xrs.2_5'UTR|DUSP13_uc001jwt.2_5'UTR|DUSP13_uc001jwv.2_5'UTR|SAMD8_uc001jwx.1_5'Flank|SAMD8_uc001jwy.1_5'Flank	NM_001007271	NP_001007272	Q6B8I1	MDSP_HUMAN	muscle-restricted dual specificity phosphatase	45	Tyrosine-protein phosphatase.					cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TCCTATGAAAAGGTTGGGCCA	0.602													15	69	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85971451	85971451	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85971451C>A	uc001kcv.2	+	14	1533	c.1533C>A	c.(1531-1533)ACC>ACA	p.T511T	CDHR1_uc001kcw.2_Silent_p.T511T|CDHR1_uc009xst.2_Silent_p.T215T|CDHR1_uc001kcx.2_5'Flank	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	511	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						AATATTCCACCTATGGGACTG	0.572													81	240	---	---	---	---	PASS
BMPR1A	657	broad.mit.edu	37	10	88649924	88649924	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88649924T>A	uc001kdy.2	+	4	721	c.173T>A	c.(172-174)TTT>TAT	p.F58Y		NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	58	Extracellular (Potential).		F -> Y (in a renal clear cell carcinoma sample; somatic mutation).		BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity	p.F58Y(1)		lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						ACCTTGCCTTTTTTAAAGTGC	0.403			Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				37	280	---	---	---	---	PASS
TBC1D12	23232	broad.mit.edu	37	10	96253172	96253172	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96253172A>T	uc001kjr.2	+	4	1447	c.1262A>T	c.(1261-1263)TAC>TTC	p.Y421F		NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12	421	Potential.					intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CGACAAGAATACGATGAGATG	0.313													20	97	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97158878	97158878	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97158878C>T	uc001kkp.2	-	10	1099	c.1054G>A	c.(1054-1056)GGC>AGC	p.G352S	SORBS1_uc001kkl.2_5'UTR|SORBS1_uc001kkn.2_Missense_Mutation_p.G185S|SORBS1_uc001kkm.2_Missense_Mutation_p.G208S|SORBS1_uc001kko.2_Missense_Mutation_p.G352S|SORBS1_uc001kkq.2_Missense_Mutation_p.G283S|SORBS1_uc001kkr.2_Missense_Mutation_p.G188S|SORBS1_uc001kks.2_Missense_Mutation_p.G188S|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_Missense_Mutation_p.G229S|SORBS1_uc001kkv.2_Missense_Mutation_p.G320S|SORBS1_uc001kkw.2_Missense_Mutation_p.G352S|SORBS1_uc010qoe.1_Missense_Mutation_p.G197S|SORBS1_uc010qof.1_Missense_Mutation_p.G550S	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	352					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ATAGCCTTGCCAGGTGAGGTG	0.488													42	117	---	---	---	---	PASS
HPS1	3257	broad.mit.edu	37	10	100179892	100179892	+	Silent	SNP	C	A	A	rs79218830	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100179892C>A	uc010qpf.1	-	18	2013	c.1767G>T	c.(1765-1767)GCG>GCT	p.A589A	HPS1_uc001kpi.1_Silent_p.A590A|HPS1_uc001kpj.1_Silent_p.A497A|HPS1_uc001kpk.1_Silent_p.A414A	NM_000195	NP_000186	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1 protein isoform a	589					lysosome organization|response to stimulus|visual perception	cytoplasmic membrane-bounded vesicle|integral to plasma membrane|lysosome|membrane fraction|soluble fraction	protein dimerization activity			skin(1)	1		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GGTATCTGCGCGCCAGCTGGA	0.572									Hermansky-Pudlak_syndrome				79	197	---	---	---	---	PASS
ABCC2	1244	broad.mit.edu	37	10	101560142	101560142	+	Splice_Site	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101560142G>T	uc001kqf.2	+	9	1171	c.1032_splice	c.e9-1	p.K344_splice		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TTCTCTGGCAGATTGCTGATC	0.458													134	471	---	---	---	---	PASS
CPN1	1369	broad.mit.edu	37	10	101816862	101816862	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101816862G>T	uc001kql.2	-	6	1179	c.919C>A	c.(919-921)CTG>ATG	p.L307M		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	307	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CTCAGTTCCAGCGTGATCTCA	0.498													138	419	---	---	---	---	PASS
CPN1	1369	broad.mit.edu	37	10	101825081	101825081	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101825081T>C	uc001kql.2	-	4	883	c.623A>G	c.(622-624)AAC>AGC	p.N208S		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	208	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		AAGAACAAAGTTGAAGGAGTG	0.622													34	97	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117221452	117221452	+	Nonsense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117221452C>G	uc001lcg.2	+	22	3710	c.3324C>G	c.(3322-3324)TAC>TAG	p.Y1108*	ATRNL1_uc010qsm.1_Nonsense_Mutation_p.Y237*|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1108	Laminin EGF-like 2.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TCCCTACAGACAGCCTTTTGA	0.328													20	83	---	---	---	---	PASS
PLEKHA1	59338	broad.mit.edu	37	10	124177492	124177492	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124177492G>T	uc001lge.1	+						PLEKHA1_uc001lgf.1_Intron|PLEKHA1_uc001lgg.1_Intron|PLEKHA1_uc001lgh.2_Intron	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A						B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CTGGTATGTTGTTACGTCATA	0.313													15	88	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124358505	124358505	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124358505G>T	uc001lgk.1	+	26	3278	c.3172G>T	c.(3172-3174)GAT>TAT	p.D1058Y	DMBT1_uc001lgl.1_Missense_Mutation_p.D1048Y|DMBT1_uc001lgm.1_Missense_Mutation_p.D559Y|DMBT1_uc009xzz.1_Missense_Mutation_p.D1058Y|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Missense_Mutation_p.D19Y	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1058	SRCR 8.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CATTGTCCTGGATGATGTGCG	0.587													87	261	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129897522	129897522	+	Intron	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129897522G>C	uc001lke.2	-						MKI67_uc001lkf.2_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67						cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TCCTCAGCCTGTGTGGGAAGA	0.358													26	56	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1156570	1156570	+	Splice_Site	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1156570A>T	uc009ycr.1	+	7	715	c.589_splice	c.e7-2	p.L197_splice		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCCTTTGCAGCTGGAGCTG	0.612													48	113	---	---	---	---	PASS
OR52N4	390072	broad.mit.edu	37	11	5776353	5776353	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5776353T>A	uc001mbu.2	+	1	431	c.383T>A	c.(382-384)ATC>AAC	p.I128N	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TATGTGGCCATCTGCTACCCC	0.488													65	162	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969286	5969286	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969286C>A	uc010qzt.1	+	1	710	c.710C>A	c.(709-711)GCC>GAC	p.A237D		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGAGGGTGCCGTGGCAAAG	0.522													103	196	---	---	---	---	PASS
RRP8	23378	broad.mit.edu	37	11	6622767	6622767	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6622767G>A	uc001med.2	-	3	608	c.529C>T	c.(529-531)CCT>TCT	p.P177S	ILK_uc001mee.2_5'Flank|ILK_uc001mef.2_5'Flank|ILK_uc010rap.1_5'Flank|ILK_uc010raq.1_5'Flank|ILK_uc001meg.2_5'Flank|ILK_uc001meh.2_5'Flank	NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,	177					chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0						GGGGGTTTAGGGGAAGTGGAC	0.527													62	173	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6653340	6653340	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6653340C>A	uc001mem.1	-	6	3813	c.3403G>T	c.(3403-3405)GGA>TGA	p.G1135*		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1135	Cadherin 11.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCATTGGGTCCTGAGTCTCGG	0.612													9	21	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21592424	21592424	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21592424G>A	uc001mqe.2	+	18	2248	c.2095G>A	c.(2095-2097)GGT>AGT	p.G699S	NELL1_uc001mqf.2_Missense_Mutation_p.G652S|NELL1_uc009yid.2_Missense_Mutation_p.G727S|NELL1_uc010rdo.1_Missense_Mutation_p.G642S|NELL1_uc010rdp.1_Missense_Mutation_p.G412S|NELL1_uc001mqh.2_Missense_Mutation_p.G244S	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	699	VWFC 4.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						AGACCAAAATGGTCACAAGCT	0.473													57	194	---	---	---	---	PASS
WT1	7490	broad.mit.edu	37	11	32410592	32410592	+	3'UTR	SNP	G	A	A	rs77462662	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32410592G>A	uc001mtn.1	-	10					WT1_uc001mtl.1_3'UTR|WT1_uc001mtm.1_3'UTR|WT1_uc001mto.1_3'UTR|WT1_uc001mtp.1_3'UTR|WT1_uc001mtq.1_3'UTR|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D						adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			AACGGTCCCCGAGGGAGACCC	0.498			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				48	135	---	---	---	---	PASS
PDHX	8050	broad.mit.edu	37	11	34988317	34988317	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34988317C>T	uc001mvt.2	+	6	1298	c.772C>T	c.(772-774)CCT>TCT	p.P258S	PDHX_uc010rep.1_Missense_Mutation_p.P243S|PDHX_uc010req.1_Intron	NM_003477	NP_003468	O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	258					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity			kidney(1)	1	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TTATCCCCGGCCTGTGATCCC	0.468													42	151	---	---	---	---	PASS
GYLTL1B	120071	broad.mit.edu	37	11	45950301	45950301	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45950301G>A	uc001nbv.1	+	14	2182	c.2071G>A	c.(2071-2073)GAC>AAC	p.D691N	GYLTL1B_uc001nbw.1_Missense_Mutation_p.D660N|GYLTL1B_uc001nbx.1_Missense_Mutation_p.D691N|GYLTL1B_uc001nby.1_Missense_Mutation_p.D374N|GYLTL1B_uc001nbz.1_Silent_p.R39R	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	691	Lumenal (Potential).				muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		GGCCCTCAAGGACGAATTCCA	0.662													40	93	---	---	---	---	PASS
OR4C3	256144	broad.mit.edu	37	11	48347191	48347191	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48347191G>T	uc010rhv.1	+	1	699	c.699G>T	c.(697-699)CTG>CTT	p.L233L		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TAATCTGCCTGTTGAACTTCC	0.512													5	133	---	---	---	---	PASS
OR4A5	81318	broad.mit.edu	37	11	51411694	51411694	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411694C>A	uc001nhi.1	-	1	702	c.702G>T	c.(700-702)TTG>TTT	p.L234F		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	234	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				TGCAGGTAGACAAGGCTTTAC	0.408													31	121	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735485	55735485	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735485C>A	uc010rit.1	-	1	455	c.455G>T	c.(454-456)TGC>TTC	p.C152F		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	152	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					GAAAATTTGGCATGTTTCCCC	0.403													38	104	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55872597	55872597	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872597G>T	uc010riy.1	+	1	79	c.79G>T	c.(79-81)GCT>TCT	p.A27S		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	27	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					GATCCAGATGGCTCTGTTTAT	0.443										HNSCC(53;0.14)			117	434	---	---	---	---	PASS
OR8K3	219473	broad.mit.edu	37	11	56086487	56086487	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56086487G>C	uc010rjf.1	+	1	705	c.705G>C	c.(703-705)AAG>AAC	p.K235N		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					GCAGACAAAAGGCTTTTTCTA	0.433													41	128	---	---	---	---	PASS
GLYATL2	219970	broad.mit.edu	37	11	58602171	58602171	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58602171C>A	uc001nnd.3	-	6	747	c.616G>T	c.(616-618)GGT>TGT	p.G206C	GLYATL2_uc009ymq.2_Missense_Mutation_p.G206C	NM_145016	NP_659453	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	206						mitochondrion	glycine N-acyltransferase activity			ovary(1)|skin(1)	2		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	CCCTCTGGACCCAGCACACCA	0.468													29	113	---	---	---	---	PASS
MS4A6E	245802	broad.mit.edu	37	11	60105257	60105257	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60105257C>A	uc001npd.2	+	2	205	c.191C>A	c.(190-192)GCC>GAC	p.A64D		NM_139249	NP_640342	Q96DS6	M4A6E_HUMAN	membrane-spanning 4-domains, subfamily A, member	64	Helical; (Potential).					integral to membrane	receptor activity				0						GCTCTGTCTGCCCTGGTGGGT	0.488													71	247	---	---	---	---	PASS
SCGB2A1	4246	broad.mit.edu	37	11	61977983	61977983	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61977983A>G	uc001nta.2	+	2	218	c.154A>G	c.(154-156)AGT>GGT	p.S52G		NM_002407	NP_002398	O75556	SG2A1_HUMAN	secretoglobin, family 2A, member 1 precursor	52						extracellular region	androgen binding				0						GTTCATAGACAGTGATGCCGC	0.428													71	221	---	---	---	---	PASS
RCOR2	283248	broad.mit.edu	37	11	63681958	63681958	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63681958G>A	uc001nyc.2	-	6	924	c.536C>T	c.(535-537)ACC>ATC	p.T179I		NM_173587	NP_775858	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	179	SANT 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)|skin(1)	2						TCGGCTGCGGGTCTTCTTCCA	0.602													56	186	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64418751	64418751	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64418751A>T	uc001oar.2	-	15	3333	c.2894T>A	c.(2893-2895)TTC>TAC	p.F965Y	NRXN2_uc001oas.2_Missense_Mutation_p.F925Y|NRXN2_uc001oaq.2_Missense_Mutation_p.F632Y	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						GATGACAATGAAGTCATTGCC	0.587											OREG0004037|OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=REGULATORY REGION|Gene=AL137356|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	28	89	---	---	---	---	PASS
P2RY2	5029	broad.mit.edu	37	11	72945604	72945604	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72945604G>C	uc001otj.2	+	3	733	c.400G>C	c.(400-402)GGC>CGC	p.G134R	P2RY2_uc001otk.2_Missense_Mutation_p.G134R|P2RY2_uc001otl.2_Missense_Mutation_p.G134R	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2	134	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	CCGGTGTCTGGGCGTCTTACG	0.672													15	168	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78381554	78381554	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78381554C>T	uc001ozl.3	-	32	6299	c.5836G>A	c.(5836-5838)GAG>AAG	p.E1946K	ODZ4_uc001ozk.3_Missense_Mutation_p.E171K|ODZ4_uc009yvb.1_Missense_Mutation_p.E530K	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1946	Extracellular (Potential).|YD 6.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TTGTCGAACTCAAAGATATAC	0.532													11	91	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85445676	85445676	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85445676C>A	uc010rth.1	-	6	969	c.693G>T	c.(691-693)AAG>AAT	p.K231N	SYTL2_uc010rtg.1_Missense_Mutation_p.K232N|SYTL2_uc010rti.1_Missense_Mutation_p.K231N|SYTL2_uc010rtj.1_Missense_Mutation_p.K183N|SYTL2_uc001pbf.3_Missense_Mutation_p.K231N|SYTL2_uc010rtf.1_Missense_Mutation_p.K89N	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	231					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GGATTGGAGCCTTGATTTGGG	0.408													46	159	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102487666	102487666	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102487666G>T	uc001phc.2	-	2	264	c.251C>A	c.(250-252)ACC>AAC	p.T84N		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	84					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		TAACTTCCCGGTGACTTGGAG	0.478													23	86	---	---	---	---	PASS
GRAMD1B	57476	broad.mit.edu	37	11	123477310	123477310	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123477310G>T	uc001pyx.2	+						GRAMD1B_uc001pyw.2_Intron|GRAMD1B_uc010rzw.1_Intron|GRAMD1B_uc010rzx.1_Intron|GRAMD1B_uc009zbe.1_Intron|GRAMD1B_uc001pyy.2_5'Flank	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CTCTGTCTTGGCTCCAGTTTG	0.567													8	18	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123894186	123894186	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123894186C>T	uc010sad.1	+	1	467	c.467C>T	c.(466-468)GCT>GTT	p.A156V		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CTGCACTCTGCTGTCCAGACC	0.552													145	346	---	---	---	---	PASS
OR8D1	283159	broad.mit.edu	37	11	124180337	124180337	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124180337A>T	uc010sag.1	-	1	326	c.326T>A	c.(325-327)GTG>GAG	p.V109E		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		ACCCTCAGCCACCACAAAGAC	0.463													23	44	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124765350	124765350	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124765350G>T	uc001qbg.2	-						ROBO4_uc010sas.1_Intron|ROBO4_uc001qbh.2_Intron|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout						angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		ATCAGGCCCTGACCTTTTTCC	0.577													50	150	---	---	---	---	PASS
STT3A	3703	broad.mit.edu	37	11	125472715	125472715	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125472715G>T	uc001qcd.2	+	5	399	c.289G>T	c.(289-291)GCT>TCT	p.A97S	STT3A_uc009zbm.2_Missense_Mutation_p.A97S|STT3A_uc001qce.2_Missense_Mutation_p.A97S|STT3A_uc010sbg.1_Missense_Mutation_p.A5S	NM_152713	NP_689926	P46977	STT3A_HUMAN	integral membrane protein 1	97	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity				0	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GATCACCTCTGCTGCAATCTA	0.428													39	169	---	---	---	---	PASS
RPUSD4	84881	broad.mit.edu	37	11	126075379	126075379	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126075379C>A	uc001qde.2	-	5	834	c.780G>T	c.(778-780)GAG>GAT	p.E260D	RPUSD4_uc010sbl.1_Missense_Mutation_p.E67D|RPUSD4_uc009zbz.2_Missense_Mutation_p.E229D|RPUSD4_uc009zby.2_RNA	NM_032795	NP_116184	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	260					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			breast(1)	1	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		TGGGCTGGAGCTCCACGAGGG	0.567													31	99	---	---	---	---	PASS
B4GALNT3	283358	broad.mit.edu	37	12	667830	667830	+	Intron	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:667830G>A	uc001qii.1	+						B4GALNT3_uc001qik.1_Intron	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta							Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GCCTGAGGGTGAGCCCTGCTC	0.572													20	67	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1995536	1995536	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1995536G>A	uc001qjp.2	-	8	1077	c.846C>T	c.(844-846)TAC>TAT	p.Y282Y	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	282	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CAGCTTGAATGTACCTGAAGG	0.498													18	42	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2775903	2775903	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2775903G>A	uc009zdu.1	+	39	5035	c.4722G>A	c.(4720-4722)CCG>CCA	p.P1574P	CACNA1C_uc009zdv.1_Silent_p.P1523P|CACNA1C_uc001qkb.2_Silent_p.P1526P|CACNA1C_uc001qkc.2_Silent_p.P1526P|CACNA1C_uc001qke.2_Silent_p.P1515P|CACNA1C_uc001qkf.2_Silent_p.P1515P|CACNA1C_uc001qjz.2_Silent_p.P1526P|CACNA1C_uc001qkd.2_Silent_p.P1526P|CACNA1C_uc001qkg.2_Silent_p.P1513P|CACNA1C_uc009zdw.1_Silent_p.P1548P|CACNA1C_uc001qkh.2_Silent_p.P1515P|CACNA1C_uc001qkl.2_Silent_p.P1574P|CACNA1C_uc001qkn.2_Silent_p.P1526P|CACNA1C_uc001qko.2_Silent_p.P1546P|CACNA1C_uc001qkp.2_Silent_p.P1526P|CACNA1C_uc001qkr.2_Silent_p.P1543P|CACNA1C_uc001qku.2_Silent_p.P1526P|CACNA1C_uc001qkq.2_Silent_p.P1554P|CACNA1C_uc001qks.2_Silent_p.P1526P|CACNA1C_uc001qkt.2_Silent_p.P1526P|CACNA1C_uc001qki.1_Silent_p.P1262P|CACNA1C_uc001qkj.1_Silent_p.P1262P|CACNA1C_uc001qkk.1_Silent_p.P1262P|CACNA1C_uc001qkm.1_Silent_p.P1251P|CACNA1C_uc010sea.1_Silent_p.P217P	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1574	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	GGATTCAGCCGCCACTAGGTT	0.577													6	11	---	---	---	---	PASS
