Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AADACL4	343066	broad.mit.edu	37	1	12726115	12726115	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12726115C>A	uc001auf.2	+	4	593	c.593C>A	c.(592-594)GCG>GAG	p.A198E		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	198	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		GGAGGTGCAGCGGTGGCCGCC	0.582													6	42	---	---	---	---	PASS
PAX7	5081	broad.mit.edu	37	1	19062345	19062345	+	Missense_Mutation	SNP	G	T	T	rs145120435	byFrequency	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19062345G>T	uc001bay.2	+	8	1973	c.1375G>T	c.(1375-1377)GGC>TGC	p.G459C	PAX7_uc001baz.2_Missense_Mutation_p.G457C|PAX7_uc010oct.1_Missense_Mutation_p.G459C	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1	459					anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CCCCGTGGCCGGCTATCAGTA	0.672			T	FOXO1A	alveolar rhabdomyosarcoma								8	65	---	---	---	---	PASS
PAX7	5081	broad.mit.edu	37	1	19062346	19062346	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19062346G>C	uc001bay.2	+	8	1974	c.1376G>C	c.(1375-1377)GGC>GCC	p.G459A	PAX7_uc001baz.2_Missense_Mutation_p.G457A|PAX7_uc010oct.1_Missense_Mutation_p.G459A	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1	459					anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CCCGTGGCCGGCTATCAGTAC	0.672			T	FOXO1A	alveolar rhabdomyosarcoma								8	65	---	---	---	---	PASS
EXTL1	2134	broad.mit.edu	37	1	26349716	26349716	+	Silent	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26349716C>A	uc001blf.2	+	1	1446	c.579C>A	c.(577-579)GGC>GGA	p.G193G		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	193	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		TCCGGCCCGGCTTTGATGTGG	0.697													5	27	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34003047	34003047	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34003047G>T	uc001bxn.1	-	60	9391	c.9362C>A	c.(9361-9363)CCC>CAC	p.P3121H	CSMD2_uc001bxm.1_Missense_Mutation_p.P3265H	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3121	Extracellular (Potential).|Sushi 24.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TATGCAGCTGGGCTGGGTGCC	0.582													9	92	---	---	---	---	PASS
CTPS	1503	broad.mit.edu	37	1	41461729	41461729	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41461729G>C	uc001cgk.3	+	8	1369	c.861G>C	c.(859-861)GAG>GAC	p.E287D	CTPS_uc010ojo.1_Missense_Mutation_p.E56D|CTPS_uc010ojp.1_Missense_Mutation_p.E294D|CTPS_uc001cgl.3_Missense_Mutation_p.E287D|CTPS_uc010ojq.1_Missense_Mutation_p.E131D|CTPS_uc009vwe.2_Missense_Mutation_p.E7D	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase	287					CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)	AATGGAAAGAGATGGCTGACA	0.468													3	26	---	---	---	---	PASS
PARS2	25973	broad.mit.edu	37	1	55223696	55223696	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55223696C>T	uc001cxy.2	-	2	1222	c.1139G>A	c.(1138-1140)GGC>GAC	p.G380D		NM_152268	NP_689481	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase (mitochondrial)(putative)	380					prolyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|proline-tRNA ligase activity			ovary(2)	2					L-Proline(DB00172)	CTCCTTACTGCCCTTCTTAGG	0.607													3	64	---	---	---	---	PASS
WDR78	79819	broad.mit.edu	37	1	67293600	67293600	+	Intron	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67293600C>T	uc001dcx.2	-						WDR78_uc009waw.2_Intron|WDR78_uc009wax.2_Intron	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						TGTCCTACAACACAAAACATC	0.323													11	108	---	---	---	---	PASS
WLS	79971	broad.mit.edu	37	1	68697929	68697929	+	Silent	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68697929A>G	uc001def.1	-	1	325	c.54T>C	c.(52-54)GGT>GGC	p.G18G	WLS_uc001dee.2_Silent_p.G18G|WLS_uc001deg.1_Silent_p.G18G|WLS_uc001deh.1_Silent_p.G18G	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1	18					multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						GCAGAATCCCACCAACAATGC	0.468													6	43	---	---	---	---	PASS
LRRC8C	84230	broad.mit.edu	37	1	90179820	90179820	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90179820C>T	uc001dnl.3	+	3	1933	c.1691C>T	c.(1690-1692)TCC>TTC	p.S564F		NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member	564						endoplasmic reticulum membrane|integral to membrane				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		GTTGATGTTTCCAGCCATCTC	0.448													4	55	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110754586	110754586	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110754586G>A	uc001dzh.2	+	1	522	c.465G>A	c.(463-465)GAG>GAA	p.E155E	KCNC4_uc001dzf.2_Silent_p.E155E|KCNC4_uc009wfr.2_Silent_p.E155E|KCNC4_uc001dzg.2_Silent_p.E155E|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	155	Cytoplasmic (Potential).				synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCGACGCCGAGGAGGCGCTCG	0.716													3	15	---	---	---	---	PASS
CHI3L2	1117	broad.mit.edu	37	1	111777527	111777527	+	Splice_Site	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111777527A>G	uc001eam.2	+	5	401	c.330_splice	c.e5-2	p.G110_splice	CHI3L2_uc001ean.2_Splice_Site_p.G100_splice|CHI3L2_uc001eao.2_Splice_Site_p.G31_splice|CHI3L2_uc009wga.2_Splice_Site_p.G31_splice	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		GCTTCTTTCCAGGTTCCACCC	0.398													4	46	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120465271	120465271	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120465271C>A	uc001eik.2	-	27	5246	c.4990G>T	c.(4990-4992)GTG>TTG	p.V1664L		NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	1664	Negative regulatory region (NRR).|Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACGACAGACACAAGAGGGTAT	0.517			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				6	65	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783657	149783657	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783657G>A	uc001esr.2	-	1	272	c.222C>T	c.(220-222)ATC>ATT	p.I74I	HIST2H2BF_uc010pbj.1_Silent_p.I74I|HIST2H2BF_uc010pbk.1_Silent_p.I74I	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a	74					nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					CCTCTCCCGCGATGCGCTCGA	0.642													7	115	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152280685	152280685	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152280685C>T	uc001ezu.1	-	3	6713	c.6677G>A	c.(6676-6678)GGC>GAC	p.G2226D		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2226	Ser-rich.|Filaggrin 13.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCCCTGGCCCACCAGTGA	0.562									Ichthyosis				17	233	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152327943	152327943	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327943G>T	uc001ezw.3	-	3	2392	c.2319C>A	c.(2317-2319)CAC>CAA	p.H773Q	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	773	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCAGAACTGTGTTGGCCAT	0.512													73	238	---	---	---	---	PASS
LMNA	4000	broad.mit.edu	37	1	156105054	156105054	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156105054G>A	uc001fni.2	+	5	1136	c.887G>A	c.(886-888)CGC>CAC	p.R296H	LMNA_uc001fnf.1_Missense_Mutation_p.R296H|LMNA_uc001fng.2_Missense_Mutation_p.R296H|LMNA_uc001fnh.2_Missense_Mutation_p.R296H|LMNA_uc009wro.1_Missense_Mutation_p.R296H|LMNA_uc010pgz.1_Missense_Mutation_p.R184H|LMNA_uc001fnj.2_Missense_Mutation_p.R215H|LMNA_uc001fnk.2_Missense_Mutation_p.R197H|LMNA_uc009wrp.2_Missense_Mutation_p.A24T|LMNA_uc010pha.1_5'Flank	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor	296	Coil 2.|Rod.				cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)					CAGCAGTCGCGCATCCGCATC	0.637									Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				3	26	---	---	---	---	PASS
SH2D2A	9047	broad.mit.edu	37	1	156779583	156779583	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156779583C>T	uc001fqd.2	-	6	724	c.584G>A	c.(583-585)GGA>GAA	p.G195E	SH2D2A_uc001fqc.1_Missense_Mutation_p.G167E|SH2D2A_uc009wsh.2_Missense_Mutation_p.G205E|SH2D2A_uc001fqe.2_Missense_Mutation_p.G177E|SH2D2A_uc010phs.1_Missense_Mutation_p.G195E	NM_003975	NP_003966	Q9NP31	SH22A_HUMAN	SH2 domain protein 2A isoform 2	195	Pro-rich.				angiogenesis|cell differentiation|signal transduction	cytoplasm|soluble fraction	SH3 domain binding|SH3/SH2 adaptor activity				0	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGGGAAAGTCCTGCAGGCTC	0.557													12	118	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157508921	157508921	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157508921C>A	uc001fqu.2	-	7	1515	c.1357G>T	c.(1357-1359)GGC>TGC	p.G453C	FCRL5_uc009wsm.2_Missense_Mutation_p.G453C|FCRL5_uc010phv.1_Missense_Mutation_p.G453C|FCRL5_uc010phw.1_Missense_Mutation_p.G368C|FCRL5_uc001fqv.1_Missense_Mutation_p.G453C|FCRL5_uc010phx.1_Missense_Mutation_p.G204C	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	453	Extracellular (Potential).|Ig-like C2-type 4.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GGGCCAAAGCCATTGTCAGCT	0.597													4	42	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157737267	157737267	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157737267A>T	uc001fre.2	-	6	975	c.916T>A	c.(916-918)TCT>ACT	p.S306T	FCRL2_uc001frd.2_Missense_Mutation_p.S53T|FCRL2_uc010phz.1_Missense_Mutation_p.S306T|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	306	Ig-like C2-type 4.|Extracellular (Potential).				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCCCCAGGAGACCTGAGGGTG	0.537													12	56	---	---	---	---	PASS
CD1B	910	broad.mit.edu	37	1	158300799	158300799	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158300799T>C	uc001frx.2	-	2	223	c.115A>G	c.(115-117)AGT>GGT	p.S39G	CD1B_uc001frw.2_Translation_Start_Site|CD1B_uc010pic.1_Missense_Mutation_p.S39G	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor	39	Extracellular (Potential).				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					GCCCAGGTACTATTGGTAAAG	0.502													56	165	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158627340	158627340	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158627340G>C	uc001fst.1	-	19	2931	c.2732C>G	c.(2731-2733)GCA>GGA	p.A911G		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	911	Spectrin 10.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CCATGTTTCTGCTTCATGCAG	0.473													23	115	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908926	158908926	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908926A>T	uc001ftb.2	+	4	713	c.468A>T	c.(466-468)AAA>AAT	p.K156N	PYHIN1_uc001fta.3_Missense_Mutation_p.K156N|PYHIN1_uc001ftc.2_Missense_Mutation_p.K147N|PYHIN1_uc001ftd.2_Missense_Mutation_p.K156N|PYHIN1_uc001fte.2_Missense_Mutation_p.K147N	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	156					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					AGATGTCCAAAGAGCAGACTC	0.468													13	49	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908927	158908927	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908927G>T	uc001ftb.2	+	4	714	c.469G>T	c.(469-471)GAG>TAG	p.E157*	PYHIN1_uc001fta.3_Nonsense_Mutation_p.E157*|PYHIN1_uc001ftc.2_Nonsense_Mutation_p.E148*|PYHIN1_uc001ftd.2_Nonsense_Mutation_p.E157*|PYHIN1_uc001fte.2_Nonsense_Mutation_p.E148*	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	157					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GATGTCCAAAGAGCAGACTCG	0.473													12	48	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160137139	160137139	+	Silent	SNP	G	A	A	rs141489030		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160137139G>A	uc001fve.3	+	10	1907	c.1428G>A	c.(1426-1428)GCG>GCA	p.A476A	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_5'UTR	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	476	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCTCTGTGGCGGAGATGAGAG	0.517													5	128	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160262293	160262293	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160262293C>A	uc009wti.2	-	28	3335	c.2941G>T	c.(2941-2943)GGC>TGC	p.G981C	COPA_uc001fvv.3_Missense_Mutation_p.G990C	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	981					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTAGGATAGCCATACATGGAG	0.502													6	95	---	---	---	---	PASS
NCSTN	23385	broad.mit.edu	37	1	160314557	160314557	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160314557T>A	uc001fvx.2	+	2	255	c.131T>A	c.(130-132)TTA>TAA	p.L44*	COPA_uc009wti.2_5'Flank|COPA_uc001fvv.3_5'Flank|COPA_uc009wtj.1_5'Flank|NCSTN_uc009wtk.1_RNA|NCSTN_uc001fvy.2_Nonsense_Mutation_p.L24*|NCSTN_uc010pjf.1_Nonsense_Mutation_p.L44*	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	44	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TATATCCCCTTAAATAAAACA	0.428													4	47	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174606637	174606637	+	Intron	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174606637C>T	uc001gjx.2	+							NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						GTAGGACTCTCTTCCTCACTT	0.348													6	62	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175046900	175046900	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046900G>A	uc001gkl.1	+	2	459	c.346G>A	c.(346-348)GAG>AAG	p.E116K	TNN_uc010pmx.1_Missense_Mutation_p.E116K	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	116					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAAGAAGCTGGAGGAAGAGAT	0.532													3	17	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176838058	176838058	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176838058C>A	uc001glc.2	-	22	3781	c.3569G>T	c.(3568-3570)CGG>CTG	p.R1190L	ASTN1_uc001glb.1_Missense_Mutation_p.R1190L|ASTN1_uc001gld.1_Missense_Mutation_p.R1190L	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	1198					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GTAGAGGACCCGGTGTAAGGT	0.498													11	52	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250530	177250530	+	Missense_Mutation	SNP	C	A	A	rs147964469	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250530C>A	uc001glf.2	+	8	2530	c.2218C>A	c.(2218-2220)CTT>ATT	p.L740I	FAM5B_uc001glg.2_Missense_Mutation_p.L635I	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	740						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						CCGACTTGACCTTTTCTCCTG	0.552													5	51	---	---	---	---	PASS
DHX9	1660	broad.mit.edu	37	1	182812436	182812436	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182812436T>G	uc001gpr.2	+	3	282	c.119T>G	c.(118-120)GTG>GGG	p.V40G	DHX9_uc001gps.2_5'UTR	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	40	DRBM 1.|Interaction with CREBBP.				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						AAGGTTCAGGTGGAAGGTTAT	0.333													6	25	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186304493	186304493	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186304493C>T	uc001grv.2	-	34	5185	c.4888G>A	c.(4888-4890)GAG>AAG	p.E1630K		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1630	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TCTTGAGGCTCATCTCTCTGC	0.393			T	NTRK1	papillary thyroid								8	92	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067166	190067166	+	Silent	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067166C>G	uc001gse.1	-	8	2515	c.2283G>C	c.(2281-2283)ACG>ACC	p.T761T	FAM5C_uc010pot.1_Silent_p.T659T	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	761						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					ATAATTTGGTCGTGTCATAAT	0.393													23	110	---	---	---	---	PASS
UCHL5	51377	broad.mit.edu	37	1	192998516	192998516	+	Splice_Site	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192998516A>T	uc001gsm.2	-	5	565	c.434_splice	c.e5+1	p.R145_splice	UCHL5_uc001gsn.2_Splice_Site|UCHL5_uc001gso.2_Splice_Site_p.R145_splice|UCHL5_uc010pov.1_Intron|UCHL5_uc001gsp.2_Splice_Site_p.R145_splice|UCHL5_uc001gsq.2_Splice_Site_p.R145_splice|UCHL5_uc010pow.1_Splice_Site_p.R21_splice|UCHL5_uc010pox.1_Splice_Site_p.R21_splice	NM_015984	NP_057068	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5						DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|ovary(1)	3						AAGTCTCTTTACCTGGCGAAA	0.299													9	31	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390837	197390837	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390837C>A	uc001gtz.2	+	6	2014	c.1879C>A	c.(1879-1881)CTG>ATG	p.L627M	CRB1_uc010poz.1_Missense_Mutation_p.L558M|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Missense_Mutation_p.L515M|CRB1_uc010ppb.1_Missense_Mutation_p.L627M|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.L108M|CRB1_uc001gub.1_Missense_Mutation_p.L276M	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	627	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						TGGTGTTGCTCTGCTTAACTT	0.418													7	124	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201021734	201021734	+	Silent	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201021734G>T	uc001gvv.2	-	32	4131	c.3904C>A	c.(3904-3906)CGG>AGG	p.R1302R		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1302	Extracellular (Potential).|IV.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TTGTTGTTCCGGTTTATTTGG	0.557													13	59	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203678504	203678504	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203678504G>A	uc001gzw.2	+	11	2517	c.1633G>A	c.(1633-1635)GAT>AAT	p.D545N	ATP2B4_uc001gzv.2_Missense_Mutation_p.D545N|ATP2B4_uc009xaq.2_Missense_Mutation_p.D545N	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	545	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTTTGTCACAGATCTGAAGCA	0.532													11	70	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343741	248343741	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343741G>A	uc010pzf.1	+	1	454	c.454G>A	c.(454-456)GGC>AGC	p.G152S		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	152	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTGGATCCTGGGCTCTACAGA	0.443													69	252	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11323555	11323555	+	3'UTR	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11323555G>C	uc002rbd.1	-	33						NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TGCTTTCATAGAAGGCAGTTA	0.303													6	26	---	---	---	---	PASS
