Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DVL1	1855	broad.mit.edu	37	1	1284316	1284316	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1284316C>A	uc001aer.3	-	1	177	c.130G>T	c.(130-132)GCC>TCC	p.A44S		NM_004421	NP_004412	O14640	DVL1_HUMAN	dishevelled 1	44	DIX.				canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AATTTGTAGGCGTGCACGGGC	0.682													6	45	---	---	---	---	PASS
VWA1	64856	broad.mit.edu	37	1	1372497	1372497	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1372497C>T	uc001afs.2	+	2	484	c.264C>T	c.(262-264)TTC>TTT	p.F88F	VWA1_uc001afr.2_Intron	NM_022834	NP_073745	Q6PCB0	VWA1_HUMAN	von Willebrand factor A domain containing 1	88	VWFA.					basement membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AGTTCCCCTTCGGCCAGCACA	0.682													9	33	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8525994	8525994	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8525994C>T	uc001ape.2	-	12	2004	c.1194G>A	c.(1192-1194)GAG>GAA	p.E398E	RERE_uc001apf.2_Silent_p.E398E|RERE_uc010nzx.1_Silent_p.E130E|RERE_uc001aph.1_Silent_p.E398E	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	398	SANT.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CCACTTCGTCCTCGGTCCAGC	0.582													22	98	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10207138	10207138	+	Missense_Mutation	SNP	G	A	A	rs147329205		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10207138G>A	uc001aqs.3	+	19	3294	c.2581G>A	c.(2581-2583)GCA>ACA	p.A861T	UBE4B_uc001aqr.3_Missense_Mutation_p.A732T|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Missense_Mutation_p.A316T|UBE4B_uc001aqt.1_Missense_Mutation_p.A201T	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	861					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CCTGGACCCCGCATATCCCGA	0.493													8	612	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10328223	10328223	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10328223A>G	uc001aqx.3	+	7	824	c.622A>G	c.(622-624)ACA>GCA	p.T208A	KIF1B_uc001aqv.3_Missense_Mutation_p.T208A|KIF1B_uc001aqw.3_Missense_Mutation_p.T208A|KIF1B_uc001aqy.2_Missense_Mutation_p.T208A|KIF1B_uc001aqz.2_Missense_Mutation_p.T208A|KIF1B_uc001ara.2_Missense_Mutation_p.T208A|KIF1B_uc001arb.2_Missense_Mutation_p.T208A|KIF1B_uc009vmt.2_RNA	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	208	Kinesin-motor.				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGTGGCAGCTACAAACATGAA	0.423													3	30	---	---	---	---	PASS
CELA2A	63036	broad.mit.edu	37	1	15788132	15788132	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15788132T>A	uc001awk.2	+	3	232	c.206T>A	c.(205-207)CTG>CAG	p.L69Q		NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein	69	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						AGCTGGGTCCTGACGGCTGCC	0.602													46	138	---	---	---	---	PASS
HSPB7	27129	broad.mit.edu	37	1	16342218	16342218	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16342218G>C	uc001axo.2	-	3	1197	c.370C>G	c.(370-372)CAC>GAC	p.H124D	HSPB7_uc001axp.2_Missense_Mutation_p.H207D|HSPB7_uc001axq.2_Missense_Mutation_p.H216D|HSPB7_uc001axr.2_Missense_Mutation_p.H217D|HSPB7_uc001axs.2_Missense_Mutation_p.H199D	NM_014424	NP_055239	Q9UBY9	HSPB7_HUMAN	cardiovascular heat shock protein	124					regulation of heart contraction|response to heat|response to unfolded protein	Cajal body	protein C-terminus binding				0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCACTTGTGAGCGAAGGTG	0.672													20	73	---	---	---	---	PASS
LDLRAD2	401944	broad.mit.edu	37	1	22142441	22142441	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22142441T>G	uc001bfg.1	+	3	704	c.517T>G	c.(517-519)TGT>GGT	p.C173G		NM_001013693	NP_001013715	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain	173	Extracellular (Potential).|LDL-receptor class A.					integral to membrane	receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		CTCAGGACCTTGTGGTGCCTA	0.627													32	137	---	---	---	---	PASS
XKR8	55113	broad.mit.edu	37	1	28293671	28293671	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28293671C>T	uc001bph.1	+	3	1225	c.1148C>T	c.(1147-1149)CCC>CTC	p.P383L		NM_018053	NP_060523	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related	383						integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		AAGTTTTTCCCCAAGGCTAAG	0.567													24	131	---	---	---	---	PASS
KCNQ4	9132	broad.mit.edu	37	1	41303990	41303990	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41303990C>A	uc001cgh.1	+	14	1965	c.1883C>A	c.(1882-1884)TCC>TAC	p.S628Y	KCNQ4_uc001cgi.1_Missense_Mutation_p.S574Y	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	628	|Cytoplasmic.|A-domain (Tetramerization).				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			CAGGTGCAGTCCATCGAGCAC	0.721													50	153	---	---	---	---	PASS
KCNQ4	9132	broad.mit.edu	37	1	41303991	41303991	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41303991C>T	uc001cgh.1	+	14	1966	c.1884C>T	c.(1882-1884)TCC>TCT	p.S628S	KCNQ4_uc001cgi.1_Silent_p.S574S	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	628	|Cytoplasmic.|A-domain (Tetramerization).				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			AGGTGCAGTCCATCGAGCACA	0.726													50	157	---	---	---	---	PASS
C1orf210	149466	broad.mit.edu	37	1	43748952	43748952	+	Translation_Start_Site	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43748952G>C	uc001cit.3	-	2	224	c.-10C>G	c.(-12--8)ATCAG>ATGAG			NM_182517	NP_872323	Q8IVY1	CA210_HUMAN	hypothetical protein LOC149466							integral to membrane					0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGAGGGGCCTGATGACACCAG	0.577													19	82	---	---	---	---	PASS
MAST2	23139	broad.mit.edu	37	1	46489553	46489553	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46489553C>T	uc001cov.2	+	15	1964	c.1681C>T	c.(1681-1683)CGT>TGT	p.R561C	MAST2_uc001cow.2_Missense_Mutation_p.R561C|MAST2_uc001coy.1_Missense_Mutation_p.R235C|MAST2_uc001coz.1_Missense_Mutation_p.R446C|MAST2_uc009vya.2_Missense_Mutation_p.R483C|MAST2_uc001cpa.2_RNA	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	561	Protein kinase.				regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CTTCGTGGAGCGTGACATACT	0.537													43	83	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52704579	52704579	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52704579C>G	uc001cto.2	+	4	1662	c.1490C>G	c.(1489-1491)TCC>TGC	p.S497C	ZFYVE9_uc001ctn.2_Missense_Mutation_p.S497C|ZFYVE9_uc001ctp.2_Missense_Mutation_p.S497C	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	497					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						ACTTTACCCTCCAAAGAAGAT	0.383													51	132	---	---	---	---	PASS
LEPROT	54741	broad.mit.edu	37	1	65897503	65897503	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65897503C>A	uc001dcf.2	+	4	386	c.297C>A	c.(295-297)TGC>TGA	p.C99*	LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc001dci.2_Intron|LEPR_uc009waq.2_Intron|LEPROT_uc009wap.2_Nonsense_Mutation_p.C108*	NM_017526	NP_059996	O15243	OBRG_HUMAN	leptin receptor gene-related protein	99						endosome membrane|Golgi membrane|integral to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		GGGGAGCCTGCGGCCTTGTGT	0.398													32	68	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75037713	75037713	+	Silent	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037713C>G	uc001dgg.2	-	14	3900	c.3681G>C	c.(3679-3681)GTG>GTC	p.V1227V		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1227	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CAGGGGCCTGCACCTTTCCTG	0.632													25	79	---	---	---	---	PASS
C1orf88	128344	broad.mit.edu	37	1	111892811	111892811	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111892811T>A	uc001eaw.2	+	5	553	c.473T>A	c.(472-474)GTT>GAT	p.V158D	C1orf88_uc001eax.2_Missense_Mutation_p.V125D|C1orf88_uc009wge.1_Silent_p.G81G|C1orf88_uc001eay.2_Missense_Mutation_p.V71D	NM_181643	NP_857594	Q8TCI5	CA088_HUMAN	hypothetical protein LOC128344	158										ovary(1)|skin(1)	2		all_cancers(81;3.21e-05)|all_epithelial(167;1.19e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|Colorectal(144;0.0301)|all cancers(265;0.0677)|Epithelial(280;0.0897)|COAD - Colon adenocarcinoma(174;0.116)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGGGCTCAGGTTCCATGTCTA	0.398													69	242	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156618367	156618367	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156618367G>T	uc001fpp.2	+	6	1113	c.777G>T	c.(775-777)CTG>CTT	p.L259L	BCAN_uc001fpo.2_Silent_p.L259L	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	259	Link 2.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGAGAACTGTTCCTGGGTG	0.338													48	179	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157668205	157668205	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157668205G>C	uc001frb.2	-	4	559	c.267C>G	c.(265-267)CTC>CTG	p.L89L	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.L89L|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'Flank|FCRL3_uc001frc.1_Silent_p.L89L	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	89	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					CGGCATCACTGAGGGAGGATC	0.463													49	289	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157765972	157765972	+	Intron	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157765972G>C	uc001frg.2	-						FCRL1_uc001frf.2_Intron|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGGAAGCAAAGATTAGGACTA	0.453													22	112	---	---	---	---	PASS
CRP	1401	broad.mit.edu	37	1	159683350	159683350	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159683350C>A	uc001ftw.2	-	2	744	c.640G>T	c.(640-642)GGC>TGC	p.G214C	CRP_uc001ftx.1_Missense_Mutation_p.G81C|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	214	Pentaxin.				acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	AACACTTCGCCTTGCACTTCA	0.557													46	134	---	---	---	---	PASS
DCAF8	50717	broad.mit.edu	37	1	160209783	160209783	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160209783C>A	uc001fvo.2	-	4	739	c.427G>T	c.(427-429)GAA>TAA	p.E143*	DCAF8_uc001fvn.2_Nonsense_Mutation_p.E143*|DCAF8_uc009wth.2_Nonsense_Mutation_p.E143*|DCAF8_uc010pjb.1_Nonsense_Mutation_p.E143*|DCAF8_uc010pjc.1_Nonsense_Mutation_p.E297*|DCAF8_uc001fvq.3_Nonsense_Mutation_p.E143*|DCAF8_uc001fvp.3_Nonsense_Mutation_p.E143*|uc010pjd.1_3'UTR	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	143						CUL4 RING ubiquitin ligase complex	protein binding			skin(2)	2						GCTGATGTTTCTGAGGACACC	0.607													47	151	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161162001	161162001	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161162001G>C	uc001fyt.3	-	8	2369	c.1941C>G	c.(1939-1941)GAC>GAG	p.D647E		NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	647	Cys-rich.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCGAGGAGCTGTCCGGGGAAC	0.532											OREG0013940	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	176	---	---	---	---	PASS
C1orf110	339512	broad.mit.edu	37	1	162824578	162824578	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162824578G>T	uc001gck.2	-	4	1061	c.886C>A	c.(886-888)CCT>ACT	p.P296T	C1orf110_uc009wuw.1_Intron|C1orf110_uc009wux.1_Missense_Mutation_p.P295T	NM_178550	NP_848645	Q86UF4	CA110_HUMAN	hypothetical protein LOC339512	296											0						AACTTAGAAGGCACCCTGTTT	0.438													61	118	---	---	---	---	PASS
DPT	1805	broad.mit.edu	37	1	168698286	168698286	+	Silent	SNP	G	T	T	rs147889127		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168698286G>T	uc001gfp.2	-	1	143	c.127C>A	c.(127-129)CGG>AGG	p.R43R		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	43	2 X 53-55 AA tandem repeats.|1-1.				cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					AAGCCTTGCCGGTTCAAATTC	0.542													29	120	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169952476	169952476	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169952476G>A	uc001ggv.2	-	13	1712	c.1441C>T	c.(1441-1443)CCA>TCA	p.P481S	KIFAP3_uc010plx.1_Missense_Mutation_p.P183S	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	481					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATCAGCAATGGATCCTTAAAC	0.333													44	46	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179380308	179380308	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179380308T>A	uc001gmo.2	+	12	1264	c.1137T>A	c.(1135-1137)TAT>TAA	p.Y379*	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_Nonsense_Mutation_p.Y167*|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Nonsense_Mutation_p.Y379*	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	379	Potential.										0						ATGACTTATATACATTACAAA	0.284													48	135	---	---	---	---	PASS
NPHS2	7827	broad.mit.edu	37	1	179520317	179520317	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179520317G>T	uc001gmq.3	-	8	1228	c.1143C>A	c.(1141-1143)CCC>CCA	p.P381P	C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmo.2_Intron|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_Intron|NPHS2_uc009wxi.2_Silent_p.P313P|C1orf125_uc001gmr.2_RNA	NM_014625	NP_055440	Q9NP85	PODO_HUMAN	podocin	381	Cytoplasmic (Potential).				excretion	integral to plasma membrane	protein binding				0						CCTATAACATGGGAGAGTCTT	0.498													19	75	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185878584	185878584	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185878584A>T	uc001grq.1	+	5	966	c.737A>T	c.(736-738)GAG>GTG	p.E246V		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	246					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AGCCTGAAAGAGGTCACTGTG	0.388													27	106	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276615	186276615	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276615T>C	uc001gru.3	+	7	1815	c.1764T>C	c.(1762-1764)ACT>ACC	p.T588T	PRG4_uc001grt.3_Silent_p.T547T|PRG4_uc009wyl.2_Silent_p.T495T|PRG4_uc009wym.2_Silent_p.T454T|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	588	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|31.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CACCCACCACTCCCAAGGAAC	0.652													7	95	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197021954	197021954	+	Silent	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197021954A>G	uc001gtt.1	-	9	1409	c.1365T>C	c.(1363-1365)ACT>ACC	p.T455T		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	455	Sushi 8.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						CCACATTAACAGTACATGGTT	0.264													13	45	---	---	---	---	PASS