KCNA5	3741	broad.mit.edu	37	12	5154937	5154937	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5154937C>A	uc001qni.2	+	1	1853	c.1624C>A	c.(1624-1626)CAG>AAG	p.Q542K		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	542						Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4						GCAGGGCACTCAGAGCCAGGG	0.627													19	56	---	---	---	---	PASS
EMG1	10436	broad.mit.edu	37	12	7084422	7084422	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7084422C>T	uc001qsh.3	+	7	646	c.503C>T	c.(502-504)CCA>CTA	p.P168L	EMG1_uc009zfo.2_Intron|EMG1_uc010sfv.1_RNA	NM_006331	NP_006322	Q92979	NEP1_HUMAN	ribosome biogenesis protein NEP1	168					ribosomal small subunit biogenesis	cytoplasm|nucleolus	rRNA (pseudouridine) methyltransferase activity|rRNA binding				0						GATCACTTTCCAGTTGGATGT	0.433													15	59	---	---	---	---	PASS
C1R	715	broad.mit.edu	37	12	7241892	7241892	+	Silent	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7241892T>A	uc010sfy.1	-	5	824	c.765A>T	c.(763-765)CTA>CTT	p.L255L	C1R_uc010sfz.1_Silent_p.L269L|C1R_uc010sga.1_Silent_p.L221L	NM_001733	NP_001724	P00736	C1R_HUMAN	complement component 1, r subcomponent	255	CUB 2.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity				0					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GCTGTACCTGTAGCTGGTCAT	0.587													8	46	---	---	---	---	PASS
GDF3	9573	broad.mit.edu	37	12	7843100	7843100	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7843100C>A	uc001qte.2	-	2	505	c.469G>T	c.(469-471)GGC>TGC	p.G157C		NM_020634	NP_065685	Q9NR23	GDF3_HUMAN	growth differentiation factor 3 precursor	157					eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity			skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						GTGGTCTGGCCCCACACATGA	0.547													62	113	---	---	---	---	PASS
SLC2A14	144195	broad.mit.edu	37	12	7980133	7980133	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7980133G>T	uc001qtk.2	-	12	1684	c.891C>A	c.(889-891)TCC>TCA	p.S297S	SLC2A14_uc001qtl.2_Silent_p.S274S|SLC2A14_uc001qtm.2_Silent_p.S274S|SLC2A14_uc010sgg.1_Silent_p.S188S|SLC2A14_uc001qtn.2_Silent_p.S297S|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Silent_p.S312S	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	297	Helical; Name=7; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		GGAGCACAATGGAAATGATGA	0.438													14	53	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9256835	9256835	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9256835C>T	uc001qvk.1	-	11	1379	c.1266G>A	c.(1264-1266)AGG>AGA	p.R422R	A2M_uc009zgk.1_Silent_p.R272R	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	422					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CCAAACTTACCCTAACAGTAA	0.408													13	49	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21350092	21350092	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21350092C>A	uc001req.3	+	8	1044	c.940C>A	c.(940-942)CAA>AAA	p.Q314K		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	314	Cytoplasmic (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	TTTGACCAATCAAGGAAAAAA	0.318													22	114	---	---	---	---	PASS
SLCO1A2	6579	broad.mit.edu	37	12	21422583	21422583	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21422583C>A	uc001rer.2	-	14	2163	c.1912G>T	c.(1912-1914)GAG>TAG	p.E638*	SLCO1A2_uc001res.2_Nonsense_Mutation_p.E638*|SLCO1A2_uc010siq.1_Nonsense_Mutation_p.E506*|SLCO1A2_uc010sio.1_Nonsense_Mutation_p.E506*|SLCO1A2_uc010sip.1_Nonsense_Mutation_p.E506*	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	638	Cytoplasmic (Potential).				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TCTATAAGCTCTGTTCCTGAA	0.383													82	162	---	---	---	---	PASS
LDHB	3945	broad.mit.edu	37	12	21794951	21794951	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21794951T>A	uc001rfc.2	-	4	548	c.530A>T	c.(529-531)GAA>GTA	p.E177V	LDHB_uc001rfd.2_Missense_Mutation_p.E177V|LDHB_uc001rfe.2_Missense_Mutation_p.E177V	NM_002300	NP_002291	P07195	LDHB_HUMAN	L-lactate dehydrogenase B	177					glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity			breast(2)|ovary(1)	3					NADH(DB00157)	GCCAAGTTTTTCAGCCATAAG	0.418													41	140	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21954116	21954116	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21954116C>A	uc001rfh.2	-						ABCC9_uc001rfg.2_Intron	NM_020297	NP_064693	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GTACTCGATGCTGTGAGTGAA	0.378													54	137	---	---	---	---	PASS
GPD1	2819	broad.mit.edu	37	12	50501542	50501542	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50501542C>T	uc001rvz.2	+	6	838	c.805C>T	c.(805-807)CGG>TGG	p.R269W	GPD1_uc001rwa.2_Missense_Mutation_p.R246W	NM_005276	NP_005267	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	269	Substrate binding.	NAD.			glycerol-3-phosphate catabolic process|triglyceride biosynthetic process	cytosol|glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|protein homodimerization activity				0					NADH(DB00157)	CTATGGAGGGCGGAACCGGAA	0.602													69	202	---	---	---	---	PASS
KRT78	196374	broad.mit.edu	37	12	53233571	53233571	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53233571C>T	uc001sbc.1	-	7	1309	c.1245G>A	c.(1243-1245)AGG>AGA	p.R415R		NM_173352	NP_775487	Q8N1N4	K2C78_HUMAN	keratin 5b	415	Coil 2.|Rod.					keratin filament	protein binding|structural molecule activity			ovary(2)	2						CCTCCAGCAGCCTGCGGTAAG	0.602													32	87	---	---	---	---	PASS
IGFBP6	3489	broad.mit.edu	37	12	53494917	53494917	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53494917C>G	uc001sbu.1	+	3	639	c.573C>G	c.(571-573)GAC>GAG	p.D191E	SOAT2_uc001sbv.2_5'Flank|SOAT2_uc009zms.2_5'Flank	NM_002178	NP_002169	P24592	IBP6_HUMAN	insulin-like growth factor binding protein 6	191	Thyroglobulin type-1.				negative regulation of cell proliferation|regulation of cell growth|signal transduction					ovary(1)	1						CCAATTGTGACCATCGAGGCT	0.582													37	126	---	---	---	---	PASS
SP7	121340	broad.mit.edu	37	12	53722390	53722390	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53722390T>C	uc001sct.2	-	2	943	c.836A>G	c.(835-837)GAG>GGG	p.E279G	SP7_uc001scu.2_Missense_Mutation_p.E261G|SP7_uc001scv.2_Missense_Mutation_p.E279G	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN	osterix	279					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCCAGCCGCTCTAGCTCCTG	0.657													4	31	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54917320	54917320	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54917320C>A	uc001sgc.3	+	19	2100	c.2021C>A	c.(2020-2022)ACC>AAC	p.T674N	NCKAP1L_uc010sox.1_Missense_Mutation_p.T216N|NCKAP1L_uc010soy.1_Missense_Mutation_p.T624N	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	674					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						AGCATTGTCACCAAGTGAGGA	0.542													33	111	---	---	---	---	PASS
OR6C70	390327	broad.mit.edu	37	12	55863141	55863141	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55863141G>A	uc010spn.1	-	1	782	c.782C>T	c.(781-783)TCA>TTA	p.S261L		NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TTCATTCGCTGATGGCTTTAT	0.393													51	170	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57114725	57114725	+	Intron	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57114725G>A	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Missense_Mutation_p.P197S|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Missense_Mutation_p.P197S|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						TTTGGATTAGGGACTACCTCA	0.498			T	BCL6	NHL								54	164	---	---	---	---	PASS
OS9	10956	broad.mit.edu	37	12	58090110	58090110	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58090110G>T	uc001spj.2	+	5	592	c.533G>T	c.(532-534)GGG>GTG	p.G178V	OS9_uc010srx.1_Intron|OS9_uc001spk.2_Missense_Mutation_p.G178V|OS9_uc001spl.2_Missense_Mutation_p.G178V|OS9_uc001spm.2_Missense_Mutation_p.G178V|OS9_uc001spn.2_Missense_Mutation_p.G178V|OS9_uc010sry.1_Intron|OS9_uc010srz.1_Missense_Mutation_p.G119V	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum	178	PRKCSH.				ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TATGGCAATGGGTCCAAGTGC	0.542													46	124	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63964527	63964527	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63964527C>A	uc001srp.1	-						DPY19L2_uc010sso.1_Intron	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		AAATACTCATCAGCTGCCAAC	0.348													21	70	---	---	---	---	PASS
IL26	55801	broad.mit.edu	37	12	68619426	68619426	+	Silent	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68619426T>G	uc001stx.1	-	1	146	c.111A>C	c.(109-111)ACA>ACC	p.T37T		NM_018402	NP_060872	Q9NPH9	IL26_HUMAN	interleukin 26 precursor	37					cell-cell signaling|negative regulation of epithelial cell proliferation|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of JAK-STAT cascade|positive regulation of protein kinase B signaling cascade|positive regulation of stress-activated MAPK cascade|positive regulation of transcription from RNA polymerase II promoter	cytosol|extracellular space|soluble fraction	cytokine activity				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		CTTGGGACAATGTTCCCCTTG	0.443													100	338	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70981052	70981052	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70981052G>T	uc001swb.3	-						PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron|PTPRB_uc001swd.3_Intron|PTPRB_uc009zrr.1_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGGGGACTGAGGAAAAAGCAA	0.458													16	43	---	---	---	---	PASS
PTPRR	5801	broad.mit.edu	37	12	71314168	71314168	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71314168C>A	uc001swi.1	-	1	419	c.3G>T	c.(1-3)ATG>ATT	p.M1I		NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	1					in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		CTGCTCTCCGCATAGTGTTTG	0.552													11	39	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72355423	72355423	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72355423G>T	uc009zrw.1	+						TPH2_uc001swy.2_Intron	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	TGTGTATGTTGAGCGTGCACA	0.378													30	107	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85492717	85492717	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85492717G>T	uc001tac.2	+	13	3265	c.3154G>T	c.(3154-3156)GCA>TCA	p.A1052S	LRRIQ1_uc001tab.1_Missense_Mutation_p.A1052S	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1052	LRR 8.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		AACTGTGGAAGCATTTTCTTC	0.303													27	101	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100431478	100431478	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100431478A>G	uc001tgq.2	-	21	4560	c.4331T>C	c.(4330-4332)CTT>CCT	p.L1444P	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.L1094P	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	1444	Potential.									ovary(2)	2						AGCCTCTGCAAGAGCCATTTT	0.383													29	151	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101491478	101491478	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101491478C>A	uc010svm.1	+	20	2472	c.1900C>A	c.(1900-1902)CTA>ATA	p.L634I	ANO4_uc001thw.2_Missense_Mutation_p.L599I|ANO4_uc001thx.2_Missense_Mutation_p.L634I|ANO4_uc001thy.2_Missense_Mutation_p.L154I	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	634	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CAGGTGGAGACTAGAAGAGGT	0.438										HNSCC(74;0.22)			24	130	---	---	---	---	PASS
HCFC2	29915	broad.mit.edu	37	12	104476524	104476524	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104476524C>A	uc001tkj.3	+	7	1011	c.908C>A	c.(907-909)TCT>TAT	p.S303Y	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	303	Kelch 4.				regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						GTATCAGATTCTCAGGAAGAT	0.363													6	128	---	---	---	---	PASS
RFX4	5992	broad.mit.edu	37	12	107090222	107090222	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107090222C>A	uc001tlr.2	+	8	897	c.831C>A	c.(829-831)GAC>GAA	p.D277E	RFX4_uc010swv.1_RNA|RFX4_uc001tls.2_Missense_Mutation_p.D286E|RFX4_uc001tlt.2_Missense_Mutation_p.D286E|RFX4_uc001tlv.2_Missense_Mutation_p.D183E	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	277					transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						CATTACCTGACAGGTGGGCAT	0.527													44	126	---	---	---	---	PASS
MYL2	4633	broad.mit.edu	37	12	111358331	111358331	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111358331C>A	uc001try.3	-	1	74	c.3G>T	c.(1-3)ATG>ATT	p.M1I	MYL2_uc001trx.3_5'Flank	NM_000432	NP_000423	P10916	MLRV_HUMAN	slow cardiac myosin regulatory light chain 2	1					cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle			ovary(1)	1						TTGTACTCACCATGGTGGAAA	0.597													35	157	---	---	---	---	PASS
RPLP0	6175	broad.mit.edu	37	12	120637225	120637225	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120637225T>A	uc001txp.2	-	3	355	c.118A>T	c.(118-120)ATG>TTG	p.M40L	RPLP0_uc001txq.2_Missense_Mutation_p.M40L|RPLP0_uc001txr.2_Missense_Mutation_p.M40L|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	40					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATCTGCTGCATCTGCTTGGAG	0.517													35	115	---	---	---	---	PASS
RPLP0	6175	broad.mit.edu	37	12	120637226	120637226	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120637226C>A	uc001txp.2	-	3	354	c.117G>T	c.(115-117)CAG>CAT	p.Q39H	RPLP0_uc001txq.2_Missense_Mutation_p.Q39H|RPLP0_uc001txr.2_Missense_Mutation_p.Q39H|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	39					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTGCTGCATCTGCTTGGAGC	0.512													34	116	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121766123	121766123	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121766123G>A	uc001uag.2	-	10	1422	c.1300C>T	c.(1300-1302)CGC>TGC	p.R434C	ANAPC5_uc010szu.1_Missense_Mutation_p.R100C|ANAPC5_uc001uae.2_5'UTR|ANAPC5_uc010szv.1_Missense_Mutation_p.R36C|ANAPC5_uc001uaf.2_RNA|ANAPC5_uc001uah.2_Missense_Mutation_p.R322C|ANAPC5_uc001uai.1_Missense_Mutation_p.R36C	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a	434					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACCTACCTGCGGCCATACAGC	0.527													20	88	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124156062	124156062	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124156062C>T	uc001ufp.2	+	2	219	c.91C>T	c.(91-93)CCT>TCT	p.P31S	TCTN2_uc009zya.2_Missense_Mutation_p.P31S	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	31	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		AGCTTTCATCCCTCCTTTTAT	0.617													29	116	---	---	---	---	PASS
DHX37	57647	broad.mit.edu	37	12	125434992	125434992	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125434992C>A	uc001ugy.2	-	23	3187	c.3088G>T	c.(3088-3090)GGG>TGG	p.G1030W	DHX37_uc001ugz.1_Missense_Mutation_p.G117W	NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	1030							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		AGCACCCGCCCCCGCTCGGGG	0.657													8	33	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129558905	129558905	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129558905C>G	uc009zyl.1	-	9	3143	c.2815G>C	c.(2815-2817)GTG>CTG	p.V939L	TMEM132D_uc001uia.2_Missense_Mutation_p.V477L	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	939	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCAAAGGTCACACAGTTTATC	0.463													46	124	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28971177	28971177	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28971177G>A	uc001usb.3	-	12	1865	c.1580C>T	c.(1579-1581)TCT>TTT	p.S527F	FLT1_uc010aar.1_Missense_Mutation_p.S527F|FLT1_uc001usc.3_Missense_Mutation_p.S527F|FLT1_uc010aas.1_RNA|FLT1_uc010aat.1_Missense_Mutation_p.S10F	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	527	Ig-like C2-type 5.|Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	AGAAATTCTAGAGTCAGCCAC	0.398													33	38	---	---	---	---	PASS
CYSLTR2	57105	broad.mit.edu	37	13	49281473	49281473	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49281473C>T	uc010acx.1	+	6	1203	c.520C>T	c.(520-522)CTG>TTG	p.L174L	CYSLTR2_uc010acy.1_Silent_p.L174L|CYSLTR2_uc010acz.1_Silent_p.L174L|CYSLTR2_uc010ada.1_Silent_p.L174L|CYSLTR2_uc010adb.1_Silent_p.L174L|CYSLTR2_uc010adc.1_Silent_p.L174L|CYSLTR2_uc010add.1_Silent_p.L174L|CYSLTR2_uc010acw.1_Silent_p.L174L|CYSLTR2_uc001vck.2_Silent_p.L174L	NM_020377	NP_065110	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	174	Helical; Name=4; (Potential).				immune response	integral to membrane|plasma membrane				lung(2)	2		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	AATAATGCTCCTGGACAGTGG	0.483													62	147	---	---	---	---	PASS
OLFM4	10562	broad.mit.edu	37	13	53608502	53608502	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53608502G>T	uc001vhl.2	+	2	224	c.224G>T	c.(223-225)GGC>GTC	p.G75V	OLFM4_uc001vhk.1_Missense_Mutation_p.G75V	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	75					cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AATTTCACCGGCTCCGTGGAT	0.478													18	76	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58299162	58299162	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58299162T>G	uc001vhq.1	+	4	4106	c.3214T>G	c.(3214-3216)TTG>GTG	p.L1072V	PCDH17_uc010aec.1_Missense_Mutation_p.L1071V|PCDH17_uc001vhr.1_Missense_Mutation_p.L161V	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	1072	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAGTCAGTACTTGCCCACTGA	0.532													8	213	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76301206	76301206	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76301206A>G	uc010thv.1	+	4	1598	c.338A>G	c.(337-339)AAT>AGT	p.N113S	LMO7_uc001vjt.1_Missense_Mutation_p.N61S	NM_005358	NP_005349	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 1	113	CH.					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAGAAGATCAATAGACTGTCT	0.318													22	73	---	---	---	---	PASS