LPIN1	23175	broad.mit.edu	37	2	11911570	11911570	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11911570A>T	uc010yjn.1	+	5	635	c.361A>T	c.(361-363)AAA>TAA	p.K121*	LPIN1_uc010yjm.1_Nonsense_Mutation_p.K170*|LPIN1_uc002rbt.2_Nonsense_Mutation_p.K121*|LPIN1_uc002rbs.2_Nonsense_Mutation_p.K121*	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	121					fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		ATGCCAGCTGAAAAGGGGCTC	0.532													4	33	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28117415	28117415	+	5'UTR	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28117415C>T	uc002rlr.2	+	3					BRE_uc002rlp.1_5'UTR|BRE_uc002rlq.2_5'UTR|BRE_uc002rls.2_5'UTR|BRE_uc002rlt.2_5'UTR|BRE_uc002rlu.2_5'UTR	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					ATTTACAAGTCAAGTTAAAAT	0.448													12	133	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37241016	37241016	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37241016C>G	uc002rpp.1	-	27	4348	c.4252G>C	c.(4252-4254)GAA>CAA	p.E1418Q	HEATR5B_uc010ezy.1_Missense_Mutation_p.E2Q|HEATR5B_uc002rpq.3_Missense_Mutation_p.E2Q	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1418							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GCCAGTTTTTCCATGGTCGTG	0.448													5	72	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656383	40656383	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656383T>C	uc002rrx.2	-	1	1062	c.1038A>G	c.(1036-1038)ATA>ATG	p.I346M	SLC8A1_uc002rry.2_Missense_Mutation_p.I346M|SLC8A1_uc002rrz.2_Missense_Mutation_p.I346M|SLC8A1_uc002rsa.2_Missense_Mutation_p.I346M|SLC8A1_uc002rsd.3_Missense_Mutation_p.I346M|SLC8A1_uc002rsb.1_Missense_Mutation_p.I346M|SLC8A1_uc010fan.1_Missense_Mutation_p.I346M|SLC8A1_uc002rsc.1_Missense_Mutation_p.I346M	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	346	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TAGCTAATTCTATTAATTGCT	0.403													11	119	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54870178	54870178	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54870178C>G	uc002rxu.2	+	19	4166	c.3917C>G	c.(3916-3918)GCC>GGC	p.A1306G	SPTBN1_uc002rxx.2_Missense_Mutation_p.A1293G	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	1306	Spectrin 10.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			TACGATGAAGCCAGAAATCTG	0.423													3	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89292023	89292023	+	RNA	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89292023C>G	uc010ytr.1	-	82		c.7183G>C			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GATCCACTGCCGCTGAACCTT	0.473													19	133	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90078197	90078197	+	RNA	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90078197C>A	uc010fhm.2	+	14		c.1587C>A								Parts of antibodies, mostly variable regions.																		GGGCCACTGGCATCCCAGACA	0.552													12	42	---	---	---	---	PASS
MAL	4118	broad.mit.edu	37	2	95715323	95715323	+	Intron	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95715323T>C	uc002stx.1	+						MAL_uc002sty.1_Intron|MAL_uc002stz.1_Intron|MAL_uc002sua.1_Intron	NM_002371	NP_002362	P21145	MAL_HUMAN	T-lymphocyte maturation-associated protein						apical protein localization|cell differentiation|central nervous system development|induction of apoptosis|membrane raft polarization|myelination	apical plasma membrane|endoplasmic reticulum|endosome|integral to plasma membrane|membrane raft	apoptotic protease activator activity|channel activity|lipid binding|structural constituent of myelin sheath				0				STAD - Stomach adenocarcinoma(1183;0.18)		GTCTGCCCCATAGGACGCAGC	0.652													6	66	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136409402	136409402	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136409402C>T	uc002tuo.2	+	17	2093	c.1723C>T	c.(1723-1725)CTT>TTT	p.L575F	R3HDM1_uc010fni.2_Missense_Mutation_p.L574F|R3HDM1_uc002tup.2_Missense_Mutation_p.L520F|R3HDM1_uc010zbh.1_Missense_Mutation_p.L323F	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	575							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		CACTGTGGTTCTTCAGTCTCC	0.373													18	145	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141055365	141055365	+	Intron	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141055365G>A	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCTGGGTGCTGCTTTTACTTA	0.353										TSP Lung(27;0.18)			17	207	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141232732	141232732	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141232732G>T	uc002tvj.1	-	60	10572	c.9600C>A	c.(9598-9600)AAC>AAA	p.N3200K		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3200	Extracellular (Potential).|LDL-receptor class B 31.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATCCATCCATGTTGCTAAATT	0.299										TSP Lung(27;0.18)			7	70	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149226272	149226272	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149226272A>T	uc002twm.3	+	9	1748	c.760A>T	c.(760-762)AAT>TAT	p.N254Y	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.N254Y|MBD5_uc002twn.1_5'Flank	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	254						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CACAAGAAGTAATCCTGGTTT	0.473													7	96	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152311402	152311402	+	Intron	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152311402T>C	uc002txm.2	+						RIF1_uc002txl.2_Intron|RIF1_uc010fnv.1_Intron|RIF1_uc002txn.2_Intron|RIF1_uc002txo.2_Intron	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TCAGTTTTTGTTTTTAGCACC	0.299													4	35	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152501057	152501057	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152501057C>A	uc010fnx.2	-	56	7760	c.7569G>T	c.(7567-7569)AAG>AAT	p.K2523N		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	2523					muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AACCTTTTCTCTTCAGCTCCT	0.383													6	68	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165984203	165984203	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165984203C>A	uc002ucx.2	-	18	3823	c.3331G>T	c.(3331-3333)GAC>TAC	p.D1111Y	SCN3A_uc002ucy.2_Missense_Mutation_p.D1062Y|SCN3A_uc002ucz.2_Missense_Mutation_p.D1062Y|SCN3A_uc002uda.1_Missense_Mutation_p.D931Y|SCN3A_uc002udb.1_Missense_Mutation_p.D931Y	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1111						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	TTTTCAAAGTCAGACTCTCCA	0.363													4	82	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166892650	166892650	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166892650C>T	uc010zcz.1	-	16	3322	c.3304G>A	c.(3304-3306)GTG>ATG	p.V1102M	SCN1A_uc002udo.3_Missense_Mutation_p.V982M|SCN1A_uc010fpk.2_Missense_Mutation_p.V954M	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1113						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	GGTACAGTCACAGTAAGACTG	0.363													7	85	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173349564	173349564	+	Nonsense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173349564C>G	uc002uhp.1	+	12	1807	c.1604C>G	c.(1603-1605)TCA>TGA	p.S535*	ITGA6_uc010zdy.1_Nonsense_Mutation_p.S416*|ITGA6_uc002uho.1_Nonsense_Mutation_p.S535*|ITGA6_uc010fqm.1_Nonsense_Mutation_p.S181*	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	574	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GGGCTATCCTCAAGAGTTCAG	0.393													4	61	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179574506	179574506	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179574506C>T	uc010zfg.1	-	96	25032	c.24808G>A	c.(24808-24810)GAG>AAG	p.E8270K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E4931K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9197							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACGTCCCTCAAGTTTGAAA	0.383													11	75	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590615	179590615	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590615T>A	uc010zfg.1	-	67	16926	c.16702A>T	c.(16702-16704)AAA>TAA	p.K5568*	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Nonsense_Mutation_p.K2229*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6495							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGAAGTTTTTGGATGCAATC	0.433													3	36	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179632624	179632624	+	Silent	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179632624G>C	uc010zfg.1	-	40	9557	c.9333C>G	c.(9331-9333)GTC>GTG	p.V3111V	TTN_uc010zfh.1_Silent_p.V3065V|TTN_uc010zfi.1_Silent_p.V3065V|TTN_uc010zfj.1_Silent_p.V3065V|TTN_uc002unb.2_Silent_p.V3111V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	3111							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAGGCGGTGGACATATTTCT	0.453													3	56	---	---	---	---	PASS
SESTD1	91404	broad.mit.edu	37	2	180011185	180011185	+	Splice_Site	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180011185C>A	uc002uni.3	-	8	732	c.582_splice	c.e8-1	p.R194_splice		NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1						regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATCCACAGACCTGGAAAACAC	0.308													4	42	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182468455	182468455	+	Intron	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182468455G>A	uc002unx.2	-						CERKL_uc002uny.2_Intron|CERKL_uc010zfm.1_Intron|CERKL_uc002unz.2_Intron|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_Intron	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			aggaacagaaggaaactatct	0.119													3	34	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210560608	210560608	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210560608G>A	uc002vde.1	+	7	3962	c.3714G>A	c.(3712-3714)GAG>GAA	p.E1238E	MAP2_uc002vdc.1_Silent_p.E1238E|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.E1234E	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1238					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	AGGAAGAAGAGATAGAAGCCC	0.483													4	35	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211469853	211469853	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211469853G>C	uc002vee.3	+	17	1996	c.1864G>C	c.(1864-1866)GTG>CTG	p.V622L	CPS1_uc010fur.2_Missense_Mutation_p.V628L|CPS1_uc010fus.2_Missense_Mutation_p.V171L	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	622	ATP-grasp 1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CCAAATTCTGGTGGAGAAGTC	0.383													7	59	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228884364	228884364	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228884364A>T	uc002vpq.2	-	7	1253	c.1206T>A	c.(1204-1206)GAT>GAA	p.D402E	SPHKAP_uc002vpp.2_Missense_Mutation_p.D402E|SPHKAP_uc010zlx.1_Missense_Mutation_p.D402E	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	402						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TAATAAATGCATCCTGCAGCA	0.448													8	76	---	---	---	---	PASS
DIS3L2	129563	broad.mit.edu	37	2	233198700	233198700	+	Intron	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233198700G>T	uc010fxz.2	+						DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vso.2_Intron|DIS3L2_uc002vsp.1_5'Flank	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.								exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CGCGTTAGGTGAGGGGTGCAG	0.672													9	55	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238249779	238249779	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238249779C>T	uc002vwl.2	-	38	8065	c.7780G>A	c.(7780-7782)GAC>AAC	p.D2594N	COL6A3_uc002vwo.2_Missense_Mutation_p.D2388N|COL6A3_uc010znj.1_Missense_Mutation_p.D1987N|COL6A3_uc002vwj.2_5'UTR	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2594	Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGGATGGGTCGATGTTGCAG	0.532													5	76	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36872686	36872686	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36872686C>T	uc003cgj.2	-	12	6908	c.6606G>A	c.(6604-6606)GAG>GAA	p.E2202E		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	2752					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						GGACTGCCACCTCGGAAGCTG	0.562													16	39	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52526102	52526102	+	Silent	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52526102C>G	uc011beg.1	+	22	4191	c.4119C>G	c.(4117-4119)CTC>CTG	p.L1373L	NISCH_uc003ded.3_Silent_p.L1373L|NISCH_uc003dee.3_Silent_p.L862L|NISCH_uc003deg.1_RNA|NISCH_uc003deh.3_Silent_p.L122L	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	1373					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CCAAGACACTCCTGCTCACCA	0.652													7	40	---	---	---	---	PASS
PXK	54899	broad.mit.edu	37	3	58381473	58381473	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58381473G>T	uc003djz.1	+	9	908	c.809G>T	c.(808-810)CGG>CTG	p.R270L	PXK_uc003djx.1_Missense_Mutation_p.R270L|PXK_uc003djy.1_Missense_Mutation_p.R253L|PXK_uc003dka.1_Missense_Mutation_p.R270L|PXK_uc003dkb.1_Missense_Mutation_p.R187L|PXK_uc003dkc.1_Missense_Mutation_p.R253L|PXK_uc011bfe.1_Missense_Mutation_p.R237L|PXK_uc010hnj.1_Missense_Mutation_p.R237L|PXK_uc003dkd.1_Missense_Mutation_p.R133L|PXK_uc010hnk.1_Missense_Mutation_p.R44L	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase	270	Protein kinase.				cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		ACATATGGACGGCAAATATTA	0.353													7	33	---	---	---	---	PASS
PPP4R2	151987	broad.mit.edu	37	3	73114104	73114104	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73114104G>C	uc003dph.1	+	8	810	c.740G>C	c.(739-741)AGA>ACA	p.R247T	PPP4R2_uc003dpi.1_Missense_Mutation_p.R190T	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	247					mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		GAGGTAAAAAGACTCAGGTTT	0.433													7	39	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73433601	73433601	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433601G>C	uc003dpl.1	-	10	2212	c.2116C>G	c.(2116-2118)CAC>GAC	p.H706D	PDZRN3_uc011bgh.1_Missense_Mutation_p.H363D|PDZRN3_uc010hoe.1_Missense_Mutation_p.H404D|PDZRN3_uc011bgf.1_Missense_Mutation_p.H423D|PDZRN3_uc011bgg.1_Missense_Mutation_p.H426D	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	706							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TGCATCTTGTGGGCGCGCACG	0.617													3	37	---	---	---	---	PASS
PROS1	5627	broad.mit.edu	37	3	93619761	93619761	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93619761C>A	uc003drb.3	-	7	955	c.614G>T	c.(613-615)TGC>TTC	p.C205F	PROS1_uc010hoo.2_Missense_Mutation_p.C74F|PROS1_uc003dqz.3_Missense_Mutation_p.C74F	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	205	EGF-like 3; calcium-binding (Potential).				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	CTTCAAAGAGCATTCATCCAC	0.383													11	28	---	---	---	---	PASS
DCBLD2	131566	broad.mit.edu	37	3	98518445	98518445	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98518445G>T	uc003dtd.2	-	16	2462	c.2099C>A	c.(2098-2100)ACT>AAT	p.T700N	DCBLD2_uc003dte.2_Missense_Mutation_p.T714N	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	700	Cytoplasmic (Potential).				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						AGCCTTGAAAGTGGATGTGGA	0.547													17	93	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142259785	142259785	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142259785C>A	uc003eux.3	-	18	3664	c.3542G>T	c.(3541-3543)GGC>GTC	p.G1181V		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1181					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GAATCGAAGGCCAGTTCTCAG	0.383								Other_conserved_DNA_damage_response_genes					6	42	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142259786	142259786	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142259786C>A	uc003eux.3	-	18	3663	c.3541G>T	c.(3541-3543)GGC>TGC	p.G1181C		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1181					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						AATCGAAGGCCAGTTCTCAGT	0.383								Other_conserved_DNA_damage_response_genes					6	44	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148786123	148786123	+	Splice_Site	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148786123C>T	uc003ewq.1	-	8	1113	c.895_splice	c.e8-1	p.G299_splice	HLTF_uc003ewr.1_Splice_Site_p.G299_splice|HLTF_uc003ews.1_Splice_Site_p.G299_splice|HLTF_uc010hve.1_Splice_Site_p.G299_splice	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor						chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GAGTTTTACCCTTAAAAATGT	0.333													17	127	---	---	---	---	PASS