VASH2	79805	broad.mit.edu	37	1	213147329	213147329	+	Silent	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213147329C>A	uc001hjy.2	+	6	1116	c.912C>A	c.(910-912)ACC>ACA	p.T304T	VASH2_uc001hjv.2_RNA|VASH2_uc001hjx.2_Silent_p.T239T|VASH2_uc010ptn.1_Silent_p.T200T|VASH2_uc001hjw.2_Silent_p.T260T	NM_001136475	NP_001129947	Q86V25	VASH2_HUMAN	vasohibin 2 isoform 3	304					positive regulation of angiogenesis|positive regulation of endothelial cell proliferation	cytoplasm					0				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)		ACTCTCCGACCCAAGTGAGAA	0.567													15	45	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216011388	216011388	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216011388C>A	uc001hku.1	-	47	9703	c.9316G>T	c.(9316-9318)GTG>TTG	p.V3106L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3106	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGTCTTCCACAGTGGTAATT	0.373										HNSCC(13;0.011)			65	185	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223567978	223567978	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223567978G>C	uc001hoa.2	+	1	1264	c.1161G>C	c.(1159-1161)CGG>CGC	p.R387R		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	387	Potential.									central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		AGATGCTACGGAACCTCCGGG	0.662													13	29	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237919660	237919660	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237919660G>A	uc001hyl.1	+	81	11338	c.11218G>A	c.(11218-11220)GTG>ATG	p.V3740M	RYR2_uc010pya.1_Missense_Mutation_p.V155M	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3740					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGCTGAGATGGTGCTACAGAC	0.483													16	39	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371821	240371821	+	Silent	SNP	C	T	T	rs111521184	byFrequency	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371821C>T	uc010pyd.1	+	5	3934	c.3709C>T	c.(3709-3711)CTG>TTG	p.L1237L	FMN2_uc010pye.1_Silent_p.L1241L	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1237	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ACCGCCCCCTCTGCTTCCTGT	0.602													19	53	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241146382	241146382	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241146382G>C	uc001hyv.2	-	4	553	c.223C>G	c.(223-225)CCA>GCA	p.P75A	RGS7_uc010pyh.1_Missense_Mutation_p.P49A|RGS7_uc010pyj.1_Translation_Start_Site|RGS7_uc001hyu.2_Missense_Mutation_p.P75A|RGS7_uc009xgn.1_Missense_Mutation_p.P75A|RGS7_uc001hyw.2_Missense_Mutation_p.P75A	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	75	DEP.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TATTTACCTGGATCTTCTATA	0.299													8	15	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15770167	15770167	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15770167G>T	uc002rce.2	+	25	2313	c.2025G>T	c.(2023-2025)CCG>CCT	p.P675P		NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	675	Helicase C-terminal.|Necessary for interaction with HNRNPK.				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		AGGTTGAGCCGGATATAAAGG	0.343													74	187	---	---	---	---	PASS
FAM49A	81553	broad.mit.edu	37	2	16740833	16740833	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16740833C>T	uc010exm.1	-	9	880	c.732G>A	c.(730-732)ACG>ACA	p.T244T	FAM49A_uc002rck.1_Silent_p.T244T	NM_030797	NP_110424	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	244						intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			TCTCTTCACTCGTAAACCTAC	0.493													49	226	---	---	---	---	PASS
C2orf44	80304	broad.mit.edu	37	2	24261359	24261359	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24261359T>C	uc002rep.2	-	2	1137	c.1006A>G	c.(1006-1008)ATT>GTT	p.I336V	C2orf44_uc010eya.2_Missense_Mutation_p.I336V	NM_025203	NP_079479	Q9H6R7	CB044_HUMAN	hypothetical protein LOC80304 isoform 1	336							protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGCCTGGAATAGTGACTTTT	0.403													82	155	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25965964	25965964	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25965964G>A	uc002rgs.2	-	12	3463	c.3242C>T	c.(3241-3243)TCA>TTA	p.S1081L	ASXL2_uc002rgt.1_Intron	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1081					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGCACAACTGAGAGAAGATT	0.502													90	330	---	---	---	---	PASS
KCNK12	56660	broad.mit.edu	37	2	47748348	47748348	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47748348G>T	uc002rwb.2	-	2	991	c.991C>A	c.(991-993)CGG>AGG	p.R331R	MSH2_uc002rvz.2_Intron	NM_022055	NP_071338	Q9HB15	KCNKC_HUMAN	potassium channel, subfamily K, member 12	331	Cytoplasmic (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_hematologic(82;0.0495)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCATTGCGCCGGGCCAGGGGC	0.756													6	12	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50847250	50847250	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50847250A>T	uc010fbq.2	-	8	2827	c.1350T>A	c.(1348-1350)TCT>TCA	p.S450S	NRXN1_uc002rxb.3_Silent_p.S82S|NRXN1_uc002rxe.3_Silent_p.S410S|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AAAAGTCATCAGACCCCAGCA	0.473													17	80	---	---	---	---	PASS
TMEM17	200728	broad.mit.edu	37	2	62733230	62733230	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62733230C>G	uc002sbt.2	-	1	375	c.35G>C	c.(34-36)GGA>GCA	p.G12A	TMEM17_uc002sbu.2_Missense_Mutation_p.G12A|TMEM17_uc002sbv.1_Intron	NM_198276	NP_938017	Q86X19	TMM17_HUMAN	transmembrane protein 17	12						integral to membrane					0	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			GCTGAAGTTTCCCAGCCGCTG	0.677													4	10	---	---	---	---	PASS
C2orf3	6936	broad.mit.edu	37	2	75899136	75899136	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75899136T>C	uc002sno.2	-	14	2026	c.1896A>G	c.(1894-1896)GTA>GTG	p.V632V	C2orf3_uc010ffs.2_Silent_p.V194V|C2orf3_uc002snn.2_Silent_p.V463V|C2orf3_uc010fft.2_Silent_p.V307V	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936	632					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						TTTTGTTTTCTACAGCACTAA	0.343													32	89	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80530588	80530588	+	Silent	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530588C>A	uc002sok.1	-	2	627	c.357G>T	c.(355-357)ACG>ACT	p.T119T	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	119	LRR 2.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						TGGAACTCAGCGTGAGTTCCT	0.587										HNSCC(69;0.2)			64	233	---	---	---	---	PASS
KCMF1	56888	broad.mit.edu	37	2	85273227	85273227	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85273227G>C	uc002sox.3	+	5	771	c.427G>C	c.(427-429)GAT>CAT	p.D143H		NM_020122	NP_064507	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	143						intracellular	ligase activity|zinc ion binding			ovary(2)	2						TTTGGGTTATGATGAATCGAG	0.403													9	43	---	---	---	---	PASS
SFTPB	6439	broad.mit.edu	37	2	85890958	85890958	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85890958C>G	uc002sqh.2	-	7	691	c.685G>C	c.(685-687)GTG>CTG	p.V229L	SFTPB_uc002sqi.2_Missense_Mutation_p.V241L|SFTPB_uc002sqj.2_Missense_Mutation_p.V229L|SFTPB_uc010ysw.1_5'Flank	NM_198843	NP_942140	P07988	PSPB_HUMAN	surfactant, pulmonary-associated protein B	229	Saposin B-type 2.				organ morphogenesis|respiratory gaseous exchange|sphingolipid metabolic process	extracellular space|lysosome				ovary(1)|central_nervous_system(1)	2						GCCACTGCCACAGCTAGCGCA	0.517													2	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89265834	89265834	+	RNA	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89265834G>T	uc010ytr.1	-	95		c.7732C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TCAGGCTGCAGGCTGCTGATG	0.483													71	272	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89265835	89265835	+	RNA	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89265835G>T	uc010ytr.1	-	95		c.7731C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		CAGGCTGCAGGCTGCTGATGG	0.488													69	275	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89326822	89326822	+	RNA	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89326822G>T	uc010ytr.1	-	68		c.6356C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GAGGAGCCTGGGAGCCTGGCC	0.577													34	86	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96949346	96949346	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96949346G>A	uc002svu.2	-	33	4776	c.4690C>T	c.(4690-4692)CCG>TCG	p.P1564S	SNRNP200_uc002svt.2_Missense_Mutation_p.P174S|SNRNP200_uc010yuj.1_RNA|SNRNP200_uc002svv.1_Missense_Mutation_p.P91S	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1564	Helicase C-terminal 2.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TTGCGAGACGGCACAAAGACA	0.582													5	275	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100906846	100906846	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100906846G>A	uc002tal.3	-	10	2434	c.1794C>T	c.(1792-1794)GAC>GAT	p.D598D	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	598	Lon.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						ACGTTCTCACGTCCTTAATCT	0.478													55	566	---	---	---	---	PASS
SLC9A4	389015	broad.mit.edu	37	2	103121941	103121941	+	Intron	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103121941G>C	uc002tbz.3	+							NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GTAAGAGACGGCAGGGCTCCA	0.517													13	97	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118693071	118693071	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118693071C>A	uc002tlj.2	-	22	1854	c.1728G>T	c.(1726-1728)AAG>AAT	p.K576N		NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	576	Potential.									large_intestine(1)|ovary(1)	2						GCCATCTGACCTTCATTCTAC	0.498													38	83	---	---	---	---	PASS
INSIG2	51141	broad.mit.edu	37	2	118860889	118860889	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118860889G>T	uc002tlk.2	+	3	567	c.361G>T	c.(361-363)GCC>TCC	p.A121S	INSIG2_uc010yye.1_Missense_Mutation_p.A13S|INSIG2_uc002tll.2_Missense_Mutation_p.A13S	NM_016133	NP_057217	Q9Y5U4	INSI2_HUMAN	insulin induced protein 2	121					ER-nuclear sterol response pathway	SREBP-SCAP-Insig complex				ovary(1)|central_nervous_system(1)	2						TATAAATCATGCCAGTGCTGT	0.398													51	262	---	---	---	---	PASS
C2orf76	130355	broad.mit.edu	37	2	120069255	120069255	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120069255C>A	uc002tls.2	-	6	788	c.247G>T	c.(247-249)GAA>TAA	p.E83*	C2orf76_uc010flf.1_Nonsense_Mutation_p.E83*|C2orf76_uc010yyg.1_RNA|C2orf76_uc002tlt.2_Nonsense_Mutation_p.E83*|C2orf76_uc002tlu.2_Nonsense_Mutation_p.E83*	NM_001017927	NP_001017927	Q3KRA6	CB076_HUMAN	hypothetical protein LOC130355	83											0						TCGTCATCTTCCAAACTCAAC	0.443													28	86	---	---	---	---	PASS
CYP27C1	339761	broad.mit.edu	37	2	127956949	127956949	+	Intron	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127956949C>A	uc002tod.2	-							NM_001001665	NP_001001665	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C,							membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		CCCCCAGACTCACCGTGTCGA	0.537													28	185	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130877689	130877689	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130877689G>C	uc010fmh.2	-	3	800	c.400C>G	c.(400-402)CAC>GAC	p.H134D		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	134						cell cortex	ATP binding			skin(3)|ovary(2)	5						CCACGGACGTGGTACCTGGGC	0.592													64	131	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	131976375	131976375	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131976375C>G	uc002tsn.2	+	1	452	c.400C>G	c.(400-402)CAC>GAC	p.H134D	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	134							ATP binding				0						GCCCAGGTACCACGTCCGTGG	0.602													14	277	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152300042	152300042	+	Splice_Site	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152300042G>T	uc002txm.2	+	18	1936	c.1806_splice	c.e18-1	p.R602_splice	RIF1_uc002txl.2_Splice_Site_p.R602_splice|RIF1_uc010fnv.1_Splice_Site_p.R566_splice|RIF1_uc002txn.2_Splice_Site_p.R602_splice|RIF1_uc002txo.2_Splice_Site_p.R602_splice	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TTTTTGTTCAGGTTCTTTCTC	0.284													76	184	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160698800	160698800	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160698800G>A	uc002ubc.3	-	24	3305	c.3236C>T	c.(3235-3237)TCC>TTC	p.S1079F	LY75_uc002ubb.3_Missense_Mutation_p.S1079F|LY75_uc010fos.2_Missense_Mutation_p.S1079F	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	1079	Extracellular (Potential).|C-type lectin 6.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TTCACTGCAGGATGTAAAATT	0.363													24	63	---	---	---	---	PASS
PSMD14	10213	broad.mit.edu	37	2	162224035	162224035	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162224035A>G	uc002ubu.2	+	4	562	c.95A>G	c.(94-96)TAT>TGT	p.Y32C		NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14	32	MPN.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						GAACAAGTCTATATCTCTTCC	0.358													6	11	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166915199	166915199	+	Splice_Site	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166915199C>A	uc010zcz.1	-	2	283	c.265_splice	c.e2-1	p.T89_splice	SCN1A_uc002udo.3_5'Flank|SCN1A_uc010fpk.2_5'Flank	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CTATAAAAGTCTGTAAGACAG	0.343													11	33	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179633453	179633453	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179633453T>C	uc010zfg.1	-	38	9334	c.9110A>G	c.(9109-9111)GAC>GGC	p.D3037G	TTN_uc010zfh.1_Missense_Mutation_p.D2991G|TTN_uc010zfi.1_Missense_Mutation_p.D2991G|TTN_uc010zfj.1_Missense_Mutation_p.D2991G|TTN_uc002unb.2_Missense_Mutation_p.D3037G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	3037							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAGGTGTAGTCAGCAGCATC	0.408													11	40	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198950210	198950210	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198950210C>A	uc010fsp.2	+	2	2260	c.1969C>A	c.(1969-1971)CAG>AAG	p.Q657K	PLCL1_uc002uuv.3_Missense_Mutation_p.Q578K	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	657	PI-PLC Y-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	CTTGAATCCACAGGACTTTTG	0.418													29	72	---	---	---	---	PASS
STRADB	55437	broad.mit.edu	37	2	202337718	202337718	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202337718G>A	uc002uyd.3	+	5	599	c.234G>A	c.(232-234)CGG>CGA	p.R78R		NM_018571	NP_061041	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	78	Protein kinase.				activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|protein binding|protein kinase activity			skin(2)|stomach(1)|lung(1)	4						ATCTTGCACGGCATACTCCCA	0.323													5	449	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	214727276	214727276	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214727276G>T	uc002veq.2	+	11	1230	c.1138G>T	c.(1138-1140)GGC>TGC	p.G380C	SPAG16_uc010fuz.1_Missense_Mutation_p.G231C|SPAG16_uc002ver.2_Missense_Mutation_p.G326C|SPAG16_uc010zjk.1_Missense_Mutation_p.G286C	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	380	WD 1.				cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GAAGGTGTTGGGCCTTCCAAA	0.532													26	105	---	---	---	---	PASS
VWC2L	402117	broad.mit.edu	37	2	215279254	215279254	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215279254A>G	uc002vet.2	+	2	467	c.337A>G	c.(337-339)AAA>GAA	p.K113E	VWC2L_uc010zjl.1_Missense_Mutation_p.K113E	NM_001080500	NP_001073969	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain-containing	113						extracellular region					0						CAAAGAAGTAAAAAACTTCTG	0.373													9	36	---	---	---	---	PASS
CYP27A1	1593	broad.mit.edu	37	2	219679732	219679732	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219679732G>A	uc002viz.3	+	9	2009	c.1575G>A	c.(1573-1575)CAG>CAA	p.Q525Q		NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,	525					bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	TGGGCCTGCAGTTCCTGCAGA	0.592													42	65	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241710530	241710530	+	Intron	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241710530A>G	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CACTGTGGAGAGAGGGTCAGG	0.632													16	88	---	---	---	---	PASS
HDLBP	3069	broad.mit.edu	37	2	242192429	242192429	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242192429C>T	uc002waz.2	-	11	1543	c.1315G>A	c.(1315-1317)GAG>AAG	p.E439K	HDLBP_uc002wba.2_Missense_Mutation_p.E439K|HDLBP_uc002wbb.2_Missense_Mutation_p.E391K	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	439	KH 4.				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		ATGTTGATCTCCACATAGTCC	0.562													55	186	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	361468	361468	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:361468G>T	uc003bou.2	+	3	280	c.9G>T	c.(7-9)CCG>CCT	p.P3P	CHL1_uc003bot.2_Silent_p.P3P|CHL1_uc003bow.1_Silent_p.P3P|CHL1_uc011asi.1_Silent_p.P3P	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	3					axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		p.P3S(1)		skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CAATGGAGCCGCTTTTACTTG	0.373													12	17	---	---	---	---	PASS