KCTD12	115207	broad.mit.edu	37	13	77460056	77460056	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77460056G>C	uc010aeu.1	-	1	485	c.228C>G	c.(226-228)AGC>AGG	p.S76R	KCTD12_uc001vka.1_Missense_Mutation_p.S76R	NM_138444	NP_612453	Q96CX2	KCD12_HUMAN	potassium channel tetramerisation domain	76						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(1)	1		Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.0499)		AGCGGCCTTTGCTGTCCCGGG	0.657													9	23	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78177239	78177239	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78177239G>T	uc001vki.2	+	18	1236	c.1066G>T	c.(1066-1068)GTA>TTA	p.V356L	SCEL_uc001vkj.2_Missense_Mutation_p.V336L|SCEL_uc010thx.1_Missense_Mutation_p.V334L	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	356	16 X approximate tandem repeats.|6.				embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TGCTACTGAAGTAAATCCCAA	0.284													36	80	---	---	---	---	PASS
RBM26	64062	broad.mit.edu	37	13	79940805	79940805	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79940805C>T	uc001vkz.2	-	7	1112	c.1098G>A	c.(1096-1098)CCG>CCA	p.P366P	RBM26_uc001vky.2_Silent_p.P366P|RBM26_uc001vla.2_Silent_p.P366P|RBM26_uc001vkx.2_Silent_p.P78P|RBM26_uc001vlb.1_RNA	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	366	Pro-rich.				mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		ATGGACCTGGCGGTGGTACTG	0.498													34	79	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99099054	99099054	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99099054C>T	uc001vnj.2	+	26	3375	c.3039C>T	c.(3037-3039)AGC>AGT	p.S1013S	FARP1_uc001vnh.2_Silent_p.S1044S	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	1013	PH 2.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGGCGGAAAGCGAGTACACGT	0.552													43	126	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101707828	101707828	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101707828A>T	uc001vox.1	-	44	5225	c.5036T>A	c.(5035-5037)ATA>AAA	p.I1679K		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1679	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGAATGGCTTATTGGTTTTGG	0.458													62	301	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101881753	101881753	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101881753C>A	uc001vox.1	-	13	1806	c.1617G>T	c.(1615-1617)ACG>ACT	p.T539T	NALCN_uc001voy.2_Silent_p.T254T|NALCN_uc001voz.2_Silent_p.T539T|NALCN_uc001vpa.2_Silent_p.T539T	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	539	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCCTCGGAAACGTAGTAAATC	0.328													62	224	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103520492	103520492	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103520492G>T	uc001vpw.2	+	12	3006	c.2563G>T	c.(2563-2565)GCT>TCT	p.A855S	ERCC5_uc001vpu.1_Missense_Mutation_p.A1309S|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.A687S	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	855	I-domain.				negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AATAAATTTGGCTTATTTGCT	0.299			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				45	140	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861015	108861015	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861015C>A	uc001vqn.2	-	2	2875	c.2602G>T	c.(2602-2604)GAT>TAT	p.D868Y	LIG4_uc001vqo.2_Missense_Mutation_p.D868Y|LIG4_uc010agg.1_Missense_Mutation_p.D801Y|LIG4_uc010agf.2_Missense_Mutation_p.D868Y|LIG4_uc001vqp.2_Missense_Mutation_p.D868Y	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	868	BRCT 2.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CGACTATGATCTTCCCCAATT	0.368								NHEJ					22	125	---	---	---	---	PASS
ATP4B	496	broad.mit.edu	37	13	114312455	114312455	+	Missense_Mutation	SNP	G	C	C	rs139992135		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114312455G>C	uc001vtz.2	-	1	47	c.5C>G	c.(4-6)GCG>GGG	p.A2G	ATP4B_uc010agy.1_Missense_Mutation_p.A2G	NM_000705	NP_000696	P51164	ATP4B_HUMAN	hydrogen/potassium-exchanging ATPase 4B	2	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	hydrogen:potassium-exchanging ATPase activity|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)		Rabeprazole(DB01129)	CTGCAGAGCCGCCATCGTCCC	0.637													9	14	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19573144	19573144	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19573144G>T	uc001vuz.1	+	8	1294	c.1242G>T	c.(1240-1242)AAG>AAT	p.K414N	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	414										ovary(1)	1						GTGATAGAAAGGTATACTTTT	0.318													9	87	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21993777	21993777	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21993777C>A	uc001wbe.2	-	2	367	c.85G>T	c.(85-87)GAG>TAG	p.E29*	SALL2_uc010tly.1_Nonsense_Mutation_p.E27*|SALL2_uc010tlz.1_Nonsense_Mutation_p.E27*|SALL2_uc001wbf.3_Nonsense_Mutation_p.E27*|SALL2_uc010tma.1_Nonsense_Mutation_p.E29*|SALL2_uc001wbg.1_Nonsense_Mutation_p.E29*	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	29							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		TGATCCTCCTCGCTAGCATCA	0.557													9	72	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24523975	24523975	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24523975C>T	uc001wlj.2	+	6	575	c.418C>T	c.(418-420)CCC>TCC	p.P140S		NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	140										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		AGATACATCCCCCAACTCTGA	0.562													22	101	---	---	---	---	PASS
GZMB	3002	broad.mit.edu	37	14	25102258	25102258	+	Silent	SNP	G	A	A	rs139103546		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25102258G>A	uc001wps.2	-	2	132	c.66C>T	c.(64-66)ATC>ATT	p.I22I	GZMB_uc010ama.2_Silent_p.I10I|GZMB_uc010amb.2_RNA	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	22	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		CATGTCCCCCGATGATCTCCC	0.567													47	264	---	---	---	---	PASS
STRN3	29966	broad.mit.edu	37	14	31376206	31376206	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31376206C>A	uc001wqu.2	-	14	1981	c.1765G>T	c.(1765-1767)GTT>TTT	p.V589F	STRN3_uc001wqv.2_Missense_Mutation_p.V505F|STRN3_uc010tpj.1_RNA	NM_001083893	NP_001077362	Q13033	STRN3_HUMAN	nuclear autoantigen isoform 1	589	WD 3.				negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AGACCCCAAACTGCATCTGTA	0.353													43	146	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44976081	44976081	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44976081C>T	uc001wvn.2	-	1	419	c.110G>A	c.(109-111)AGC>AAC	p.S37N		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	37						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		GCTGCCTTTGCTTCCAGAAGT	0.413													51	326	---	---	---	---	PASS
KLHL28	54813	broad.mit.edu	37	14	45414769	45414769	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45414769C>A	uc001wvq.2	-	2	609	c.363G>T	c.(361-363)CTG>CTT	p.L121L	KLHL28_uc001wvr.2_Silent_p.L121L|KLHL28_uc001wvt.3_Silent_p.L121L	NM_017658	NP_060128	Q9NXS3	KLH28_HUMAN	BTB (POZ) domain containing 5	121										ovary(1)	1						AACATTCTTTCAGGACAAGTT	0.408													26	103	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45642255	45642255	+	Intron	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45642255A>G	uc001wwd.3	+						FANCM_uc010anf.2_Intron|FANCM_uc001wwe.3_Intron|FANCM_uc010ang.2_5'Flank	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M						DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						TTAAATAATTAAGGCTCAAGA	0.308								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				11	119	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120628	47120628	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120628G>T	uc001wwg.2	-	1	401	c.312C>A	c.(310-312)TCC>TCA	p.S104S		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	104					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						CCCCAGCACAGGACAACATCT	0.532													27	100	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120629	47120629	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120629G>T	uc001wwg.2	-	1	400	c.311C>A	c.(310-312)TCC>TAC	p.S104Y		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	104					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						CCCAGCACAGGACAACATCTT	0.532													27	100	---	---	---	---	PASS
PPIL5	122769	broad.mit.edu	37	14	50065836	50065836	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50065836G>A	uc001wwn.2	+	1	422	c.98G>A	c.(97-99)TGT>TAT	p.C33Y	SDCCAG1_uc010anj.1_Intron|PPIL5_uc001wwo.2_Missense_Mutation_p.C33Y|PPIL5_uc010ank.2_5'UTR|PPIL5_uc001wwp.2_RNA	NM_152329	NP_689542	Q96L50	LLR1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 5	33											0	all_epithelial(31;0.0021)|Breast(41;0.0124)					TTGAGCCTCTGTCAGCAGACT	0.637													3	19	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59112428	59112428	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59112428A>T	uc001xdw.2	+	4	1251	c.1087A>T	c.(1087-1089)AAC>TAC	p.N363Y	DACT1_uc010trv.1_Missense_Mutation_p.N82Y|DACT1_uc001xdx.2_Missense_Mutation_p.N326Y|DACT1_uc010trw.1_Missense_Mutation_p.N82Y	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	363					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						AACCAGCGTGAACGCTGACCC	0.517													14	76	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68265178	68265178	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68265178C>A	uc001xka.2	-	11	1940	c.1801G>T	c.(1801-1803)GAG>TAG	p.E601*	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Nonsense_Mutation_p.E601*|ZFYVE26_uc010tta.1_Nonsense_Mutation_p.E601*	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	601					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCATCATCCTCAGCATAGTCC	0.522													27	109	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68268906	68268906	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68268906G>T	uc001xka.2	-	10	1668	c.1529C>A	c.(1528-1530)GCC>GAC	p.A510D	ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Missense_Mutation_p.A510D|ZFYVE26_uc010tta.1_Missense_Mutation_p.A510D	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	510					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TACACAGAGGGCATAGATGGC	0.542													39	217	---	---	---	---	PASS
C14orf115	55237	broad.mit.edu	37	14	74824129	74824129	+	Missense_Mutation	SNP	C	A	A	rs142400429	byFrequency	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74824129C>A	uc001xpw.3	+	2	834	c.643C>A	c.(643-645)CCC>ACC	p.P215T		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	215					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		CGACCACGTGCCCTCCACGCT	0.637													14	88	---	---	---	---	PASS
KIAA0317	9870	broad.mit.edu	37	14	75143291	75143291	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75143291G>C	uc001xqb.2	-	6	1151	c.646C>G	c.(646-648)CAT>GAT	p.H216D	KIAA0317_uc010tut.1_Missense_Mutation_p.H55D|KIAA0317_uc001xqc.2_Missense_Mutation_p.H216D	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870	216					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		CTTACCTCATGAATGGACAAG	0.453													51	142	---	---	---	---	PASS
FAM164C	79696	broad.mit.edu	37	14	75537471	75537471	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75537471G>A	uc001xri.2	+	2	368	c.195G>A	c.(193-195)CTG>CTA	p.L65L	FAM164C_uc001xrh.2_Silent_p.L65L	NM_001042430	NP_001035895	Q53FD0	F164C_HUMAN	chromosome 14 open reading frame 140 isoform b	65										ovary(1)	1						AGTTGATTCTGGATAAAGTCT	0.473													110	276	---	---	---	---	PASS
GPR65	8477	broad.mit.edu	37	14	88477477	88477477	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88477477A>C	uc001xvv.2	+	2	816	c.286A>C	c.(286-288)ATG>CTG	p.M96L		NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	96	Helical; Name=3; (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0						TCTCATGTACATGAATTTTTA	0.413													132	375	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88729855	88729855	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88729855G>T	uc001xwo.2	-	2	535	c.78C>A	c.(76-78)AGC>AGA	p.S26R	KCNK10_uc001xwm.2_Missense_Mutation_p.S31R|KCNK10_uc001xwn.2_Missense_Mutation_p.S31R	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	26	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						CGTTAGTGGCGCTCTTGGGCT	0.592													37	121	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92908488	92908488	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92908488C>A	uc001yak.2	+	5	422	c.398C>A	c.(397-399)TCA>TAA	p.S133*	SLC24A4_uc001yai.2_Nonsense_Mutation_p.S86*|SLC24A4_uc010twm.1_Nonsense_Mutation_p.S150*|SLC24A4_uc001yaj.2_Nonsense_Mutation_p.S133*|SLC24A4_uc010auj.2_Nonsense_Mutation_p.S41*|SLC24A4_uc010twn.1_5'Flank	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	150	Cytoplasmic (Potential).|Alpha-1.					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GCAGGAAGCTCAACGCCAGAG	0.557													12	100	---	---	---	---	PASS
TCL1B	9623	broad.mit.edu	37	14	96152930	96152930	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96152930G>T	uc001yez.2	+	1	168	c.126G>T	c.(124-126)TCG>TCT	p.S42S	TCL1B_uc001yew.2_Intron|TCL1B_uc001yex.2_Intron|TCL1B_uc010avj.2_Intron|TCL1B_uc001yfa.2_Silent_p.S42S	NM_004918	NP_004909	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	42										ovary(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		TCAATCCCTCGCGTAGGGAAT	0.667													14	70	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96769593	96769593	+	Splice_Site	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96769593C>A	uc001yfi.2	-	33	5208	c.4843_splice	c.e33-1	p.V1615_splice		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B											ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GAAACTTCACCTTAACGGGTA	0.418													14	122	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	101396322	101396322	+	IGR	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101396322G>A								SNORD113-2 (2574 upstream) : SNORD113-4 (6506 downstream)																							taactctgaggtccaTTATAA	0.144													94	156	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102472281	102472281	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102472281T>C	uc001yks.2	+	27	5654	c.5490T>C	c.(5488-5490)ATT>ATC	p.I1830I		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1830	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						AAAGCAAGATTGACAACGCCA	0.388													53	297	---	---	---	---	PASS
MARK3	4140	broad.mit.edu	37	14	103941431	103941431	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103941431A>G	uc001ymz.3	+	13	2032	c.1366A>G	c.(1366-1368)AGT>GGT	p.S456G	MARK3_uc001ymx.3_Missense_Mutation_p.S456G|MARK3_uc001ymw.3_Missense_Mutation_p.S456G|MARK3_uc001yna.3_Missense_Mutation_p.S440G|MARK3_uc001ymy.3_Missense_Mutation_p.S377G|MARK3_uc010awp.2_Missense_Mutation_p.S479G|MARK3_uc010tyb.1_Missense_Mutation_p.S251G|MARK3_uc010awq.2_5'UTR	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	456				S -> T (in Ref. 5; AAA59991).			ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			CCGGAAATCAAGTGGCAGTGC	0.483													9	68	---	---	---	---	PASS
BRF1	2972	broad.mit.edu	37	14	105739131	105739131	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105739131C>A	uc001yqp.2	-	3	729	c.366G>T	c.(364-366)CTG>CTT	p.L122L	BRF1_uc010tyo.1_Silent_p.L7L|BRF1_uc010typ.1_Silent_p.L7L|BRF1_uc010axg.1_Silent_p.L95L|BRF1_uc001yqr.2_Silent_p.L122L	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1	122	1.				positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GGCCGCGGGTCAGGTGCCTGC	0.637													52	82	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106053432	106053432	+	Intron	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106053432C>T	uc010tyt.1	-						uc001yrs.2_RNA|uc001yrt.2_Missense_Mutation_p.A295T					Parts of antibodies, mostly variable regions.												0						CAGTCCTCAGCTGCCACGCGC	0.642													13	50	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106173663	106173663	+	RNA	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106173663C>T	uc010tyt.1	-	3633		c.60235G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysc.2_5'Flank					Parts of antibodies, mostly variable regions.												0						CAGTCCTCGGCTGCCACGCGC	0.652													10	77	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23812394	23812394	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23812394G>T	uc001ywh.3	+	1	1941	c.1465G>T	c.(1465-1467)GAG>TAG	p.E489*	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Intron	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	489						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		ACCCTTCTCTGAGGACCAGTG	0.453													48	229	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25456996	25456996	+	Intron	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25456996T>A	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_Intron|PAR4_uc001yzs.2_RNA|uc001yzt.1_5'Flank|HBII-52-24_uc010ayp.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GACTTAAAATTACCATGCTCA	0.527													72	295	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25650618	25650618	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25650618C>A	uc001zaq.2	-	2	61	c.61G>T	c.(61-63)GCT>TCT	p.A21S	UBE3A_uc001zar.2_5'UTR|UBE3A_uc001zas.2_Missense_Mutation_p.A18S|UBE3A_uc001zat.2_5'UTR|UBE3A_uc001zau.1_RNA	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	21					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		ATTCGGCTAGCTTCAATGTCG	0.348													33	154	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	29993840	29993840	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29993840C>A	uc001zcr.2	-	28	5681	c.5206G>T	c.(5206-5208)GTT>TTT	p.V1736F	TJP1_uc010azl.2_Missense_Mutation_p.V1744F|TJP1_uc001zcq.2_Missense_Mutation_p.V1680F|TJP1_uc001zcs.2_Missense_Mutation_p.V1656F	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	1736					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TTTGCTCCAACGAGATAATTT	0.348													24	91	---	---	---	---	PASS
ACTC1	70	broad.mit.edu	37	15	35085701	35085701	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35085701G>T	uc001ziu.1	-	3	442	c.199C>A	c.(199-201)CTG>ATG	p.L67M	uc001zit.1_Intron	NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein	67					apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TTCAGGGTCAGGATGCCTCTC	0.498													44	71	---	---	---	---	PASS
EIF2AK4	440275	broad.mit.edu	37	15	40308761	40308761	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40308761C>A	uc001zkm.1	+	28	3868	c.3818C>A	c.(3817-3819)ACA>AAA	p.T1273K	EIF2AK4_uc010bbj.1_Missense_Mutation_p.T974K|EIF2AK4_uc001zkn.1_Missense_Mutation_p.T373K|EIF2AK4_uc001zko.1_Intron|EIF2AK4_uc010bbk.1_RNA	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	1273	Histidyl-tRNA synthetase-like.				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CTTATGCCAACAATAAATTCA	0.428													4	122	---	---	---	---	PASS