RNF13	11342	broad.mit.edu	37	3	149678729	149678729	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149678729A>T	uc003exn.3	+	11	1768	c.984A>T	c.(982-984)GAA>GAT	p.E328D	RNF13_uc003exp.3_Missense_Mutation_p.E328D|RNF13_uc010hvh.2_Missense_Mutation_p.E209D	NM_007282	NP_009213	O43567	RNF13_HUMAN	ring finger protein 13	328	Cytoplasmic (Potential).				protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CTTTATCGGAATCCCGCTCAC	0.413													5	65	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167016091	167016091	+	Splice_Site	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167016091A>T	uc003fep.2	-	18	2202	c.1879_splice	c.e18+1	p.G627_splice	ZBBX_uc011bpc.1_Splice_Site_p.E627_splice|ZBBX_uc003feq.2_Splice_Site_p.G598_splice	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2						CTAGAAATTTACCTGCAAGTG	0.328													12	60	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184099493	184099493	+	Intron	SNP	T	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184099493T>G	uc003fov.2	+						CHRD_uc003fow.2_Intron|CHRD_uc003fox.2_Intron|CHRD_uc003foy.2_Intron|CHRD_uc010hyc.2_Intron|CHRD_uc011brr.1_5'Flank	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor						BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCATCTTCCTCCCGTCCCAG	0.667													9	22	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193343920	193343920	+	Intron	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193343920C>G	uc003ftm.2	+						OPA1_uc003ftg.2_Missense_Mutation_p.Q240E|OPA1_uc003fth.2_Missense_Mutation_p.Q204E|OPA1_uc003fti.2_Missense_Mutation_p.Q222E|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Missense_Mutation_p.Q186E|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		ACAACAAATTCAAGAGCATGA	0.493													6	53	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1730122	1730122	+	Silent	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1730122G>C	uc003gdo.2	+	4	1101	c.993G>C	c.(991-993)TCG>TCC	p.S331S	TACC3_uc010ibz.2_Silent_p.S331S|TACC3_uc003gdp.2_Intron|TACC3_uc010ica.2_5'Flank	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	331						centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CCAGCTCCTCGAGGAGCGGAC	0.597													5	37	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6107434	6107434	+	Silent	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6107434C>G	uc003giu.3	-	3	666	c.390G>C	c.(388-390)ACG>ACC	p.T130T	JAKMIP1_uc010idb.1_Silent_p.T130T|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Silent_p.T130T|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Silent_p.T130T|JAKMIP1_uc010ide.2_Silent_p.T130T	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	130	Potential.|Mediates association with microtubules.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TCAGCAGCGCCGTCTTGACCT	0.716													4	20	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9783788	9783788	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9783788C>T	uc003gmb.3	+	1	531	c.135C>T	c.(133-135)TGC>TGT	p.C45C		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	45	Helical; Name=1; (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	TCACCGCCTGCCTGCTGACCC	0.692													4	17	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49040076	49040076	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49040076A>G	uc003gyv.2	+	13	1864	c.1682A>G	c.(1681-1683)CAG>CGG	p.Q561R	CWH43_uc011bzl.1_Missense_Mutation_p.Q534R	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	561					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						AGGAAACTGCAGGCTATTGCT	0.363													29	143	---	---	---	---	PASS
AMBN	258	broad.mit.edu	37	4	71467241	71467241	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71467241C>T	uc003hfl.2	+	6	476	c.401C>T	c.(400-402)ACC>ATC	p.T134I		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	134					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			GCTGCAACCACCAACCAGGCC	0.547											OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	100	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73941987	73941987	+	Silent	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73941987T>C	uc003hgp.2	-	34	7890	c.7773A>G	c.(7771-7773)GCA>GCG	p.A2591A	ANKRD17_uc003hgo.2_Silent_p.A2478A|ANKRD17_uc003hgq.2_Silent_p.A2340A|ANKRD17_uc003hgr.2_Silent_p.A2590A	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	2591					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCATGTGAGGTGCCCAGGGTC	0.373													3	13	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	74005579	74005579	+	Silent	SNP	T	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74005579T>G	uc003hgp.2	-	15	2871	c.2754A>C	c.(2752-2754)GGA>GGC	p.G918G	ANKRD17_uc003hgo.2_Silent_p.G805G|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Silent_p.G918G|ANKRD17_uc011cbd.1_Silent_p.G483G	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	918	Gln-rich.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAAGCTGCTCTCCAACTCCAA	0.463													12	79	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111482632	111482632	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111482632C>T	uc003iab.3	+	20	3134	c.2792C>T	c.(2791-2793)ACA>ATA	p.T931I		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	931	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	GTGCTGGAAACAGTGAAAAAC	0.363													5	25	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115856388	115856388	+	Missense_Mutation	SNP	G	C	C	rs141975586		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115856388G>C	uc003ibu.2	-	6	2189	c.1510C>G	c.(1510-1512)CTT>GTT	p.L504V	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	504	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GTGAGAAAAAGTTCACCTCCT	0.368													8	52	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134075494	134075494	+	Silent	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134075494A>T	uc003iha.2	+	2	3490	c.2664A>T	c.(2662-2664)CTA>CTT	p.L888L		NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	888	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		TCAGCTATCTAGTTGACAGAC	0.378													6	32	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162841620	162841620	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162841620G>T	uc003iqh.2	-	4	781	c.345C>A	c.(343-345)CAC>CAA	p.H115Q	FSTL5_uc003iqi.2_Missense_Mutation_p.H114Q|FSTL5_uc010iqv.2_Missense_Mutation_p.H114Q	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	115	Kazal-like.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AAGCAGCTCTGTGCACTTCAC	0.438													8	45	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5237108	5237108	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5237108A>G	uc003jdl.2	+	14	2188	c.2050A>G	c.(2050-2052)ATC>GTC	p.I684V	ADAMTS16_uc003jdk.1_Missense_Mutation_p.I684V|ADAMTS16_uc010itk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	684	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ACTCTACTGTATCGCAGAAGG	0.338													7	103	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	22078623	22078623	+	Missense_Mutation	SNP	C	A	A	rs147912407		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22078623C>A	uc010iuc.2	-	2	621	c.163G>T	c.(163-165)GGC>TGC	p.G55C	CDH12_uc011cno.1_Missense_Mutation_p.G55C|CDH12_uc003jgk.2_Missense_Mutation_p.G55C	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	55	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						CATACCCAGCCACGTTTAACA	0.468										HNSCC(59;0.17)			63	93	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33624455	33624455	+	Missense_Mutation	SNP	A	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33624455A>C	uc003jia.1	-	14	2187	c.2024T>G	c.(2023-2025)ATG>AGG	p.M675R	ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	675	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						ACAGCCAACCATCTGTGGGGA	0.532										HNSCC(64;0.19)			5	34	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33649789	33649789	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33649789G>T	uc003jia.1	-	8	1367	c.1204C>A	c.(1204-1206)CAT>AAT	p.H402N	ADAMTS12_uc010iuq.1_Missense_Mutation_p.H402N	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	402	Peptidase M12B.	Zinc; catalytic (By similarity).			proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TTCCCATCATGCTGGATGCCG	0.512										HNSCC(64;0.19)			20	36	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41181587	41181587	+	Silent	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41181587T>C	uc003jmk.2	-	7	1011	c.801A>G	c.(799-801)CAA>CAG	p.Q267Q	C6_uc003jml.1_Silent_p.Q267Q	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	267	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				ATGAGCCTTGTTGATTTTCAT	0.358													28	40	---	---	---	---	PASS
MGC42105	167359	broad.mit.edu	37	5	43277439	43277439	+	Intron	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43277439T>A	uc003jno.2	+							NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1								ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						TGAGCAGGGGTGACGAGTGAG	0.512													19	49	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82816206	82816206	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82816206T>C	uc003kii.3	+	7	2437	c.2081T>C	c.(2080-2082)ATG>ACG	p.M694T	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.M694T|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	694	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ATACCAGAGATGAGAACAGAT	0.333													7	39	---	---	---	---	PASS
ZNF608	57507	broad.mit.edu	37	5	123982838	123982838	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123982838T>C	uc003ktq.1	-	4	3362	c.3239A>G	c.(3238-3240)TAT>TGT	p.Y1080C	ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Missense_Mutation_p.Y1080C|ZNF608_uc003ktt.1_Missense_Mutation_p.Y1080C|ZNF608_uc003ktp.1_5'Flank	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1080						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		ATACTGGCCATAATAAAGTGA	0.483													8	37	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140564188	140564188	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140564188C>T	uc003liv.2	+	1	3209	c.2054C>T	c.(2053-2055)TCG>TTG	p.S685L	PCDHB9_uc003liw.1_5'Flank	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	685	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGCCAACTCGCTCACTGTC	0.692													5	92	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154395721	154395721	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154395721C>T	uc010jih.1	+	1	2462	c.2302C>T	c.(2302-2304)CTT>TTT	p.L768F		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	768	Interaction with PRC1 (By similarity).|Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAATGACCTCCTTGAAGACAG	0.453													6	23	---	---	---	---	PASS
KIAA0319	9856	broad.mit.edu	37	6	24556934	24556934	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24556934G>T	uc011djo.1	-	18	2995	c.2758C>A	c.(2758-2760)CAT>AAT	p.H920N	KIAA0319_uc011djp.1_Missense_Mutation_p.H875N|KIAA0319_uc003neh.1_Missense_Mutation_p.H920N|KIAA0319_uc011djq.1_Missense_Mutation_p.H911N|KIAA0319_uc011djr.1_Missense_Mutation_p.H920N|KIAA0319_uc010jpt.1_Missense_Mutation_p.H331N	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	920	Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						CAGTGACCATGGCCAGAACAC	0.502													6	29	---	---	---	---	PASS
HIST1H2AH	85235	broad.mit.edu	37	6	27114908	27114908	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27114908A>G	uc003niz.2	+	1	1	c.1A>G	c.(1-3)ATG>GTG	p.M1V	HIST1H2BK_uc003nix.1_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080596	NP_542163	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	1					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TGTGACCAGTATGTCTGGACG	0.542													17	63	---	---	---	---	PASS
OR2J2	26707	broad.mit.edu	37	6	29141953	29141953	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29141953G>T	uc011dlm.1	+	1	643	c.541G>T	c.(541-543)GAA>TAA	p.E181*		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTTCTTCTGTGAAGTTCCAGC	0.448													5	133	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51752042	51752042	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51752042C>A	uc003pah.1	-	44	7274	c.6998G>T	c.(6997-6999)GGG>GTG	p.G2333V	PKHD1_uc010jzn.1_Missense_Mutation_p.G316V|PKHD1_uc003pai.2_Missense_Mutation_p.G2333V	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2333	PbH1 4.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CACTCTGTTCCCCTACAGAAA	0.393													8	47	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74521937	74521937	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74521937G>A	uc003php.2	+	29	4137	c.3712G>A	c.(3712-3714)GTA>ATA	p.V1238I	CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.V1221I|CD109_uc010kba.2_Missense_Mutation_p.V1161I	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	1238						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						GCTTGCTGTGGTACAGCCAAC	0.338													12	74	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75847265	75847265	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75847265A>T	uc003phs.2	-	31	5448	c.5282T>A	c.(5281-5283)GTG>GAG	p.V1761E	COL12A1_uc003pht.2_Missense_Mutation_p.V597E	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1761	Fibronectin type-III 13.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TGCATTGTACACTTGAAGGTT	0.453													12	32	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117710738	117710738	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117710738T>A	uc003pxp.1	-	12	1733	c.1534A>T	c.(1534-1536)ACA>TCA	p.T512S	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	512	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTGCCATCTGTGACAAGAAAG	0.418			T	GOPC|ROS1	glioblastoma|NSCLC								5	41	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129722441	129722441	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129722441G>A	uc003qbn.2	+	38	5623	c.5518G>A	c.(5518-5520)GAT>AAT	p.D1840N	LAMA2_uc003qbo.2_Missense_Mutation_p.D1840N	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1840	Domain II and I.|Potential.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGACATACTCGATGAAGCCAA	0.398													12	48	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11464372	11464372	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11464372C>A	uc003ssf.3	-	15	3586	c.3334G>T	c.(3334-3336)GTG>TTG	p.V1112L		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1112	TSP type-1 11.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CGCATATTCACAAAGGTCACC	0.483										HNSCC(18;0.044)			25	143	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21779282	21779282	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21779282C>T	uc003svc.2	+	49	7957	c.7926C>T	c.(7924-7926)CCC>CCT	p.P2642P		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2642	AAA 3 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CCATCAATCCCAGGCTACAGG	0.433									Kartagener_syndrome				7	39	---	---	---	---	PASS
NPVF	64111	broad.mit.edu	37	7	25266386	25266386	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25266386C>T	uc003sxo.2	-	2	445	c.398G>A	c.(397-399)AGA>AAA	p.R133K		NM_022150	NP_071433	Q9HCQ7	RFRP_HUMAN	neuropeptide VF precursor	133					neuropeptide signaling pathway	extracellular region|membrane	G-protein coupled receptor activity			ovary(1)	1						TGTTGTTGTTCTCCCAAACCT	0.488													26	139	---	---	---	---	PASS
NPVF	64111	broad.mit.edu	37	7	25266428	25266428	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25266428C>T	uc003sxo.2	-	2	403	c.356G>A	c.(355-357)AGC>AAC	p.S119N		NM_022150	NP_071433	Q9HCQ7	RFRP_HUMAN	neuropeptide VF precursor	119					neuropeptide signaling pathway	extracellular region|membrane	G-protein coupled receptor activity			ovary(1)	1						TCTCACGAGGCTCACCTCCAT	0.493													24	151	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38389199	38389199	+	Intron	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38389199A>G	uc003tgp.1	+						uc003tgq.1_Silent_p.A37A					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		AAGTGATTTCAGCAGATGACC	0.478													8	76	---	---	---	---	PASS
MRPS24	64951	broad.mit.edu	37	7	43906544	43906544	+	Silent	SNP	C	A	A	rs9154	byFrequency	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43906544C>A	uc003tit.1	-	4	309	c.258G>T	c.(256-258)ACG>ACT	p.T86T		NM_032014	NP_114403	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24 precursor	86					translation	mitochondrial large ribosomal subunit|mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						CATCCTCCACCGTTCGCTCTG	0.557													3	53	---	---	---	---	PASS
ZPBP	11055	broad.mit.edu	37	7	50097591	50097591	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50097591T>A	uc003tou.2	-	4	551	c.481A>T	c.(481-483)ATA>TTA	p.I161L	ZPBP_uc011kci.1_Missense_Mutation_p.I87L|ZPBP_uc010kyw.2_Missense_Mutation_p.I160L	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	161					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					TTACCATATATAGCATATTTT	0.284													3	35	---	---	---	---	PASS
HIP1	3092	broad.mit.edu	37	7	75197564	75197564	+	Intron	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75197564G>C	uc003uds.1	-						HIP1_uc011kfz.1_Intron	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						GGGAGGCCTGGAAGAAATTGG	0.592			T	PDGFRB	CMML								8	27	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81588591	81588591	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81588591C>A	uc003uhr.1	-	38	3415	c.3159G>T	c.(3157-3159)TTG>TTT	p.L1053F	CACNA2D1_uc011kgy.1_Missense_Mutation_p.L265F	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	1065	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	GTGATCTTACCAAGACATTGT	0.368													11	50	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81598298	81598298	+	Intron	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81598298A>T	uc003uhr.1	-						CACNA2D1_uc011kgy.1_Intron	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	TTCtaaaaaaaaaataaataa	0.294													7	49	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88956788	88956788	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88956788G>C	uc011khi.1	+	3	918	c.380G>C	c.(379-381)TGT>TCT	p.C127S		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	127						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CAATCTGAATGGTAAGAATTA	0.363										HNSCC(36;0.09)			7	36	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95499246	95499246	+	Silent	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95499246G>T	uc003uoc.3	+	6	754	c.477G>T	c.(475-477)CTG>CTT	p.L159L	DYNC1I1_uc003uod.3_Silent_p.L142L|DYNC1I1_uc003uob.2_Silent_p.L122L|DYNC1I1_uc003uoe.3_Silent_p.L139L|DYNC1I1_uc010lfl.2_Silent_p.L148L	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	159					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGGATTTCCTGCCAAGGGAAG	0.448													13	61	---	---	---	---	PASS