CHL1	10752	broad.mit.edu	37	3	431056	431056	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:431056C>G	uc003bou.2	+	19	2592	c.2321C>G	c.(2320-2322)ACG>AGG	p.T774R	CHL1_uc003bot.2_Missense_Mutation_p.T790R|CHL1_uc003bow.1_Missense_Mutation_p.T774R|CHL1_uc011asi.1_Missense_Mutation_p.T790R	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	774	Fibronectin type-III 2.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CGGGTGATGACGCCTGCTGTC	0.438													34	38	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7620396	7620396	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7620396G>A	uc003bqm.2	+	8	2077	c.1803G>A	c.(1801-1803)GGG>GGA	p.G601G	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Silent_p.G601G|GRM7_uc003bql.2_Silent_p.G601G|GRM7_uc003bqn.1_Silent_p.G184G|GRM7_uc010hch.1_Silent_p.G112G	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	601	Helical; Name=1; (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	CAATGTTGGGGATCATTGCCA	0.532													86	123	---	---	---	---	PASS
KIF9	64147	broad.mit.edu	37	3	47286396	47286396	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47286396C>T	uc010hjp.2	-	16	2003	c.1399G>A	c.(1399-1401)GAT>AAT	p.D467N	KIF9_uc003cqx.2_Missense_Mutation_p.D467N|KIF9_uc003cqy.2_Missense_Mutation_p.D467N|KIF9_uc011bat.1_RNA	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2	467					blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		AGGTGGCCATCAACATCCACA	0.527													18	35	---	---	---	---	PASS
ITIH3	3699	broad.mit.edu	37	3	52829632	52829632	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52829632C>G	uc003dfv.2	+	2	143	c.107C>G	c.(106-108)CCG>CGG	p.P36R	ITIH3_uc011bek.1_Missense_Mutation_p.P36R	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	36	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CGGAGCCTCCCGGAAGGGGTA	0.567													6	40	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89498436	89498436	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89498436C>T	uc003dqy.2	+	14	2633	c.2408C>T	c.(2407-2409)TCA>TTA	p.S803L	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	803	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AAGTTCACGTCAGCCAGCGAT	0.443										TSP Lung(6;0.00050)			82	266	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108270104	108270104	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108270104C>A	uc003dxb.3	-	21	2879	c.2610G>T	c.(2608-2610)TTG>TTT	p.L870F		NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	870	Potential.					cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						GAAGTTTCACCAAGGACTCTT	0.428													14	62	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955261	113955261	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955261C>A	uc010hqo.2	-	1	1165	c.661G>T	c.(661-663)GAA>TAA	p.E221*	ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80	221	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TTCCCACATTCTTTGCACTCG	0.483													70	292	---	---	---	---	PASS
IQCB1	9657	broad.mit.edu	37	3	121518141	121518141	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121518141C>T	uc010hre.1	-	8	883	c.668G>A	c.(667-669)AGT>AAT	p.S223N	IQCB1_uc003eek.2_Intron|IQCB1_uc010hrf.1_RNA	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a	223					cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		TATAACTGGACTAGGAGTTGA	0.333													10	55	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	122003471	122003471	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122003471C>T	uc003eev.3	+	7	3042	c.2670C>T	c.(2668-2670)CGC>CGT	p.R890R	CASR_uc003eew.3_Silent_p.R900R	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	890	Cytoplasmic (Potential).|Interaction with RNF19A.				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCACGCTGCGCCGCAGCAACG	0.627													24	52	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	122003473	122003473	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122003473G>C	uc003eev.3	+	7	3044	c.2672G>C	c.(2671-2673)CGC>CCC	p.R891P	CASR_uc003eew.3_Missense_Mutation_p.R901P	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	891	Cytoplasmic (Potential).|Interaction with RNF19A.				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	ACGCTGCGCCGCAGCAACGTC	0.627													26	50	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124732636	124732636	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124732636G>A	uc003ehs.3	-	6	1855	c.1787C>T	c.(1786-1788)TCA>TTA	p.S596L	HEG1_uc011bke.1_Missense_Mutation_p.S696L	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	596	Extracellular (Potential).|Ser-rich.					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						GGAATACTCTGAATGTGAAGA	0.418													26	104	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128971157	128971157	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128971157C>T	uc003els.2	+	3	224	c.124C>T	c.(124-126)CGG>TGG	p.R42W	COPG_uc010htb.2_5'UTR	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	42					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						CATCAACCCTCGGAAATGTGC	0.453													69	193	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134920518	134920518	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134920518A>T	uc003eqt.2	+	12	2553	c.2333A>T	c.(2332-2334)TAC>TTC	p.Y778F	EPHB1_uc003equ.2_Missense_Mutation_p.Y339F	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	778	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						GATCCCACCTACACCAGCTCC	0.537													26	99	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169546579	169546579	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169546579G>T	uc003fgb.2	+	2	1053	c.1053G>T	c.(1051-1053)CTG>CTT	p.L351L		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	351	LRR 15.										0						TTTCAAAACTGAAGATACTTG	0.373													118	143	---	---	---	---	PASS
NAALADL2	254827	broad.mit.edu	37	3	175042061	175042061	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175042061T>G	uc003fit.2	+	5	1124	c.1037T>G	c.(1036-1038)ATG>AGG	p.M346R	NAALADL2_uc003fiu.1_Missense_Mutation_p.M339R|NAALADL2_uc010hwy.1_Missense_Mutation_p.M168R|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	346	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GATACCTTCATGGTGTCACTG	0.423													104	565	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180366086	180366086	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180366086T>C	uc010hxe.2	-	10	1344	c.1229A>G	c.(1228-1230)CAG>CGG	p.Q410R	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	410	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGTCTCAGTCTGTAACTCCTG	0.333													45	250	---	---	---	---	PASS
KLHL24	54800	broad.mit.edu	37	3	183368731	183368731	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183368731A>T	uc003flv.2	+	3	882	c.587A>T	c.(586-588)GAG>GTG	p.E196V	KLHL24_uc003flw.2_Missense_Mutation_p.E196V|KLHL24_uc003flx.2_Missense_Mutation_p.E196V	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	DRE1 protein	196	BACK.					axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			CAGACTTTTGAGGATGTATCC	0.363													203	233	---	---	---	---	PASS
PARL	55486	broad.mit.edu	37	3	183551362	183551362	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183551362T>G	uc003fmd.2	-	9	1005	c.946A>C	c.(946-948)ATC>CTC	p.I316L	PARL_uc003fme.2_Missense_Mutation_p.I266L	NM_018622	NP_061092	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like isoform 1	316	Helical; (Potential).				proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity				0	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCCATGGCGATAATGGCTTTC	0.453													26	112	---	---	---	---	PASS
ABCC5	10057	broad.mit.edu	37	3	183645225	183645225	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183645225G>T	uc003fmg.2	-	28	4105	c.3940C>A	c.(3940-3942)CAG>AAG	p.Q1314K	ABCC5_uc011bqt.1_Missense_Mutation_p.Q842K|ABCC5_uc010hxl.2_Missense_Mutation_p.Q1271K	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	1314	ABC transporter 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGAGGTAGCTGAGCAATCTAG	0.458													8	82	---	---	---	---	PASS
HTR3D	200909	broad.mit.edu	37	3	183756643	183756643	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183756643G>T	uc011bqv.1	+	8	1245	c.1245G>T	c.(1243-1245)AAG>AAT	p.K415N	HTR3D_uc003fmj.2_Missense_Mutation_p.K240N|HTR3D_uc011bqu.1_Missense_Mutation_p.K365N|HTR3D_uc010hxp.2_Missense_Mutation_p.K194N	NM_001163646	NP_001157118	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine receptor 3 subunit D isoform	415	Cytoplasmic (Potential).					integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity				0	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGGCCCAGAAGCAGCACTCGG	0.637													50	154	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184580696	184580696	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184580696A>T	uc003fpb.1	+	15	1401	c.1230A>T	c.(1228-1230)TCA>TCT	p.S410S	VPS8_uc010hyd.1_Silent_p.S410S	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	412							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GGATAAATTCACGCACAGTTG	0.438													41	248	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186508180	186508180	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186508180T>C	uc003fqz.2	-	9	1040	c.817A>G	c.(817-819)AAA>GAA	p.K273E	RFC4_uc011bsc.1_Missense_Mutation_p.K273E	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4	273					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CCATCAATTTTCTCAGCTGGT	0.443													35	174	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195475876	195475876	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195475876C>G	uc011bto.1	-	25	16007	c.15547G>C	c.(15547-15549)GTC>CTC	p.V5183L	MUC4_uc010hzq.2_Missense_Mutation_p.V168L|MUC4_uc003fuz.2_Missense_Mutation_p.V909L|MUC4_uc003fva.2_Missense_Mutation_p.V791L|MUC4_uc003fvb.2_Missense_Mutation_p.V827L|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.V827L|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.V791L|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.V875L|MUC4_uc011bti.1_Missense_Mutation_p.V875L|MUC4_uc011btj.1_Missense_Mutation_p.V1052L|MUC4_uc011btk.1_Missense_Mutation_p.V791L|MUC4_uc011btl.1_Missense_Mutation_p.V820L|MUC4_uc011btm.1_Missense_Mutation_p.V1000L|MUC4_uc011btn.1_Missense_Mutation_p.V791L|MUC4_uc003fvo.2_Missense_Mutation_p.V1075L|MUC4_uc003fvp.2_Missense_Mutation_p.V1024L	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	2068					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGCTGTAGACCAGGTCGTAG	0.602													19	103	---	---	---	---	PASS
GABRB1	2560	broad.mit.edu	37	4	47033717	47033717	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47033717G>T	uc003gxh.2	+	1	423	c.49G>T	c.(49-51)GTG>TTG	p.V17L	GABRB1_uc011bze.1_5'UTR|GABRB1_uc011bzd.1_Missense_Mutation_p.V17L|GABRB1_uc010igg.2_RNA	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	17					synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	CTCTTTCCCTGTGATGATTAC	0.338													77	265	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49052819	49052819	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49052819G>C	uc003gyv.2	+	15	2156	c.1974G>C	c.(1972-1974)GTG>GTC	p.V658V	CWH43_uc011bzl.1_Silent_p.V631V	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	658					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						ACCAGAAAGTGGTCATAGACC	0.408													21	85	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55127335	55127335	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55127335G>C	uc003han.3	+	3	454	c.123G>C	c.(121-123)CTG>CTC	p.L41L	PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_Silent_p.L41L|PDGFRA_uc010igq.1_Intron|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	41	Ig-like C2-type 1.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TTGTGCAGCTGAATTCATCCT	0.463			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			87	215	---	---	---	---	PASS
UGT2B4	7363	broad.mit.edu	37	4	70352343	70352343	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70352343G>T	uc003hek.3	-	4	1121	c.1074C>A	c.(1072-1074)CCC>CCA	p.P358P	UGT2B4_uc011cap.1_Silent_p.P222P|UGT2B4_uc003hel.3_Silent_p.P358P	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	358					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						GATCATTCTGGGGTATCCACT	0.338													33	209	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77290599	77290599	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77290599G>A	uc003hkb.3	-	10	1480	c.1327C>T	c.(1327-1329)CAG>TAG	p.Q443*		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	443	Potential.									skin(3)|ovary(2)|pancreas(1)	6						ATCTGGCCCTGACACTCGCTC	0.542													25	90	---	---	---	---	PASS
BMP3	651	broad.mit.edu	37	4	81967617	81967617	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81967617A>T	uc003hmg.3	+	2	1362	c.1042A>T	c.(1042-1044)ACG>TCG	p.T348S		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	348					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						GAAGAGCCAGACGCTCCAATT	0.493													16	59	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85722798	85722798	+	Intron	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85722798C>A	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGAAAGAGAACTTACCTCAAC	0.448													64	176	---	---	---	---	PASS
C4orf17	84103	broad.mit.edu	37	4	100460363	100460363	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100460363G>A	uc003huw.2	+	7	995	c.672G>A	c.(670-672)GAG>GAA	p.E224E	C4orf17_uc003hux.2_RNA	NM_032149	NP_115525	Q53FE4	CD017_HUMAN	hypothetical protein LOC84103	224											0				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		AGCTTGCCGAGATAAACCTGT	0.438													97	205	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114267166	114267166	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114267166G>C	uc003ibe.3	+	35	4459	c.4359G>C	c.(4357-4359)CCG>CCC	p.P1453P	ANK2_uc003ibd.3_Silent_p.P1444P|ANK2_uc003ibf.3_Silent_p.P1453P|ANK2_uc011cgc.1_Silent_p.P629P|ANK2_uc003ibg.3_Silent_p.P448P|ANK2_uc003ibh.3_Silent_p.P127P|ANK2_uc011cgb.1_Silent_p.P1468P	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1420					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCACTTTGCCGATTTATACAA	0.373													34	72	---	---	---	---	PASS
EXOSC9	5393	broad.mit.edu	37	4	122722986	122722986	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122722986T>G	uc003iea.2	+	2	179	c.71T>G	c.(70-72)CTG>CGG	p.L24R	EXOSC9_uc003idz.2_Missense_Mutation_p.L24R|EXOSC9_uc003ieb.2_Missense_Mutation_p.L8R|EXOSC9_uc010inp.1_5'Flank	NM_005033	NP_005024	Q06265	EXOS9_HUMAN	exosome component 9 isoform 2	24	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0						TTACAGCGGCTGGATGGCAGA	0.259													31	81	---	---	---	---	PASS
HHIP	64399	broad.mit.edu	37	4	145640048	145640048	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145640048G>C	uc003ijs.1	+	11	2355	c.1700G>C	c.(1699-1701)AGC>ACC	p.S567T		NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	567						cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		ATTTTATCAAGCAGTAAAAGT	0.328													26	71	---	---	---	---	PASS