BUB1B	701	broad.mit.edu	37	15	40462291	40462291	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40462291A>T	uc001zkx.3	+	3	420	c.208A>T	c.(208-210)ACT>TCT	p.T70S		NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	70	BUB1 N-terminal.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		TCGATTTTACACTGGAAATGA	0.353			Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				45	104	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50264859	50264859	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50264859T>A	uc001zxu.2	-	13	1305	c.1163A>T	c.(1162-1164)TAC>TTC	p.Y388F	ATP8B4_uc010ber.2_Missense_Mutation_p.Y261F|ATP8B4_uc010ufd.1_Missense_Mutation_p.Y261F|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	388	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GGAGAAAATGTACTCAATCTG	0.413													24	71	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53049925	53049925	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53049925G>T	uc002aci.1	-	2	1353	c.1225C>A	c.(1225-1227)CGT>AGT	p.R409S		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	409	Homeobox.				endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		TTGGATGGACGCTTATTTTCC	0.478													79	188	---	---	---	---	PASS
ISLR	3671	broad.mit.edu	37	15	74468267	74468267	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74468267G>A	uc002axg.1	+	2	1350	c.1068G>A	c.(1066-1068)GGG>GGA	p.G356G	ISLR_uc002axh.1_Silent_p.G356G	NM_005545	NP_005536	O14498	ISLR_HUMAN	immunoglobulin superfamily containing	356					cell adhesion	extracellular region				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						ACACACTGGGGCGCAGGTTCC	0.617													3	36	---	---	---	---	PASS
LINGO1	84894	broad.mit.edu	37	15	77906817	77906817	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77906817G>T	uc002bct.1	-	2	1484	c.1432C>A	c.(1432-1434)CCT>ACT	p.P478T	LINGO1_uc002bcu.1_Missense_Mutation_p.P472T	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	478	Extracellular (Potential).|Ig-like C2-type.				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2						GTGCCATCAGGGAAGACTGTG	0.677													8	21	---	---	---	---	PASS
HDGFRP3	50810	broad.mit.edu	37	15	83808016	83808016	+	3'UTR	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83808016T>C	uc002bjs.1	-	6						NM_016073	NP_057157	Q9Y3E1	HDGR3_HUMAN	hepatoma-derived growth factor, related protein						cell proliferation	nucleus	growth factor activity				0						GCATTCATTATGGTAGTTAGG	0.318													20	108	---	---	---	---	PASS
WDR73	84942	broad.mit.edu	37	15	85189409	85189409	+	Intron	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85189409C>T	uc002bkw.2	-						WDR73_uc002bkv.2_RNA|WDR73_uc002bkx.2_Intron|WDR73_uc010upa.1_Missense_Mutation_p.V175M|uc002bky.1_3'UTR	NM_032856	NP_116245	Q6P4I2	WDR73_HUMAN	WD repeat domain 73												0						CAAAGTACCACGGTACCTGAG	0.498													10	38	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85326964	85326964	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85326964G>T	uc002bld.2	+	4	1394	c.1058G>T	c.(1057-1059)TGC>TTC	p.C353F	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	353					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGTAGCATCTGCAGTGACAGC	0.532													50	100	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15729647	15729647	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15729647C>A	uc002ddr.2	-	3	890	c.697G>T	c.(697-699)GCT>TCT	p.A233S	KIAA0430_uc002ddq.2_Missense_Mutation_p.A232S|KIAA0430_uc010uzv.1_Missense_Mutation_p.A232S|KIAA0430_uc010uzw.1_Missense_Mutation_p.A232S|KIAA0430_uc010uzx.1_Missense_Mutation_p.A232S	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	232						peroxisome	nucleotide binding|RNA binding				0						TGCCCTGGAGCCCCGCTTGTG	0.512													36	62	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20996449	20996449	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20996449C>T	uc010vbe.1	-	48	7615	c.7615G>A	c.(7615-7617)GAG>AAG	p.E2539K	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2539	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCAACCTTCTCTCCTTGGGTC	0.463													23	59	---	---	---	---	PASS
AQP8	343	broad.mit.edu	37	16	25238398	25238398	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25238398G>T	uc002doc.2	+	5	694	c.612G>T	c.(610-612)GTG>GTT	p.V204V		NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8	204	Helical; (Potential).				cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		GGGGCCCTGTGTCTGGAGGCT	0.612													40	77	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27733015	27733015	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27733015G>C	uc002dow.2	+	14	1766	c.1742G>C	c.(1741-1743)GGC>GCC	p.G581A	KIAA0556_uc002dox.1_Missense_Mutation_p.G489A	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	581										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						ACAGCTGATGGCGTAAGTAAC	0.493													21	55	---	---	---	---	PASS
GSG1L	146395	broad.mit.edu	37	16	27802692	27802692	+	Nonstop_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27802692C>A	uc002doz.2	-	7	1080	c.995G>T	c.(994-996)TGA>TTA	p.*332L	GSG1L_uc010bya.1_Nonstop_Mutation_p.*281L|GSG1L_uc010bxz.1_Nonstop_Mutation_p.*195L|GSG1L_uc002doy.2_Nonstop_Mutation_p.*177L	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1	332						integral to membrane				ovary(1)	1						AGGTCTTGGTCACACCCAGTG	0.662													13	46	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28986619	28986619	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28986619C>T	uc010vdi.1	+	2	287	c.147C>T	c.(145-147)CGC>CGT	p.R49R	uc010vct.1_Intron|SPNS1_uc002dry.2_Silent_p.R49R|SPNS1_uc002drx.2_5'UTR|SPNS1_uc002dsa.2_Silent_p.R49R|SPNS1_uc002drz.2_Silent_p.R49R|SPNS1_uc010byp.2_Silent_p.R49R|SPNS1_uc010byq.1_5'UTR	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	49					lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						GGCTGCAGCGCATCACCGGCC	0.677													5	10	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31419090	31419090	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31419090G>T	uc002ebv.1	+	9	911	c.862G>T	c.(862-864)GGA>TGA	p.G288*	ITGAD_uc010vfl.1_Missense_Mutation_p.G320V|ITGAD_uc010cap.1_Nonsense_Mutation_p.G288*|ITGAD_uc002ebw.1_Missense_Mutation_p.G131V	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	288	Extracellular (Potential).|VWFA.				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						GCTGCAGGTGGGACACGCTTT	0.622													25	44	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53326832	53326832	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53326832A>T	uc002ehb.2	+	28	5542	c.5378A>T	c.(5377-5379)CAG>CTG	p.Q1793L	CHD9_uc002egy.2_Missense_Mutation_p.Q1793L|CHD9_uc002ehc.2_Missense_Mutation_p.Q1793L|CHD9_uc002ehf.2_Missense_Mutation_p.Q907L|CHD9_uc010cbw.2_Missense_Mutation_p.Q161L	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1793					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				ACTGCATACCAGCGTACTAAT	0.413													37	89	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61761073	61761073	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61761073C>T	uc002eog.1	-	9	1713	c.1461G>A	c.(1459-1461)CTG>CTA	p.L487L	CDH8_uc002eoh.2_Silent_p.L256L	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	487	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CATTGACATCCAGCACTTTAA	0.403													77	173	---	---	---	---	PASS
SLC38A8	146167	broad.mit.edu	37	16	84070480	84070480	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84070480C>A	uc002fhg.1	-	2	215	c.215G>T	c.(214-216)GGG>GTG	p.G72V		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	72	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane					0						GATGACCAGCCCGCTGATCAG	0.662													10	15	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89924792	89924792	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89924792C>T	uc002foz.1	+	8	1201	c.1149C>T	c.(1147-1149)GCC>GCT	p.A383A	SPIRE2_uc010civ.1_Silent_p.A298A|SPIRE2_uc010ciw.1_Silent_p.A383A|SPIRE2_uc002fpa.1_Silent_p.A335A|SPIRE2_uc010cix.1_Silent_p.A250A	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	383					transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		CCGGAGATGCCAAGTCCACCT	0.672													72	152	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15968834	15968834	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15968834T>C	uc002gpo.2	-	33	5156	c.4916A>G	c.(4915-4917)GAG>GGG	p.E1639G	NCOR1_uc002gpn.2_Missense_Mutation_p.E1655G|NCOR1_uc002gpm.2_Missense_Mutation_p.E159G|NCOR1_uc010vwb.1_Missense_Mutation_p.E223G|NCOR1_uc010coy.2_Missense_Mutation_p.E547G|NCOR1_uc010vwc.1_Missense_Mutation_p.E449G	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1639	Interaction with ETO.|Interaction with C1D (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CAGTGGCTGCTCTCTTGGGGA	0.398													14	66	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15968835	15968835	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15968835C>A	uc002gpo.2	-	33	5155	c.4915G>T	c.(4915-4917)GAG>TAG	p.E1639*	NCOR1_uc002gpn.2_Nonsense_Mutation_p.E1655*|NCOR1_uc002gpm.2_Nonsense_Mutation_p.E159*|NCOR1_uc010vwb.1_Nonsense_Mutation_p.E223*|NCOR1_uc010coy.2_Nonsense_Mutation_p.E547*|NCOR1_uc010vwc.1_Nonsense_Mutation_p.E449*	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1639	Interaction with ETO.|Interaction with C1D (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AGTGGCTGCTCTCTTGGGGAG	0.398													14	66	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21319036	21319036	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319036C>A	uc002gyv.1	+	3	1087	c.382C>A	c.(382-384)CAC>AAC	p.H128N		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	128	Extracellular (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	GATGCAGGTGCACGGCTTCAT	0.657										Prostate(3;0.18)			4	29	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32956181	32956181	+	Silent	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32956181G>C	uc002hif.2	+	5	1354	c.1026G>C	c.(1024-1026)ACG>ACC	p.T342T		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	342	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		CTGAGCTGACGGTCATTCAGC	0.602													8	34	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32959860	32959860	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32959860C>T	uc002hif.2	+	7	1678	c.1350C>T	c.(1348-1350)CAC>CAT	p.H450H		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	450	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		TGCCCTTGCACATTGAGCTCT	0.607													68	217	---	---	---	---	PASS
SLFN5	162394	broad.mit.edu	37	17	33586457	33586457	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33586457A>T	uc002hjf.3	+	2	865	c.748A>T	c.(748-750)AGC>TGC	p.S250C	SLFN5_uc002hje.2_Missense_Mutation_p.S250C|SLFN5_uc010wcg.1_Missense_Mutation_p.S250C	NM_144975	NP_659412	Q08AF3	SLFN5_HUMAN	schlafen family member 5	250					cell differentiation		ATP binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		AGACCTTACGAGCTTGAGGGC	0.388													63	175	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901108	51901108	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901108C>A	uc002iua.2	+	1	870	c.714C>A	c.(712-714)GTC>GTA	p.V238V	uc010wna.1_Intron	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	238	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TCATCACCGTCCCCTCGGACA	0.557													19	56	---	---	---	---	PASS
INTS2	57508	broad.mit.edu	37	17	59989438	59989438	+	Intron	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59989438T>C	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						CAAACTAACATGATAGAAACC	0.303													100	218	---	---	---	---	PASS
CCDC137	339230	broad.mit.edu	37	17	79639558	79639558	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79639558C>G	uc002kbc.3	+	6	730	c.694C>G	c.(694-696)CTG>GTG	p.L232V	CCDC137_uc002kbd.2_RNA	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	232										central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCGGATGCTTCTGAGCCCCGG	0.652													3	6	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3582091	3582091	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3582091G>T	uc002kmf.2	-	5	1814	c.1747C>A	c.(1747-1749)CAG>AAG	p.Q583K	DLGAP1_uc010wyz.1_Missense_Mutation_p.Q583K|DLGAP1_uc002kme.1_Missense_Mutation_p.Q281K|DLGAP1_uc010dkn.2_Missense_Mutation_p.Q291K|DLGAP1_uc010wyw.1_Missense_Mutation_p.Q289K|DLGAP1_uc010wyx.1_Missense_Mutation_p.Q305K|DLGAP1_uc010wyy.1_Missense_Mutation_p.Q267K|DLGAP1_uc002kmg.2_Missense_Mutation_p.Q281K	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	583					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				AGTCCAGACTGGCTGATAATA	0.557													47	102	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3582092	3582092	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3582092G>A	uc002kmf.2	-	5	1813	c.1746C>T	c.(1744-1746)AGC>AGT	p.S582S	DLGAP1_uc010wyz.1_Silent_p.S582S|DLGAP1_uc002kme.1_Silent_p.S280S|DLGAP1_uc010dkn.2_Silent_p.S290S|DLGAP1_uc010wyw.1_Silent_p.S288S|DLGAP1_uc010wyx.1_Silent_p.S304S|DLGAP1_uc010wyy.1_Silent_p.S266S|DLGAP1_uc002kmg.2_Silent_p.S280S	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	582					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				GTCCAGACTGGCTGATAATAT	0.562													48	103	---	---	---	---	PASS
KCTD1	284252	broad.mit.edu	37	18	24056539	24056539	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24056539C>A	uc002kvw.2	-	3	809	c.249G>T	c.(247-249)ATG>ATT	p.M83I	KCTD1_uc010xbj.1_Missense_Mutation_p.M691I|KCTD1_uc010xbk.1_Missense_Mutation_p.M83I|KCTD1_uc002kvy.2_Missense_Mutation_p.M1I	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain	83	BTB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			TATATCTGAACATCTGTCCAT	0.373													25	60	---	---	---	---	PASS
DSC1	1823	broad.mit.edu	37	18	28723718	28723718	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28723718C>T	uc002kwn.2	-	8	1238	c.976G>A	c.(976-978)GAC>AAC	p.D326N	DSC1_uc002kwm.2_Missense_Mutation_p.D326N	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	326	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			CCACCCATGTCTCGCACTTCC	0.333													22	46	---	---	---	---	PASS
MBD1	4152	broad.mit.edu	37	18	47796151	47796151	+	Intron	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47796151T>C	uc010dow.1	-						MBD1_uc002lef.2_Intron|MBD1_uc002leg.2_Intron|MBD1_uc010xdi.1_3'UTR|MBD1_uc002leh.3_3'UTR|MBD1_uc002len.2_3'UTR|MBD1_uc002lei.3_3'UTR|MBD1_uc002lej.3_3'UTR|MBD1_uc002lek.3_3'UTR|MBD1_uc002lel.3_Missense_Mutation_p.K537E|MBD1_uc002lem.3_Missense_Mutation_p.K606E|MBD1_uc010xdj.1_Silent_p.V501V	NM_015846	NP_056671	Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1 isoform 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						tcccacactttacatccatct	0.000													31	72	---	---	---	---	PASS
C18orf55	29090	broad.mit.edu	37	18	71825704	71825704	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71825704C>G	uc010dqr.1	+	6	1034	c.736C>G	c.(736-738)CAA>GAA	p.Q246E		NM_014177	NP_054896	Q9BVV7	TI21L_HUMAN	hypothetical protein LOC29090 precursor	246					protein transport|transmembrane transport	integral to membrane|mitochondrial membrane					0		Esophageal squamous(42;0.0746)|Prostate(75;0.157)|Melanoma(33;0.211)				TAATCGATCCCAAGATGATTA	0.363													3	19	---	---	---	---	PASS
SHC2	25759	broad.mit.edu	37	19	422160	422160	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:422160C>A	uc002loq.3	-	11	1606	c.1606G>T	c.(1606-1608)GAC>TAC	p.D536Y	SHC2_uc002lop.3_Missense_Mutation_p.D277Y	NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)	536	SH2.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTCGGGGTCCACGAGCAGC	0.682													9	15	---	---	---	---	PASS
SHC2	25759	broad.mit.edu	37	19	422161	422161	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:422161C>A	uc002loq.3	-	11	1605	c.1605G>T	c.(1603-1605)GTG>GTT	p.V535V	SHC2_uc002lop.3_Silent_p.V276V	NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)	535	SH2.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCGGGGTCCACGAGCAGCA	0.687													9	15	---	---	---	---	PASS
TBXA2R	6915	broad.mit.edu	37	19	3600005	3600005	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600005G>T	uc002lyg.1	-	2	842	c.628C>A	c.(628-630)CTG>ATG	p.L210M	TBXA2R_uc002lye.1_Intron	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	210	Helical; Name=5; (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	AGGAAGGACAGCCCGACCGAG	0.697													13	15	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8175791	8175791	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8175791C>A	uc002mjf.2	-	33	4292	c.4271G>T	c.(4270-4272)GGA>GTA	p.G1424V		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1424	EGF-like 22; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCGGAACATTCCAGGCAGGTT	0.612													67	120	---	---	---	---	PASS
ACTL9	284382	broad.mit.edu	37	19	8808488	8808488	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8808488G>A	uc002mkl.2	-	1	685	c.564C>T	c.(562-564)CAC>CAT	p.H188H		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	188						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						TGACACGACCGTGGGCGTAGA	0.662													28	48	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9062542	9062542	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9062542G>T	uc002mkp.2	-	3	25108	c.24904C>A	c.(24904-24906)CCT>ACT	p.P8302T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8304	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACCAGGCCAGGGTTGAGAAGA	0.517													40	99	---	---	---	---	PASS
OR7E24	26648	broad.mit.edu	37	19	9362644	9362644	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9362644A>G	uc002mlb.1	+	1	925	c.925A>G	c.(925-927)AGC>GGC	p.S309G		NM_001079935	NP_001073404	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E,	309	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTTCATCTACAGCCTGAGGAA	0.483													34	81	---	---	---	---	PASS
MAN2B1	4125	broad.mit.edu	37	19	12758128	12758128	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12758128T>C	uc002mub.2	-	23	2918	c.2842A>G	c.(2842-2844)ATC>GTC	p.I948V	MAN2B1_uc010dyv.1_Missense_Mutation_p.I947V	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	948					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						AGGCGGGTGATGGTGAAGGTG	0.632													43	84	---	---	---	---	PASS
EMR3	84658	broad.mit.edu	37	19	14748941	14748941	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14748941G>T	uc002mzi.3	-	11	1608	c.1460C>A	c.(1459-1461)CCT>CAT	p.P487H	EMR3_uc010dzp.2_Missense_Mutation_p.P435H|EMR3_uc010xnv.1_Missense_Mutation_p.P361H	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor	487	Extracellular (Potential).				neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						ATAAAGGTGAGGCCAGGAGGC	0.498													62	144	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15572071	15572071	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15572071C>A	uc002nbe.2	-	4	588	c.502G>T	c.(502-504)GAG>TAG	p.E168*		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	168					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						ATGCTGCCCTCGGAGCTAGCA	0.542													6	25	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22157333	22157333	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22157333G>T	uc002nqp.2	-	4	652	c.503C>A	c.(502-504)ACT>AAT	p.T168N	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTCTTTCCAGTATGCCTTAT	0.328													34	105	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039975	31039975	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039975C>T	uc002nsu.1	+	4	3587	c.3449C>T	c.(3448-3450)CCC>CTC	p.P1150L	ZNF536_uc010edd.1_Missense_Mutation_p.P1150L	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1150					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					ATCCTGATCCCCGAAACCACG	0.547													20	105	---	---	---	---	PASS