PLOD3	8985	broad.mit.edu	37	7	100855937	100855937	+	Splice_Site	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100855937C>G	uc003uyd.2	-	9	1336	c.880_splice	c.e9-1	p.P294_splice	PLOD3_uc010lhs.2_Splice_Site	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGGGGGGAGGCTGGAAGATGC	0.642													4	23	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128486411	128486411	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128486411C>T	uc003vnz.3	+	23	4230	c.4021C>T	c.(4021-4023)CGA>TGA	p.R1341*	FLNC_uc003voa.3_Nonsense_Mutation_p.R1341*	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1341	Filamin 11.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GAGCCCCTTCCGAGTGGGCGT	0.647													5	28	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138545946	138545946	+	Missense_Mutation	SNP	C	A	A	rs60797311	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138545946C>A	uc011kql.1	-	16	5235	c.5186G>T	c.(5185-5187)AGG>ATG	p.R1729M	KIAA1549_uc011kqi.1_Missense_Mutation_p.R513M|KIAA1549_uc003vuk.3_Missense_Mutation_p.R1679M|KIAA1549_uc011kqj.1_Missense_Mutation_p.R1729M|KIAA1549_uc011kqk.1_Missense_Mutation_p.R513M	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1729						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						GGTGGCTCGCCTCTCTTCCTG	0.647			O	BRAF	pilocytic astrocytoma								7	36	---	---	---	---	PASS
SGCZ	137868	broad.mit.edu	37	8	13959919	13959919	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13959919C>A	uc003wwq.2	-	7	1370	c.710G>T	c.(709-711)AGG>ATG	p.R237M	SGCZ_uc010lss.2_Missense_Mutation_p.R190M	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta	224	Extracellular (Potential).				cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		GAGCTCCTTCCTGCAGGTGGC	0.522													15	55	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30702473	30702473	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30702473A>T	uc003xil.2	-	1	4061	c.4061T>A	c.(4060-4062)TTG>TAG	p.L1354*		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1354										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTGCTTATCCAAGTAAGATTT	0.393													23	86	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38187351	38187351	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38187351C>T	uc003xli.2	-	6	1644	c.1126G>A	c.(1126-1128)GAG>AAG	p.E376K	WHSC1L1_uc011lbm.1_Missense_Mutation_p.E376K|WHSC1L1_uc010lwe.2_Missense_Mutation_p.E376K|WHSC1L1_uc003xlj.2_Missense_Mutation_p.E376K	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	376					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			AATGCTTTCTCTGCATGGGCA	0.383			T	NUP98	AML								7	295	---	---	---	---	PASS
GINS4	84296	broad.mit.edu	37	8	41397202	41397202	+	Silent	SNP	G	A	A	rs141057295		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41397202G>A	uc003xnx.2	+	5	513	c.303G>A	c.(301-303)GAG>GAA	p.E101E	GINS4_uc003xny.2_Silent_p.E101E	NM_032336	NP_115712	Q9BRT9	SLD5_HUMAN	GINS complex subunit 4	101					DNA strand elongation involved in DNA replication|S phase of mitotic cell cycle	cytoplasm|nucleoplasm		p.E101E(1)		skin(1)	1	Ovarian(28;0.014)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.00732)|Lung NSC(58;0.0207)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00329)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			CACAGATAGAGAAGTTTTTCC	0.463													9	99	---	---	---	---	PASS
AP3M2	10947	broad.mit.edu	37	8	42015516	42015516	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42015516G>C	uc003xop.2	+	4	622	c.331G>C	c.(331-333)GAG>CAG	p.E111Q	AP3M2_uc003xoo.2_Missense_Mutation_p.E111Q|AP3M2_uc010lxe.2_RNA|AP3M2_uc003xoq.1_5'UTR|AP3M2_uc003xor.1_Missense_Mutation_p.E111Q	NM_001134296	NP_001127768	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	111					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus					0	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			TGTGGTTTATGAGGTATTGGA	0.403													9	102	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67577946	67577946	+	Silent	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67577946A>G	uc003xwn.2	-	1	1507	c.1248T>C	c.(1246-1248)GCT>GCC	p.A416A	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	416					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CTTCTTCCATAGCAGCAACAA	0.388													20	127	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77620155	77620155	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77620155A>G	uc003yav.2	+	3	3274	c.2887A>G	c.(2887-2889)AAG>GAG	p.K963E	ZFHX4_uc003yat.1_Missense_Mutation_p.K963E|ZFHX4_uc003yau.1_Missense_Mutation_p.K989E|ZFHX4_uc003yaw.1_Missense_Mutation_p.K963E	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	963						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTGGAGGTTGAAGTGTATTGC	0.433										HNSCC(33;0.089)			8	55	---	---	---	---	PASS
ZBTB10	65986	broad.mit.edu	37	8	81412556	81412556	+	Silent	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81412556A>G	uc003ybx.3	+	2	2398	c.1800A>G	c.(1798-1800)TCA>TCG	p.S600S	ZBTB10_uc003ybv.3_Silent_p.S308S|ZBTB10_uc003ybw.3_Silent_p.S600S|ZBTB10_uc010lzt.2_Silent_p.S600S	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10 isoform	600					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)	1	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			AAGATTGCTCAGTAATGCAGC	0.343													3	6	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87680270	87680270	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87680270G>T	uc003ydx.2	-	5	666	c.620C>A	c.(619-621)CCA>CAA	p.P207Q	CNGB3_uc010maj.2_Missense_Mutation_p.P69Q	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	207	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TATGCTGTTTGGAAGTTTAAT	0.388													24	162	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	93003993	93003993	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93003993G>T	uc003yfd.2	-	6	949	c.865C>A	c.(865-867)CTG>ATG	p.L289M	RUNX1T1_uc003yfc.1_Missense_Mutation_p.L262M|RUNX1T1_uc003yfe.1_Missense_Mutation_p.L252M|RUNX1T1_uc010mao.2_Missense_Mutation_p.L262M|RUNX1T1_uc011lgi.1_Missense_Mutation_p.L300M|RUNX1T1_uc010man.1_Translation_Start_Site|RUNX1T1_uc003yfb.1_Missense_Mutation_p.L252M	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	289					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GGGTGAGGCAGGCCATTGGGC	0.557													8	70	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113326784	113326784	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113326784G>C	uc003ynu.2	-	48	7582	c.7423C>G	c.(7423-7425)CCT>GCT	p.P2475A	CSMD3_uc003yns.2_Missense_Mutation_p.P1677A|CSMD3_uc003ynt.2_Missense_Mutation_p.P2435A|CSMD3_uc011lhx.1_Missense_Mutation_p.P2371A|CSMD3_uc003ynw.1_Missense_Mutation_p.P186A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2475	CUB 14.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TAACTGTCAGGATATCCAGGG	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			8	47	---	---	---	---	PASS
MTBP	27085	broad.mit.edu	37	8	121509646	121509646	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121509646G>A	uc003ypc.1	+	14	1506	c.1461G>A	c.(1459-1461)TTG>TTA	p.L487L		NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53	487					cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			GACGAAAGTTGGCAAAGCAGC	0.328													10	36	---	---	---	---	PASS
KLHL38	340359	broad.mit.edu	37	8	124664148	124664148	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124664148A>T	uc003yqs.1	-	1	1043	c.1019T>A	c.(1018-1020)ATG>AAG	p.M340K		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	340	Kelch 2.										0						GCTGACAGCCATGCCCCCCAG	0.592													17	51	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139601533	139601533	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139601533C>A	uc003yvd.2	-	65	5291	c.4844G>T	c.(4843-4845)AGC>ATC	p.S1615I	COL22A1_uc011ljo.1_Missense_Mutation_p.S895I	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1615					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGCAGCAAGGCTGGCGAAGTA	0.607										HNSCC(7;0.00092)			7	26	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139733018	139733018	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139733018T>A	uc003yvd.2	-	27	2766	c.2319A>T	c.(2317-2319)AGA>AGT	p.R773S	COL22A1_uc011ljo.1_Missense_Mutation_p.R73S	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	773	Collagen-like 5.|Pro-rich.|Gly-rich.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CATCTTCCCCTCTTTCTCCTG	0.483										HNSCC(7;0.00092)			15	143	---	---	---	---	PASS
LINGO2	158038	broad.mit.edu	37	9	27949789	27949789	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27949789G>T	uc003zqu.1	-	2	1075	c.881C>A	c.(880-882)TCT>TAT	p.S294Y	LINGO2_uc010mjf.1_Missense_Mutation_p.S294Y|LINGO2_uc003zqv.1_Missense_Mutation_p.S294Y	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	294	LRR 10.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GATCAGGTCAGAGAACATGCC	0.522													9	45	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32635006	32635006	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32635006G>C	uc003zrg.1	-	1	662	c.572C>G	c.(571-573)GCC>GGC	p.A191G	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	191					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AAAGGAAGGGGCAATGATGGA	0.483													4	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	78965771	78965771	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78965771G>C	uc004akc.1	+	8	1389	c.1169G>C	c.(1168-1170)TGT>TCT	p.C390S						Homo sapiens cDNA FLJ16215 fis, clone CTONG2025610, moderately similar to PC6B.																		TGTTTATCCTGTGTGTGGAGT	0.478													4	80	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84608660	84608660	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84608660C>T	uc004amn.2	+	4	3322	c.3275C>T	c.(3274-3276)CCG>CTG	p.P1092L		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1092						integral to membrane					0						TTTCTGCCCCCGCCACACAGC	0.517													4	43	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90502826	90502826	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90502826G>T	uc004app.3	+	4	3459	c.3424G>T	c.(3424-3426)GAC>TAC	p.D1142Y		NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	1142						integral to membrane				ovary(3)	3						CACTGCCGCAGACAGGCTGCC	0.652													4	39	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115805640	115805640	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115805640G>C	uc004bgm.1	-	4	1286	c.1258C>G	c.(1258-1260)CTT>GTT	p.L420V	ZFP37_uc011lwz.1_Missense_Mutation_p.L435V|ZFP37_uc011lxa.1_Missense_Mutation_p.L421V	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	420	C2H2-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TGTTCGGTAAGAGATGAGTTA	0.388													8	109	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475061	120475061	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475061C>A	uc004bjz.2	+	3	946	c.655C>A	c.(655-657)CAA>AAA	p.Q219K	TLR4_uc004bka.2_Missense_Mutation_p.Q179K|TLR4_uc004bkb.2_Missense_Mutation_p.Q19K	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	219	LRR 7.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						GAACTTTATCCAACCAGGTGC	0.363													5	66	---	---	---	---	PASS
TRAF1	7185	broad.mit.edu	37	9	123675906	123675906	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123675906C>A	uc004bku.1	-	5	977	c.405G>T	c.(403-405)GAG>GAT	p.E135D	TRAF1_uc011lyg.1_Missense_Mutation_p.E13D|TRAF1_uc010mvl.1_Missense_Mutation_p.E135D	NM_005658	NP_005649	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	135					apoptosis|positive regulation of NF-kappaB transcription factor activity|protein complex assembly|regulation of apoptosis|signal transduction	cytoplasm	protein binding|zinc ion binding			skin(2)|ovary(1)	3						TGGGCCCAGACTCCAGGCCAC	0.632													12	47	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123874791	123874791	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123874791G>A	uc004bkx.1	+	7	1088	c.1057G>A	c.(1057-1059)GAA>AAA	p.E353K	CEP110_uc004bkw.2_Missense_Mutation_p.E353K|CEP110_uc004bky.1_5'UTR	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	353					cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						ATATGAGCTGGAACAGGAATT	0.328													6	47	---	---	---	---	PASS
OR1L1	26737	broad.mit.edu	37	9	125423912	125423912	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125423912A>G	uc011lza.1	+	1	68	c.68A>G	c.(67-69)AAA>AGA	p.K23R		NM_001005236	NP_001005236	Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L,	23	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						AAGAAGAATAAAAGGAGAAAT	0.279													6	34	---	---	---	---	PASS
LMX1B	4010	broad.mit.edu	37	9	129455563	129455563	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129455563C>T	uc004bqj.2	+	4	683	c.633C>T	c.(631-633)TTC>TTT	p.F211F	LMX1B_uc004bqi.2_Silent_p.F211F|LMX1B_uc011maa.1_Silent_p.F211F	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	211	Homeobox.				dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GAAGAGCCTTCAAGGCCTCCT	0.582									Nail-Patella_Syndrome				3	13	---	---	---	---	PASS
KIAA0649	9858	broad.mit.edu	37	9	138379288	138379288	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138379288G>T	uc004cfr.1	+	4	3481	c.2932G>T	c.(2932-2934)GGT>TGT	p.G978C		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	978						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		AAGTGCTTTTGGTCAGCTGCC	0.632													7	32	---	---	---	---	PASS
QSOX2	169714	broad.mit.edu	37	9	139100587	139100587	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139100587T>G	uc010nbi.2	-	12	2122	c.2084A>C	c.(2083-2085)CAC>CCC	p.H695P		NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor	695					cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		CACGGCCGGGTGGTGGTGCTT	0.602													4	41	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139912284	139912284	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139912284C>A	uc011mem.1	-	15	2311	c.2163G>T	c.(2161-2163)ATG>ATT	p.M721I	ABCA2_uc011mel.1_Missense_Mutation_p.M722I|ABCA2_uc004ckl.1_Missense_Mutation_p.M652I|ABCA2_uc004ckm.1_Missense_Mutation_p.M752I|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	721					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCTGGATGGTCATGGCCACGG	0.667													4	15	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139912285	139912285	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139912285A>T	uc011mem.1	-	15	2310	c.2162T>A	c.(2161-2163)ATG>AAG	p.M721K	ABCA2_uc011mel.1_Missense_Mutation_p.M722K|ABCA2_uc004ckl.1_Missense_Mutation_p.M652K|ABCA2_uc004ckm.1_Missense_Mutation_p.M752K|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	721					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CTGGATGGTCATGGCCACGGA	0.662													4	15	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26506596	26506596	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26506596G>T	uc001isp.2	+	2	637	c.134G>T	c.(133-135)TGC>TTC	p.C45F	GAD2_uc009xkr.2_Missense_Mutation_p.C45F|GAD2_uc001isq.2_Missense_Mutation_p.C45F	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	45					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	AACAAACTGTGCGGTGAGTGC	0.642													5	14	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50870714	50870714	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50870714C>T	uc001jhz.2	+	14	2016	c.1863C>T	c.(1861-1863)GAC>GAT	p.D621D	CHAT_uc001jhv.1_Silent_p.D503D|CHAT_uc001jhx.1_Silent_p.D503D|CHAT_uc001jhy.1_Silent_p.D503D|CHAT_uc001jia.2_Silent_p.D503D|CHAT_uc010qgs.1_Silent_p.D503D	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	621					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	TGGCCATTGACAACCACCTGC	0.567													14	55	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108431020	108431020	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108431020C>A	uc001kym.2	-	16	2172	c.2164G>T	c.(2164-2166)GTC>TTC	p.V722F	SORCS1_uc001kyl.2_Missense_Mutation_p.V722F|SORCS1_uc009xxs.2_Missense_Mutation_p.V722F|SORCS1_uc001kyn.1_Missense_Mutation_p.V722F|SORCS1_uc001kyo.2_Missense_Mutation_p.V722F	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	722	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TCAGTGCAGACACAGGGTTCA	0.423													8	46	---	---	---	---	PASS
ACSL5	51703	broad.mit.edu	37	10	114187011	114187011	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114187011C>T	uc001kzs.2	+	21	2088	c.1947C>T	c.(1945-1947)TCC>TCT	p.S649S	ACSL5_uc001kzt.2_Silent_p.S649S|ACSL5_uc001kzu.2_Silent_p.S705S|ACSL5_uc009xxz.2_Silent_p.S625S|ACSL5_uc010qrj.1_Silent_p.S431S	NM_203379	NP_976313	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	649	Cytoplasmic (Potential).				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(2)|skin(1)	3		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		AGCCATTTTCCATTGAAAATG	0.458													11	68	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118231330	118231330	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118231330G>C	uc001lcl.3	+	10	1212	c.1111G>C	c.(1111-1113)GGA>CGA	p.G371R		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	371	PLAT.				lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		AGTCACTCAAGGAACTGTCTT	0.463													11	85	---	---	---	---	PASS