ACCN5	51802	broad.mit.edu	37	4	156757953	156757953	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156757953C>A	uc003ipe.1	-	8	1170	c.1123G>T	c.(1123-1125)GTT>TTT	p.V375F		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	375	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		TCACAAGAAACGGGGCAGCTA	0.363													27	101	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159782811	159782811	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159782811C>G	uc003iqe.3	+	12	1531	c.1348C>G	c.(1348-1350)CCA>GCA	p.P450A		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	450					DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GGCCTGGGTCCCAACTGTCAT	0.473													51	155	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186380094	186380094	+	Missense_Mutation	SNP	C	A	A	rs17853848		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186380094C>A	uc003ixu.3	-	6	1723	c.1647G>T	c.(1645-1647)AAG>AAT	p.K549N	CCDC110_uc003ixv.3_Missense_Mutation_p.K512N|CCDC110_uc011ckt.1_Missense_Mutation_p.K549N	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	549	Potential.					nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTTTGTGTTCCTTACTTTTTA	0.303													11	47	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190878625	190878625	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190878625A>G	uc003izs.2	+	6	696	c.505A>G	c.(505-507)AGT>GGT	p.S169G		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	169					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAAGCAAAAAGTAAAACAGC	0.363													4	131	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9052140	9052140	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9052140T>G	uc003jek.2	-	20	3402	c.2690A>C	c.(2689-2691)GAG>GCG	p.E897A		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	897	Extracellular (Potential).|TSP type-1 7.				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						CGACCAGCTCTCTGCAGAGAC	0.572													9	33	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23524526	23524526	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23524526G>T	uc003jgo.2	+	10	1216	c.1034G>T	c.(1033-1035)CGA>CTA	p.R345L		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	345	SET.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						AGAACCTGCCGAGTCATTAGG	0.552										HNSCC(3;0.000094)			32	57	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26988403	26988403	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26988403G>A	uc003jgs.1	-	2	207	c.38C>T	c.(37-39)ACC>ATC	p.T13I	CDH9_uc010iug.2_Missense_Mutation_p.T13I	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	13					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						GAACATATAGGTCCAGATGAA	0.343													34	155	---	---	---	---	PASS
MTMR12	54545	broad.mit.edu	37	5	32233887	32233887	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32233887G>A	uc003jhq.2	-	15	1836	c.1666C>T	c.(1666-1668)CGC>TGC	p.R556C	MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	556	Myotubularin phosphatase.|Interaction with MTM1.					cytoplasm	phosphatase activity			ovary(1)	1						ACTTTGAAGCGCATTCCTTTC	0.473													6	579	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	36958243	36958243	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36958243G>T	uc003jkl.3	+	4	767	c.268G>T	c.(268-270)GGT>TGT	p.G90C	NIPBL_uc003jkk.3_Missense_Mutation_p.G90C	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	90					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGACCCAGAAGGTGACATACC	0.403													44	157	---	---	---	---	PASS
MRPS30	10884	broad.mit.edu	37	5	44809368	44809368	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44809368G>C	uc003joh.2	+	1	342	c.304G>C	c.(304-306)GCC>CCC	p.A102P	MRPS30_uc003joi.1_5'Flank	NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	102					apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)					CGCGCTGAATGCCGACCGCTG	0.493													21	35	---	---	---	---	PASS
POC5	134359	broad.mit.edu	37	5	75008707	75008707	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75008707C>T	uc003keh.3	-	2	253	c.56G>A	c.(55-57)CGA>CAA	p.R19Q	POC5_uc010izu.2_5'Flank|POC5_uc003keg.3_5'Flank	NM_001099271	NP_001092741	Q8NA72	POC5_HUMAN	proteome of centriole 5 isoform 1	19					cell cycle	centriole				lung(1)	1						AGAACTGCCTCGACTGGAGTC	0.343													6	21	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79028281	79028281	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79028281A>T	uc003kgc.2	+	2	3765	c.3693A>T	c.(3691-3693)CCA>CCT	p.P1231P		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1231						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CTCAGCCTCCAAATGTTCCAG	0.413													13	16	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89913642	89913642	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89913642G>T	uc003kju.2	+	3	325	c.229G>T	c.(229-231)GAC>TAC	p.D77Y	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	77	Extracellular (Potential).|Calx-beta 1.				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGACGCTGGTGACTTTTTTGA	0.378													4	15	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96514781	96514781	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96514781G>C	uc003kmz.2	-	2	293	c.183C>G	c.(181-183)CTC>CTG	p.L61L	RIOK2_uc003kna.3_Silent_p.L61L	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1	61							ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		CCCAAGCTATGAGTTTATGTT	0.318													15	51	---	---	---	---	PASS
FSTL4	23105	broad.mit.edu	37	5	132939579	132939579	+	Silent	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132939579C>A	uc003kyn.1	-	2	314	c.96G>T	c.(94-96)CCG>CCT	p.P32P		NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor	32						extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACCCACATCCGGGCCTCTGC	0.537													53	105	---	---	---	---	PASS
IL9	3578	broad.mit.edu	37	5	135231514	135231514	+	5'UTR	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135231514C>A	uc003lbb.1	-	1						NM_000590	NP_000581	P15248	IL9_HUMAN	interleukin 9 precursor						immune response|inflammatory response|positive regulation of cell proliferation|positive regulation of interleukin-5 biosynthetic process	extracellular space	cytokine activity|cytokine receptor binding|growth factor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ATCTTGACAGCGGACTGGAGC	0.547													3	81	---	---	---	---	PASS
PDE6A	5145	broad.mit.edu	37	5	149324107	149324107	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149324107C>T	uc003lrg.3	-	1	250	c.130G>A	c.(130-132)GTG>ATG	p.V44M		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	44					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CTGAAGTCCACGGCAGCCTCC	0.527													35	39	---	---	---	---	PASS
NDST1	3340	broad.mit.edu	37	5	149901021	149901021	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149901021C>T	uc003lsk.3	+	2	707	c.205C>T	c.(205-207)CCA>TCA	p.P69S	NDST1_uc011dcj.1_Missense_Mutation_p.P69S|NDST1_uc003lsl.2_Missense_Mutation_p.P69S	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	69	Heparan sulfate N-deacetylase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGCCTGCTGCCACTCAAGCC	0.677													17	22	---	---	---	---	PASS
ZNF300	91975	broad.mit.edu	37	5	150276413	150276413	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150276413C>A	uc003lsy.1	-	6	655	c.388G>T	c.(388-390)GGT>TGT	p.G130C	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	130					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGACCATCACCTTGACAGACT	0.428													106	138	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156819909	156819909	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156819909G>A	uc003lwq.2	+	33	3801	c.3663G>A	c.(3661-3663)CTG>CTA	p.L1221L	CYFIP2_uc011ddn.1_Silent_p.L1195L|CYFIP2_uc011ddo.1_Silent_p.L1025L|CYFIP2_uc003lwr.2_Silent_p.L1221L|CYFIP2_uc003lws.2_Silent_p.L1221L|CYFIP2_uc003lwt.2_Silent_p.L1124L|CYFIP2_uc011ddp.1_Silent_p.L955L|CYFIP2_uc003lwv.2_Silent_p.L176L	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	1246					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTGCCATCCTGAACAAATACA	0.517													41	162	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169122822	169122822	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169122822G>T	uc003maf.2	+	10	939	c.859G>T	c.(859-861)GAC>TAC	p.D287Y	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	287					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGAAACAAAGACCTCAACAG	0.418													136	135	---	---	---	---	PASS
CDHR2	54825	broad.mit.edu	37	5	176004648	176004648	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176004648C>A	uc003mem.1	+	14	1427	c.1361C>A	c.(1360-1362)ACA>AAA	p.T454K	CDHR2_uc003men.1_Missense_Mutation_p.T454K	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	454	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						GTTGTGGCCACAGACTCCGTC	0.642													6	37	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176638319	176638319	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176638319G>C	uc003mfr.3	+	5	3057	c.2919G>C	c.(2917-2919)CAG>CAC	p.Q973H	NSD1_uc003mft.3_Missense_Mutation_p.Q704H|NSD1_uc003mfs.1_Missense_Mutation_p.Q870H|NSD1_uc011dfx.1_Missense_Mutation_p.Q621H	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	973					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATGGCACTCAGAACTCCGCCA	0.517			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			62	55	---	---	---	---	PASS
SERPINB9	5272	broad.mit.edu	37	6	2895721	2895721	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2895721G>T	uc003mug.2	-	4	449	c.328C>A	c.(328-330)CAA>AAA	p.Q110K	uc003mue.2_Intron	NM_004155	NP_004146	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B, member 9	110					anti-apoptosis|cellular response to estrogen stimulus|immune response|mast cell mediated immunity|regulation of proteolysis	cytosol|extracellular space|nucleus	caspase inhibitor activity|protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.108)				TGGTAGAATTGAAGACAGGAT	0.403													49	177	---	---	---	---	PASS
SERPINB6	5269	broad.mit.edu	37	6	2948583	2948583	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2948583C>A	uc003muk.2	-	6	3075	c.1080G>T	c.(1078-1080)CAG>CAT	p.Q360H	SERPINB6_uc003mui.2_Missense_Mutation_p.Q243H|SERPINB6_uc003muj.2_RNA|SERPINB6_uc003mul.2_Missense_Mutation_p.Q360H|SERPINB6_uc003mum.2_Missense_Mutation_p.Q360H|SERPINB6_uc003mun.2_Missense_Mutation_p.Q360H|SERPINB6_uc003muo.2_Missense_Mutation_p.Q360H	NM_004568	NP_004559	P35237	SPB6_HUMAN	serine (or cysteine) proteinase inhibitor, clade	360					regulation of proteolysis	centrosome|cytosol|protein complex	protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	TCTTGCTGTGCTGGATGAAGA	0.612													45	163	---	---	---	---	PASS
GFOD1	54438	broad.mit.edu	37	6	13365013	13365013	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13365013C>T	uc003nat.1	-	2	1800	c.1135G>A	c.(1135-1137)GAG>AAG	p.E379K	GFOD1_uc003nas.1_Missense_Mutation_p.E276K	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain	379						extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			CGCATGGCCTCGCTGATCAGG	0.612													35	65	---	---	---	---	PASS
RNF182	221687	broad.mit.edu	37	6	13977868	13977868	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13977868G>A	uc003nbe.2	+	3	936	c.518G>A	c.(517-519)TGC>TAC	p.C173Y	RNF182_uc003nbf.2_Missense_Mutation_p.C173Y|RNF182_uc003nbg.2_Missense_Mutation_p.C173Y	NM_152737	NP_689950	Q8N6D2	RN182_HUMAN	ring finger protein 182	173						cytoplasm|integral to membrane|intracellular membrane-bounded organelle	protein binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			GTGTGGAACTGCACGTCCCTG	0.512													6	477	---	---	---	---	PASS
SCGN	10590	broad.mit.edu	37	6	25670275	25670275	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25670275G>T	uc003nfb.2	+	6	645	c.442G>T	c.(442-444)GCT>TCT	p.A148S	SCGN_uc010jpz.2_Missense_Mutation_p.R57S	NM_006998	NP_008929	O76038	SEGN_HUMAN	secretagogin precursor	148						extracellular region|transport vesicle membrane	calcium ion binding			ovary(2)|pancreas(1)	3						CATTTCTGAGGCTAAACTGGA	0.299													20	461	---	---	---	---	PASS
BTN2A3	54718	broad.mit.edu	37	6	26423164	26423164	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26423164A>T	uc011dkl.1	+	2	113	c.83A>T	c.(82-84)CAG>CTG	p.Q28L	BTN2A3_uc011dkm.1_RNA					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						TGAACAGCCCAGGTCACTGTC	0.512													76	50	---	---	---	---	PASS
SCAND3	114821	broad.mit.edu	37	6	28542544	28542544	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28542544A>T	uc003nlo.2	-	3	2556	c.1938T>A	c.(1936-1938)CTT>CTA	p.L646L		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	646					DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTTCATAGCAAAGGCTACAAG	0.408													8	341	---	---	---	---	PASS
LY6G6C	80740	broad.mit.edu	37	6	31686934	31686934	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31686934G>A	uc003nwh.2	-	3	371	c.317C>T	c.(316-318)CCA>CTA	p.P106L	LY6G6C_uc010jtd.2_RNA	NM_025261	NP_079537	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex G6C precursor	106	UPAR/Ly6.					anchored to membrane|plasma membrane					0						GCCCAGGGCTGGAGTGGGCCG	0.602													172	126	---	---	---	---	PASS
SKIV2L	6499	broad.mit.edu	37	6	31936519	31936519	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31936519C>T	uc003nyn.1	+	25	3515	c.3126C>T	c.(3124-3126)TTC>TTT	p.F1042F	SKIV2L_uc011dou.1_Silent_p.F884F|SKIV2L_uc011dov.1_Silent_p.F849F|STK19_uc003nyt.2_5'Flank	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	1042						nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						GGCTGCGCTTCCTACTGTCGG	0.607													44	147	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33157234	33157234	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33157234A>G	uc003ocx.1	-	2	323	c.95T>C	c.(94-96)GTG>GCG	p.V32A	COL11A2_uc003ocy.1_Missense_Mutation_p.V32A|COL11A2_uc003ocz.1_Missense_Mutation_p.V32A|COL11A2_uc003oda.2_Missense_Mutation_p.V32A	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	32	TSP N-terminal.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						GAGCACATCCACAGGGGGTGC	0.582													32	103	---	---	---	---	PASS
RGL2	5863	broad.mit.edu	37	6	33260956	33260956	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33260956C>T	uc003odv.2	-	16	1977	c.1844G>A	c.(1843-1845)CGC>CAC	p.R615H	RGL2_uc003odu.2_Missense_Mutation_p.R175H|RGL2_uc010jur.2_Missense_Mutation_p.R175H|RGL2_uc003odw.2_Missense_Mutation_p.R533H	NM_004761	NP_004752	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation	615					Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity			skin(3)|lung(1)|breast(1)|pancreas(1)	6						GGCTGAGCGGCGGTGACCTCG	0.662													106	86	---	---	---	---	PASS
SRPK1	6732	broad.mit.edu	37	6	35840405	35840405	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35840405C>T	uc003olj.2	-	8	809	c.686G>A	c.(685-687)CGG>CAG	p.R229Q	SRPK1_uc011dtg.1_Missense_Mutation_p.R213Q|SRPK1_uc003olh.2_Missense_Mutation_p.R122Q|SRPK1_uc003oli.2_Missense_Mutation_p.R122Q	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1	229	Protein kinase.				cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						AGCCAGCCTCCGAATGTACTG	0.458													13	14	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38819450	38819450	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38819450G>T	uc003ooe.1	+	37	5415	c.4815G>T	c.(4813-4815)CAG>CAT	p.Q1605H		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ACACCATACAGGTATAATCTA	0.363													25	55	---	---	---	---	PASS