CCDC123	84902	broad.mit.edu	37	19	33392320	33392320	+	Splice_Site	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33392320T>A	uc002nty.2	-	15	1655	c.1566_splice	c.e15-1	p.S522_splice	CCDC123_uc002ntx.2_Splice_Site_p.S275_splice|CCDC123_uc010edg.2_Splice_Site	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)					TGTAATTGGCTGAAGGACAAA	0.478													69	221	---	---	---	---	PASS
ZNF567	163081	broad.mit.edu	37	19	37211129	37211129	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37211129A>G	uc010xtl.1	+	6	1725	c.1503A>G	c.(1501-1503)GGA>GGG	p.G501G	ZNF567_uc002oeo.1_Silent_p.G501G|ZNF567_uc010xtk.1_Silent_p.G501G|ZNF567_uc002oep.3_Silent_p.G470G|ZNF567_uc002oeq.1_Silent_p.G470G	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	501					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CTCACACAGGAGAGAAACCAT	0.388													23	121	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39212286	39212286	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39212286A>G	uc002oja.1	+	12	1459	c.1400A>G	c.(1399-1401)CAG>CGG	p.Q467R	ACTN4_uc010egc.1_Missense_Mutation_p.Q467R	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	467	Spectrin 2.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCTGCGCACCAGGACCGCGTG	0.622													20	73	---	---	---	---	PASS
SHKBP1	92799	broad.mit.edu	37	19	41097083	41097083	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41097083C>T	uc002oob.2	+	18	2143	c.2094C>T	c.(2092-2094)CCC>CCT	p.P698P	SHKBP1_uc002ooc.2_Silent_p.P673P|SHKBP1_uc002ood.2_Silent_p.P606P|SHKBP1_uc002ooe.2_Silent_p.P535P|SHKBP1_uc002oof.2_Silent_p.P534P|SHKBP1_uc010xvm.1_Silent_p.P478P|SHKBP1_uc010xvn.1_Silent_p.P576P|LTBP4_uc002oog.1_5'Flank	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	698						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCACACCTCCCAAGATGAAGC	0.622													11	52	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41626392	41626392	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41626392A>G	uc002opu.1	+	4	531	c.475A>G	c.(475-477)AAA>GAA	p.K159E	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Missense_Mutation_p.K159E|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	159					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						GGAGCTGCGGAAAACTGAAGG	0.403													48	202	---	---	---	---	PASS
CEACAM20	125931	broad.mit.edu	37	19	45029205	45029205	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45029205G>T	uc010ejn.1	-	2	141	c.125C>A	c.(124-126)ACC>AAC	p.T42N	CEACAM20_uc010ejo.1_Missense_Mutation_p.T42N|CEACAM20_uc010ejp.1_Missense_Mutation_p.T42N|CEACAM20_uc010ejq.1_Missense_Mutation_p.T42N	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	42	Extracellular (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				CTCACTTTGGGTGGCATCAAG	0.562													53	127	---	---	---	---	PASS
CLPTM1	1209	broad.mit.edu	37	19	45489736	45489736	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45489736G>T	uc002pai.2	+	7	711	c.696G>T	c.(694-696)GTG>GTT	p.V232V	CLPTM1_uc010ejv.1_Silent_p.V130V|CLPTM1_uc010xxf.1_Silent_p.V130V|CLPTM1_uc010xxg.1_Silent_p.V218V	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	232	Extracellular (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		ATGGGCCTGTGGAGGTGATCT	0.592													42	147	---	---	---	---	PASS
CLPTM1	1209	broad.mit.edu	37	19	45489737	45489737	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45489737G>T	uc002pai.2	+	7	712	c.697G>T	c.(697-699)GAG>TAG	p.E233*	CLPTM1_uc010ejv.1_Nonsense_Mutation_p.E131*|CLPTM1_uc010xxf.1_Nonsense_Mutation_p.E131*|CLPTM1_uc010xxg.1_Nonsense_Mutation_p.E219*	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	233	Extracellular (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		TGGGCCTGTGGAGGTGATCTC	0.587													40	150	---	---	---	---	PASS
HAS1	3036	broad.mit.edu	37	19	52219607	52219607	+	Silent	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52219607A>T	uc002pxo.1	-	4	998	c.963T>A	c.(961-963)CTT>CTA	p.L321L	HAS1_uc010epc.1_Intron|HAS1_uc010epd.1_Silent_p.L286L|HAS1_uc002pxn.1_Silent_p.L328L|HAS1_uc002pxp.1_Silent_p.L320L	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1	321	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACCAGGCCTCAAGAAACTGCT	0.473													11	133	---	---	---	---	PASS
DPRX	503834	broad.mit.edu	37	19	54140201	54140201	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54140201G>T	uc002qcf.1	+	3	586	c.535G>T	c.(535-537)GGC>TGC	p.G179C		NM_001012728	NP_001012746	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	179						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		CTTCCATTCTGGCTCTCCTGC	0.388													58	236	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55085922	55085922	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55085922G>C	uc002qgg.3	+	3	314	c.225G>C	c.(223-225)GAG>GAC	p.E75D	LILRA2_uc010ern.2_Missense_Mutation_p.E75D|LILRA2_uc002qgf.2_Missense_Mutation_p.E75D|LILRA2_uc010yfe.1_Missense_Mutation_p.E75D|LILRA2_uc010yff.1_Missense_Mutation_p.E63D|LILRA2_uc010ero.2_Missense_Mutation_p.E63D|LILRA2_uc010yfg.1_Missense_Mutation_p.E75D	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	75	Extracellular (Potential).|Ig-like C2-type 1.				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		GGATACAAGAGCCTGGGAAGA	0.522													69	114	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55148200	55148200	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55148200C>A	uc002qgj.2	+	16	2164	c.1824C>A	c.(1822-1824)GCC>GCA	p.A608A	LILRB1_uc002qgl.2_Silent_p.A609A|LILRB1_uc002qgk.2_Silent_p.A609A|LILRB1_uc002qgm.2_Silent_p.A610A|LILRB1_uc010erq.2_Silent_p.A592A|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	608	Cytoplasmic (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CATCTGAAGCCCCCCAGGATG	0.657										HNSCC(37;0.09)			32	110	---	---	---	---	PASS
PPP1R12C	54776	broad.mit.edu	37	19	55624120	55624120	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55624120T>A	uc002qix.2	-	2	381	c.365A>T	c.(364-366)GAG>GTG	p.E122V	PPP1R12C_uc010yfs.1_Missense_Mutation_p.E48V|PPP1R12C_uc002qiy.2_Missense_Mutation_p.E122V	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	122	ANK 1.					cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGCGCCCTGCTCCACCAAGAA	0.642													50	144	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56372885	56372885	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56372885C>A	uc002qmd.3	+	4	2412	c.1990C>A	c.(1990-1992)CAT>AAT	p.H664N	NLRP4_uc002qmf.2_Missense_Mutation_p.H589N|NLRP4_uc010etf.2_Missense_Mutation_p.H495N	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	664							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CCAGCTGAGGCATCCCAGCTG	0.557													37	161	---	---	---	---	PASS
PDYN	5173	broad.mit.edu	37	20	1961062	1961062	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1961062C>G	uc010gaj.2	-	3	914	c.672G>C	c.(670-672)AAG>AAC	p.K224N	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.K224N|PDYN_uc010zpt.1_Missense_Mutation_p.K69N	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	224					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						CGCCATAGCGCTTCTGGTTGT	0.567													51	180	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3678513	3678513	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3678513C>A	uc002wja.2	-	8	2054	c.2054G>T	c.(2053-2055)GGC>GTC	p.G685V	SIGLEC1_uc002wiz.3_Missense_Mutation_p.G685V	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	685	Ig-like C2-type 6.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						GAGGTACAAGCCCTCCTCTTC	0.622													36	118	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7886921	7886921	+	Missense_Mutation	SNP	C	A	A	rs113948510		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7886921C>A	uc002wmw.1	-	4	625	c.601G>T	c.(601-603)GAC>TAC	p.D201Y	HAO1_uc010gbu.2_Missense_Mutation_p.D201Y	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	201	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						CCACTGTCGTCTCCAAAATTT	0.353													59	154	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9546740	9546740	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9546740A>G	uc002wnl.2	-	6	1827	c.1282T>C	c.(1282-1284)TCC>CCC	p.S428P	PAK7_uc002wnk.2_Missense_Mutation_p.S428P|PAK7_uc002wnj.2_Missense_Mutation_p.S428P|PAK7_uc010gby.1_Missense_Mutation_p.S428P	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	428	Linker.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			TGTTCATGGGACACCCTGGAG	0.632													36	142	---	---	---	---	PASS
OVOL2	58495	broad.mit.edu	37	20	18005510	18005510	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18005510C>A	uc002wqi.1	-	4	841	c.598G>T	c.(598-600)GTG>TTG	p.V200L		NM_021220	NP_067043	Q9BRP0	OVOL2_HUMAN	zinc finger protein 339	200					negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1						TGCTGCTGCACCCCATGGATT	0.572													38	126	---	---	---	---	PASS
RBBP9	10741	broad.mit.edu	37	20	18474619	18474619	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18474619C>T	uc002wqy.2	-	3	307	c.231G>A	c.(229-231)GGG>GGA	p.G77G		NM_006606	NP_006597	O75884	RBBP9_HUMAN	retinoblastoma binding protein 9	77						cytoplasm|nucleus	hydrolase activity			haematopoietic_and_lymphoid_tissue(1)	1						CCGCGATGGCCCCAGAACTGT	0.483													37	93	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20177337	20177337	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20177337A>G	uc002wru.2	+	16	1790	c.1714A>G	c.(1714-1716)AAG>GAG	p.K572E	C20orf26_uc010zse.1_Missense_Mutation_p.K552E	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	572										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		GCACTACACCAAGTTCTTTCT	0.458													33	143	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20278834	20278834	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20278834C>A	uc002wru.2	+	25	3302	c.3226C>A	c.(3226-3228)CTA>ATA	p.L1076I	C20orf26_uc002wrw.2_RNA	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	1076										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		GGGTTTAGAACTAGTAACCGG	0.388													30	70	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21695287	21695287	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21695287C>G	uc002wsj.2	+	5	1505	c.1451C>G	c.(1450-1452)ACG>AGG	p.T484R	PAX1_uc010zsl.1_3'UTR|PAX1_uc010zsm.1_3'UTR	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	484					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2						GCAATCGGCACGGGCAGGATC	0.771													3	7	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31671617	31671617	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31671617G>T	uc010zue.1	+	3	629	c.614G>T	c.(613-615)GGA>GTA	p.G205V		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	205	Gly-rich.					cytoplasm|extracellular region	lipid binding				0						CTTCTTGGAGGAGGGGGTGTC	0.652													23	70	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345744C>T	uc002xav.2	-	8	3378	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	NCOA6_uc002xaw.2_Silent_p.Q269Q|NCOA6_uc010gew.1_Silent_p.Q226Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						gctgctgctgctgttgttgtt	0.313													3	13	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37536446	37536446	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37536446C>A	uc002xje.2	+						PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TCTGCCCCTTCAGACCTGTGC	0.572													9	176	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40714482	40714482	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40714482C>A	uc002xkg.2	-	28	4042	c.3858G>T	c.(3856-3858)CAG>CAT	p.Q1286H	PTPRT_uc010ggj.2_Missense_Mutation_p.Q1305H|PTPRT_uc010ggi.2_Missense_Mutation_p.Q489H	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1286	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CAGGCCAGTACTGCATACAGA	0.488													31	136	---	---	---	---	PASS
PI3	5266	broad.mit.edu	37	20	43804748	43804748	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43804748G>A	uc002xng.2	+	2	350	c.326G>A	c.(325-327)TGC>TAC	p.C109Y		NM_002638	NP_002629	P19957	ELAF_HUMAN	elafin preproprotein	109	WAP.				copulation	proteinaceous extracellular matrix	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				GAAGGCTCTTGCGGGATGGCC	0.552													33	116	---	---	---	---	PASS
STX16	8675	broad.mit.edu	37	20	57245631	57245631	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57245631A>T	uc002xzi.2	+	6	1355	c.620A>T	c.(619-621)GAT>GTT	p.D207V	STX16_uc010zzq.1_Missense_Mutation_p.D21V|STX16_uc002xzk.2_Missense_Mutation_p.D190V|STX16_uc002xzm.2_Missense_Mutation_p.D203V|STX16_uc002xzj.2_Missense_Mutation_p.D186V|STX16_uc002xzl.2_Missense_Mutation_p.D21V	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a	207	Cytoplasmic (Potential).				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			CTAATGGATGATGGAGACGAT	0.438													22	94	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57474005	57474005	+	Silent	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57474005A>G	uc002xzw.2	+	3	2436	c.2151A>G	c.(2149-2151)GAA>GAG	p.E717E	GNAS_uc002xzt.2_3'UTR|GNAS_uc002xzu.3_RNA|GNAS_uc010gjq.2_Silent_p.E15E|GNAS_uc002xzv.2_RNA|GNAS_uc002xzx.2_Silent_p.E15E|GNAS_uc010gjr.2_Intron|GNAS_uc002xzy.2_Intron|GNAS_uc002yaa.2_Intron|GNAS_uc010zzt.1_Silent_p.E74E|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_5'UTR	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	74					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GGGGCGGCGAAGAGGACCCGC	0.473			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			19	219	---	---	---	---	PASS
CHRNA4	1137	broad.mit.edu	37	20	61982241	61982241	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61982241G>T	uc002yes.2	-	5	700	c.522C>A	c.(520-522)AAC>AAA	p.N174K	CHRNA4_uc002yet.1_Translation_Start_Site|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_Missense_Mutation_p.N103K|CHRNA4_uc002yev.1_Translation_Start_Site|CHRNA4_uc010gkf.1_Translation_Start_Site	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit	174	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	TCATGGTGCAGTTCTGCTGGT	0.602													44	152	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19775788	19775788	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19775788G>T	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AACTCCATGTGACTTACCTCG	0.413													51	146	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43519149	43519149	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43519149G>T	uc002zaf.1	+	7	1045	c.1045G>T	c.(1045-1047)GGT>TGT	p.G349C	UMODL1_uc002zad.1_Missense_Mutation_p.G277C|UMODL1_uc002zae.1_Missense_Mutation_p.G277C|UMODL1_uc002zag.1_Missense_Mutation_p.G349C|UMODL1_uc010gow.1_Missense_Mutation_p.G141C|UMODL1_uc002zai.1_5'UTR|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_5'UTR|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.G94C	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	349	Extracellular (Potential).|Fibronectin type-III 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						GGTTTACCGGGGTATGGAGTT	0.557													49	113	---	---	---	---	PASS
C21orf33	8209	broad.mit.edu	37	21	45564780	45564780	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45564780T>C	uc002zec.3	+	7	842	c.756T>C	c.(754-756)CAT>CAC	p.H252H	C21orf33_uc002zed.3_Silent_p.H221H	NM_004649	NP_004640	P30042	ES1_HUMAN	es1 protein isoform Ia precursor	252						mitochondrion				ovary(1)	1				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)		ACTACATCCATGATGGGATCG	0.582													36	62	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47551972	47551972	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47551972G>T	uc002zia.1	+	28	2648	c.2566G>T	c.(2566-2568)GTG>TTG	p.V856L	COL6A2_uc002zib.1_Missense_Mutation_p.V262L|COL6A2_uc002zic.1_5'UTR|COL6A2_uc010gqe.1_RNA	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	856	Nonhelical region.|VWFA 3.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCGGCGCTTCGTGGAGCAGGT	0.706													7	15	---	---	---	---	PASS
KLHL22	84861	broad.mit.edu	37	22	20819581	20819581	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20819581G>A	uc002zsl.1	-	4	785	c.676C>T	c.(676-678)CAG>TAG	p.Q226*	KLHL22_uc011ahr.1_Nonsense_Mutation_p.Q83*|KLHL22_uc002zsm.1_Nonsense_Mutation_p.Q226*	NM_032775	NP_116164	Q53GT1	KLH22_HUMAN	kelch-like	226					cell division	Cul3-RING ubiquitin ligase complex				lung(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCTGCACCTGCTCCAGGCTA	0.587													18	58	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26422656	26422656	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26422656C>G	uc003abz.1	+	43	6966	c.6716C>G	c.(6715-6717)TCG>TGG	p.S2239W	MYO18B_uc003aca.1_Missense_Mutation_p.S2120W|MYO18B_uc010guy.1_Missense_Mutation_p.S2121W|MYO18B_uc010guz.1_Missense_Mutation_p.S2119W|MYO18B_uc011aka.1_Missense_Mutation_p.S1393W|MYO18B_uc011akb.1_Missense_Mutation_p.S1752W|MYO18B_uc010gva.1_Missense_Mutation_p.S222W|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2239						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						TCCCCGCTGTCGAGGGAAAAG	0.612													13	31	---	---	---	---	PASS
GAL3ST1	9514	broad.mit.edu	37	22	30951750	30951750	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30951750C>T	uc003aig.1	-	4	602	c.462G>A	c.(460-462)CCG>CCA	p.P154P	GAL3ST1_uc003aih.1_Silent_p.P154P|GAL3ST1_uc003aii.1_Silent_p.P154P|GAL3ST1_uc010gvz.1_Silent_p.P154P	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	154	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						TGGCGTTGGTCGGCACCAGGC	0.652													47	141	---	---	---	---	PASS
BPIL2	254240	broad.mit.edu	37	22	32849427	32849427	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32849427C>A	uc003amn.2	-	2	188	c.188G>T	c.(187-189)AGC>ATC	p.S63I	BPIL2_uc010gwo.2_5'UTR|BPIL2_uc011amb.1_5'UTR|BPIL2_uc003amo.3_Missense_Mutation_p.S63I	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	63						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						CTCAGAACCGCTTAAATCTGG	0.264													20	62	---	---	---	---	PASS
ISX	91464	broad.mit.edu	37	22	35463085	35463085	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35463085G>T	uc003anj.2	+	1	956	c.5G>T	c.(4-6)TGT>TTT	p.C2F	ISX_uc011amg.1_5'UTR	NM_001008494	NP_001008494	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	2						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)	5						CCCTCAATGTGTGCTGAGGTG	0.617													13	29	---	---	---	---	PASS