KIAA1598	57698	broad.mit.edu	37	10	118728205	118728205	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118728205C>T	uc009xyw.2	-	3	628	c.130G>A	c.(130-132)GAA>AAA	p.E44K	KIAA1598_uc001lcz.3_Missense_Mutation_p.E44K|KIAA1598_uc010qso.1_5'UTR|KIAA1598_uc010qsp.1_Missense_Mutation_p.E44K|KIAA1598_uc010qsq.1_5'UTR|KIAA1598_uc001lcy.3_Missense_Mutation_p.E14K	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a	44	Potential.				axon guidance	axon					0				all cancers(201;0.00494)		TCATCTCGTTCTTGCCTAATT	0.313													5	16	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1020744	1020744	+	Intron	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1020744G>C	uc001lsw.2	-							NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric						maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACTGCAAGAAGATGGGGTCAG	0.662													5	68	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3724058	3724058	+	Silent	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3724058T>C	uc001lyh.2	-	23	3438	c.3147A>G	c.(3145-3147)CAA>CAG	p.Q1049Q	NUP98_uc001lyi.2_Silent_p.Q1049Q|NUP98_uc001lyg.2_Silent_p.Q117Q	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1066					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TACGACATTCTTGCACAGAGA	0.458			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								4	37	---	---	---	---	PASS
OR52E8	390079	broad.mit.edu	37	11	5878401	5878401	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5878401G>C	uc010qzr.1	-	1	532	c.532C>G	c.(532-534)CGT>GGT	p.R178G	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGATGATACGATGCCCACAG	0.502													6	100	---	---	---	---	PASS
ARFIP2	23647	broad.mit.edu	37	11	6499300	6499300	+	Silent	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6499300G>T	uc001mdk.2	-	6	803	c.666C>A	c.(664-666)CTC>CTA	p.L222L	ARFIP2_uc001mdl.2_Silent_p.L222L|ARFIP2_uc010ral.1_Silent_p.L184L|ARFIP2_uc010ram.1_Silent_p.L128L|ARFIP2_uc010ran.1_Silent_p.L255L|ARFIP2_uc001mdm.2_RNA	NM_012402	NP_036534	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	222	AH.				actin cytoskeleton organization|cellular component movement|lamellipodium assembly|ruffle organization|small GTPase mediated signal transduction	cell cortex|plasma membrane|ruffle	GTP binding|GTP-dependent protein binding|Rac GTPase binding				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCACAGTCATGAGCGTGTCTT	0.512													4	52	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587763	55587763	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587763G>T	uc010rin.1	+	1	658	c.658G>T	c.(658-660)GCG>TCG	p.A220S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CACATCTTATGCGTTCATTGT	0.483													15	83	---	---	---	---	PASS
OR5B3	441608	broad.mit.edu	37	11	58170189	58170189	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58170189A>G	uc010rkf.1	-	1	694	c.694T>C	c.(694-696)TAC>CAC	p.Y232H		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GGCTTCTGGTATACTGAAGCT	0.408													3	40	---	---	---	---	PASS
NDUFV1	4723	broad.mit.edu	37	11	67379895	67379895	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67379895C>T	uc001omj.2	+	10	1514	c.1361C>T	c.(1360-1362)GCC>GTC	p.A454V	NDUFV1_uc010rpv.1_Missense_Mutation_p.A353V|NDUFV1_uc001oml.2_Missense_Mutation_p.A447V|NDUFV1_uc001omk.3_Missense_Mutation_p.A445V|NDUFV1_uc010rpw.1_Missense_Mutation_p.A163V	NM_007103	NP_009034	P49821	NDUV1_HUMAN	NADH dehydrogenase ubiquinone flavoprotein 1	454					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	CAGCGGTTTGCCCAGCAGCAT	0.617													3	29	---	---	---	---	PASS
CCDC89	220388	broad.mit.edu	37	11	85396970	85396970	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85396970G>A	uc001pau.1	-	1	351	c.204C>T	c.(202-204)TCC>TCT	p.S68S		NM_152723	NP_689936	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	68	Potential.					cytoplasm|nucleus					0		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CTTCAATGCGGGAGCGAAGCA	0.587													3	35	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105845170	105845170	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105845170A>T	uc001pix.2	+	16	2989	c.2543A>T	c.(2542-2544)AAG>ATG	p.K848M	GRIA4_uc001piw.2_Missense_Mutation_p.K848M|GRIA4_uc010rvm.1_RNA|GRIA4_uc009yxl.1_RNA	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	848	Cytoplasmic (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	AAGAGAATGAAGGTGGCAAAG	0.473													6	62	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108383971	108383971	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108383971C>A	uc001pkk.2	-	6	2374	c.2263G>T	c.(2263-2265)GGG>TGG	p.G755W	EXPH5_uc010rvy.1_Missense_Mutation_p.G567W|EXPH5_uc010rvz.1_Missense_Mutation_p.G599W|EXPH5_uc010rwa.1_Missense_Mutation_p.G679W	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	755					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		AAACCAAACCCGTTGCTCTTG	0.413													12	85	---	---	---	---	PASS
OR8D2	283160	broad.mit.edu	37	11	124189347	124189347	+	Silent	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124189347G>T	uc010sah.1	-	1	747	c.747C>A	c.(745-747)GGC>GGA	p.G249G		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		CAAAAAAGATGCCCACAGCCA	0.423													7	90	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124743726	124743726	+	Silent	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124743726T>A	uc001qbc.2	+	11	1944	c.1752T>A	c.(1750-1752)GCT>GCA	p.A584A		NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	584	Fibronectin type-III 1.|Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		AAACTGGGGCTGCAGTCACGT	0.527													3	17	---	---	---	---	PASS
KCNJ1	3758	broad.mit.edu	37	11	128710050	128710050	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128710050C>T	uc001qeo.1	-	2	197	c.146G>A	c.(145-147)TGC>TAC	p.C49Y	KCNJ1_uc001qep.1_Missense_Mutation_p.C30Y|KCNJ1_uc001qeq.1_Missense_Mutation_p.C30Y|KCNJ1_uc001qer.1_Missense_Mutation_p.C30Y|KCNJ1_uc001qes.1_Missense_Mutation_p.C30Y	NM_000220	NP_000211	P48048	IRK1_HUMAN	potassium inwardly-rectifying channel J1 isoform	49	Cytoplasmic (By similarity).				excretion	voltage-gated potassium channel complex	ATP binding|inward rectifier potassium channel activity			ovary(3)|breast(1)	4	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Acetohexamide(DB00414)|Chlorpropamide(DB00672)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolazamide(DB00839)|Tolbutamide(DB01124)	TTCTATGTTGCACCTTCCATC	0.438													12	105	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	14019082	14019082	+	Missense_Mutation	SNP	C	A	A	rs79046967		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14019082C>A	uc001rbt.2	-	2	240	c.61G>T	c.(61-63)GTG>TTG	p.V21L		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	21					response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CTGCCTGACACGGCCAGGACG	0.577													3	15	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14809478	14809478	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14809478C>G	uc001rcd.2	-	12	1575	c.1438G>C	c.(1438-1440)GAG>CAG	p.E480Q		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	480	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						TCATTGGTCTCCAGAGGAAAG	0.373													7	91	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39734052	39734052	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39734052T>A	uc001rly.2	-	16	2371	c.2225A>T	c.(2224-2226)CAT>CTT	p.H742L	KIF21A_uc001rlw.2_Missense_Mutation_p.H59L|KIF21A_uc001rlx.2_Missense_Mutation_p.H729L|KIF21A_uc001rlz.2_Missense_Mutation_p.H729L|KIF21A_uc010skl.1_Missense_Mutation_p.H729L	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	742					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CAACCTTGCATGTTCTTTTTG	0.333													6	45	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57112272	57112272	+	Intron	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57112272C>T	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Silent_p.V1014V|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						AGGGAGGAGTCACAGCTGGGG	0.657			T	BCL6	NHL								4	39	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62777614	62777614	+	Intron	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62777614C>T	uc001src.1	+						USP15_uc001srb.1_Intron	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TTTTGCATTTCTTACAGACAC	0.303													3	61	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99166848	99166848	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99166848T>A	uc001tge.1	-	24	3893	c.3476A>T	c.(3475-3477)TAC>TTC	p.Y1159F	ANKS1B_uc001tgf.1_Missense_Mutation_p.Y675F|ANKS1B_uc001tgk.2_Missense_Mutation_p.Y456F|ANKS1B_uc010svd.1_Missense_Mutation_p.Y165F|ANKS1B_uc001tgd.1_Missense_Mutation_p.Y325F|ANKS1B_uc009ztq.2_Missense_Mutation_p.Y61F|ANKS1B_uc010sve.1_Missense_Mutation_p.Y189F|ANKS1B_uc001tgh.3_Missense_Mutation_p.Y165F|ANKS1B_uc001tgi.2_Missense_Mutation_p.Y409F|ANKS1B_uc009ztr.2_Missense_Mutation_p.Y349F|ANKS1B_uc001tgj.2_Missense_Mutation_p.Y325F|ANKS1B_uc009ztp.2_Missense_Mutation_p.Y190F|ANKS1B_uc010svf.1_Missense_Mutation_p.Y189F|ANKS1B_uc001tgg.3_Missense_Mutation_p.Y257F|ANKS1B_uc010svg.1_Missense_Mutation_p.Y294F|ANKS1B_uc009zts.1_Missense_Mutation_p.Y385F	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	1159	PID.					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CACATGACAGTAGTGGTGATT	0.443													4	24	---	---	---	---	PASS
NT5DC3	51559	broad.mit.edu	37	12	104187249	104187249	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104187249C>T	uc010swe.1	-	8	897	c.856G>A	c.(856-858)GCC>ACC	p.A286T		NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	286							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						GCCAGTTTGGCCAACACTGCG	0.443													3	37	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124184242	124184242	+	Intron	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124184242C>G	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		ATGTCTTACTCTCTTGCAGGG	0.448													7	33	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129566354	129566354	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129566354G>T	uc009zyl.1	-	7	2201	c.1873C>A	c.(1873-1875)CAA>AAA	p.Q625K	TMEM132D_uc001uia.2_Missense_Mutation_p.Q163K	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	625	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGTCCGCCTTGCAGCTTGGCG	0.527													6	54	---	---	---	---	PASS
ALG5	29880	broad.mit.edu	37	13	37524105	37524105	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37524105G>A	uc001uvy.2	-	10	1016	c.949C>T	c.(949-951)CTT>TTT	p.L317F	ALG5_uc010teq.1_Missense_Mutation_p.L287F|ALG5_uc010ter.1_RNA	NM_013338	NP_037470	Q9Y673	ALG5_HUMAN	dolichyl-phosphate beta-glucosyltransferase	317	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate beta-glucosyltransferase activity|oligosaccharyl transferase activity				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		GTTTGCTCAAGCCTCCAGGCA	0.363													6	42	---	---	---	---	PASS
CSNK1A1L	122011	broad.mit.edu	37	13	37678416	37678416	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37678416T>A	uc001uwm.1	-	1	1386	c.978A>T	c.(976-978)CAA>CAT	p.Q326H		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	326					Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TTTTTTCAGTTTGCTTGCCTG	0.463													17	54	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39603489	39603489	+	Silent	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39603489T>C	uc001uwy.2	-	4	1077	c.204A>G	c.(202-204)ACA>ACG	p.T68T	C13orf23_uc001uwz.2_Silent_p.T46T	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1	68										ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		TGACCACTTCTGTTGGCTGGA	0.299													5	56	---	---	---	---	PASS
DAOA	267012	broad.mit.edu	37	13	106142326	106142326	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106142326A>T	uc001vqb.2	+	4	632	c.358A>T	c.(358-360)AAG>TAG	p.K120*	DAOA_uc010tjf.1_Nonsense_Mutation_p.K49*|DAOA_uc001vpz.2_RNA|DAOA_uc010agd.2_RNA|DAOA_uc010tjg.1_Nonsense_Mutation_p.K92*|DAOA_uc001vqc.2_RNA|DAOA_uc001vqe.2_RNA	NM_172370	NP_758958	P59103	DAOA_HUMAN	D-amino acid oxidase activator isoform 1	120						Golgi apparatus					0	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					tgaggcctctaaggaccgcag	0.000													7	27	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20248835	20248835	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20248835G>A	uc010tku.1	+	1	354	c.354G>A	c.(352-354)ATG>ATA	p.M118I		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCACAGTGATGGCCTATGACC	0.507													17	190	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20248836	20248836	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20248836G>T	uc010tku.1	+	1	355	c.355G>T	c.(355-357)GCC>TCC	p.A119S		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CACAGTGATGGCCTATGACCG	0.512													18	187	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30066794	30066794	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30066794G>A	uc001wqh.2	-	16	2518	c.2337C>T	c.(2335-2337)GGC>GGT	p.G779G		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	779	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		ATGGGAATGTGCCGCTTAGGC	0.463													9	82	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35231082	35231082	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35231082G>A	uc001wsk.2	-	24	4692	c.4124C>T	c.(4123-4125)CCT>CTT	p.P1375L	BAZ1A_uc001wsl.2_Missense_Mutation_p.P1343L	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1375					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TCTGAAGTTAGGGAAGTTGGG	0.403													10	114	---	---	---	---	PASS
ACOT2	10965	broad.mit.edu	37	14	74036497	74036497	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036497A>G	uc001xon.3	+	1	726	c.553A>G	c.(553-555)ACG>GCG	p.T185A	ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	185					acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		GCTGTGCCAGACGCGGCACGA	0.736													3	9	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79111646	79111646	+	5'UTR	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79111646C>A	uc001xun.2	+	2					NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.A75E	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AAGGATGGTGCGGTCTCCTTG	0.542													3	14	---	---	---	---	PASS
SERPINA4	5267	broad.mit.edu	37	14	95035794	95035794	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95035794C>A	uc001ydk.2	+	5	1212	c.1146C>A	c.(1144-1146)AGC>AGA	p.S382R	SERPINA4_uc010avd.2_Missense_Mutation_p.S419R|SERPINA4_uc001ydl.2_Missense_Mutation_p.S382R	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	382				S -> T (in Ref. 1 and 2).	regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		CAGCCACCAGCTTCGCGATCA	0.557													5	26	---	---	---	---	PASS
SNORD115-26	100033802	broad.mit.edu	37	15	25477614	25477614	+	Intron	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25477614C>T	uc001yzw.1	+						SNORD115-20_uc001yzq.1_RNA|SNORD115-35_uc001zac.1_5'Flank					Homo sapiens clone Rt-15 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						ACGCTGAGGCCCAGCCTAGGT	0.512													9	202	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25959128	25959128	+	Silent	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25959128C>A	uc010ayu.2	-	10	2143	c.2037G>T	c.(2035-2037)TCG>TCT	p.S679S		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	679	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GAGCAAGCTCCGAGGCCCAGT	0.677													4	28	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41827820	41827820	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41827820G>T	uc001zod.2	-	5	555	c.431C>A	c.(430-432)GCA>GAA	p.A144E		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	144						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ACCAGATGTTGCTGATTTCCC	0.502													3	48	---	---	---	---	PASS
SLC24A5	283652	broad.mit.edu	37	15	48434509	48434509	+	Silent	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48434509A>T	uc001zwe.2	+	9	1537	c.1464A>T	c.(1462-1464)GGA>GGT	p.G488G	SLC24A5_uc010bel.2_Silent_p.G428G|MYEF2_uc001zwg.3_3'UTR|MYEF2_uc001zwh.3_3'UTR|MYEF2_uc001zwi.3_3'UTR|MYEF2_uc001zwj.3_3'UTR|SLC24A5_uc001zwk.2_Silent_p.G119G	NM_205850	NP_995322	Q71RS6	NCKX5_HUMAN	solute carrier family 24, member 5 precursor	488	Helical; Name=11; (Potential).				response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity				0		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		ATGAACTTGGAATTATTGGAA	0.373													7	57	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53908393	53908393	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53908393C>T	uc002acj.2	-	15	2052	c.2010G>A	c.(2008-2010)GTG>GTA	p.V670V	WDR72_uc010bfi.1_Silent_p.V670V	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	670										lung(1)|skin(1)	2				all cancers(107;0.0511)		ATTTTGTCTTCACAGGCAAGA	0.343													3	28	---	---	---	---	PASS
ZNF280D	54816	broad.mit.edu	37	15	56961049	56961049	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56961049T>A	uc002adu.2	-	14	1734	c.1517A>T	c.(1516-1518)CAA>CTA	p.Q506L	ZNF280D_uc002adv.2_Missense_Mutation_p.Q493L|ZNF280D_uc010bfq.2_Missense_Mutation_p.Q506L|ZNF280D_uc002adw.1_Missense_Mutation_p.Q534L|ZNF280D_uc010bfr.1_RNA|ZNF280D_uc010bfp.2_RNA	NM_017661	NP_060131	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 1	506					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		TCCTTCTAGTTGTTTAGGTTT	0.333													4	60	---	---	---	---	PASS