KCNK5	8645	broad.mit.edu	37	6	39159251	39159251	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39159251G>C	uc003oon.2	-	5	1279	c.915C>G	c.(913-915)ATC>ATG	p.I305M		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	305	Cytoplasmic (Potential).				excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						CGATCTGCTTGATGAGGTCGT	0.627													110	314	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39846265	39846265	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39846265G>C	uc003oow.2	+	13	1602	c.1446G>C	c.(1444-1446)ACG>ACC	p.T482T	DAAM2_uc010jxc.2_Silent_p.T482T|DAAM2_uc003oox.2_Silent_p.T482T	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	482	Potential.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					TGATGCGGACGCTGAACAAAA	0.582													7	10	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50718971	50718971	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50718971C>A	uc003paf.2	+	7	1585	c.1073C>A	c.(1072-1074)CCA>CAA	p.P358Q	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	358	H-S-H (helix-span-helix), dimerization.						DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					GATAGATCACCACTGGGATCC	0.343													26	107	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73100434	73100434	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73100434G>T	uc003pga.2	+	30	4578	c.4501G>T	c.(4501-4503)GGC>TGC	p.G1501C	RIMS1_uc011dyb.1_Missense_Mutation_p.G898C|RIMS1_uc003pgc.2_Missense_Mutation_p.G950C|RIMS1_uc010kaq.2_Missense_Mutation_p.G821C|RIMS1_uc011dyc.1_Missense_Mutation_p.G626C|RIMS1_uc010kar.2_Missense_Mutation_p.G569C|RIMS1_uc011dyd.1_Missense_Mutation_p.G635C|RIMS1_uc003pgf.2_Missense_Mutation_p.G501C|RIMS1_uc003pgg.2_Missense_Mutation_p.G397C|RIMS1_uc003pgi.2_Missense_Mutation_p.G317C|RIMS1_uc003pgh.2_Missense_Mutation_p.G368C|RIMS1_uc003pgd.2_Missense_Mutation_p.G567C|RIMS1_uc003pge.2_Missense_Mutation_p.G541C|RIMS1_uc011dye.1_Missense_Mutation_p.G307C|RIMS1_uc011dyf.1_Missense_Mutation_p.G125C|RIMS1_uc011dyg.1_Missense_Mutation_p.G28C	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1501					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAGCTCTGAGGGCAAGTAAGT	0.488													16	45	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73100435	73100435	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73100435G>T	uc003pga.2	+	30	4579	c.4502G>T	c.(4501-4503)GGC>GTC	p.G1501V	RIMS1_uc011dyb.1_Missense_Mutation_p.G898V|RIMS1_uc003pgc.2_Missense_Mutation_p.G950V|RIMS1_uc010kaq.2_Missense_Mutation_p.G821V|RIMS1_uc011dyc.1_Missense_Mutation_p.G626V|RIMS1_uc010kar.2_Missense_Mutation_p.G569V|RIMS1_uc011dyd.1_Missense_Mutation_p.G635V|RIMS1_uc003pgf.2_Missense_Mutation_p.G501V|RIMS1_uc003pgg.2_Missense_Mutation_p.G397V|RIMS1_uc003pgi.2_Missense_Mutation_p.G317V|RIMS1_uc003pgh.2_Missense_Mutation_p.G368V|RIMS1_uc003pgd.2_Missense_Mutation_p.G567V|RIMS1_uc003pge.2_Missense_Mutation_p.G541V|RIMS1_uc011dye.1_Missense_Mutation_p.G307V|RIMS1_uc011dyf.1_Missense_Mutation_p.G125V|RIMS1_uc011dyg.1_Missense_Mutation_p.G28V	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1501					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGCTCTGAGGGCAAGTAAGTG	0.488													16	45	---	---	---	---	PASS
C6orf165	154313	broad.mit.edu	37	6	88128111	88128111	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88128111G>C	uc003plv.2	+	7	909	c.817G>C	c.(817-819)GAG>CAG	p.E273Q	C6orf165_uc003plw.2_Missense_Mutation_p.E85Q|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Missense_Mutation_p.E273Q	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1	273										central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		ACGACAATATGAGGTCTTCCT	0.403													34	125	---	---	---	---	PASS
ADAT2	134637	broad.mit.edu	37	6	143755110	143755110	+	Silent	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143755110T>A	uc003qjj.2	-	3	256	c.210A>T	c.(208-210)CGA>CGT	p.R70R	ADAT2_uc003qjk.1_RNA	NM_182503	NP_872309	Q7Z6V5	ADAT2_HUMAN	deaminase domain containing 1	70					tRNA processing		hydrolase activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		TTTCTGCATGTCGAGTAGCCT	0.428													60	103	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152651065	152651065	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152651065C>A	uc010kiw.2	-	78	15357	c.14755G>T	c.(14755-14757)GAC>TAC	p.D4919Y	SYNE1_uc003qot.3_Missense_Mutation_p.D4848Y|SYNE1_uc003qou.3_Missense_Mutation_p.D4919Y|SYNE1_uc010kiz.2_Missense_Mutation_p.D674Y	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4919	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTGGATGTCCTGCAGGTTG	0.498										HNSCC(10;0.0054)			96	232	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152730366	152730366	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152730366G>T	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCATGCTGTGGATAAATGAT	0.294										HNSCC(10;0.0054)			32	97	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152730367	152730367	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152730367G>T	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCATGCTGTGGATAAATGATT	0.294										HNSCC(10;0.0054)			30	94	---	---	---	---	PASS
WTAP	9589	broad.mit.edu	37	6	160157288	160157288	+	Splice_Site	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160157288A>T	uc003qsl.2	+	2	215	c.-7_splice	c.e2-2		WTAP_uc010kjx.2_Splice_Site|WTAP_uc003qsk.2_Splice_Site|WTAP_uc003qsm.1_Splice_Site|WTAP_uc003qsn.2_Splice_Site	NM_004906	NP_004897	Q15007	FL2D_HUMAN	Wilms' tumour 1-associating protein isoform 1						cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus					0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		TTTTTTTTTTAGGATTCAAGA	0.318													5	239	---	---	---	---	PASS
PHF10	55274	broad.mit.edu	37	6	170115902	170115902	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170115902A>C	uc011egy.1	-	6	674	c.595T>G	c.(595-597)TAT>GAT	p.Y199D	PHF10_uc011egz.1_Missense_Mutation_p.Y197D|PHF10_uc011eha.1_Missense_Mutation_p.Y50D	NM_018288	NP_060758	Q8WUB8	PHF10_HUMAN	PHD finger protein 10 isoform a	199	SAY.				nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	npBAF complex	zinc ion binding			urinary_tract(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TTCTTAATATACTCAGGCACT	0.353													4	125	---	---	---	---	PASS
SNX8	29886	broad.mit.edu	37	7	2297030	2297030	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2297030G>C	uc003slw.2	-	9	1147	c.1104C>G	c.(1102-1104)TCC>TCG	p.S368S		NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	368					cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		GCTGCTCCACGGACTCCGGCT	0.687													9	33	---	---	---	---	PASS
AMZ1	155185	broad.mit.edu	37	7	2751971	2751971	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2751971A>C	uc003smr.1	+	7	1317	c.956A>C	c.(955-957)TAC>TCC	p.Y319S	AMZ1_uc003sms.1_Silent_p.L262L|AMZ1_uc011jwa.1_Missense_Mutation_p.Y68S	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	319							metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		TAGAGACTCTACACCTGGACT	0.652													12	26	---	---	---	---	PASS
RADIL	55698	broad.mit.edu	37	7	4917591	4917591	+	Silent	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4917591C>A	uc003snj.1	-	2	353	c.180G>T	c.(178-180)TCG>TCT	p.S60S	RADIL_uc003sng.1_RNA|RADIL_uc011jwd.1_RNA	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	60					cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CACCAGGGGCCGACAGCTGGG	0.657													22	43	---	---	---	---	PASS
MRPL32	64983	broad.mit.edu	37	7	42977163	42977163	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42977163C>T	uc003tia.2	+	3	602	c.555C>T	c.(553-555)TTC>TTT	p.F185F	MRPL32_uc003tib.2_RNA|MRPL32_uc003tic.2_Silent_p.F132F	NM_031903	NP_114109	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32 precursor	185					translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0						CATCCTGGTTCACCCAGAATT	0.428													24	82	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45701765	45701765	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45701765G>C	uc003tne.3	+	8	1575	c.1557G>C	c.(1555-1557)AAG>AAC	p.K519N	ADCY1_uc003tnd.2_Missense_Mutation_p.K294N	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	519	Interaction with calmodulin (By similarity).|Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AAATGTTCAAGGCCGAGATCC	0.542													27	61	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48352831	48352831	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48352831G>T	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc003tos.1_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTCAACAGGTGTGTGTTTCAT	0.408													8	28	---	---	---	---	PASS
ZNF107	51427	broad.mit.edu	37	7	64167413	64167413	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64167413A>G	uc003ttd.2	+	7	1517	c.731A>G	c.(730-732)TAC>TGC	p.Y244C	ZNF107_uc003tte.2_Missense_Mutation_p.Y244C	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	244	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				GAGAACCTCTACAAGTGTAAA	0.368													25	75	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66490007	66490007	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66490007A>T	uc003tvn.2	+	7	1131	c.982A>T	c.(982-984)AAG>TAG	p.K328*	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	328					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				GAAGAAAGAAAAGGTACCGTT	0.413													71	198	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70880885	70880885	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70880885G>T	uc003tvy.2	+	4	600	c.600G>T	c.(598-600)AAG>AAT	p.K200N	WBSCR17_uc003tvz.2_Translation_Start_Site	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	200	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGGAGCTGAAGGTCCCCCTAG	0.498													15	73	---	---	---	---	PASS
PMS2L5	5383	broad.mit.edu	37	7	74312523	74312523	+	Intron	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74312523C>T	uc003ubl.2	+						PMS2L5_uc003ubk.2_Intron|PMS2L5_uc010lbw.2_Intron|PMS2L5_uc003ubm.3_Intron	NR_027775				SubName: Full=Postmeiotic segregation increased 2-like 5;												0						CAGTCTCTTTCAGCTCTGAAA	0.398													23	48	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965447	88965447	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965447C>G	uc011khi.1	+	4	3689	c.3151C>G	c.(3151-3153)CAA>GAA	p.Q1051E		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1051						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AACAAAAGAACAATCAAAACC	0.353										HNSCC(36;0.09)			37	88	---	---	---	---	PASS
PEX1	5189	broad.mit.edu	37	7	92147523	92147523	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92147523C>A	uc003uly.2	-	4	500	c.404G>T	c.(403-405)CGA>CTA	p.R135L	PEX1_uc011khr.1_5'UTR|PEX1_uc010ley.2_Missense_Mutation_p.R135L|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_5'Flank	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	135					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AAAAACTATTCGAATTTGATC	0.348													49	91	---	---	---	---	PASS
ASB4	51666	broad.mit.edu	37	7	95167000	95167000	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95167000A>T	uc011kij.1	+	5	1210	c.1210A>T	c.(1210-1212)ATT>TTT	p.I404F		NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	404	SOCS box.				intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			CCATAGAGCAATTCCTTTGCT	0.413													51	158	---	---	---	---	PASS
GIGYF1	64599	broad.mit.edu	37	7	100280005	100280005	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100280005C>T	uc003uwg.1	-	21	3710	c.2701G>A	c.(2701-2703)GGC>AGC	p.G901S		NM_022574	NP_072096	O75420	PERQ1_HUMAN	PERQ amino acid rich, with GYF domain 1	901										large_intestine(1)|central_nervous_system(1)	2	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TGGGTGAAGCCGTCCTGGGGC	0.652													13	35	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137255959	137255959	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137255959C>A	uc003vtt.2	-	19	1910	c.1909G>T	c.(1909-1911)GGT>TGT	p.G637C	DGKI_uc003vtu.2_Missense_Mutation_p.G337C	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	637					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						TCAATATAACCATCATCATGA	0.378													22	56	---	---	---	---	PASS
TAS2R3	50831	broad.mit.edu	37	7	141464388	141464388	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141464388A>T	uc003vwp.1	+	1	492	c.430A>T	c.(430-432)AGT>TGT	p.S144C		NM_016943	NP_058639	Q9NYW6	TA2R3_HUMAN	taste receptor T2R3	144	Helical; Name=4; (Potential).				sensory perception of taste		taste receptor activity			central_nervous_system(1)	1	Melanoma(164;0.0171)					ATCCTGTGGTAGTACCGCATC	0.473													66	132	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154667727	154667727	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154667727C>A	uc003wlk.2	+	20	2124	c.1995C>A	c.(1993-1995)AGC>AGA	p.S665R	DPP6_uc003wli.2_Missense_Mutation_p.S601R|DPP6_uc003wlm.2_Missense_Mutation_p.S603R|DPP6_uc011kvq.1_Missense_Mutation_p.S558R	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	665	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GCCGTGGCAGCGGCTTCCAAG	0.662													4	9	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	157049687	157049687	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157049687A>T	uc010lqs.2	+	22	3342	c.3030A>T	c.(3028-3030)AAA>AAT	p.K1010N	UBE3C_uc003wni.3_Missense_Mutation_p.K373N	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	1010	HECT.				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AAAAGCGCAAACTGCTGAAGT	0.423													87	216	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2024291	2024291	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2024291C>T	uc003wpx.3	+	11	1329	c.1191C>T	c.(1189-1191)GAC>GAT	p.D397D	MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	397	Fibronectin type-III 1.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCAACCGGGACTACGTCATCG	0.632													7	44	---	---	---	---	PASS
SPAG11B	10407	broad.mit.edu	37	8	7308359	7308359	+	3'UTR	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7308359A>T	uc003wrk.2	-	4					SPAG11B_uc003wrg.1_Missense_Mutation_p.F93Y|SPAG11B_uc003wrh.1_Intron|SPAG11B_uc003wri.2_3'UTR|SPAG11B_uc003wrj.2_Missense_Mutation_p.F40Y|SPAG11B_uc003wrl.2_Missense_Mutation_p.F93Y	NM_016512	NP_057596	Q08648	SG11B_HUMAN	sperm associated antigen 11B isoform A						spermatogenesis	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		ATGGCAGAAAAAAAGTCTGCA	0.423													31	308	---	---	---	---	PASS
SPAG11A	653423	broad.mit.edu	37	8	7718231	7718231	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7718231T>A	uc003wrx.2	+	3	445	c.410T>A	c.(409-411)TTT>TAT	p.F137Y	SPAG11A_uc003wry.2_3'UTR|SPAG11A_uc003wrz.2_Missense_Mutation_p.F93Y|SPAG11A_uc003wsa.2_Intron|SPAG11A_uc003wsb.2_Intron	NM_001081552	NP_001075021	Q6PDA7	SG11A_HUMAN	sperm associated antigen 11A	Error:Variant_position_missing_in_Q6PDA7_after_alignment						extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		TGCAGACTTTTTTTCTGCCAT	0.423													8	114	---	---	---	---	PASS
FDFT1	2222	broad.mit.edu	37	8	11689122	11689122	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11689122G>A	uc003wui.2	+	7	1127	c.975G>A	c.(973-975)ATG>ATA	p.M325I	FDFT1_uc003wuh.2_Missense_Mutation_p.M261I|FDFT1_uc010lsa.1_Missense_Mutation_p.M240I|FDFT1_uc011kxe.1_Missense_Mutation_p.M261I|FDFT1_uc011kxf.1_Missense_Mutation_p.M282I|FDFT1_uc011kxg.1_Missense_Mutation_p.M158I|FDFT1_uc003wuj.2_Missense_Mutation_p.M318I|FDFT1_uc010lsb.2_Missense_Mutation_p.M261I|FDFT1_uc011kxh.1_Missense_Mutation_p.M261I|FDFT1_uc011kxi.1_RNA|FDFT1_uc011kxj.1_Missense_Mutation_p.M261I|FDFT1_uc003wuk.2_Missense_Mutation_p.M384I|FDFT1_uc011kxk.1_Missense_Mutation_p.M240I	NM_004462	NP_004453	P37268	FDFT_HUMAN	squalene synthase	325					cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)		TGACCCTGATGATGGATGCCA	0.433													78	265	---	---	---	---	PASS
USP17L2	377630	broad.mit.edu	37	8	11995788	11995788	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11995788G>T	uc003wvc.1	-	1	482	c.482C>A	c.(481-483)GCC>GAC	p.A161D	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	161					apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)	3						AAATTCATGGGCATCTTCCTG	0.532													13	34	---	---	---	---	PASS
NEFM	4741	broad.mit.edu	37	8	24771859	24771859	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24771859C>A	uc003xed.3	+	1	586	c.553C>A	c.(553-555)CTC>ATC	p.L185I	NEFM_uc011lac.1_Missense_Mutation_p.L185I|NEFM_uc010lue.2_5'Flank|uc010luc.1_Missense_Mutation_p.S70I	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	185	Rod.|Coil 1B.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		CATCCACCGGCTCAAGGAGCG	0.657													7	47	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35608194	35608194	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35608194C>T	uc003xjr.1	+	13	2358	c.2030C>T	c.(2029-2031)GCG>GTG	p.A677V	UNC5D_uc003xjs.1_Missense_Mutation_p.A672V|UNC5D_uc003xju.1_Missense_Mutation_p.A253V	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	677	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GGGACCTATGCGCTCACTGGA	0.502													5	284	---	---	---	---	PASS