PNPLA3	80339	broad.mit.edu	37	22	44330490	44330490	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44330490T>C	uc003bei.1	+	5	874	c.701T>C	c.(700-702)CTG>CCG	p.L234P	PNPLA3_uc010gzm.1_RNA	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	234	Lumenal (Potential).				triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)				TCACAGGTGCTGGGAGAGATA	0.493													37	87	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46657974	46657974	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46657974G>T	uc003bhh.2	-	1	1246	c.1246C>A	c.(1246-1248)CTG>ATG	p.L416M		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	416	Extracellular (Potential).|REJ.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		AAAAGTGTCAGTACAGGGCCC	0.522													71	137	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3238788	3238788	+	Silent	SNP	C	T	T	rs138419461		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3238788C>T	uc004crg.3	-	5	5095	c.4938G>A	c.(4936-4938)CCG>CCA	p.P1646P		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1646						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TAGTTATTTCCGGTTTGTTGG	0.453													144	438	---	---	---	---	PASS
GPR143	4935	broad.mit.edu	37	X	9728819	9728819	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9728819C>A	uc004cst.1	-	2	358	c.358G>T	c.(358-360)GAC>TAC	p.D120Y		NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143	100	Extracellular (Potential).				calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				GAGACGCTGTCAACAAAATTT	0.483													8	12	---	---	---	---	PASS
ASB9	140462	broad.mit.edu	37	X	15268612	15268612	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15268612G>T	uc004cwl.2	-	5	755	c.508C>A	c.(508-510)CCA>ACA	p.P170T	ASB9_uc004cwk.2_Missense_Mutation_p.P170T|ASB9_uc004cwm.2_Missense_Mutation_p.P160T|ASB9_uc010ner.2_Missense_Mutation_p.P170T|ASB9_uc004cwn.2_Missense_Mutation_p.P141T	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform	170	ANK 5.				intracellular signal transduction						0	Hepatocellular(33;0.183)					AAATAGAGTGGAGTGCCCAGG	0.458													68	199	---	---	---	---	PASS
PHEX	5251	broad.mit.edu	37	X	22115098	22115098	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22115098C>A	uc004dah.2	+	8	1078	c.875C>A	c.(874-876)ACC>AAC	p.T292N	PHEX_uc011mjr.1_Missense_Mutation_p.T292N|PHEX_uc011mjs.1_Missense_Mutation_p.T195N	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	292	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						GAAAACCGAACCAGCGAGGCC	0.363													18	122	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23019971	23019971	+	Silent	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23019971A>T	uc004daj.2	+	1	1885	c.1797A>T	c.(1795-1797)GTA>GTT	p.V599V		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	599	Helicase C-terminal.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						ATCTTGTAGTAATGGCTGAGC	0.388													43	142	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26179760	26179760	+	IGR	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26179760G>T								MAGEB18 (20908 upstream) : MAGEB6 (30797 downstream)																							CGGCAGGTGTGCAACAGTGAT	0.483													54	155	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27998447	27998447	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998447G>T	uc004dbx.1	-	1	1120	c.1005C>A	c.(1003-1005)GTC>GTA	p.V335V		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	335	WD 4.									ovary(3)|skin(1)	4						TATACAGTCCGACTTTCTTAT	0.418													49	123	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27998849	27998849	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998849G>T	uc004dbx.1	-	1	718	c.603C>A	c.(601-603)ACC>ACA	p.T201T		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	201	WD 1.									ovary(3)|skin(1)	4						TAAAGTGTATGGTACTGACAG	0.542													10	30	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31152218	31152218	+	Splice_Site	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31152218C>A	uc004dda.1	-	77	11258	c.11014_splice	c.e77+1	p.G3672_splice	DMD_uc004dcq.1_Splice_Site_p.G943_splice|DMD_uc004dcr.1_Splice_Site_p.G1092_splice|DMD_uc004dcs.1_Splice_Site_p.G1102_splice|DMD_uc004dct.1_Splice_Site_p.G1212_splice|DMD_uc004dcu.1_Splice_Site_p.G1212_splice|DMD_uc004dcv.1_Splice_Site_p.G1199_splice|DMD_uc004dcw.2_Splice_Site_p.G2328_splice|DMD_uc004dcx.2_Splice_Site_p.G2331_splice|DMD_uc004dcz.2_Splice_Site_p.G3549_splice|DMD_uc004dcy.1_Splice_Site_p.G3668_splice|DMD_uc004ddb.1_Splice_Site_p.G3664_splice|DMD_uc004dcm.1_Splice_Site_p.G604_splice|DMD_uc004dcn.1_Splice_Site_p.G591_splice|DMD_uc004dco.1_Splice_Site_p.G604_splice|DMD_uc004dcp.1_Splice_Site_p.G591_splice|DMD_uc011mkb.1_Splice_Site_p.G494_splice	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGGAGCTTACCTCTTGAACT	0.498													35	91	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37913508	37913508	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37913508G>T	uc004ddu.2	+	4	696	c.162G>T	c.(160-162)GGG>GGT	p.G54G	SYTL5_uc004ddv.2_Silent_p.G54G|SYTL5_uc004ddx.2_Silent_p.G54G	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	54	RabBD.				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						GTAGAAGTGGGAAAACTCAAC	0.438													23	72	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37913589	37913589	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37913589T>A	uc004ddu.2	+	4	777	c.243T>A	c.(241-243)TGT>TGA	p.C81*	SYTL5_uc004ddv.2_Nonsense_Mutation_p.C81*|SYTL5_uc004ddx.2_Nonsense_Mutation_p.C81*	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	81	FYVE-type.|RabBD.				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						GAGACCCTTGTCAGGCTTGCT	0.512													9	213	---	---	---	---	PASS
NYX	60506	broad.mit.edu	37	X	41333968	41333968	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41333968T>A	uc004dfh.2	+	2	1692	c.1262T>A	c.(1261-1263)CTG>CAG	p.L421Q	NYX_uc011mku.1_Missense_Mutation_p.L416Q	NM_022567	NP_072089	Q9GZU5	NYX_HUMAN	nyctalopin precursor	421					response to stimulus|visual perception	intracellular|proteinaceous extracellular matrix				lung(2)	2						TCCAAGCTGCTGGCCCCGAGG	0.711													5	13	---	---	---	---	PASS
SLC9A7	84679	broad.mit.edu	37	X	46513039	46513039	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46513039C>A	uc004dgu.1	-							NM_032591	NP_115980	Q96T83	SL9A7_HUMAN	solute carrier family 9, member 7						regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity			ovary(2)	2						GTAGAAAAAACCTACCTGTAA	0.502													43	94	---	---	---	---	PASS
SYN1	6853	broad.mit.edu	37	X	47435811	47435811	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47435811G>T	uc004die.2	-						SYN1_uc004did.2_Intron	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia							cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1						TCCTCCTGGGGGACAAGGGGA	0.592													41	89	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	47658192	47658192	+	IGR	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47658192C>A								LOC100133957 (138416 upstream) : ZNF81 (38109 downstream)																							CATTATGGTGCAACATCCATA	0.229													29	98	---	---	---	---	PASS
PIM2	11040	broad.mit.edu	37	X	48775872	48775872	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48775872G>T	uc004dls.2	-	2	414	c.112C>A	c.(112-114)CTG>ATG	p.L38M		NM_006875	NP_006866	Q9P1W9	PIM2_HUMAN	serine/threonine protein kinase pim-2	38	Protein kinase.|ATP (By similarity).				anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity			lung(3)|stomach(1)	4						CCCTTACCCAGGAGGGGGCCG	0.657													27	45	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48896775	48896775	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48896775G>T	uc004dmb.3	-	3	629	c.391C>A	c.(391-393)CGT>AGT	p.R131S	TFE3_uc004dmc.3_Missense_Mutation_p.R26S|TFE3_uc004dme.1_RNA	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3	131					humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						CGACGCTCACGCCTCTCCTGC	0.662			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								11	11	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49087004	49087004	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49087004G>A	uc004dnb.2	-	5	651	c.589C>T	c.(589-591)CCA>TCA	p.P197S	CACNA1F_uc010nip.2_Missense_Mutation_p.P197S	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	197	I.|Extracellular (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	AAGCCTCCTGGCTTTCCCCCG	0.697													6	20	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50090771	50090771	+	Nonsense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50090771C>G	uc004dox.3	+	11	4255	c.3957C>G	c.(3955-3957)TAC>TAG	p.Y1319*	CCNB3_uc004doy.2_Nonsense_Mutation_p.Y1319*|CCNB3_uc004doz.2_Nonsense_Mutation_p.Y215*|CCNB3_uc010njq.2_Nonsense_Mutation_p.Y211*|CCNB3_uc004dpa.2_Nonsense_Mutation_p.Y158*	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1319					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AGCTCGGATACTGGGTAAACA	0.502													13	54	---	---	---	---	PASS
TSPYL2	64061	broad.mit.edu	37	X	53112250	53112250	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53112250G>T	uc004drw.2	+	1	702	c.570G>T	c.(568-570)CGG>CGT	p.R190R	TSPYL2_uc004drv.2_Silent_p.R190R|TSPYL2_uc004drx.1_5'Flank	NM_022117	NP_071400	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	190	Arg-rich.				cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0						ggaggcggcggcggcggcgga	0.244													11	19	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53574688	53574688	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53574688C>A	uc004dsp.2	-	68	10984	c.10582G>T	c.(10582-10584)GTA>TTA	p.V3528L	HUWE1_uc004dsn.2_Missense_Mutation_p.V2336L|HUWE1_uc004dsq.1_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3528	Thr-rich.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						GAAGCAGCTACGACAATGGTG	0.502													15	51	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53574689	53574689	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53574689G>A	uc004dsp.2	-	68	10983	c.10581C>T	c.(10579-10581)GTC>GTT	p.V3527V	HUWE1_uc004dsn.2_Silent_p.V2335V|HUWE1_uc004dsq.1_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3527	Thr-rich.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						AAGCAGCTACGACAATGGTGG	0.502													16	50	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54276065	54276065	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54276065G>T	uc004dtd.1	-	17	3155	c.2716C>A	c.(2716-2718)CCA>ACA	p.P906T	WNK3_uc004dtc.1_Missense_Mutation_p.P906T	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	906					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GTGTTTTTTGGACCTGGAACA	0.408													69	185	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54481902	54481902	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54481902C>A	uc004dtg.2	-	12	2728	c.1994G>T	c.(1993-1995)CGC>CTC	p.R665L	FGD1_uc011moi.1_Missense_Mutation_p.R423L	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	665	PH 1.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CTCGAGGGAGCGCTGCTTTCC	0.557													18	71	---	---	---	---	PASS
PFKFB1	5207	broad.mit.edu	37	X	54984739	54984739	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54984739C>A	uc004dty.1	-	6	587	c.516G>T	c.(514-516)AGG>AGT	p.R172S	PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Missense_Mutation_p.R107S	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,	172	6-phosphofructo-2-kinase.				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						TGGTCCTTACCCTGATGTTTT	0.398													42	121	---	---	---	---	PASS
ALAS2	212	broad.mit.edu	37	X	55044101	55044101	+	Intron	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55044101G>C	uc004dua.3	-						ALAS2_uc004dub.3_Intron|ALAS2_uc004dud.3_Intron	NM_000032	NP_000023	P22557	HEM0_HUMAN	5-aminolevulinate synthase 2 isoform a						cellular iron ion homeostasis|erythrocyte differentiation|heme biosynthetic process|hemoglobin biosynthetic process|oxygen homeostasis|response to hypoxia	mitochondrial inner membrane|mitochondrial matrix	5-aminolevulinate synthase activity|coenzyme binding|glycine binding|protein binding|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(1)	1					Glycine(DB00145)	CTCGCACCCTGAGGAAGCAGA	0.488													62	128	---	---	---	---	PASS
RRAGB	10325	broad.mit.edu	37	X	55782263	55782263	+	Intron	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55782263C>G	uc004dup.2	+						RRAGB_uc004duq.2_Intron	NM_016656	NP_057740	Q5VZM2	RRAGB_HUMAN	Ras-related GTP binding B long isoform						cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|signal transduction	Golgi apparatus|lysosome|nucleus	GTP binding|protein binding				0						gGACAATATTCTTTTTCATAG	0.199													24	57	---	---	---	---	PASS
SPIN2B	474343	broad.mit.edu	37	X	57146278	57146278	+	3'UTR	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57146278C>A	uc004duy.2	-	2					SPIN2B_uc004duz.2_3'UTR|SPIN2B_uc004dva.2_3'UTR|uc011mor.1_5'Flank	NM_001006682	NP_001006683	Q9BPZ2	SPI2B_HUMAN	spindlin-like protein 2						apoptosis|cell cycle|gamete generation	nucleus					0						CAAATTTTACCCTAACAGTTA	0.353													21	86	---	---	---	---	PASS
ZXDA	7789	broad.mit.edu	37	X	57935969	57935969	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57935969C>A	uc004dve.2	-	1	1099	c.886G>T	c.(886-888)GGC>TGC	p.G296C		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	296	Required for interaction with ZXDC.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						GGCCTCTGGCCCTGGCTGCTG	0.632													11	34	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63411079	63411079	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63411079C>G	uc004dvo.2	-	2	2361	c.2088G>C	c.(2086-2088)AGG>AGC	p.R696S		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	696					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						GACGGAAGTCCCTCCAGTCTG	0.552													32	101	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63488508	63488508	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63488508G>T	uc004dvs.2	-	14	2092	c.2024C>A	c.(2023-2025)GCC>GAC	p.A675D	MTMR8_uc011mou.1_Intron	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	675						nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						GAAACCCCTGGCCTCAGAAAT	0.542													62	140	---	---	---	---	PASS
VSIG4	11326	broad.mit.edu	37	X	65252573	65252573	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65252573G>T	uc004dwh.2	-	3	558	c.431C>A	c.(430-432)ACA>AAA	p.T144K	VSIG4_uc004dwi.2_Intron|VSIG4_uc010nkq.1_Missense_Mutation_p.T144K|VSIG4_uc004dwj.2_Missense_Mutation_p.T144K|VSIG4_uc011moy.1_Intron|VSIG4_uc004dwk.2_Missense_Mutation_p.T144K|VSIG4_uc004dwl.2_Missense_Mutation_p.T40K	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	144	Ig-like 2.|Extracellular (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0						AGTTGTCACTGTGGGCTTGGA	0.507													10	55	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67937247	67937247	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67937247G>T	uc004dxa.2	+	5	623	c.251G>T	c.(250-252)AGC>ATC	p.S84I	STARD8_uc004dxb.2_Missense_Mutation_p.S164I|STARD8_uc004dxc.3_Missense_Mutation_p.S84I	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	84					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						ATCACCGTGAGCCTACCACCC	0.682													7	46	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70613229	70613229	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70613229C>T	uc004dzu.3	+	21	3178	c.3127C>T	c.(3127-3129)CCC>TCC	p.P1043S	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.P1064S|TAF1_uc004dzv.3_Missense_Mutation_p.P217S	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1043					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				TGGAGAGGGGCCCATGAGTAA	0.463													52	127	---	---	---	---	PASS
OGT	8473	broad.mit.edu	37	X	70784604	70784604	+	Splice_Site	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70784604G>T	uc004eaa.1	+	19	2806	c.2589_splice	c.e19+1	p.N863_splice	BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Splice_Site_p.N853_splice|OGT_uc004eac.2_Splice_Site_p.N724_splice|OGT_uc004ead.2_Splice_Site_p.N482_splice	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1						cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					GTGGGCAAACGTGAGTATGCA	0.408													47	142	---	---	---	---	PASS
NCRNA00182	100302692	broad.mit.edu	37	X	73438301	73438301	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73438301G>T	uc010nlq.1	-						uc004ebq.1_Intron|MIR421_hsa-mir-421|MI0003685_5'Flank					Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0						atgtgcaccggattaggcact	0.134													16	18	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76938690	76938690	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76938690C>A	uc004ecp.3	-	9	2290	c.2058G>T	c.(2056-2058)AAG>AAT	p.K686N	ATRX_uc004ecq.3_Missense_Mutation_p.K648N|ATRX_uc004eco.3_Missense_Mutation_p.K471N|ATRX_uc004ecr.2_Missense_Mutation_p.K618N|ATRX_uc010nlx.1_Missense_Mutation_p.K657N|ATRX_uc010nly.1_Missense_Mutation_p.K631N	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	686					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTTGTTTCTCCTTAACTGTTT	0.373			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						197	457	---	---	---	---	PASS
CYSLTR1	10800	broad.mit.edu	37	X	77528615	77528615	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77528615G>T	uc004edb.2	-	3	1029	c.629C>A	c.(628-630)ACA>AAA	p.T210K	CYSLTR1_uc010nma.2_Missense_Mutation_p.T210K|CYSLTR1_uc010nmb.2_Missense_Mutation_p.T210K	NM_006639	NP_006630	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	210	Helical; Name=5; (Potential).				elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity			ovary(1)	1					Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AATGATCATTGTGTAACAGAC	0.318													23	68	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79978191	79978191	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79978191G>T	uc004edt.2	-	17	2009	c.1746C>A	c.(1744-1746)CAC>CAA	p.H582Q	BRWD3_uc004edo.2_Missense_Mutation_p.H178Q|BRWD3_uc004edp.2_Missense_Mutation_p.H411Q|BRWD3_uc004edq.2_Missense_Mutation_p.H178Q|BRWD3_uc010nmj.1_Missense_Mutation_p.H178Q|BRWD3_uc004edr.2_Missense_Mutation_p.H252Q|BRWD3_uc004eds.2_Missense_Mutation_p.H178Q|BRWD3_uc004edu.2_Missense_Mutation_p.H252Q|BRWD3_uc004edv.2_Missense_Mutation_p.H178Q|BRWD3_uc004edw.2_Missense_Mutation_p.H178Q|BRWD3_uc004edx.2_Missense_Mutation_p.H178Q|BRWD3_uc004edy.2_Missense_Mutation_p.H178Q|BRWD3_uc004edz.2_Missense_Mutation_p.H252Q|BRWD3_uc004eea.2_Missense_Mutation_p.H252Q|BRWD3_uc004eeb.2_Missense_Mutation_p.H178Q	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	582										ovary(4)	4						GAGGCATGAGGTGAGGAGCTT	0.428													58	160	---	---	---	---	PASS
HMGN5	79366	broad.mit.edu	37	X	80375275	80375275	+	Intron	SNP	A	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:80375275A>G	uc004eee.1	-							NM_030763	NP_110390	P82970	HMGN5_HUMAN	high-mobility group nucleosome binding domain 5						chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|nucleolus	chromatin binding|DNA binding			lung(1)	1						TGCTAAGACTAAAGAAACTCA	0.363													22	66	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83390218	83390218	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83390218C>A	uc004eej.1	-	7	579	c.502G>T	c.(502-504)GTT>TTT	p.V168F	RPS6KA6_uc011mqt.1_Missense_Mutation_p.V168F|RPS6KA6_uc011mqu.1_Missense_Mutation_p.V65F|RPS6KA6_uc010nmo.1_RNA	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	168	Protein kinase 1.				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						GTAAACAGAACCTAGAACAAA	0.333													13	38	---	---	---	---	PASS