LBXCOR1	390598	broad.mit.edu	37	15	68118713	68118713	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68118713G>A	uc002aqy.1	+	2	520	c.520G>A	c.(520-522)GTG>ATG	p.V174M		NM_001031807	NP_001026977	P84550	SKOR1_HUMAN	transcriptional corepressor Corl1	183					negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity				0						CGCCTTCGATGTGGTGCACGA	0.607													6	57	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79339108	79339108	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79339108G>A	uc002beq.2	-	5	1233	c.858C>T	c.(856-858)GTC>GTT	p.V286V	RASGRF1_uc002bep.2_Silent_p.V286V|RASGRF1_uc010blm.1_Silent_p.V208V|RASGRF1_uc002ber.3_Silent_p.V286V	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	286	DH.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						AGATGCTGCTGACGTCGTCGT	0.572													10	82	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85383868	85383868	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85383868G>A	uc002ble.2	+	5	2131	c.1964G>A	c.(1963-1965)AGG>AAG	p.R655K		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	655					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCACCCCTCAGGGCTAGAAGC	0.652													3	43	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61747770	61747770	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61747770C>T	uc002eog.1	-	10	1881	c.1629G>A	c.(1627-1629)CCG>CCA	p.P543P		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	543	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGGTGAAATTCGGATTGTTGA	0.333													5	35	---	---	---	---	PASS
COX4I1	1327	broad.mit.edu	37	16	85840455	85840455	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85840455A>T	uc002fje.2	+	5	649	c.485A>T	c.(484-486)TAC>TTC	p.Y162F	COX4I1_uc002fjf.2_3'UTR|COX4I1_uc002fjg.1_3'UTR|COX4I1_uc010vom.1_Missense_Mutation_p.Y129F	NM_001861	NP_001852	P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	162					respiratory electron transport chain	mitochondrial inner membrane|nucleus	cytochrome-c oxidase activity|protein binding			lung(1)	1		Renal(780;0.228)				AAGTGGGACTACGAAAAGAAC	0.557													6	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	88620302	88620302	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88620302C>A	uc010vox.1	-	2	328	c.328G>T	c.(328-330)GAA>TAA	p.E110*						RecName: Full=Putative uncharacterized protein C16orf85;																		CCGGTGGGTTCCTGCAGGGCT	0.632													3	31	---	---	---	---	PASS
TCF25	22980	broad.mit.edu	37	16	89973675	89973675	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89973675G>T	uc002fpb.2	+	16	1826	c.1744G>T	c.(1744-1746)GGG>TGG	p.G582W	TCF25_uc002fpc.2_Missense_Mutation_p.G347W	NM_014972	NP_055787	Q9BQ70	TCF25_HUMAN	NULP1	582					heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		GTCTGTGATGGGGTTTGATCC	0.567													35	169	---	---	---	---	PASS
TCF25	22980	broad.mit.edu	37	16	89973676	89973676	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89973676G>T	uc002fpb.2	+	16	1827	c.1745G>T	c.(1744-1746)GGG>GTG	p.G582V	TCF25_uc002fpc.2_Missense_Mutation_p.G347V	NM_014972	NP_055787	Q9BQ70	TCF25_HUMAN	NULP1	582					heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		TCTGTGATGGGGTTTGATCCT	0.572													35	169	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2203562	2203562	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2203562C>A	uc002fub.1	-	2	540	c.485G>T	c.(484-486)CGG>CTG	p.R162L	SMG6_uc002fud.1_Missense_Mutation_p.R131L	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	162	Interaction with telomeric DNA.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						CTCCTCCACCCGACTGGCGGA	0.463													34	158	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3663533	3663533	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3663533G>A	uc002fwo.3	-	7	746	c.647C>T	c.(646-648)CCA>CTA	p.P216L		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	216	VWFA.|Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CTGAAAGTCTGGGGGATCAAT	0.473													7	28	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579414	7579414	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579414C>T	uc002gim.2	-	4	467	c.273G>A	c.(271-273)TGG>TGA	p.W91*	TP53_uc002gig.1_Nonsense_Mutation_p.W91*|TP53_uc002gih.2_Nonsense_Mutation_p.W91*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.W91*|TP53_uc010cni.1_Nonsense_Mutation_p.W91*|TP53_uc002gij.2_Nonsense_Mutation_p.W91*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.W52*|TP53_uc010cnk.1_Nonsense_Mutation_p.W106*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	91	Interaction with WWOX.		W -> C (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.W91*(11)|p.0?(7)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.P92fs*57(1)|p.W91fs*57(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGACAGGGGCCAGGAGGGGG	0.627		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			14	40	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11572717	11572717	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11572717A>G	uc002gne.2	+	17	3027	c.2959A>G	c.(2959-2961)AAC>GAC	p.N987D	DNAH9_uc010coo.2_Missense_Mutation_p.N281D	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	987	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGATTTGGCAAACATGCGGCG	0.557													3	23	---	---	---	---	PASS
LLGL1	3996	broad.mit.edu	37	17	18136004	18136004	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18136004C>A	uc002gsp.2	+	4	341	c.280C>A	c.(280-282)CTT>ATT	p.L94I		NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1	94	WD 2.				cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					CCTGTCCCTGCTTGATGACAG	0.592													7	61	---	---	---	---	PASS
FOXN1	8456	broad.mit.edu	37	17	26851655	26851655	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26851655C>T	uc010crm.2	+	3	456	c.258C>T	c.(256-258)CCC>CCT	p.P86P	FOXN1_uc002hbj.2_Silent_p.P86P	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	86					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					CAGCCGGCCCCGGCCCTGGGC	0.687													9	27	---	---	---	---	PASS
CDK5R1	8851	broad.mit.edu	37	17	30815095	30815095	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30815095C>G	uc002hhn.2	+	2	678	c.457C>G	c.(457-459)CGC>GGC	p.R153G	CDK5R1_uc010wca.1_Missense_Mutation_p.R153G|CDK5R1_uc010ctc.2_5'UTR	NM_003885	NP_003876	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1	153					axon guidance|axonal fasciculation|brain development|cell proliferation|embryo development|ionotropic glutamate receptor signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of transcription, DNA-dependent|neuron cell-cell adhesion|neuron migration|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of neuron apoptosis|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation	axon|contractile fiber|cyclin-dependent protein kinase 5 holoenzyme complex|cytosol|dendritic spine|growth cone|neuromuscular junction|neuronal cell body|perinuclear region of cytoplasm|plasma membrane	cadherin binding|calcium ion binding|protein kinase binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			TGAGCTGCTTCGCTGCCTGGG	0.682													4	57	---	---	---	---	PASS
GRN	2896	broad.mit.edu	37	17	42426621	42426621	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42426621G>A	uc002igp.1	+	2	308	c.89G>A	c.(88-90)TGC>TAC	p.C30Y	GRN_uc002igq.1_Missense_Mutation_p.C30Y|GRN_uc002igr.1_5'Flank	NM_002087	NP_002078	P28799	GRN_HUMAN	granulin precursor	30					signal transduction	extracellular space	cytokine activity|growth factor activity			ovary(2)|central_nervous_system(2)|skin(1)	5		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCTGTGGCCTGCTGCCTGGAC	0.647													3	42	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62036723	62036723	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62036723C>A	uc002jds.1	-	12	1998	c.1921G>T	c.(1921-1923)GGT>TGT	p.G641C		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	641	Helical; Name=S3 of repeat II; (Potential).|II.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	ATATTCCAACCCTGCTGGAAA	0.557													4	21	---	---	---	---	PASS
H3F3B	3021	broad.mit.edu	37	17	73775177	73775177	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73775177T>C	uc002jpl.2	-	2	212	c.79A>G	c.(79-81)AGG>GGG	p.R27G		NM_005324	NP_005315	P84243	H33_HUMAN	H3 histone, family 3B	27					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding			ovary(1)	1	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCGCTTTTCCTGGCGGCTTTC	0.622											OREG0024740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	19	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22669518	22669518	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22669518G>T	uc002kvk.2	-	7	4064	c.3817C>A	c.(3817-3819)CAG>AAG	p.Q1273K	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.Q1273K|ZNF521_uc002kvl.2_Missense_Mutation_p.Q1053K	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	1273	C2H2-type 29.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AAAATATGCTGCTGCAACTTG	0.398			T	PAX5	ALL								10	57	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28993227	28993227	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28993227C>A	uc002kwq.2	+	16	2927	c.2792C>A	c.(2791-2793)CCC>CAC	p.P931H	DSG4_uc002kwr.2_Missense_Mutation_p.P950H	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	931	Cytoplasmic (Potential).|Desmoglein repeat 2.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CAGCTTGCACCCAATGTTGTA	0.413													28	124	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28993228	28993228	+	Silent	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28993228C>G	uc002kwq.2	+	16	2928	c.2793C>G	c.(2791-2793)CCC>CCG	p.P931P	DSG4_uc002kwr.2_Silent_p.P950P	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	931	Cytoplasmic (Potential).|Desmoglein repeat 2.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AGCTTGCACCCAATGTTGTAG	0.413													28	128	---	---	---	---	PASS
DSG2	1829	broad.mit.edu	37	18	29126518	29126518	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29126518C>T	uc002kwu.3	+	15	3357	c.3169C>T	c.(3169-3171)CTG>TTG	p.L1057L	uc002kwv.3_Intron	NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	1057	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TGCTTCCACTCTGCAATCCAG	0.517													7	64	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50705330	50705330	+	Splice_Site	SNP	A	T	T	rs34244428		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50705330A>T	uc002lfe.1	+	9	2006	c.1419_splice	c.e9-2	p.R473_splice	DCC_uc010xdr.1_Splice_Site_p.R321_splice|DCC_uc010dpf.1_Splice_Site_p.R128_splice	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TTGATTTCTCAGGGAACGAGC	0.438													4	27	---	---	---	---	PASS
C18orf54	162681	broad.mit.edu	37	18	51887006	51887006	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51887006G>C	uc002lfn.3	+	2	180	c.64G>C	c.(64-66)GCA>CCA	p.A22P	C18orf54_uc002lfo.3_Missense_Mutation_p.A22P	NM_173529	NP_775800	Q8IYD9	CR054_HUMAN	hypothetical protein LOC162681 precursor	22						extracellular region				ovary(1)|skin(1)	2				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		TGCCCTGCTGGCAAGCTGCAC	0.418													17	71	---	---	---	---	PASS
KDSR	2531	broad.mit.edu	37	18	61022457	61022457	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61022457G>T	uc010dpw.2	-	5	552	c.397C>A	c.(397-399)CTT>ATT	p.L133I	KDSR_uc010xem.1_Missense_Mutation_p.L133I	NM_002035	NP_002026	Q06136	KDSR_HUMAN	3-ketodihydrosphingosine reductase precursor	133	Cytoplasmic (Potential).				3-keto-sphinganine metabolic process	endoplasmic reticulum membrane|extracellular space|integral to membrane	3-dehydrosphinganine reductase activity|binding			skin(1)	1						CTAACTTCAAGATCTTCAAAT	0.413													21	71	---	---	---	---	PASS
C18orf22	79863	broad.mit.edu	37	18	77794645	77794645	+	Silent	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77794645G>C	uc002lns.2	+	1	288	c.150G>C	c.(148-150)TCG>TCC	p.S50S	TXNL4A_uc010drg.2_5'Flank|C18orf22_uc010drh.2_Silent_p.S50S|C18orf22_uc010dri.1_RNA	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor	50					rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		AATTTGCCTCGAAAACCAAGT	0.632													4	55	---	---	---	---	PASS
THEG	51298	broad.mit.edu	37	19	372678	372678	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:372678T>A	uc002lol.2	-	5	627	c.588A>T	c.(586-588)GAA>GAT	p.E196D	THEG_uc002lom.2_Missense_Mutation_p.E172D	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	196	THEG 2.				cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGAGACAGTTCCTCCACGC	0.552													4	40	---	---	---	---	PASS
PLIN5	440503	broad.mit.edu	37	19	4529157	4529157	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4529157C>A	uc002mas.2	-	5	501	c.448G>T	c.(448-450)GCT>TCT	p.A150S	PLIN5_uc002mat.1_3'UTR	NM_001013706	NP_001013728	Q00G26	PLIN5_HUMAN	lipid storage droplet protein 5	150						lipid particle					0						ACATCCACAGCATGGCTCACG	0.627													8	135	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6707815	6707815	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6707815C>G	uc002mfm.2	-	15	2033	c.1971G>C	c.(1969-1971)AGG>AGC	p.R657S		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	657					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CCTCACCTGCCCTCTGGGCGG	0.557													5	78	---	---	---	---	PASS
ZNF763	284390	broad.mit.edu	37	19	12089452	12089452	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12089452G>T	uc002msw.2	+	4	868	c.713G>T	c.(712-714)AGT>ATT	p.S238I	ZNF763_uc010xmf.1_Missense_Mutation_p.S258I|ZNF763_uc002msv.2_Missense_Mutation_p.S241I|ZNF763_uc010xmg.1_Missense_Mutation_p.S116I	NM_001012753	NP_001012771	Q0D2J5	ZN763_HUMAN	zinc finger protein 763	238	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						AAATCCTTTAGTTATTCTGCT	0.378													6	55	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22574667	22574667	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22574667G>T	uc002nqt.2	-	4	1492	c.1370C>A	c.(1369-1371)ACT>AAT	p.T457N		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	457					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TTTCTCTCCAGTATGAATTAT	0.373													3	76	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40367871	40367871	+	Silent	SNP	T	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40367871T>G	uc002omp.3	-	29	13097	c.13089A>C	c.(13087-13089)CCA>CCC	p.P4363P		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4363	TIL 10.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTGGGCAGGGTGGGCCACAGA	0.622													6	21	---	---	---	---	PASS
PNKP	11284	broad.mit.edu	37	19	50370414	50370414	+	Silent	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50370414A>G	uc002pqh.2	-	1	100	c.48T>C	c.(46-48)CCT>CCC	p.P16P	PNKP_uc002pqg.2_5'Flank|PNKP_uc002pqi.2_5'UTR|PNKP_uc002pqj.2_Silent_p.P16P|PNKP_uc010enm.2_Silent_p.P16P|PNKP_uc002pqk.2_Silent_p.P16P	NM_007254	NP_009185	Q96T60	PNKP_HUMAN	polynucleotide kinase 3' phosphatase	16					DNA damage response, detection of DNA damage|DNA-dependent DNA replication|nucleotide-excision repair, DNA damage removal|response to oxidative stress|response to radiation	nucleolus	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|damaged DNA binding|double-stranded DNA binding|endonuclease activity|nucleotide kinase activity|polynucleotide 3'-phosphatase activity|protein binding			ovary(1)|kidney(1)	2		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		GCGCTCCCCCAGGGGGGCTCT	0.721								Other_BER_factors					6	30	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55699442	55699442	+	Intron	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55699442C>A	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|uc002qjr.2_5'Flank	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TGTCCTCTCCCCACCTGGTAC	0.612													3	33	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328547	57328547	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328547C>T	uc002qnu.2	-	7	1614	c.1263G>A	c.(1261-1263)GAG>GAA	p.E421E	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.E392E|PEG3_uc002qnv.2_Silent_p.E421E|PEG3_uc002qnw.2_Silent_p.E297E|PEG3_uc002qnx.2_Silent_p.E295E|PEG3_uc010etr.2_Silent_p.E421E	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	421					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTTTTCTCATCTCACTACCAC	0.493													18	106	---	---	---	---	PASS
IDH3B	3420	broad.mit.edu	37	20	2641562	2641562	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2641562G>A	uc002wgp.2	-	5	400	c.391C>T	c.(391-393)CGG>TGG	p.R131W	IDH3B_uc002wgq.2_Missense_Mutation_p.R131W|IDH3B_uc002wgr.2_5'UTR|IDH3B_uc010zpz.1_Missense_Mutation_p.R131W	NM_006899	NP_008830	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3, beta subunit isoform	131					isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	electron carrier activity|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	TACCTCAGCCGCATATCATAG	0.567													3	58	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3677499	3677499	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3677499T>C	uc002wja.2	-	10	2417	c.2417A>G	c.(2416-2418)GAC>GGC	p.D806G	SIGLEC1_uc002wiz.3_Missense_Mutation_p.D806G	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	806	Ig-like C2-type 8.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CTGGCCCATGTCTAGGAGGGC	0.622													3	32	---	---	---	---	PASS
MKKS	8195	broad.mit.edu	37	20	10389284	10389284	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10389284C>T	uc002wnt.1	-	4	2040	c.1153G>A	c.(1153-1155)GAG>AAG	p.E385K	MKKS_uc002wnu.1_Missense_Mutation_p.E385K|MKKS_uc010zrd.1_RNA	NM_018848	NP_061336	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome protein	385					brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0						ACCTTCAGCTCATCCCAGGCA	0.388									Bardet-Biedl_syndrome				4	56	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13856732	13856732	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13856732C>T	uc010gcf.2	-	12	1138	c.1056G>A	c.(1054-1056)CCG>CCA	p.P352P	SEL1L2_uc002woq.3_Silent_p.P213P|SEL1L2_uc010zrl.1_Silent_p.P352P|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	352	Extracellular (Potential).|Sel1-like 6.					integral to membrane	binding			ovary(2)	2						CGTTATTTTGCGGCACGGCAG	0.318													9	116	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43850411	43850411	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43850411G>A	uc010ggz.2	+	2	195	c.138G>A	c.(136-138)CAG>CAA	p.Q46Q	SEMG2_uc002xnk.2_Silent_p.Q46Q|SEMG2_uc002xnl.2_Silent_p.Q46Q	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	46					sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				AAAAGGGCCAGCACTATTTTG	0.388													6	88	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50769200	50769200	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50769200T>A	uc002xwl.2	-	6	1880	c.1531A>T	c.(1531-1533)ATC>TTC	p.I511F	ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Missense_Mutation_p.I509F|ZFP64_uc002xwn.2_Missense_Mutation_p.I457F	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	511					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						GCCTGGACGATGGTGTTCGCC	0.647													3	27	---	---	---	---	PASS