EFCAB1	79645	broad.mit.edu	37	8	49641664	49641664	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49641664T>C	uc003xqo.2	-	5	673	c.513A>G	c.(511-513)GAA>GAG	p.E171E	EFCAB1_uc003xqn.3_RNA|EFCAB1_uc011ldj.1_Silent_p.E119E|EFCAB1_uc010lxx.2_RNA|EFCAB1_uc011ldk.1_RNA	NM_024593	NP_078869	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform a	171	EF-hand 3.						calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TCACAGCCAGTTCATAGTCTG	0.433													23	69	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55541884	55541884	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541884A>T	uc003xsd.1	+	4	5590	c.5442A>T	c.(5440-5442)CTA>CTT	p.L1814L	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1814					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCCTTGAACTAAAATGCAATT	0.443													19	52	---	---	---	---	PASS
TOX	9760	broad.mit.edu	37	8	59739410	59739410	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59739410C>G	uc003xtw.1	-	6	1197	c.976G>C	c.(976-978)GCA>CCA	p.A326P		NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX	326	HMG box.					nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CTGTATGCTGCGAGTTGCTTC	0.438													12	32	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62366772	62366772	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62366772C>G	uc003xuh.2	+	4	1027	c.703C>G	c.(703-705)CTC>GTC	p.L235V	CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Missense_Mutation_p.L235V	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	235	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						CCTCTACACACTCATCAAGCC	0.438													70	270	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71050559	71050559	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71050559C>G	uc003xyn.1	-	15	3199	c.3037G>C	c.(3037-3039)GAA>CAA	p.E1013Q	NCOA2_uc011lfb.1_Missense_Mutation_p.E101Q	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1013					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ATCTCTAATTCAGATGGCCCT	0.413			T	RUNXBP2	AML								10	23	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89053690	89053690	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89053690C>T	uc003yeb.3	-	10	2105	c.1823G>A	c.(1822-1824)TGA>TAA	p.*608*		NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	608					collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						AACCCTACATCACACCCACTC	0.433													54	129	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89339430	89339430	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89339430G>T	uc003yeb.3	-	1	288	c.6C>A	c.(4-6)ATC>ATA	p.I2I	MMP16_uc003yec.2_Silent_p.I2I	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	2					collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						ATGTGAGTAAGATCATAGTGA	0.373													70	240	---	---	---	---	PASS
ESRP1	54845	broad.mit.edu	37	8	95686605	95686605	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95686605T>C	uc003ygq.3	+	12	1705	c.1522T>C	c.(1522-1524)TGT>CGT	p.C508R	ESRP1_uc003ygr.3_Missense_Mutation_p.C508R|ESRP1_uc003ygs.3_Missense_Mutation_p.C508R|ESRP1_uc003ygt.3_Missense_Mutation_p.C508R|ESRP1_uc003ygu.3_Missense_Mutation_p.C508R|ESRP1_uc003ygv.2_Missense_Mutation_p.C348R|ESRP1_uc003ygw.2_Missense_Mutation_p.C348R	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1	508	RRM 3.				mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						TGCACAGAAGTGTCATAAAAA	0.433													31	91	---	---	---	---	PASS
ATP6V1C1	528	broad.mit.edu	37	8	104075191	104075191	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104075191C>T	uc003ykz.3	+	9	895	c.650C>T	c.(649-651)TCA>TTA	p.S217L	ATP6V1C1_uc010mbz.2_Missense_Mutation_p.S142L|ATP6V1C1_uc003yla.2_Missense_Mutation_p.S217L|ATP6V1C1_uc011lhl.1_Missense_Mutation_p.S142L	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	217					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			AGTGTTCTTTCAGAGGACCAA	0.348													46	139	---	---	---	---	PASS
TAF2	6873	broad.mit.edu	37	8	120770319	120770319	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120770319T>G	uc003you.2	-	21	3032	c.2762A>C	c.(2761-2763)TAT>TCT	p.Y921S		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	921					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TAACCTTACATAGGGTACAGG	0.289													4	152	---	---	---	---	PASS
KIAA0196	9897	broad.mit.edu	37	8	126079900	126079900	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126079900C>T	uc003yrt.2	-	10	1541	c.1212G>A	c.(1210-1212)CGG>CGA	p.R404R	KIAA0196_uc011lir.1_Silent_p.R256R|KIAA0196_uc003yru.1_5'UTR	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	404					cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TGGGATTGTACCGAGAGTCTG	0.398													7	188	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131792811	131792811	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131792811G>C	uc003ytd.3	-	18	3837	c.3581C>G	c.(3580-3582)GCG>GGG	p.A1194G	ADCY8_uc010mds.2_Missense_Mutation_p.A1063G	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1194	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CAGGACAACCGCGGCCAGGGA	0.507										HNSCC(32;0.087)			32	75	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133141622	133141622	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133141622C>A	uc003ytj.2	-	15	2731	c.2506G>T	c.(2506-2508)GGT>TGT	p.G836C	KCNQ3_uc010mdt.2_Missense_Mutation_p.G824C|uc003yti.2_5'Flank	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	836					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TCCGTCTCACCCTCGGCGAGG	0.592													21	50	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139838949	139838949	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139838949C>T	uc003yvd.2	-	6	1368	c.921G>A	c.(919-921)AAG>AAA	p.K307K		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	307	TSP N-terminal.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACCAGTCTTCCTTCCGAGAGG	0.507										HNSCC(7;0.00092)			52	94	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143955799	143955799	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143955799G>C	uc003yxi.2	-	9	1509	c.1502C>G	c.(1501-1503)GCC>GGC	p.A501G	CYP11B1_uc010mex.2_Missense_Mutation_p.A200G|CYP11B1_uc003yxh.2_Missense_Mutation_p.A151G|CYP11B1_uc003yxj.2_Missense_Mutation_p.A435G|CYP11B1_uc010mey.2_Missense_Mutation_p.A572G	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	501					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	TTAGTTGATGGCTCTGAAGGT	0.567									Familial_Hyperaldosteronism_type_I				7	193	---	---	---	---	PASS
RECQL4	9401	broad.mit.edu	37	8	145737345	145737345	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145737345C>T	uc003zdj.2	-	20	3374	c.3342G>A	c.(3340-3342)CAG>CAA	p.Q1114Q		NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	1114					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTCCCGGCTCCTGCCCTTCCT	0.677			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				7	21	---	---	---	---	PASS
KIAA1161	57462	broad.mit.edu	37	9	34372105	34372105	+	Silent	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34372105C>G	uc003zue.3	-	3	1004	c.837G>C	c.(835-837)CTG>CTC	p.L279L		NM_020702	NP_065753	Q6NSJ0	K1161_HUMAN	hypothetical protein LOC57462	279	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane	hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|breast(1)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		CTCGGTAGCTCAGCTCTGGCG	0.667													11	48	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34514434	34514434	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34514434G>A	uc003zum.2	+	17	1805	c.1612G>A	c.(1612-1614)GCC>ACC	p.A538T		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	538	WD 3.				cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CACCTATGACGCCCACAACAT	0.557									Kartagener_syndrome				87	315	---	---	---	---	PASS
FBXO10	26267	broad.mit.edu	37	9	37541752	37541752	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37541752C>A	uc004aab.2	-	2	63	c.14G>T	c.(13-15)GGC>GTC	p.G5V	FBXO10_uc004aac.2_Missense_Mutation_p.G21V|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10	5	F-box.					ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)		CAAGGGGAGGCCACCAGCCTC	0.493													13	49	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73296450	73296450	+	Silent	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73296450A>G	uc004aid.2	-	9	1561	c.1317T>C	c.(1315-1317)GAT>GAC	p.D439D	TRPM3_uc004ahu.2_Silent_p.D269D|TRPM3_uc004ahv.2_Silent_p.D269D|TRPM3_uc004ahw.2_Silent_p.D311D|TRPM3_uc004ahx.2_Silent_p.D286D|TRPM3_uc004ahy.2_Silent_p.D311D|TRPM3_uc004ahz.2_Silent_p.D286D|TRPM3_uc004aia.2_Silent_p.D286D|TRPM3_uc004aib.2_Silent_p.D286D|TRPM3_uc004aic.2_Silent_p.D439D|TRPM3_uc010mor.2_Silent_p.D439D	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	464	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						GGATAGCCAAATCAATGTCCT	0.383													35	142	---	---	---	---	PASS
MRPL50	54534	broad.mit.edu	37	9	104160868	104160868	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104160868C>A	uc004bbe.2	-	1	52	c.7G>T	c.(7-9)GCG>TCG	p.A3S	MRPL50_uc011lvj.1_Missense_Mutation_p.A3S|ZNF189_uc004bbg.1_5'Flank|ZNF189_uc004bbh.1_5'Flank|ZNF189_uc004bbi.1_5'Flank|ZNF189_uc011lvk.1_5'Flank	NM_019051	NP_061924	Q8N5N7	RM50_HUMAN	mitochondrial ribosomal protein L50	3						mitochondrion|ribosome					0		Acute lymphoblastic leukemia(62;0.0559)				ACAGATCGCGCCGCCATCTTC	0.537													4	137	---	---	---	---	PASS
PRPF4	9128	broad.mit.edu	37	9	116045413	116045413	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116045413A>G	uc004bgx.2	+	5	535	c.485A>G	c.(484-486)TAT>TGT	p.Y162C	PRPF4_uc004bgy.2_Missense_Mutation_p.Y161C	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog	162						Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						GCCTTTCAGTATCAGCAAACC	0.408													104	240	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117846753	117846753	+	Splice_Site	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117846753T>C	uc004bjj.3	-	4	2230	c.1868_splice	c.e4-1	p.V623_splice	TNC_uc010mvf.2_Splice_Site_p.V623_splice	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor						cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GAGGAGACACTGGCAGGAATA	0.502													35	68	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121971016	121971016	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121971016G>T	uc004bkc.2	-	7	1582	c.1126C>A	c.(1126-1128)CAC>AAC	p.H376N		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	376					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GGCAGCTGGTGGTTGGGATTG	0.552													18	72	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123330665	123330665	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123330665C>T	uc004bkf.2	-	3	310	c.129G>A	c.(127-129)CTG>CTA	p.L43L	CDK5RAP2_uc004bkg.2_Silent_p.L43L|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Silent_p.L43L	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	43				L -> V (in Ref. 3; AAP41926).	brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						CATTTGGGAGCACTGTAAAAA	0.438													81	287	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139393454	139393454	+	Intron	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139393454T>A	uc004chz.2	-							NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein						aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CTTGCCTGCGTGAAAGAAGCA	0.632			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			98	264	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1245948	1245948	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1245948G>A	uc009xhq.2	-	8	2196	c.1822C>T	c.(1822-1824)CAG>TAG	p.Q608*	ADARB2_uc001igm.3_Nonsense_Mutation_p.Q117*	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	608	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GCGGGCAGCTGGCCGACACCC	0.687													8	7	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8115758	8115758	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8115758G>A	uc001ika.2	+	6	1661	c.1104G>A	c.(1102-1104)ATG>ATA	p.M368I	GATA3_uc001ijz.2_Missense_Mutation_p.M369I	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	368					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						ACCGAAAAATGTCTAGCAAAT	0.403			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						52	83	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18690040	18690040	+	Intron	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18690040G>A	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qcn.1_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GTAAGCGCAAGGGCTTTCGTT	0.478													28	56	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	21940594	21940594	+	Intron	SNP	G	A	A	rs143936689	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21940594G>A	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001ira.2_Intron|MLLT10_uc001iqz.2_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						ACTTATATTCGTTTTTAGAAA	0.299			T	MLL|PICALM|CDK6	AL								19	41	---	---	---	---	PASS
BAMBI	25805	broad.mit.edu	37	10	28970226	28970226	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28970226C>A	uc001iuj.1	+	2	519	c.116C>A	c.(115-117)GCC>GAC	p.A39D	BAMBI_uc001iui.2_Missense_Mutation_p.A39D	NM_012342	NP_036474	Q13145	BAMBI_HUMAN	BMP and activin membrane-bound inhibitor	39	Extracellular (Potential).				cell migration|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|positive regulation of protein binding|positive regulation of transcription, DNA-dependent|regulation of cell shape	cytoplasm|integral to membrane|plasma membrane	frizzled binding|type II transforming growth factor beta receptor binding			central_nervous_system(4)	4						CACTGTGTAGCCACTGGTTAT	0.463													35	68	---	---	---	---	PASS
LYZL2	119180	broad.mit.edu	37	10	30918610	30918610	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30918610G>C	uc001ivk.2	-	1	38	c.25C>G	c.(25-27)CTG>GTG	p.L9V		NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	Error:Variant_position_missing_in_Q7Z4W2_after_alignment					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				GTCGGTGACAGGCAGCTCAGG	0.502													11	26	---	---	---	---	PASS
LYZL2	119180	broad.mit.edu	37	10	30918611	30918611	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30918611G>A	uc001ivk.2	-	1	37	c.24C>T	c.(22-24)TGC>TGT	p.C8C		NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	Error:Variant_position_missing_in_Q7Z4W2_after_alignment					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				TCGGTGACAGGCAGCTCAGGG	0.507													11	26	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33538436	33538436	+	Intron	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33538436T>C	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron|NRP1_uc001iwz.2_Intron|NRP1_uc001ixa.2_Intron|NRP1_uc001ixb.1_Intron|NRP1_uc001ixc.1_Intron	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	AAGAGGAAGATTTTGATCGCA	0.348													13	37	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33559685	33559685	+	Silent	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33559685C>A	uc001iwx.3	-	3	871	c.348G>T	c.(346-348)GGG>GGT	p.G116G	NRP1_uc001iwv.3_Silent_p.G116G|NRP1_uc009xlz.2_Silent_p.G116G|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Silent_p.G116G|NRP1_uc001iwz.2_Silent_p.G116G|NRP1_uc001ixa.2_Silent_p.G116G|NRP1_uc001ixb.1_Silent_p.G116G|NRP1_uc001ixc.1_Silent_p.G116G	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	116	CUB 1.|Extracellular (Potential).				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	AAAGAAATGGCCCTGAAGACA	0.413													5	146	---	---	---	---	PASS