ZNF711	7552	broad.mit.edu	37	X	84526181	84526181	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84526181C>A	uc004eeo.2	+	9	1980	c.1633C>A	c.(1633-1635)CAA>AAA	p.Q545K	ZNF711_uc004eep.2_Missense_Mutation_p.Q545K|ZNF711_uc004eeq.2_Missense_Mutation_p.Q591K|ZNF711_uc011mqy.1_Missense_Mutation_p.Q144K	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	545	C2H2-type 5.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						GTGTGCAGATCAATCAAATCT	0.393													34	55	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133298	91133298	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133298C>A	uc004efk.1	+	2	2904	c.2059C>A	c.(2059-2061)CCG>ACG	p.P687T	PCDH11X_uc004efl.1_Missense_Mutation_p.P687T|PCDH11X_uc004efo.1_Missense_Mutation_p.P687T|PCDH11X_uc010nmv.1_Missense_Mutation_p.P687T|PCDH11X_uc004efm.1_Missense_Mutation_p.P687T|PCDH11X_uc004efn.1_Missense_Mutation_p.P687T|PCDH11X_uc004efh.1_Missense_Mutation_p.P687T|PCDH11X_uc004efj.1_Missense_Mutation_p.P687T	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	687	Cadherin 7.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ATTGGTTCTACCGTCCACTAA	0.423													64	273	---	---	---	---	PASS
XKRX	402415	broad.mit.edu	37	X	100182953	100182953	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100182953G>T	uc004egn.2	-						XKRX_uc011mre.1_Intron	NM_212559	NP_997724	Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related,							integral to membrane|plasma membrane				breast(1)	1						TTTAAAAGTTGCTCACCTGAT	0.413													65	246	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100490873	100490873	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100490873G>T	uc004egz.2	+	4	511	c.142G>T	c.(142-144)GCA>TCA	p.A48S	DRP2_uc011mrh.1_5'UTR	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	48					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						CACCAGCCCTGCACCTCCTCA	0.557													101	298	---	---	---	---	PASS
ARMCX3	51566	broad.mit.edu	37	X	100880053	100880053	+	Silent	SNP	T	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100880053T>C	uc004ehz.1	+	5	617	c.84T>C	c.(82-84)ACT>ACC	p.T28T	ARMCX3_uc004eia.1_Silent_p.T28T|ARMCX3_uc004eib.1_Silent_p.T28T|ARMCX3_uc004eic.1_Silent_p.T28T	NM_016607	NP_057691	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	28	Helical; (Potential).					integral to membrane	binding			ovary(1)|lung(1)	2						ATAGACTGACTAGGGGAAGAA	0.542													66	177	---	---	---	---	PASS
ARMCX2	9823	broad.mit.edu	37	X	100912230	100912230	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100912230G>T	uc004eid.2	-	3	700	c.345C>A	c.(343-345)GCC>GCA	p.A115A	ARMCX2_uc004eie.3_Silent_p.A115A|ARMCX2_uc004eif.3_Silent_p.A115A|ARMCX2_uc004eig.3_Silent_p.A115A|ARMCX2_uc010nnt.2_Silent_p.A115A	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	115	Ala-rich.					integral to membrane	binding			ovary(6)	6						CTGCCTCTTGGGCCTGACTGC	0.642													46	169	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101908916	101908916	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101908916G>T	uc004ejj.3	+	5	876	c.75G>T	c.(73-75)GGG>GGT	p.G25G	GPRASP1_uc004eji.3_Silent_p.G25G|GPRASP1_uc010nod.2_Silent_p.G25G	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	25						cytoplasm	protein binding			ovary(1)|lung(1)	2						TTGTAGGTGGGGCTGAGATAG	0.522													98	332	---	---	---	---	PASS
PLP1	5354	broad.mit.edu	37	X	103041628	103041628	+	Silent	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103041628G>A	uc010nov.2	+	4	706	c.426G>A	c.(424-426)TTG>TTA	p.L142L	RAB9B_uc004eli.1_Intron|PLP1_uc004elk.2_Silent_p.L142L|PLP1_uc004elj.2_Intron|PLP1_uc011msf.1_Silent_p.L87L|PLP1_uc010now.1_Silent_p.L146L|PLP1_uc010nox.2_Silent_p.L96L	NM_001128834	NP_001122306	P60201	MYPR_HUMAN	proteolipid protein 1 isoform 1	142	Cytoplasmic (Probable).		Missing (in HLD1).		cell death|synaptic transmission	integral to membrane				ovary(1)	1						GTCATTGTTTGGGAAAATGGC	0.567													81	299	---	---	---	---	PASS
TEX13A	56157	broad.mit.edu	37	X	104464792	104464792	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104464792G>A	uc004ema.2	-	2	402	c.290C>T	c.(289-291)GCC>GTC	p.A97V	IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.A97V	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN	testis expressed sequence 13A	97						intracellular	zinc ion binding			ovary(2)	2						GTGCAGTTTGGCGAAGCCGTG	0.632													27	57	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105152799	105152799	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105152799C>A	uc004emd.2	+	13	1469	c.1166C>A	c.(1165-1167)CCC>CAC	p.P389H	NRK_uc010npc.1_Missense_Mutation_p.P57H	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	389							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CATGGGGAACCCTCTCAGCCA	0.542										HNSCC(51;0.14)			24	120	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105153311	105153311	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105153311G>T	uc004emd.2	+	13	1981	c.1678G>T	c.(1678-1680)GAG>TAG	p.E560*	NRK_uc010npc.1_Nonsense_Mutation_p.E228*	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	560	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TGAACAGCCAGAGGTACAGGA	0.572										HNSCC(51;0.14)			5	18	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108636237	108636237	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108636237C>A	uc004eod.3	-	13	2748	c.2472G>T	c.(2470-2472)ATG>ATT	p.M824I	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	824	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						ACATCCGAAGCATAGAATCAA	0.353													79	339	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108719023	108719023	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108719023A>T	uc004eod.3	-	2	419	c.143T>A	c.(142-144)GTG>GAG	p.V48E	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	48					intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						GAGTGTCCACACCTGCTGCGG	0.562											OREG0019905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	43	176	---	---	---	---	PASS
LHFPL1	340596	broad.mit.edu	37	X	111914544	111914544	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111914544G>T	uc004epq.2	-	2	408	c.75C>A	c.(73-75)ACC>ACA	p.T25T	LHFPL1_uc004epp.2_Silent_p.T48T|LHFPL1_uc010nqa.2_Intron|LHFPL1_uc010nqb.2_Silent_p.T25T	NM_178175	NP_835469	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1 precursor	25						integral to membrane					0						GGAAGTAACTGGTAGAACTGG	0.562													150	460	---	---	---	---	PASS
CUL4B	8450	broad.mit.edu	37	X	119693974	119693974	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119693974C>G	uc004esw.2	-	3	1011	c.574G>C	c.(574-576)GGC>CGC	p.G192R	CUL4B_uc004esv.2_Missense_Mutation_p.G174R	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1	192	Ser-rich.				cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						TTAGCAGAGCCAGGTTTGCTG	0.428													50	188	---	---	---	---	PASS
MCTS1	28985	broad.mit.edu	37	X	119742191	119742191	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119742191C>T	uc004esx.2	+	4	722	c.374C>T	c.(373-375)CCT>CTT	p.P125L	MCTS1_uc011mub.1_Missense_Mutation_p.P126L	NM_014060	NP_054779	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1 isoform 1	125	PUA.				cell cycle|positive regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm	RNA binding				0						AAGCTTTACCCTGCTGCAGTA	0.433													17	242	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122599631	122599631	+	Intron	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122599631G>T	uc004etq.3	+						GRIA3_uc004etr.3_Missense_Mutation_p.D811Y|GRIA3_uc004ets.3_RNA	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform						glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	CGGGGGCGGTGACTCCAAGGT	0.478													20	81	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123211914	123211914	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123211914C>A	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						AACAGGTAAGCATTAAGAGTA	0.348													32	144	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123587186	123587186	+	Splice_Site	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123587186C>A	uc004euj.2	-	22	4147	c.4083_splice	c.e22+1	p.Q1361_splice	ODZ1_uc011muj.1_Splice_Site_p.Q1367_splice|ODZ1_uc010nqy.2_Splice_Site_p.Q1368_splice	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GTGATGCCTACCTGAGTGATG	0.408													51	168	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123615585	123615585	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123615585G>C	uc004euj.2	-	21	3989	c.3925C>G	c.(3925-3927)CGA>GGA	p.R1309G	ODZ1_uc011muj.1_Missense_Mutation_p.R1315G|ODZ1_uc010nqy.2_Missense_Mutation_p.R1316G	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1309	NHL 2.|Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						tttttaCCTCGAGGGCTATTC	0.393													22	92	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	124030047	124030047	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124030047G>T	uc004euj.2	-	2	325	c.261C>A	c.(259-261)TAC>TAA	p.Y87*	ODZ1_uc011muj.1_Nonsense_Mutation_p.Y87*|ODZ1_uc010nqy.2_Nonsense_Mutation_p.Y87*	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	87	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TGTCTGTTTGGTAGCCAGAGC	0.478													82	285	---	---	---	---	PASS
ACTRT1	139741	broad.mit.edu	37	X	127185842	127185842	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127185842G>T	uc004eum.2	-	1	541	c.344C>A	c.(343-345)CCT>CAT	p.P115H		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	115						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						AATTTCCCTAGGATTCAAAGA	0.483													169	658	---	---	---	---	PASS
XPNPEP2	7512	broad.mit.edu	37	X	128902393	128902393	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128902393C>A	uc004eut.1	+	21	2201	c.1957C>A	c.(1957-1959)CCA>ACA	p.P653T		NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound	653					cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						CGCCAGGGCCCCAGACACCGC	0.617													24	96	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129058809	129058809	+	Silent	SNP	C	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129058809C>T	uc004euz.2	+	12	1415	c.1387C>T	c.(1387-1389)CTA>TTA	p.L463L	UTP14A_uc011mup.1_Silent_p.L411L|UTP14A_uc011muq.1_Silent_p.L409L	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	463					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						ATTGAGAGTACTATCTCAGAA	0.448													178	548	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129059948	129059948	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129059948G>T	uc004euz.2	+	13	1831	c.1803G>T	c.(1801-1803)GGG>GGT	p.G601G	UTP14A_uc011mup.1_Silent_p.G549G|UTP14A_uc011muq.1_Silent_p.G547G	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	601					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						CTTTTGCTGGGGATGATGTCA	0.507											OREG0019920	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	48	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129148793	129148793	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129148793C>G	uc004evb.1	+	4	2159	c.2045C>G	c.(2044-2046)TCC>TGC	p.S682C	BCORL1_uc010nrd.1_Missense_Mutation_p.S584C	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	682					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						TGCCTGGGCTCCACTTCCTCG	0.607													30	117	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130413316	130413316	+	Splice_Site	SNP	C	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130413316C>G	uc004ewd.2	-	10	1885	c.1647_splice	c.e10-1	p.R549_splice	IGSF1_uc004ewe.3_Splice_Site_p.R538_splice|IGSF1_uc004ewf.2_Splice_Site_p.R529_splice	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1						regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						CCAGGCTTCTCTAGTGAGACC	0.562													25	90	---	---	---	---	PASS
MOSPD1	56180	broad.mit.edu	37	X	134025618	134025618	+	Silent	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134025618C>A	uc004eyb.2	-	5	688	c.501G>T	c.(499-501)GTG>GTT	p.V167V	MOSPD1_uc004eya.2_Intron|MOSPD1_uc010nrv.2_RNA	NM_019556	NP_062456	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1	167	Helical; (Potential).				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	integral to membrane|nucleus|perinuclear region of cytoplasm	structural molecule activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CAATGCACACCACTCCCAGGA	0.448													67	187	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136648863	136648863	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136648863C>A	uc004fak.2	+	1	518	c.13C>A	c.(13-15)CTG>ATG	p.L5M		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	5					cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GACGATGCTCCTGGACGGAGG	0.672													6	12	---	---	---	---	PASS
UBE2NL	389898	broad.mit.edu	37	X	142967197	142967197	+	5'UTR	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142967197G>T	uc004fca.2	+	1						NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like								acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					CCGAACTCAGGTTCTGATGGC	0.423													54	164	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144337227	144337227	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337227C>A	uc004fcb.2	+	2	112	c.112C>A	c.(112-114)CCG>ACG	p.P38T		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	38											0	Acute lymphoblastic leukemia(192;6.56e-05)					AGCCCCCGAACCGAGTTTGAA	0.403													47	166	---	---	---	---	PASS
PRRG3	79057	broad.mit.edu	37	X	150869319	150869319	+	Silent	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150869319G>T	uc004few.1	+	4	900	c.510G>T	c.(508-510)CGG>CGT	p.R170R		NM_024082	NP_076987	Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3	170	Cytoplasmic (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CCACAGTCCGGCTAGAGAGCA	0.662													25	68	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151093079	151093079	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151093079G>T	uc004fez.2	+	3	1099	c.943G>T	c.(943-945)GAG>TAG	p.E315*	MAGEA4_uc004ffa.2_Nonsense_Mutation_p.E315*|MAGEA4_uc004ffb.2_Nonsense_Mutation_p.E315*|MAGEA4_uc004ffc.2_Nonsense_Mutation_p.E315*|MAGEA4_uc004ffd.2_Nonsense_Mutation_p.E315*	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	315							protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGGAGGAAGAGGGAGTCTG	0.572													64	202	---	---	---	---	PASS
HAUS7	55559	broad.mit.edu	37	X	152728063	152728063	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152728063C>A	uc004fho.1	-						HAUS7_uc004fhl.2_Intron|HAUS7_uc004fhm.2_Intron|HAUS7_uc004fhn.1_Intron|HAUS7_uc004fhp.1_Intron|HAUS7_uc011myq.1_Intron	NM_017518	NP_059988	Q99871	HAUS7_HUMAN	HAUS augmin-like complex subunit 7						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding				0						CAGAGGCCCTCTTACCTTGAG	0.587													17	54	---	---	---	---	PASS
PDZD4	57595	broad.mit.edu	37	X	153073817	153073817	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153073817C>A	uc004fiz.1	-	2	544	c.294G>T	c.(292-294)GAG>GAT	p.E98D	PDZD4_uc004fiy.1_Missense_Mutation_p.E17D|PDZD4_uc004fix.2_5'UTR|PDZD4_uc004fja.1_Missense_Mutation_p.E98D|PDZD4_uc011mze.1_Intron	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	98						cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGACGTACGGCTCCAGGATGA	0.672													23	59	---	---	---	---	PASS
FAM50A	9130	broad.mit.edu	37	X	153678551	153678551	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153678551C>A	uc004fll.3	+							NM_004699	NP_004690	Q14320	FA50A_HUMAN	XAP-5 protein						spermatogenesis	nucleus				ovary(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCTCTTCCTCCCTTAGTCCCA	0.622													48	191	---	---	---	---	PASS
FAM50A	9130	broad.mit.edu	37	X	153678552	153678552	+	Intron	SNP	C	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153678552C>A	uc004fll.3	+							NM_004699	NP_004690	Q14320	FA50A_HUMAN	XAP-5 protein						spermatogenesis	nucleus				ovary(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTCTTCCTCCCTTAGTCCCAT	0.622													47	192	---	---	---	---	PASS
ACOT7	11332	broad.mit.edu	37	1	6399800	6399800	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6399800delT	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		GGCACCGCGGttttttttttt	0.269													4	2	---	---	---	---	
CELA2B	51032	broad.mit.edu	37	1	15807394	15807394	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15807394delT	uc001awl.2	+							NM_015849	NP_056933	P08218	CEL2B_HUMAN	elastase 2B preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						cctggccTGATTttttttttt	0.005													4	2	---	---	---	---	
FNDC5	252995	broad.mit.edu	37	1	33330043	33330043	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33330043delT	uc001bwf.1	-						FNDC5_uc001bwe.2_Intron	NM_153756	NP_715637	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5							integral to membrane|peroxisomal membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CACTCACTGCTTTTTTTTTTT	0.383													6	4	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57537737	57537738	+	Intron	INS	-	A	A	rs60921398		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57537737_57537738insA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						ACCCATTAGTTaaaaaaaaaaa	0.342													3	3	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	66041907	66041907	+	Intron	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66041907delC	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CAGGCACTGTCCAGCTGACGT	0.532													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71123754	71123755	+	IGR	INS	-	TCCTTCCTTCCT	TCCTTCCTTCCT	rs143061057	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71123754_71123755insTCCTTCCTTCCT								CTH (218502 upstream) : PTGER3 (194281 downstream)																							tccttcctttctccttccttcc	0.079													4	2	---	---	---	---	
CELSR2	1952	broad.mit.edu	37	1	109816863	109816864	+	3'UTR	INS	-	C	C	rs145508961	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109816863_109816864insC	uc001dxa.3	+	34						NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2						dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TAGTGCCAACTCCCCCCCCACC	0.550													6	3	---	---	---	---	
XCL2	6846	broad.mit.edu	37	1	168513367	168513367	+	5'Flank	DEL	A	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168513367delA	uc001gfn.3	-							NM_003175	NP_003166	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2 precursor						blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity			ovary(1)	1	all_hematologic(923;0.215)					TATTTTTCTTAAAAAAAAAAA	0.423													6	3	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185992421	185992421	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185992421delT	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAACCTAGGGTTTTTTTTTTT	0.269													9	6	---	---	---	---	