ZNF217	7764	broad.mit.edu	37	20	52199112	52199112	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52199112A>G	uc002xwq.3	-	1	525	c.254T>C	c.(253-255)TTA>TCA	p.L85S	ZNF217_uc010gij.1_Missense_Mutation_p.L77S	NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217	85	C2H2-type 1.				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GTGTTGCATTAAGACATGTTT	0.458													24	134	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	17956717	17956717	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17956717G>T	uc010gqw.1	+	1	214	c.88G>T	c.(88-90)GAT>TAT	p.D30Y	CECR2_uc010gqv.1_5'UTR|CECR2_uc002zml.2_5'UTR	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	72					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		TCAACGAAGAGATATCACGTG	0.463													3	32	---	---	---	---	PASS
ZDHHC8	29801	broad.mit.edu	37	22	20126807	20126807	+	Silent	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20126807C>T	uc002zrq.2	+	2	301	c.195C>T	c.(193-195)GCC>GCT	p.A65A	ZDHHC8_uc002zrr.1_Silent_p.A65A|ZDHHC8_uc010gsa.2_5'Flank	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	65	Helical; (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					TCAGCATGGCCACTTTCATGG	0.562													9	105	---	---	---	---	PASS
KCNJ4	3761	broad.mit.edu	37	22	38824079	38824079	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38824079C>A	uc003avs.1	-	2	156	c.59G>T	c.(58-60)CGC>CTC	p.R20L	KCNJ4_uc003avt.1_Missense_Mutation_p.R20L	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	20	Cytoplasmic (By similarity).				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)					CTTGACGAAGCGGTTGCGGCG	0.642													69	326	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1424412	1424412	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1424412G>C	uc010nct.2	+	13	1439	c.1117G>C	c.(1117-1119)GAA>CAA	p.E373Q	CSF2RA_uc011mhb.1_Missense_Mutation_p.E373Q|CSF2RA_uc004cpq.2_3'UTR|CSF2RA_uc004cpn.2_Missense_Mutation_p.E373Q|CSF2RA_uc004cpo.2_Missense_Mutation_p.E373Q|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Missense_Mutation_p.E240Q|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Missense_Mutation_p.E407Q|CSF2RA_uc004cpr.2_3'UTR	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	373	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CCATGAGGTGGAAGACGAGGT	0.557													8	73	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18822079	18822079	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18822079G>T	uc004cyq.2	+	14	1616	c.1135G>T	c.(1135-1137)GGC>TGC	p.G379C	PPEF1_uc004cyp.2_Missense_Mutation_p.G351C|PPEF1_uc004cyr.2_Intron|PPEF1_uc004cys.2_Missense_Mutation_p.G379C|PPEF1_uc011mja.1_Missense_Mutation_p.G314C|PPEF1_uc011mjb.1_Missense_Mutation_p.G323C	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	379	Catalytic.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					CCGAGGAGGGGGCTGCTATTT	0.418													5	84	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18822080	18822080	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18822080G>T	uc004cyq.2	+	14	1617	c.1136G>T	c.(1135-1137)GGC>GTC	p.G379V	PPEF1_uc004cyp.2_Missense_Mutation_p.G351V|PPEF1_uc004cyr.2_Intron|PPEF1_uc004cys.2_Missense_Mutation_p.G379V|PPEF1_uc011mja.1_Missense_Mutation_p.G314V|PPEF1_uc011mjb.1_Missense_Mutation_p.G323V	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	379	Catalytic.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					CGAGGAGGGGGCTGCTATTTT	0.418													6	83	---	---	---	---	PASS
YY2	404281	broad.mit.edu	37	X	21875391	21875391	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21875391G>A	uc011mjp.1	+	1	789	c.789G>A	c.(787-789)AAG>AAA	p.K263K	MBTPS2_uc004dae.2_Intron|MBTPS2_uc010nfr.2_Intron|YY2_uc010nfq.2_Silent_p.K481K|MBTPS2_uc004dab.2_Intron	NM_206923	NP_996806	O15391	TYY2_HUMAN	YY2 transcription factor	263	Mediates transcriptional repression.|C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GCTGCGAAAAGATGTTCCGGG	0.488													10	162	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24760118	24760118	+	Splice_Site	SNP	G	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24760118G>C	uc004dbl.2	+	22	2352	c.2329_splice	c.e22-1	p.S777_splice	SCARNA23_uc004dbo.1_5'Flank	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	CCATTTAATAGTCCAGGACGC	0.378													18	69	---	---	---	---	PASS
MAGEB6	158809	broad.mit.edu	37	X	26212947	26212947	+	Silent	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26212947T>A	uc004dbr.2	+	2	1133	c.984T>A	c.(982-984)GCT>GCA	p.A328A	MAGEB6_uc010ngc.1_Silent_p.A108A	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	328	MAGE.									ovary(3)	3						ATGGGGATGCTCGGAAGATCA	0.498													14	131	---	---	---	---	PASS
CXorf21	80231	broad.mit.edu	37	X	30578234	30578234	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30578234C>A	uc004dcg.1	-	3	515	c.239G>T	c.(238-240)AGA>ATA	p.R80I		NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	80										ovary(1)	1						CACTGTGACTCTCTGACTTCT	0.453													18	149	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149282	34149282	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149282C>A	uc004ddg.2	-	1	1147	c.1114G>T	c.(1114-1116)GGG>TGG	p.G372W		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	372										ovary(4)|central_nervous_system(1)	5						AGACTGGACCCCCGACGAGTC	0.632													8	46	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37026659	37026659	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37026659G>T	uc004ddl.1	+	1	190	c.176G>T	c.(175-177)CGC>CTC	p.R59L		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	59										ovary(3)	3						GACGACTTCCGCTACGGCTGT	0.557													3	42	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37029127	37029127	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37029127T>G	uc004ddl.1	+	1	2658	c.2644T>G	c.(2644-2646)TAT>GAT	p.Y882D		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	882										ovary(3)	3						CAGAGCAACCTATCAAGACCA	0.458													5	80	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39933450	39933450	+	Silent	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39933450G>A	uc004den.3	-	4	1441	c.1149C>T	c.(1147-1149)TTC>TTT	p.F383F	BCOR_uc004dep.3_Silent_p.F383F|BCOR_uc004deo.3_Silent_p.F383F|BCOR_uc004dem.3_Silent_p.F383F|BCOR_uc004deq.3_Silent_p.F383F	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	383					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						TGGCCGCGGGGAACTCGCTGC	0.602													4	25	---	---	---	---	PASS
PHF16	9767	broad.mit.edu	37	X	46918459	46918459	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46918459C>A	uc004dgx.2	+	11	2503	c.2452C>A	c.(2452-2454)CAC>AAC	p.H818N	PHF16_uc004dgy.2_Missense_Mutation_p.H818N	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	818					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						TCCCCTTTCCCACAGTTCAAT	0.448													3	30	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48542349	48542349	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48542349T>A	uc004dkm.3	+	1	164	c.107T>A	c.(106-108)TTT>TAT	p.F36Y		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	36					blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				CAGCGACTCTTTGAGATGCTT	0.537			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				6	59	---	---	---	---	PASS
PRICKLE3	4007	broad.mit.edu	37	X	49032071	49032071	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49032071C>A	uc004dmy.1	-	9	1825	c.1799G>T	c.(1798-1800)CGC>CTC	p.R600L	PRICKLE3_uc011mmv.1_Missense_Mutation_p.R532L|PRICKLE3_uc011mmw.1_Missense_Mutation_p.R519L|PRICKLE3_uc011mmx.1_Missense_Mutation_p.R562L	NM_006150	NP_006141	O43900	PRIC3_HUMAN	LIM domain only 6	600							protein binding|zinc ion binding			breast(1)	1						CATCCCTGCGCGAGAGTCCCT	0.602													4	51	---	---	---	---	PASS
AKAP4	8852	broad.mit.edu	37	X	49957892	49957892	+	Missense_Mutation	SNP	G	T	T	rs146755588		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49957892G>T	uc004dow.1	-	5	1596	c.1472C>A	c.(1471-1473)ACT>AAT	p.T491N	AKAP4_uc004dov.1_Intron|AKAP4_uc010njp.1_Missense_Mutation_p.T313N|AKAP4_uc004dou.1_Missense_Mutation_p.T482N	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	491					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					CTCAGCACTAGTCAGTGACTT	0.458													13	123	---	---	---	---	PASS
MAGEH1	28986	broad.mit.edu	37	X	55479403	55479403	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55479403C>A	uc004dum.2	+	1	866	c.596C>A	c.(595-597)TCG>TAG	p.S199*		NM_014061	NP_054780	Q9H213	MAGH1_HUMAN	melanoma antigen, family H, 1 protein	199					apoptosis					ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GACTGGGATTCGGACGATGAT	0.493													5	85	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64738141	64738141	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64738141C>A	uc004dwa.1	-	12	1725	c.1653G>T	c.(1651-1653)AAG>AAT	p.K551N	LAS1L_uc004dwc.1_Missense_Mutation_p.K534N|LAS1L_uc004dwd.1_Missense_Mutation_p.K492N|LAS1L_uc004dvy.1_Missense_Mutation_p.K64N|LAS1L_uc004dvz.1_Missense_Mutation_p.K64N	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	551						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						GTTGCTGGGCCTTTGCTTCAG	0.507													16	106	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66765158	66765158	+	Missense_Mutation	SNP	T	A	A	rs78686797		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66765158T>A	uc004dwu.1	+	1	1285	c.170T>A	c.(169-171)CTG>CAG	p.L57Q	AR_uc011mpd.1_Missense_Mutation_p.L57Q|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Missense_Mutation_p.L57Q	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	57	Poly-Leu.|Modulating.		L -> Q (in prostate cancer).		cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	TTGCTGCTGCTgcagcagcag	0.338									Androgen_Insensitivity_Syndrome				3	26	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76937558	76937558	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76937558C>T	uc004ecp.3	-	9	3422	c.3190G>A	c.(3190-3192)GCT>ACT	p.A1064T	ATRX_uc004ecq.3_Missense_Mutation_p.A1026T|ATRX_uc004eco.3_Missense_Mutation_p.A849T|ATRX_uc004ecr.2_Missense_Mutation_p.A996T|ATRX_uc010nlx.1_Missense_Mutation_p.A1035T|ATRX_uc010nly.1_Missense_Mutation_p.A1009T	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1064					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	GACTTCTCAGCATAATCAGAT	0.338			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						20	184	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107454957	107454957	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107454957T>C	uc004enw.3	-	7	561	c.458A>G	c.(457-459)CAG>CGG	p.Q153R	COL4A6_uc004env.3_Missense_Mutation_p.Q152R|COL4A6_uc011msn.1_Missense_Mutation_p.Q152R|COL4A6_uc010npk.2_Missense_Mutation_p.Q152R	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	153	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						TGATCCTTTCTGACCAGGAAG	0.398									Alport_syndrome_with_Diffuse_Leiomyomatosis				10	101	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107454958	107454958	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107454958G>T	uc004enw.3	-	7	560	c.457C>A	c.(457-459)CAG>AAG	p.Q153K	COL4A6_uc004env.3_Missense_Mutation_p.Q152K|COL4A6_uc011msn.1_Missense_Mutation_p.Q152K|COL4A6_uc010npk.2_Missense_Mutation_p.Q152K	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	153	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GATCCTTTCTGACCAGGAAGC	0.403									Alport_syndrome_with_Diffuse_Leiomyomatosis				10	101	---	---	---	---	PASS
WDR44	54521	broad.mit.edu	37	X	117576644	117576644	+	Splice_Site	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117576644G>T	uc004eqn.2	+	17	2809	c.2384_splice	c.e17+1	p.S795_splice	WDR44_uc004eqo.2_Splice_Site_p.S795_splice|WDR44_uc011mtr.1_Splice_Site_p.S706_splice|WDR44_uc010nqi.2_Splice_Site_p.S505_splice	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein							cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						CAAGTTTCAGGTAAATTGGCA	0.388													8	36	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120182743	120182743	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120182743C>A	uc004eto.2	+	1	1282	c.1205C>A	c.(1204-1206)GCT>GAT	p.A402D		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	402					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	AAGATCATTGCTGAAGGTGCC	0.483													14	158	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122831592	122831592	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122831592G>T	uc004etu.2	-	5	316	c.284C>A	c.(283-285)ACA>AAA	p.T95K	THOC2_uc011muh.1_Missense_Mutation_p.T16K|THOC2_uc011mui.1_5'UTR	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	95					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TAAACAATTTGTCTCAATGTC	0.274													3	8	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123514829	123514829	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123514829C>G	uc004euj.2	-	31	7799	c.7735G>C	c.(7735-7737)GGG>CGG	p.G2579R	ODZ1_uc011muj.1_Missense_Mutation_p.G2585R|ODZ1_uc010nqy.2_Missense_Mutation_p.G2586R	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2579	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TCCAGAGACCCAAGCTTAATG	0.498													6	70	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123540170	123540170	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123540170G>T	uc004euj.2	-	25	5195	c.5131C>A	c.(5131-5133)CAA>AAA	p.Q1711K	ODZ1_uc011muj.1_Missense_Mutation_p.Q1717K|ODZ1_uc010nqy.2_Missense_Mutation_p.Q1718K	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1711	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						ATCTTACCTTGTTTTAAAATA	0.408													6	98	---	---	---	---	PASS
SMARCA1	6594	broad.mit.edu	37	X	128645952	128645952	+	Silent	SNP	C	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128645952C>A	uc004eun.3	-	6	752	c.639G>T	c.(637-639)GGG>GGT	p.G213G	SMARCA1_uc004eup.3_Silent_p.G213G|SMARCA1_uc011muk.1_Silent_p.G213G|SMARCA1_uc011mul.1_Silent_p.G213G	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	213	Helicase ATP-binding.|ATP (Potential).				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						GTAAAGTTTTCCCAAGGCCCT	0.353													15	169	---	---	---	---	PASS
ZDHHC9	51114	broad.mit.edu	37	X	128940418	128940418	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128940418G>T	uc004euv.2	-	10	1392	c.1023C>A	c.(1021-1023)AGC>AGA	p.S341R	ZDHHC9_uc004euw.2_Missense_Mutation_p.S341R	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9	341	Cytoplasmic (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						CGGGAGTGCTGCTGTCCTCCG	0.502													16	83	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130409717	130409717	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130409717C>G	uc004ewd.2	-	16	3157	c.2919G>C	c.(2917-2919)TTG>TTC	p.L973F	IGSF1_uc004ewe.3_Missense_Mutation_p.L967F|IGSF1_uc004ewf.2_Missense_Mutation_p.L953F	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	973	Extracellular (Potential).|Ig-like C2-type 10.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GCTCAGCAAACAACCATGGCT	0.458													5	102	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138886687	138886687	+	Silent	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138886687G>T	uc004faz.2	-	6	606	c.507C>A	c.(505-507)ACC>ACA	p.T169T	ATP11C_uc004fba.2_Silent_p.T169T	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	169	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					TTCCATCAGTGGTGCAAGATG	0.383													8	179	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138886688	138886688	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138886688G>T	uc004faz.2	-	6	605	c.506C>A	c.(505-507)ACC>AAC	p.T169N	ATP11C_uc004fba.2_Missense_Mutation_p.T169N	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	169	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					TCCATCAGTGGTGCAAGATGA	0.378													8	176	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140985527	140985527	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140985527G>A	uc011mwp.1	+	8	1841	c.1841G>A	c.(1840-1842)AGA>AAA	p.R614K	MAGEC3_uc004fbs.2_3'UTR|MAGEC3_uc010nsj.2_3'UTR	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	614	MAGE 2.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATGGAAGACAGAGCCCAGGCC	0.478													3	76	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140995782	140995782	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140995782G>T	uc004fbt.2	+	4	2878	c.2592G>T	c.(2590-2592)TTG>TTT	p.L864F	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	864							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CCACTTCATTGAGCCCATTCA	0.507										HNSCC(15;0.026)			14	178	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151870130	151870130	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151870130G>A	uc004ffq.1	+	3	1014	c.820G>A	c.(820-822)GGT>AGT	p.G274S	MAGEA6_uc004ffr.1_Missense_Mutation_p.G274S|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	274	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					GTTCCTGTGGGGTCCAAGGGC	0.532													9	130	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153580937	153580937	+	Silent	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153580937G>T	uc004fkk.2	-	40	6735	c.6486C>A	c.(6484-6486)CTC>CTA	p.L2162L	FLNA_uc004fki.2_Silent_p.L205L|FLNA_uc011mzn.1_Silent_p.L295L|FLNA_uc010nuu.1_Silent_p.L2154L	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	2162	Filamin 20.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTTTCAGGCTGAGGTCACAAT	0.637													5	68	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153698898	153698898	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153698898G>T	uc004flm.2	+	30	5273	c.5100G>T	c.(5098-5100)CAG>CAT	p.Q1700H		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1700	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGGATGAGCAGGCGGACCAGC	0.622													10	97	---	---	---	---	PASS