CREM	1390	broad.mit.edu	37	10	35437385	35437385	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35437385A>T	uc001iyb.2	+	3	296	c.134A>T	c.(133-135)CAG>CTG	p.Q45L	CREM_uc001ixx.2_Missense_Mutation_p.Q29L|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Missense_Mutation_p.Q45L|CREM_uc001iyc.2_Missense_Mutation_p.Q29L|CREM_uc001iyd.2_Missense_Mutation_p.Q45L|CREM_uc001iye.2_Missense_Mutation_p.Q45L	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a	45					cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTGCAGACTCAGACTGGCCAA	0.428													34	84	---	---	---	---	PASS
ZNF25	219749	broad.mit.edu	37	10	38241502	38241502	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38241502G>C	uc001ize.1	-	6	1029	c.924C>G	c.(922-924)CAC>CAG	p.H308Q	ZNF25_uc001izf.1_Missense_Mutation_p.H272Q	NM_145011	NP_659448	P17030	ZNF25_HUMAN	zinc finger protein 25	308	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|central_nervous_system(1)	4		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				TCTCTCCTGTGTGACTTCTCT	0.438													23	74	---	---	---	---	PASS
CXCL12	6387	broad.mit.edu	37	10	44871476	44871476	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44871476G>T	uc001jbf.2	-						CXCL12_uc001jbh.2_Missense_Mutation_p.R91S	NM_000609	NP_000600	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12 (stromal						blood circulation|cell adhesion|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|negative regulation of leukocyte apoptosis|positive regulation of monocyte chemotaxis|regulation of actin polymerization or depolymerization|response to virus	extracellular space	chemokine activity|growth factor activity|signal transducer activity				0					Dexamethasone(DB01234)	TCTTCTCTGCGCCCCCTTAGA	0.383													81	254	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49440322	49440322	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49440322C>A	uc001jgi.2	-	10	1111	c.1004G>T	c.(1003-1005)GGG>GTG	p.G335V	FRMPD2_uc001jgh.2_Missense_Mutation_p.G304V|FRMPD2_uc001jgj.2_Missense_Mutation_p.G313V	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	335					tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		ATAGGATTTCCCTTTTTTGGT	0.308													15	40	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70446445	70446445	+	Silent	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70446445T>G	uc001jok.3	+	11	5890	c.5385T>G	c.(5383-5385)CCT>CCG	p.P1795P		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	1795					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						ACAGTAAGCCTTCGTCACTGC	0.428													51	118	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72462179	72462179	+	Missense_Mutation	SNP	G	A	A	rs141188417		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72462179G>A	uc001jrh.2	+	3	634	c.634G>A	c.(634-636)GTC>ATC	p.V212I	ADAMTS14_uc001jrg.2_Missense_Mutation_p.V212I	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	212					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CCGGGAGGCCGTCCAGCAGGA	0.622													37	68	---	---	---	---	PASS
VCL	7414	broad.mit.edu	37	10	75854156	75854156	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75854156G>C	uc001jwd.2	+	11	1574	c.1480G>C	c.(1480-1482)GAG>CAG	p.E494Q	VCL_uc009xrr.2_Missense_Mutation_p.E243Q|VCL_uc010qky.1_Missense_Mutation_p.E401Q|VCL_uc001jwe.2_Missense_Mutation_p.E494Q|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL	494	N-terminal globular head.|3.|3 X 112 AA tandem repeats.				adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGTACACCTTGAGGGCAAGAT	0.557													17	38	---	---	---	---	PASS
LRIT1	26103	broad.mit.edu	37	10	85997240	85997240	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85997240G>T	uc001kcz.1	-	2	347	c.325C>A	c.(325-327)CTG>ATG	p.L109M		NM_015613	NP_056428	Q9P2V4	LRIT1_HUMAN	retina specific protein PAL	109	LRR 3.|Lumenal (Potential).					integral to endoplasmic reticulum membrane					0						AGCTCCCGCAGGCGTCGCAGG	0.741													7	15	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87966113	87966113	+	Intron	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87966113C>A	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GCCTGCCGGACAACTCACCAT	0.632										Multiple Myeloma(13;0.14)			13	30	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87966116	87966116	+	Intron	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87966116C>A	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	TGCCGGACAACTCACCATACT	0.627										Multiple Myeloma(13;0.14)			16	31	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124352026	124352026	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124352026C>A	uc001lgk.1	+	20	2521	c.2415C>A	c.(2413-2415)CAC>CAA	p.H805Q	DMBT1_uc001lgl.1_Missense_Mutation_p.H795Q|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Missense_Mutation_p.H805Q|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Missense_Mutation_p.H418Q	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	805	SRCR 6.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GCTCAGGACACGAGTCCTACC	0.622													4	124	---	---	---	---	PASS
SYCE1	93426	broad.mit.edu	37	10	135370274	135370274	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135370274A>T	uc001lno.2	-	8	622	c.517T>A	c.(517-519)TGG>AGG	p.W173R	CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.W45R|SYCE1_uc009ybn.2_Missense_Mutation_p.W173R|SYCE1_uc001lnn.2_Missense_Mutation_p.W137R	NM_001143764	NP_001137236	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	173	Potential.				cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TGGAAGTCCCAGAGGTCCTTG	0.517													6	13	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1088727	1088727	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1088727G>T	uc001lsx.1	+	26	3539	c.3512G>T	c.(3511-3513)AGG>ATG	p.R1171M		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	1171						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCCAAGGACAGGCCCATCTAT	0.622													7	18	---	---	---	---	PASS
TRPM5	29850	broad.mit.edu	37	11	2444157	2444157	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2444157C>G	uc001lwm.3	-	1	119	c.110G>C	c.(109-111)CGA>CCA	p.R37P	TRPM5_uc010qxl.1_Missense_Mutation_p.R37P|TRPM5_uc009ydn.2_Missense_Mutation_p.R37P	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,	37	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		TACCTTGCCTCGCTTCTTCCC	0.657													43	107	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068057	5068057	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068057C>A	uc010qyv.1	+	1	302	c.302C>A	c.(301-303)GCC>GAC	p.A101D		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	101	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTTGTGTGGCCCAGATGTTT	0.493													33	69	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068180	5068180	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068180T>A	uc010qyv.1	+	1	425	c.425T>A	c.(424-426)GTG>GAG	p.V142E		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACATCCCAAGTGTTGGTGGGC	0.478													25	54	---	---	---	---	PASS
RPL27A	6157	broad.mit.edu	37	11	8707051	8707051	+	Intron	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8707051C>G	uc001mgs.3	+						SNORA45_uc001mgr.1_RNA	NM_000990	NP_000981	P46776	RL27A_HUMAN	ribosomal protein L27a						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				Epithelial(150;3.24e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGAAGAGAATCTACTGGTCTT	0.517													50	108	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20657899	20657899	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20657899G>T	uc001mqd.2	+	11	1944	c.1671G>T	c.(1669-1671)CTG>CTT	p.L557L	SLC6A5_uc009yic.2_Silent_p.L322L	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	557	Helical; Name=8; (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	TAACCAGGCTGCCTCTCTCTC	0.478													25	95	---	---	---	---	PASS
ACCSL	390110	broad.mit.edu	37	11	44074600	44074600	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44074600G>C	uc001mxw.1	+	7	986	c.930G>C	c.(928-930)CTG>CTC	p.L310L	ACCSL_uc009ykr.2_Silent_p.L129L	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase	310							1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						AGGAAGCCCTGCTTGAAGCTA	0.438													42	157	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46394213	46394213	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46394213G>A	uc001ncn.1	+	13	1746	c.1621G>A	c.(1621-1623)GGG>AGG	p.G541R	DGKZ_uc001nch.1_Missense_Mutation_p.G369R|DGKZ_uc010rgq.1_Missense_Mutation_p.G296R|DGKZ_uc001ncj.1_Missense_Mutation_p.G319R|DGKZ_uc010rgr.1_Missense_Mutation_p.G318R|DGKZ_uc001nck.1_Missense_Mutation_p.G131R|DGKZ_uc001ncl.2_Missense_Mutation_p.G353R|DGKZ_uc001ncm.2_Missense_Mutation_p.G352R|DGKZ_uc009yky.1_Missense_Mutation_p.G353R|DGKZ_uc010rgs.1_Missense_Mutation_p.G330R	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	541	DAGKc.|Mediates interaction with RASGRP1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCTGGCGTGCGGGGGCGACGG	0.662													16	57	---	---	---	---	PASS
AMBRA1	55626	broad.mit.edu	37	11	46565514	46565514	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46565514G>T	uc010rgu.1	-						AMBRA1_uc010rgt.1_5'Flank|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GGAACTGCTGGACTAACTTAC	0.358													41	162	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55032464	55032464	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55032464G>T	uc010rid.1	+	2	219	c.133G>T	c.(133-135)GAC>TAC	p.D45Y		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	29	RING-type.					intracellular	zinc ion binding				0						GGTCACCATAGACTGTGGGCA	0.468													7	446	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595086	55595086	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595086T>C	uc001nhy.1	+	1	392	c.392T>C	c.(391-393)CTG>CCG	p.L131P		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				AACCCCCTGCTGTACATGGTG	0.522										HNSCC(27;0.073)			94	298	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	56143295	56143295	+	IGR	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56143295C>A								OR8J1 (14624 upstream) : OR5R1 (41441 downstream)																							TCTTAGCAACCTAGCTTTTGT	0.393													95	520	---	---	---	---	PASS
OR10Q1	219960	broad.mit.edu	37	11	57995960	57995960	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57995960T>C	uc010rkd.1	-	1	388	c.388A>G	c.(388-390)ATC>GTC	p.I130V		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				GGGTGGCAGATAGCCACATAG	0.612													15	65	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58207164	58207164	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207164G>T	uc010rkh.1	-	1	461	c.461C>A	c.(460-462)GCA>GAA	p.A154E		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	154	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ATGAATGGATGCATTCAGGAA	0.453													39	174	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60165446	60165446	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60165446C>A	uc001npj.2	+	2	825	c.260C>A	c.(259-261)GCA>GAA	p.A87E	MS4A14_uc001npi.2_Intron|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.A87E|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	87	Helical; (Potential).					integral to membrane	receptor activity			breast(1)	1						TTCTGGGGAGCACTTATTGTG	0.323													18	66	---	---	---	---	PASS
PRPF19	27339	broad.mit.edu	37	11	60665318	60665318	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60665318C>T	uc001nqf.2	-	15	1624	c.1417G>A	c.(1417-1419)GAG>AAG	p.E473K		NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN	PRP19/PSO4 pre-mRNA processing factor 19	473	WD 7.				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						CAGCCTCTACCTGTAAAGTGA	0.532													49	202	---	---	---	---	PASS
HRASLS5	117245	broad.mit.edu	37	11	63230995	63230995	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63230995G>T	uc001nwy.2	-	6	994	c.820C>A	c.(820-822)CCC>ACC	p.P274T	HRASLS5_uc001nwz.2_Missense_Mutation_p.P264T|HRASLS5_uc010rmq.1_3'UTR|HRASLS5_uc009yos.2_RNA	NM_054108	NP_473449	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5 isoform 1	274										ovary(1)	1						ATTGGTTTGGGCTTTATGCTA	0.473													68	232	---	---	---	---	PASS
NUDT22	84304	broad.mit.edu	37	11	63996966	63996966	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63996966G>C	uc001nyp.3	+	5	874	c.694G>C	c.(694-696)GAG>CAG	p.E232Q	NUDT22_uc009ype.2_Missense_Mutation_p.E232Q|NUDT22_uc001nyq.3_Missense_Mutation_p.E199Q|NUDT22_uc010rng.1_RNA|uc001nyr.1_3'UTR|DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank	NM_032344	NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety	232	Nudix hydrolase.						hydrolase activity				0						CCTGACTTCTGAGCAGGTGAG	0.587													73	239	---	---	---	---	PASS
C11orf2	738	broad.mit.edu	37	11	64875684	64875684	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64875684C>T	uc001ocr.1	+	5	781	c.741C>T	c.(739-741)GGC>GGT	p.G247G	C11orf2_uc001ocs.1_Silent_p.G123G	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	247					lipid transport|protein transport	Golgi apparatus|integral to membrane					0						GCGGCTCAGGCGCCCCGGAGC	0.721													6	8	---	---	---	---	PASS
CD248	57124	broad.mit.edu	37	11	66082942	66082942	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66082942G>A	uc001ohm.1	-	1	1574	c.1557C>T	c.(1555-1557)ACC>ACT	p.T519T		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	519	Pro-rich.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	CCGGATATTTGGTTGAGATCA	0.572													76	194	---	---	---	---	PASS
DHCR7	1717	broad.mit.edu	37	11	71146456	71146456	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71146456C>A	uc001oqk.2	-	9	1643	c.1393G>T	c.(1393-1395)GCA>TCA	p.A465S	DHCR7_uc001oql.2_Missense_Mutation_p.A465S	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	465					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)	TAAGGCACTGCGGCGGTGTAG	0.652									Smith-Lemli-Opitz_syndrome				45	126	---	---	---	---	PASS
MAP6	4135	broad.mit.edu	37	11	75298589	75298589	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75298589T>A	uc001owu.2	-	4	2022	c.1957A>T	c.(1957-1959)ATG>TTG	p.M653L		NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1	653	Pro-rich.					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)					GCTGTGGCCATGGCACTTTCA	0.498													5	426	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92590384	92590384	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92590384A>T	uc001pdj.3	+	19	11387	c.11370A>T	c.(11368-11370)GGA>GGT	p.G3790G	FAT3_uc001pdi.3_Silent_p.G230G	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3790	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACAGGAGGACTGTGTCCGG	0.517										TCGA Ovarian(4;0.039)			40	139	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92600220	92600220	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92600220T>C	uc001pdj.3	+	21	11989	c.11972T>C	c.(11971-11973)CTG>CCG	p.L3991P	FAT3_uc001pdi.3_Missense_Mutation_p.L431P	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3991	Laminin G-like.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCGGTGATACTGAATAACAAT	0.637										TCGA Ovarian(4;0.039)			4	6	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92600221	92600221	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92600221G>T	uc001pdj.3	+	21	11990	c.11973G>T	c.(11971-11973)CTG>CTT	p.L3991L	FAT3_uc001pdi.3_Silent_p.L431L	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3991	Laminin G-like.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CGGTGATACTGAATAACAATG	0.637										TCGA Ovarian(4;0.039)			4	6	---	---	---	---	PASS
TRPC6	7225	broad.mit.edu	37	11	101362427	101362427	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101362427C>A	uc001pgk.3	-	3	1413	c.988G>T	c.(988-990)GTT>TTT	p.V330F	TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Missense_Mutation_p.V330F	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	330	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AGGAGTCCAACAACAAAGTCT	0.418													69	221	---	---	---	---	PASS