RPE	6120	broad.mit.edu	37	2	210882456	210882457	+	Intron	DEL	GC	-	-	rs2243769		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210882456_210882457delGC	uc002vdn.2	+						RPE_uc002vdm.2_Intron|RPE_uc002vdo.2_Intron|RPE_uc010zjf.1_Intron|RPE_uc002vdp.2_Intron|RPE_uc010fup.2_Intron|RPE_uc002vdq.2_Intron|RPE_uc002vdr.2_Intron	NM_199229	NP_954699	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase isoform 1						pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		AAGTGGATATGCTttttttttt	0.188													2	4	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240111911	240111918	+	Intron	DEL	TCCCCCTG	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240111911_240111918delTCCCCCTG	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc002vyl.1_Intron|HDAC4_uc010fyy.2_5'Flank	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GATACCCCTCTCCCCCTGTCCCCCTCTT	0.611													4	2	---	---	---	---	
RBMS3	27303	broad.mit.edu	37	3	29410979	29410986	+	Intron	DEL	ACACACAC	-	-	rs72238258		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29410979_29410986delACACACAC	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				TCACTCCTTAacacacacacacacacac	0.255													3	3	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142753863	142753864	+	Intron	INS	-	GG	GG			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142753863_142753864insGG	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron|SR140_uc003evl.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						TTTAAATGGGTGGGGGGAGGGC	0.356													7	4	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160672744	160672745	+	Intron	INS	-	T	T	rs142883004	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160672744_160672745insT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			tccttccttccttcctttcctt	0.020													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18147044	18147044	+	IGR	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18147044delC								LCORL (123659 upstream) : None (None downstream)																							ttccttccttccttccttcct	0.124													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49147318	49147319	+	IGR	INS	-	GGAAG	GGAAG			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49147318_49147319insGGAAG								CWH43 (83225 upstream) : None (None downstream)																							cattccattccattccattcca	0.000													4	2	---	---	---	---	
EDNRA	1909	broad.mit.edu	37	4	148453478	148453479	+	Intron	DEL	AA	-	-	rs34658974		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148453478_148453479delAA	uc003iky.2	+						EDNRA_uc011cid.1_Intron|EDNRA_uc010ipe.1_Intron|EDNRA_uc010ipf.1_Intron|EDNRA_uc010ipg.1_Intron	NM_001957	NP_001948	P25101	EDNRA_HUMAN	endothelin receptor type A isoform a precursor						activation of adenylate cyclase activity|artery smooth muscle contraction|cell proliferation|glucose transport|respiratory gaseous exchange	integral to plasma membrane	endothelin-A receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|breast(1)	2	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Bosentan(DB00559)	attttgcctcaaaaaaaaaaaa	0.149													4	3	---	---	---	---	
LOC340094	340094	broad.mit.edu	37	5	5043429	5043432	+	Intron	DEL	AAAG	-	-	rs66711034		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5043429_5043432delAAAG	uc003jdg.2	+						LOC340094_uc003jdh.2_Intron	NR_026994				Homo sapiens hypothetical protein LOC340094, mRNA (cDNA clone IMAGE:5295461).												0						cttaccacaaaaagaaagaaagaa	0.049													2	4	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51606194	51606194	+	Intron	DEL	T	-	-	rs71894206		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51606194delT	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGTTTTTCtcttttttttttc	0.169													4	2	---	---	---	---	
TPD52L1	7164	broad.mit.edu	37	6	125493265	125493266	+	Intron	INS	-	CC	CC			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125493265_125493266insCC	uc003pzu.1	+						TPD52L1_uc003pzv.1_Intron|TPD52L1_uc003pzw.1_Intron|TPD52L1_uc003pzx.1_Intron|TPD52L1_uc003pzy.1_Intron	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1						DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		tttctttctttctttctttctt	0.040													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127683600	127683600	+	IGR	DEL	A	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127683600delA								ECHDC1 (18846 upstream) : C6orf174 (75952 downstream)																							aaaaaaaaagaaaaaaaaaaa	0.109													5	3	---	---	---	---	
SGK1	6446	broad.mit.edu	37	6	134492496	134492497	+	Intron	INS	-	TG	TG	rs141268381	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134492496_134492497insTG	uc003qen.3	-						SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_Intron|SGK1_uc011ecu.1_Intron|SGK1_uc011ecv.1_Intron|SGK1_uc011ecw.1_Intron	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		gtgtgtgtgtttgtgtgtgtgt	0.356													8	6	---	---	---	---	
SP4	6671	broad.mit.edu	37	7	21468304	21468306	+	In_Frame_Del	DEL	AGG	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21468304_21468306delAGG	uc003sva.2	+	2	198_200	c.17_19delAGG	c.(16-21)AAGGAG>AAG	p.E11del	SP4_uc003svb.2_5'UTR	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	11	Poly-Glu.				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						GATCAGAAGAAGGAGGAGGAGGA	0.517													4	2	---	---	---	---	
LOC646762	646762	broad.mit.edu	37	7	29720536	29720536	+	Intron	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29720536delC	uc003tad.3	-							NR_024278				Homo sapiens cDNA: FLJ23070 fis, clone LNG05629.												0						AAGAATAGTTCCAAAAAATCC	0.438													23	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62609194	62609194	+	IGR	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62609194delT								None (None upstream) : LOC643955 (142478 downstream)																							TATCTTACTCTTTTTTTTTTT	0.214													6	4	---	---	---	---	
TAF6	6878	broad.mit.edu	37	7	99708603	99708603	+	Intron	DEL	A	-	-	rs112139162		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99708603delA	uc003uti.2	-						TAF6_uc003utg.2_Intron|TAF6_uc003uth.2_Intron|TAF6_uc003utk.2_Intron|TAF6_uc011kji.1_Intron|TAF6_uc003utj.2_Intron|TAF6_uc003utl.2_Intron|TAF6_uc003utm.2_Intron|TAF6_uc003utn.1_Intron	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha						negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actccatctcaaaaaaaaaaa	0.224													6	5	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	51621688	51621693	+	Intron	DEL	TCGATC	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51621688_51621693delTCGATC	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AAATTATGCTTCGATCTGAAAAAAAG	0.218													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90460007	90460008	+	IGR	DEL	CT	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90460007_90460008delCT								CTSL3 (58208 upstream) : C9orf79 (37733 downstream)																							AAAAGTCTTGCTCtgtgtgtgt	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98909275	98909276	+	IGR	INS	-	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98909275_98909276insA								NCRNA00092 (125238 upstream) : HSD17B3 (88313 downstream)																							AGGTCCCCCCCAAAGACCCAAA	0.500													73	35	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119748449	119748449	+	Intron	DEL	A	-	-	rs116287164	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119748449delA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GCCCCCCCCCACCCCCCTGCA	0.582													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4734408	4734418	+	IGR	DEL	GGTAGGTGAAG	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4734408_4734418delGGTAGGTGAAG								LOC100216001 (14146 upstream) : AKR1E2 (133984 downstream)																							aaggaaggaaggtaggtgaagggaaggaagg	0.071													3	3	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34420743	34420743	+	Intron	DEL	T	-	-	rs71920712		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34420743delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TTAGATATTCTTTTTTTTTTT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50981273	50981273	+	IGR	DEL	A	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50981273delA								OGDHL (10848 upstream) : PARG (45054 downstream)																							CACAGGCCACATTAACACCTT	0.373													43	22	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73163211	73163211	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73163211delT	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ccttccttcctttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125015169	125015169	+	IGR	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125015169delT								BUB3 (90283 upstream) : GPR26 (410702 downstream)																							atcaccatcatcacaccacca	0.000													9	5	---	---	---	---	
DNAJB13	374407	broad.mit.edu	37	11	73680791	73680794	+	Intron	DEL	AAAC	-	-	rs34820619		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73680791_73680794delAAAC	uc001ouo.2	+							NM_153614	NP_705842	P59910	DJB13_HUMAN	testis spermatogenesis apoptosis-related protein						apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)					CCCATGTCTTAAACAAAGTTTCTG	0.529													4	3	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178316	134178316	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178316delT	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		accaccatcatcaccatcacc	0.000													5	4	---	---	---	---	
GPRC5D	55507	broad.mit.edu	37	12	13097785	13097792	+	Intron	DEL	TTCTTTCT	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13097785_13097792delTTCTTTCT	uc010shp.1	-							NM_018654	NP_061124	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, family C, group 5,							integral to membrane|plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		ccttccttccttctttctttctttcttt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31269805	31269806	+	Intron	INS	-	AAG	AAG	rs10650892		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31269805_31269806insAAG	uc010sjy.1	-						uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CAATATTCCTCAAACTTCTCTT	0.307													4	2	---	---	---	---	
LRRK2	120892	broad.mit.edu	37	12	40646943	40646944	+	Intron	DEL	TA	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40646943_40646944delTA	uc001rmg.3	+						LRRK2_uc001rmh.1_Intron	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AAGATATCTCTATGTGTAGAGA	0.188													3	4	---	---	---	---	
NOS1	4842	broad.mit.edu	37	12	117672527	117672527	+	Frame_Shift_Del	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117672527delC	uc001twm.1	-	21	3764	c.3078delG	c.(3076-3078)GGGfs	p.G1026fs		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1026	FAD-binding FR-type.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GCTCCTGGCTCCCGTTGGTGT	0.587													77	34	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													11	7	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123024332	123024333	+	Intron	INS	-	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123024332_123024333insT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ttttgaatgacttttttttttt	0.168													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81044631	81044634	+	IGR	DEL	TCCT	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81044631_81044634delTCCT								SPRY2 (129545 upstream) : None (None downstream)																							tttctttctctccttccttccttc	0.137													8	5	---	---	---	---	
COL4A1	1282	broad.mit.edu	37	13	110821801	110821804	+	Intron	DEL	AAGA	-	-	rs3832902		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110821801_110821804delAAGA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGTTACTGGCAAGAAAGAAAGAAA	0.230													2	5	---	---	---	---	
SNW1	22938	broad.mit.edu	37	14	78185056	78185056	+	Intron	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78185056delC	uc001xuf.2	-						SNW1_uc010tvm.1_Intron|SNW1_uc010asu.2_Intron|SNW1_uc010tvn.1_Intron	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein						negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ACTTTGGAttctttttttttt	0.154													4	4	---	---	---	---	
PTPN21	11099	broad.mit.edu	37	14	88971026	88971026	+	Intron	DEL	A	-	-	rs138863875		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88971026delA	uc001xwv.3	-						PTPN21_uc010twc.1_Intron|PTPN21_uc010atf.1_Intron	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						CACAAGAGCCAAAAAAAAAAA	0.398													4	2	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176039	92176041	+	Intron	DEL	AAC	-	-	rs12882622		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176039_92176041delAAC	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				atctcaaaaaaacaaaaaaaaag	0.143													4	2	---	---	---	---	
IPW	3653	broad.mit.edu	37	15	25419898	25419898	+	Intron	DEL	G	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25419898delG	uc001yyp.1	+						IPW_uc010aym.1_Intron|uc001yys.1_Intron|SNORD115-3_uc001yyt.1_5'Flank|SNORD115-4_uc001yyu.1_5'Flank					Homo sapiens clone kid12 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						gtattgatttgggaagtgata	0.015													16	7	---	---	---	---	
DMXL2	23312	broad.mit.edu	37	15	51783639	51783640	+	Intron	INS	-	A	A			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51783639_51783640insA	uc002abf.2	-						DMXL2_uc010ufy.1_Intron|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		attccatctccaaaaaaaaaaa	0.149													5	3	---	---	---	---	
GGA2	23062	broad.mit.edu	37	16	23486511	23486511	+	Intron	DEL	T	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23486511delT	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		GTTATATGCCttttttttttt	0.179													8	4	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77331497	77331501	+	Intron	DEL	ATAAT	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77331497_77331501delATAAT	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						CCTCCCtaaaataatatattttata	0.263													4	4	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10547484	10547486	+	Intron	DEL	AAC	-	-	rs59737390		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10547484_10547486delAAC	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						aaaaaaaaaaaacaaacaaaaaa	0.202													5	3	---	---	---	---	
MRC2	9902	broad.mit.edu	37	17	60753462	60753462	+	Intron	DEL	G	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60753462delG	uc002jad.2	+						MRC2_uc002jac.2_Intron|MRC2_uc010ddq.1_5'Flank	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GTGTAGGGCAGGGCCCGGGCA	0.522													4	2	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3169070	3169071	+	Intron	INS	-	AAAAA	AAAAA	rs140809501	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3169070_3169071insAAAAA	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GCAGTCACAGCAAAAAAAAAAT	0.307													4	3	---	---	---	---	
PSTPIP2	9050	broad.mit.edu	37	18	43578963	43578963	+	Intron	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43578963delC	uc002lbp.3	-						PSTPIP2_uc002lbq.3_Intron	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting							membrane				ovary(1)	1						ATTCAACGTGCCCTGCAATCT	0.428													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9324429	9324431	+	IGR	DEL	AAC	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9324429_9324431delAAC								OR7D2 (24936 upstream) : OR7D4 (144 downstream)																							caataacaataacaacaacaaaC	0.158													9	4	---	---	---	---	
SARS2	54938	broad.mit.edu	37	19	39422776	39422776	+	5'Flank	DEL	A	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39422776delA	uc002oka.2	-						SARS2_uc002ojz.2_5'Flank|SARS2_uc010xup.1_5'Flank|SARS2_uc002okb.2_5'Flank|SARS2_uc010xuq.1_Intron|SARS2_uc010xur.1_5'Flank|SARS2_uc010xus.1_5'Flank|MRPS12_uc002okc.2_Intron|MRPS12_uc002okd.2_Intron|MRPS12_uc002oke.2_Intron	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor						seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			actttgtctcaaaaaaaaaaa	0.119													4	4	---	---	---	---	
TGM6	343641	broad.mit.edu	37	20	2411880	2411883	+	Intron	DEL	TCAG	-	-	rs72068458		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2411880_2411883delTCAG	uc002wfy.1	+						TGM6_uc010gal.1_Intron	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6						cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	actcattcactcagtcattcactc	0.083													7	5	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													6	5	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32339915	32339915	+	Intron	DEL	C	-	-	rs11477069		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32339915delC	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						tgcaagcaagccCCCCCCCCT	0.164													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074492	62074494	+	Intron	DEL	CAC	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074492_62074494delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaccatcatcaccaccaccatc	0.000													4	2	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47541823	47541824	+	Intron	INS	-	T	T	rs138054396	by1000genomes	TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47541823_47541824insT	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGGCAGGCTTCGGGTCTCTAGG	0.668													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20149983	20149985	+	IGR	DEL	CAT	-	-	rs13057826		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20149983_20149985delCAT								ZDHHC8 (14454 upstream) : LOC150197 (43870 downstream)																							ccaccatcaccatcaccaccacc	0.025													4	2	---	---	---	---	
CYTSA	23384	broad.mit.edu	37	22	24808884	24808892	+	Intron	DEL	CACGTGAAA	-	-	rs146164777		TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24808884_24808892delCACGTGAAA	uc002zzw.2	+						CYTSA_uc002zzv.3_Intron|CYTSA_uc011ajq.1_Intron	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						ACTTTTATCTCACGTGAAACACCCTAAGG	0.589													6	3	---	---	---	---	
TCF20	6942	broad.mit.edu	37	22	42611473	42611474	+	5'Flank	INS	-	T	T			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42611473_42611474insT	uc003bcj.1	-						TCF20_uc003bck.1_5'Flank|TCF20_uc003bnt.2_5'Flank	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TTGAAtttctattttttttttt	0.193													6	7	---	---	---	---	
NLGN4X	57502	broad.mit.edu	37	X	5947575	5947594	+	Intron	DEL	TTGAATTAAGCACATTTATT	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5947575_5947594delTTGAATTAAGCACATTTATT	uc010ndh.2	-						NLGN4X_uc004crp.2_Intron|NLGN4X_uc004crq.2_Intron|NLGN4X_uc010ndi.2_Intron|NLGN4X_uc004crr.2_Intron|NLGN4X_uc010ndj.2_Intron	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor						brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						CTATTTTGACTTGAATTAAGCACATTTATTTTTATGGATG	0.309													9	7	---	---	---	---	
TEX13B	56156	broad.mit.edu	37	X	107225439	107225439	+	Intron	DEL	C	-	-			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107225439delC	uc004enn.1	-							NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B											ovary(1)	1						CTTAGCCCCTCCCCTCATCTG	0.577													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13476584	13476585	+	IGR	INS	-	G	G			TCGA-21-1070-01A-01D-1521-08	TCGA-21-1070-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13476584_13476585insG								None (None upstream) : None (None downstream)																							TTGCCGCACACGGGAATCCATC	0.569													9	4	---	---	---	---	