IL9R	3581	broad.mit.edu	37	X	155235072	155235072	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155235072G>T	uc004fnv.1	+	6	888	c.709G>T	c.(709-711)GAG>TAG	p.E237*	IL9R_uc010nvn.2_Nonsense_Mutation_p.E216*|IL9R_uc004fnu.1_Nonsense_Mutation_p.E272*	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor	237	Extracellular (Potential).|Fibronectin type-III.				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGATGTGGTAGAGGAGGAGCG	0.582													6	35	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16363393	16363412	+	Intron	DEL	TCAGTGCACCATGATCTCCA	-	-	rs71003234		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16363393_16363412delTCAGTGCACCATGATCTCCA	uc001axw.3	+						FAM131C_uc010obz.1_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CCACATTCCCTCAGTGCACCATGATCTCCATCAGTGCCCC	0.632													5	5	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCAAGGttttctttttttttt	0.189													5	3	---	---	---	---	
PYHIN1	149628	broad.mit.edu	37	1	158912333	158912333	+	Intron	DEL	C	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158912333delC	uc001ftb.2	+						PYHIN1_uc001ftc.2_Intron|PYHIN1_uc001ftd.2_Intron|PYHIN1_uc001fte.2_Intron	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1						cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					ATAAAGTCTTCTTCGAGGTTA	0.338													9	4	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175049103	175049104	+	Intron	INS	-	GT	GT	rs142891850	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175049103_175049104insGT	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCtgtgtgtgagtgtgtgtgtg	0.248													4	3	---	---	---	---	
TMEM63A	9725	broad.mit.edu	37	1	226061869	226061870	+	Intron	DEL	AC	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226061869_226061870delAC	uc001hpm.1	-						TMEM63A_uc010pvi.1_Intron	NM_014698	NP_055513	O94886	TM63A_HUMAN	transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)					CATTCCAGGGacacacacacac	0.292													9	4	---	---	---	---	
LYG2	254773	broad.mit.edu	37	2	99870873	99870893	+	Intron	DEL	AGATAGTATTCTCACAGGCTC	-	-	rs80345491		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99870873_99870893delAGATAGTATTCTCACAGGCTC	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_5'Flank|LYG2_uc002szx.1_Intron	NM_175735	NP_783862	Q86SG7	LYG2_HUMAN	lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1						CCCTGTTTCAAGATAGTATTCTCACAGGCTCAGTACATAGT	0.308													4	2	---	---	---	---	
SCN2A	6326	broad.mit.edu	37	2	166243113	166243113	+	Intron	DEL	T	-	-	rs112640887		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166243113delT	uc002udc.2	+						SCN2A_uc002udd.2_Intron|SCN2A_uc002ude.2_Intron	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ttgcaaggaattttttttttt	0.080													4	2	---	---	---	---	
PRR21	643905	broad.mit.edu	37	2	240982244	240982257	+	Frame_Shift_Del	DEL	TGGATGAAGGGCCA	-	-	rs75044548	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240982244_240982257delTGGATGAAGGGCCA	uc010zod.1	-	1	143_156	c.143_156delTGGCCCTTCATCCA	c.(142-156)ATGGCCCTTCATCCAfs	p.M48fs		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	48_52	Pro-rich.									ovary(1)|skin(1)	2						TGAAGAGCCGTGGATGAAGGGCCATGGGTGAAGA	0.575													9	7	---	---	---	---	
PROM1	8842	broad.mit.edu	37	4	15989500	15989501	+	Intron	INS	-	T	T	rs56144936		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15989500_15989501insT	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						TGTGTACtttcttttttttttt	0.173													17	8	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39507525	39507525	+	Intron	DEL	A	-	-	rs35867925		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39507525delA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	CCTATGGATTAAAAAAAAAAA	0.229													6	3	---	---	---	---	
RPS3A	6189	broad.mit.edu	37	4	152025591	152025592	+	Intron	INS	-	TTT	TTT	rs13111229		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152025591_152025592insTTT	uc003ilz.2	+							NM_001006	NP_000997	P61247	RS3A_HUMAN	ribosomal protein S3a						cell differentiation|endocrine pancreas development|induction of apoptosis|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_hematologic(180;0.093)					CAGttttttggttttttttttt	0.401													9	5	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32077366	32077366	+	Intron	DEL	A	-	-	rs34030551		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32077366delA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						tttagagttgaaaaaaatgga	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165983	180165984	+	IGR	INS	-	C	C	rs2054696	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165983_180165984insC								FLT4 (89359 upstream) : OR2Y1 (139 downstream)																							tgttccccccgccaccaaaaaa	0.188													6	5	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	486926	486927	+	Intron	INS	-	ATCA	ATCA	rs145708345	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:486926_486927insATCA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		AAAAGAAACACATCAAAGAAGT	0.441													2	6	---	---	---	---	
PPT2	9374	broad.mit.edu	37	6	32123361	32123362	+	Intron	INS	-	TG	TG	rs140466503	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32123361_32123362insTG	uc003nzx.2	+						PRRT1_uc003nzu.2_5'Flank|uc003nzv.3_5'Flank|PPT2_uc003nzw.2_Intron|PPT2_uc011dpi.1_Intron|PPT2_uc003nzy.1_Intron|PPT2_uc003nzz.2_Intron|PPT2_uc003oaa.2_Intron|PPT2_uc010jtu.1_Intron	NM_005155	NP_005146	Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2 isoform a						protein modification process	lysosome	palmitoyl-(protein) hydrolase activity				0						gtgtgtgtctctgtgtgtgtgt	0.198													10	6	---	---	---	---	
NFYA	4800	broad.mit.edu	37	6	41058162	41058162	+	Intron	DEL	A	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41058162delA	uc003opo.2	+						NFYA_uc003opp.2_Intron|NFYA_uc003opq.2_Intron	NM_002505	NP_002496	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha isoform 1						transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					TTTTTTGGACAAAAAAAAAAA	0.373													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42467818	42467818	+	IGR	DEL	A	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42467818delA								TRERF1 (47953 upstream) : UBR2 (64240 downstream)																							AGTTTATGTTAAAAAAAAAAA	0.343													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57191021	57191022	+	Intron	INS	-	G	G	rs148099435	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57191021_57191022insG	uc003pdx.2	+						PRIM2_uc003pdv.1_3'UTR|PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTAGAAGAAAAGGACTCCTTAA	0.342													2	4	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34193010	34193011	+	3'UTR	INS	-	TA	TA	rs140714031	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34193010_34193011insTA	uc011kap.1	+	15						NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						Gtatatatgtgtatatatatat	0.307													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7679341	7679342	+	IGR	INS	-	A	A			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7679341_7679342insA								FAM90A7 (262107 upstream) : SPAG11A (26060 downstream)																							gactccttctcaaaaaaaaaaa	0.074													3	3	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128099158	128099158	+	Intron	DEL	T	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128099158delT	uc010mwx.2	+						GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CATAATTTGATTTTTTTTTTC	0.333													4	2	---	---	---	---	
AIF1L	83543	broad.mit.edu	37	9	133987249	133987254	+	Intron	DEL	CTGCGG	-	-	rs145131993		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133987249_133987254delCTGCGG	uc004cab.1	+						AIF1L_uc004cad.1_Intron|AIF1L_uc004cae.1_Intron|AIF1L_uc004cac.1_Intron|AIF1L_uc011mce.1_Intron	NM_031426	NP_113614	Q9BQI0	AIF1L_HUMAN	ionized calcium binding adapter molecule 2							actin cytoskeleton|cytoplasm|focal adhesion|ruffle membrane	actin filament binding|calcium ion binding				0						CTCCCTGCCCCTGCGGGCCCCGTCAC	0.704													4	2	---	---	---	---	
APBB1IP	54518	broad.mit.edu	37	10	26828336	26828337	+	Intron	INS	-	A	A	rs113271338		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26828336_26828337insA	uc001iss.2	+						APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						atgagatcctgaaaaaaaaaaa	0.025													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112211342	112211342	+	IGR	DEL	A	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112211342delA								SMNDC1 (146635 upstream) : DUSP5 (46283 downstream)																							TGTTTCTGGCATTTTTTTTTT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43283606	43283606	+	RNA	DEL	A	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43283606delA	uc001mxe.1	-	2		c.1330delT								Homo sapiens cDNA FLJ44864 fis, clone BRALZ2013621, moderately similar to Heterogeneous nuclear ribonucleoprotein K.																		AAGCAAATGTAAAAAAAAAAA	0.388													6	3	---	---	---	---	
P4HA3	283208	broad.mit.edu	37	11	73999993	73999994	+	Intron	INS	-	A	A	rs36086552		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73999993_73999994insA	uc001ouz.2	-						P4HA3_uc001ouy.3_Intron|P4HA3_uc010rrj.1_Intron	NM_182904	NP_878907	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha III subunit							endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)					gatgccatctcaaaaaaaAAAA	0.173													4	2	---	---	---	---	
CWF19L2	143884	broad.mit.edu	37	11	107299315	107299316	+	Intron	INS	-	AATT	AATT	rs144602276	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107299315_107299316insAATT	uc010rvp.1	-						CWF19L2_uc001pjh.3_Intron|CWF19L2_uc009yxo.2_Intron	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control								catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TATAGCTACTGCTTTCAGCTCT	0.297													3	3	---	---	---	---	
DCTN2	10540	broad.mit.edu	37	12	57927570	57927570	+	Intron	DEL	G	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57927570delG	uc001som.1	-						DCTN2_uc009zpu.1_Intron|DCTN2_uc009zpv.1_Intron|DCTN2_uc009zpw.1_Intron|DCTN2_uc001soo.1_Intron|DCTN2_uc001son.1_Intron|DCTN2_uc001sop.1_Intron|DCTN2_uc001soq.1_Intron|DCTN2_uc009zpx.1_Intron	NM_006400	NP_006391	Q13561	DCTN2_HUMAN	dynactin 2						cell proliferation|G2/M transition of mitotic cell cycle|mitosis	centrosome|cytosol|dynactin complex|dynein complex|kinetochore|membrane|microtubule|vesicle	motor activity|protein binding			ovary(1)	1						aaaaaaaaaagaaagaaaCAT	0.209													4	2	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88514121	88514121	+	Intron	DEL	T	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88514121delT	uc001tar.2	-						CEP290_uc001tat.2_Intron|CEP290_uc009zsl.1_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						AAGTTCATGATTTTTTTTTTA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132152375	132152376	+	IGR	INS	-	AAA	AAA	rs34559456		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132152375_132152376insAAA								LOC116437 (454900 upstream) : SFRS8 (43259 downstream)																							TGGTTATTGttaaaaaaaaaaa	0.460													4	3	---	---	---	---	
CDC16	8881	broad.mit.edu	37	13	115004335	115004335	+	Intron	DEL	T	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115004335delT	uc001vuk.1	+						CDC16_uc010tkm.1_Intron|CDC16_uc001vul.1_Intron|CDC16_uc001vum.1_Intron|CDC16_uc001vun.1_Intron|CDC16_uc001vuo.1_Intron	NM_003903	NP_003894	Q13042	CDC16_HUMAN	anaphase-promoting complex, subunit 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cell proliferation|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	binding				0	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			CAGGACTGGATTTTTTTTTTA	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21580896	21580896	+	IGR	DEL	A	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21580896delA								ZNF219 (8033 upstream) : OR5AU1 (42201 downstream)																							TTGCTTTAGGAATAGTAATTG	0.318													4	2	---	---	---	---	
PPP2R5E	5529	broad.mit.edu	37	14	63862106	63862108	+	Intron	DEL	GAG	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63862106_63862108delGAG	uc001xgd.1	-						PPP2R5E_uc010tsf.1_Intron|PPP2R5E_uc010tsg.1_Intron|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		aggaggagaagaggaggaggagg	0.064													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76077689	76077690	+	5'Flank	INS	-	G	G			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76077689_76077690insG	uc002bbb.1	-											DQ577530																		agcaagatcttgttcttaaaag	0.243													3	3	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89403776	89403777	+	Intron	INS	-	CTCAGGCTT	CTCAGGCTT	rs147084610	by1000genomes	TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89403776_89403777insCTCAGGCTT	uc010upo.1	+						ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTCCACTGAGGCTCAGGCTGGG	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26855912	26855912	+	IGR	DEL	A	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26855912delA								HS3ST4 (706904 upstream) : C16orf82 (222307 downstream)																							agactctgtcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29113498	29113498	+	Intron	DEL	T	-	-	rs66955531		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29113498delT	uc010vct.1	-						RRN3P2_uc002dsf.3_Intron|RRN3P2_uc002dsg.3_Intron|RRN3P2_uc010vdn.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		AGGAGGTGGAttttttttttc	0.254													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32176904	32176904	+	IGR	DEL	G	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32176904delG								HERC2P4 (13030 upstream) : TP53TG3B (507937 downstream)																							AAAAAAAAAAGAAATCAAAGC	0.284													4	2	---	---	---	---	
GOT2	2806	broad.mit.edu	37	16	58767917	58767918	+	Intron	DEL	GT	-	-	rs143852021		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58767917_58767918delGT	uc002eof.1	-						GOT2_uc010vim.1_Intron	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor						aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	TGGCAGAAAAGTGTGTGTGTGT	0.639													4	3	---	---	---	---	
USP6	9098	broad.mit.edu	37	17	5036584	5036585	+	Intron	DEL	TT	-	-			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5036584_5036585delTT	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Intron|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CCATCCACTCTTTCAGTCCTGG	0.554			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								6	3	---	---	---	---	
RHBDL3	162494	broad.mit.edu	37	17	30621148	30621148	+	Intron	DEL	A	-	-	rs72151087		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30621148delA	uc002hhe.1	+						RHBDL3_uc010csw.1_Intron|RHBDL3_uc010csx.1_Intron|RHBDL3_uc010csy.1_Intron|RHBDL3_uc002hhf.1_Intron	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3						proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)				actccatctcaaaaaaaaaaa	0.224													4	2	---	---	---	---	
ABCA6	23460	broad.mit.edu	37	17	67081660	67081661	+	Intron	INS	-	A	A	rs35438104		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67081660_67081661insA	uc002jhw.1	-							NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TATCCAAAGGCaaaaaaaaaaa	0.277													6	3	---	---	---	---	
KIAA0195	9772	broad.mit.edu	37	17	73486159	73486159	+	Intron	DEL	A	-	-	rs34908427		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73486159delA	uc002jnz.3	+						KIAA0195_uc010wsa.1_Intron|KIAA0195_uc010wsb.1_5'Flank	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			actccgtctcaaaaaaaaaaa	0.279													4	6	---	---	---	---	
RNMT	8731	broad.mit.edu	37	18	13742793	13742794	+	Intron	INS	-	A	A	rs7229786		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13742793_13742794insA	uc002ksk.1	+						RNMT_uc002ksl.1_Intron|RNMT_uc002ksm.1_Intron|RNMT_uc010dlk.2_Intron|RNMT_uc010xae.1_Intron	NM_003799	NP_003790	O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase						mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	mRNA (guanine-N7-)-methyltransferase activity|RNA binding				0						TTTGTGTTTTTAAAAAAAAAAA	0.287													4	2	---	---	---	---	
ZNF324	25799	broad.mit.edu	37	19	58980399	58980400	+	Intron	INS	-	T	T			TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58980399_58980400insT	uc002qsw.1	+						ZNF324_uc002qsx.1_5'Flank	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		tgcaatttttattttttttagc	0.005													3	4	---	---	---	---	
OFD1	8481	broad.mit.edu	37	X	13754423	13754423	+	Intron	DEL	A	-	-	rs34932784		TCGA-21-5784-01A-01D-1632-08	TCGA-21-5784-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13754423delA	uc004cvp.3	+						OFD1_uc004cvr.3_Intron|OFD1_uc011mil.1_Intron|OFD1_uc004cvq.3_Intron|OFD1_uc010nen.2_Intron|OFD1_uc004cvs.3_Intron|OFD1_uc004cvu.3_Intron|OFD1_uc004cvv.3_Intron|TRAPPC2_uc010nek.1_5'Flank|TRAPPC2_uc010nel.1_5'Flank|TRAPPC2_uc010nem.1_5'Flank	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1						cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						GGGGTAAGACAAAGTGTGCAG	0.453													3	3	---	---	---	---	