MMP7	4316	broad.mit.edu	37	11	102398592	102398592	+	Silent	SNP	G	T	T	rs17879417	byFrequency	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102398592G>T	uc001phb.2	-	2	278	c.231C>A	c.(229-231)CGC>CGA	p.R77R	MMP7_uc009yxd.2_Silent_p.R77R|MMP7_uc010rus.1_Silent_p.R77R	NM_002423	NP_002414	P09237	MMP7_HUMAN	matrix metalloproteinase 7 preproprotein	77					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(1)	1	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)		TTTCTATGACGCGGGAGTTTA	0.408													57	182	---	---	---	---	PASS
CASP4	837	broad.mit.edu	37	11	104819395	104819395	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104819395C>A	uc001pid.1	-	6	863	c.790G>T	c.(790-792)GGG>TGG	p.G264W	CASP4_uc001pib.1_Missense_Mutation_p.G208W|CASP4_uc009yxg.1_Missense_Mutation_p.G173W	NM_001225	NP_001216	P49662	CASP4_HUMAN	caspase 4 isoform alpha precursor	264					apoptosis|induction of apoptosis|proteolysis	intracellular	cysteine-type endopeptidase activity|protein binding			lung(2)|ovary(1)|skin(1)	4		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		CACAGTTCCCCACGGTTTGCT	0.488													13	98	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108032402	108032402	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108032402C>T	uc001pjz.3	-	17	3513	c.3411G>A	c.(3409-3411)CGG>CGA	p.R1137R	NPAT_uc010rvv.1_Silent_p.R193R	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	1137					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGGTGGTATGCCGGCTAATGG	0.383													4	230	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108382569	108382569	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108382569C>A	uc001pkk.2	-	6	3776	c.3665G>T	c.(3664-3666)CGT>CTT	p.R1222L	EXPH5_uc010rvy.1_Missense_Mutation_p.R1034L|EXPH5_uc010rvz.1_Missense_Mutation_p.R1066L|EXPH5_uc010rwa.1_Missense_Mutation_p.R1146L	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1222					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TGTTTTCCCACGTTCTTTTCC	0.383													54	263	---	---	---	---	PASS
FAM55D	54827	broad.mit.edu	37	11	114453140	114453140	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114453140C>A	uc001ppc.2	-	3	881	c.700G>T	c.(700-702)GAC>TAC	p.D234Y	FAM55D_uc001ppd.2_Intron	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	234						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		TCTCTGTTGTCCAGGTACTGG	0.468													58	185	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117332318	117332318	+	Intron	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117332318G>A	uc001prh.1	-							NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGGCACTGCAGGGGGTAGGGG	0.627													22	75	---	---	---	---	PASS
IL10RA	3587	broad.mit.edu	37	11	117860271	117860271	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117860271G>T	uc001prv.2	+	3	380	c.303G>T	c.(301-303)CGG>CGT	p.R101R	IL10RA_uc010rxl.1_Silent_p.R81R|IL10RA_uc010rxm.1_Silent_p.R81R|IL10RA_uc010rxn.1_Intron|IL10RA_uc001prw.2_5'UTR	NM_001558	NP_001549	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha precursor	101	Extracellular (Potential).					integral to membrane|plasma membrane	interleukin-10 receptor activity			ovary(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CCAGAGTGCGGGCTGTGGACG	0.577													17	39	---	---	---	---	PASS
HINFP	25988	broad.mit.edu	37	11	119004999	119004999	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119004999G>C	uc001pvp.2	+	11	1534	c.1345G>C	c.(1345-1347)GAA>CAA	p.E449Q	HINFP_uc001pvq.2_Missense_Mutation_p.E449Q|HINFP_uc001pvr.2_Missense_Mutation_p.E202Q	NM_015517	NP_056332	Q9BQA5	HINFP_HUMAN	MBD2 (methyl-CpG-binding protein)-interacting	449	Interaction with NPAT.				DNA damage checkpoint|DNA repair|establishment of protein localization|in utero embryonic development|myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	enzyme binding|histone binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						CAAGGGTAGCGAAGGGACAGC	0.562											OREG0021397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	100	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	994800	994800	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:994800G>T	uc001qio.3	+	19	5337	c.4830G>T	c.(4828-4830)GTG>GTT	p.V1610V	WNK1_uc001qip.3_Silent_p.V1363V|WNK1_uc001qir.3_Silent_p.V783V	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1610					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTGCCAATGTGCCTGCTGTAC	0.478													125	213	---	---	---	---	PASS
ZNF384	171017	broad.mit.edu	37	12	6788168	6788168	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6788168G>T	uc010sfh.1	-	4	456	c.248C>A	c.(247-249)TCC>TAC	p.S83Y	ZNF384_uc001qpz.2_Missense_Mutation_p.S83Y|ZNF384_uc001qqa.2_Missense_Mutation_p.S83Y|ZNF384_uc001qqb.2_Missense_Mutation_p.S83Y|ZNF384_uc001qqc.2_Missense_Mutation_p.S83Y|ZNF384_uc001qqd.2_Missense_Mutation_p.S83Y|ZNF384_uc001qqe.2_Missense_Mutation_p.S83Y|ZNF384_uc009zew.1_5'Flank	NM_001135734	NP_001129206	Q8TF68	ZN384_HUMAN	nuclear matrix transcription factor 4 isoform d	83					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/ZNF384(4)	haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						CTGGGTAACGGACGCTTGGCT	0.562			T	EWSR1|TAF15 	ALL								60	364	---	---	---	---	PASS
ZNF384	171017	broad.mit.edu	37	12	6788212	6788212	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6788212G>T	uc010sfh.1	-	4	412	c.204C>A	c.(202-204)GAC>GAA	p.D68E	ZNF384_uc001qpz.2_Missense_Mutation_p.D68E|ZNF384_uc001qqa.2_Missense_Mutation_p.D68E|ZNF384_uc001qqb.2_Missense_Mutation_p.D68E|ZNF384_uc001qqc.2_Missense_Mutation_p.D68E|ZNF384_uc001qqd.2_Missense_Mutation_p.D68E|ZNF384_uc001qqe.2_Missense_Mutation_p.D68E|ZNF384_uc009zew.1_5'Flank	NM_001135734	NP_001129206	Q8TF68	ZN384_HUMAN	nuclear matrix transcription factor 4 isoform d	68					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/ZNF384(4)	haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						TGGACTCTGTGTCCATACTGA	0.592			T	EWSR1|TAF15 	ALL								59	361	---	---	---	---	PASS
C1S	716	broad.mit.edu	37	12	7177909	7177909	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7177909G>A	uc001qsj.2	+	15	2740	c.2021G>A	c.(2020-2022)TGG>TAG	p.W674*	C1S_uc001qsk.2_Nonsense_Mutation_p.W674*|C1S_uc001qsl.2_Nonsense_Mutation_p.W674*|C1S_uc009zfr.2_Nonsense_Mutation_p.W507*|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	674	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	TATGTTGACTGGATAATGAAG	0.522													5	409	---	---	---	---	PASS
CLEC4C	170482	broad.mit.edu	37	12	7882298	7882298	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7882298C>A	uc001qtg.1	-	6	710	c.536G>T	c.(535-537)CGT>CTT	p.R179L	CLEC4C_uc001qth.1_Missense_Mutation_p.R179L|CLEC4C_uc001qti.1_Missense_Mutation_p.R148L	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	179	Extracellular (Potential).|C-type lectin.				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		TATCGCACAACGCTCATCAAG	0.418													93	488	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082408	8082408	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082408C>T	uc001qtr.2	-	6	995	c.733G>A	c.(733-735)GAG>AAG	p.E245K	SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	245	Cytoplasmic (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		CTTGCACTCTCATCTTTCATC	0.483													63	249	---	---	---	---	PASS
CLEC6A	93978	broad.mit.edu	37	12	8610588	8610588	+	Intron	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8610588G>C	uc001qum.1	+							NM_001007033	NP_001007034	Q6EIG7	CLC6A_HUMAN	dectin-2						defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding			breast(1)	1	Lung SC(5;0.184)					GTGTAGGTAAGTTCTTCACTG	0.463													3	127	---	---	---	---	PASS
CLEC4E	26253	broad.mit.edu	37	12	8692491	8692491	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8692491G>A	uc001quo.1	-	2	255	c.90C>T	c.(88-90)CCC>CCT	p.P30P		NM_014358	NP_055173	Q9ULY5	CLC4E_HUMAN	C-type lectin domain family 4, member E	30	Helical; Signal-anchor for type II membrane protein; (Potential).					integral to membrane	sugar binding			central_nervous_system(1)	1	Lung SC(5;0.184)					GAAATAGGATGGGGATCCCAG	0.413													162	328	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9304822	9304822	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9304822T>C	uc001qvl.2	-	32	4235	c.4206A>G	c.(4204-4206)GTA>GTG	p.V1402V	PZP_uc009zgl.2_Silent_p.V1188V	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						CTACCATTTTTACTGTTGGTT	0.363													35	141	---	---	---	---	PASS
TAS2R19	259294	broad.mit.edu	37	12	11174603	11174603	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11174603G>C	uc010shj.1	-	1	568	c.568C>G	c.(568-570)CTG>GTG	p.L190V	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176888	NP_795369	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	190	Helical; Name=5; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1						ATTAGGCTCAGAGTAAAGGGT	0.398													60	310	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14613884	14613884	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14613884G>C	uc001rbw.2	+	9	2772	c.2614G>C	c.(2614-2616)GTG>CTG	p.V872L	ATF7IP_uc010shs.1_3'UTR|ATF7IP_uc001rbu.2_Missense_Mutation_p.V872L|ATF7IP_uc001rbv.1_Missense_Mutation_p.V871L|ATF7IP_uc001rbx.2_Missense_Mutation_p.V871L|ATF7IP_uc010sht.1_3'UTR|ATF7IP_uc001rby.3_Missense_Mutation_p.V872L|ATF7IP_uc001rca.2_Missense_Mutation_p.V872L	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	872					DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						AACACTTGCTGTGCAGGCTGT	0.493													37	93	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18715656	18715656	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18715656G>T	uc001rdt.2	+	26	3603	c.3487G>T	c.(3487-3489)GAG>TAG	p.E1163*	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Nonsense_Mutation_p.E1204*|PIK3C2G_uc010sic.1_Nonsense_Mutation_p.E982*	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1163	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				GGAAAGTCTGGAGTGTTTCCC	0.378													5	27	---	---	---	---	PASS
SLCO1A2	6579	broad.mit.edu	37	12	21446895	21446895	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21446895C>T	uc001rer.2	-	10	1672	c.1421G>A	c.(1420-1422)GGA>GAA	p.G474E	SLCO1A2_uc001res.2_Missense_Mutation_p.G474E|SLCO1A2_uc010siq.1_Missense_Mutation_p.G342E|SLCO1A2_uc010sio.1_Missense_Mutation_p.G342E|SLCO1A2_uc010sip.1_Missense_Mutation_p.G342E|SLCO1A2_uc001ret.2_Missense_Mutation_p.G472E	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	474	Extracellular (Potential).|Kazal-like.				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TATTCCCGTTCCAATGGATGT	0.393													18	107	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21968726	21968726	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21968726C>A	uc001rfi.1	-	32	4014	c.3994G>T	c.(3994-3996)GTC>TTC	p.V1332F	ABCC9_uc001rfh.2_Missense_Mutation_p.V1332F|ABCC9_uc001rfj.1_Missense_Mutation_p.V1296F	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1332	Cytoplasmic (Potential).|ABC transporter 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TAAGCCTTGACGTGCTTAAGA	0.383													42	216	---	---	---	---	PASS
ALG10	84920	broad.mit.edu	37	12	34175630	34175630	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34175630A>T	uc001rlm.2	+	1	415	c.96A>T	c.(94-96)CGA>CGT	p.R32R		NM_032834	NP_116223	Q5BKT4	AG10A_HUMAN	asparagine-linked glycosylation 10 homolog	32	Extracellular (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			skin(1)	1	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				GGGCGTTGCGAGAGCCCTACA	0.597													108	447	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51847358	51847358	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51847358G>A	uc001rys.1	+	5	627	c.449G>A	c.(448-450)GGA>GAA	p.G150E	SLC4A8_uc010sni.1_Missense_Mutation_p.G97E|SLC4A8_uc001rym.2_Missense_Mutation_p.G97E|SLC4A8_uc001ryn.2_Missense_Mutation_p.G97E|SLC4A8_uc001ryo.2_Missense_Mutation_p.G97E|SLC4A8_uc001ryp.1_Missense_Mutation_p.G97E|SLC4A8_uc010snj.1_Missense_Mutation_p.G177E|SLC4A8_uc001ryq.3_Missense_Mutation_p.G150E|SLC4A8_uc001ryr.2_Missense_Mutation_p.G150E|SLC4A8_uc010snk.1_Missense_Mutation_p.G97E	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	150	Extracellular (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		GAAGATGGGGGAGAACGCTGG	0.418													44	104	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52156414	52156414	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52156414G>C	uc001ryw.2	+	15	2676	c.2498G>C	c.(2497-2499)AGT>ACT	p.S833T	SCN8A_uc010snl.1_Missense_Mutation_p.S698T|SCN8A_uc001ryy.2_Missense_Mutation_p.S698T	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	833	Helical; Name=S3 of repeat II; (Potential).|II.				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	ATGGAACTGAGTCTAGCAGAC	0.408													46	122	---	---	---	---	PASS
NAB2	4665	broad.mit.edu	37	12	57485758	57485758	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57485758G>T	uc001smz.2	+	2	1312	c.934G>T	c.(934-936)GGC>TGC	p.G312C		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	312	NCD2.				cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GCGGCGGGAGGGCAAGCAGCT	0.547													39	87	---	---	---	---	PASS
SRRM4	84530	broad.mit.edu	37	12	119419808	119419808	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119419808C>A	uc001txa.1	+	1	413	c.121C>A	c.(121-123)CCG>ACG	p.P41T		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	41					cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						GGCCCGCAAGCCGCTGCCAAG	0.607													3	3	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123055683	123055683	+	Intron	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123055683G>C	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GGTATGATGTGAGAATGGATT	0.353													29	40	---	---	---	---	PASS
SLC15A4	121260	broad.mit.edu	37	12	129294026	129294026	+	Intron	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129294026T>C	uc001uhu.2	-						SLC15A4_uc001uhv.2_Intron	NM_145648	NP_663623	Q8N697	S15A4_HUMAN	solute carrier family 15, member 4						oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		CATCTAGGTATAAAAAACAGT	0.403													32	79	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132400428	132400428	+	Intron	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132400428C>G	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		AGGCGTGTCTCTCTCTAGGCT	0.692													19	51	---	---	---	---	PASS
RNF17	56163	broad.mit.edu	37	13	25363490	25363490	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25363490T>A	uc001upr.2	+	8	829	c.788T>A	c.(787-789)ATC>AAC	p.I263N	RNF17_uc010tdd.1_Missense_Mutation_p.I122N|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.I263N|RNF17_uc001ups.2_Missense_Mutation_p.I202N|RNF17_uc001upq.1_Missense_Mutation_p.I263N	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	263					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTCTAGATTATCCGGACTTTG	0.333													52	122	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32907110	32907110	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32907110C>T	uc001uub.1	+	10	1722	c.1495C>T	c.(1495-1497)CAG>TAG	p.Q499*	BRCA2_uc001uua.1_Nonsense_Mutation_p.Q376*	NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	499					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTCTTCATTTCAGGGTATCAA	0.358			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			34	73	---	---	---	---	PASS
C13orf36	400120	broad.mit.edu	37	13	37269404	37269404	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37269404C>T	uc001uvt.3	+	2	635	c.189C>T	c.(187-189)CTC>CTT	p.L63L		NM_203451	NP_982276	A2A2V5	CM036_HUMAN	hypothetical protein LOC400120	63	Helical; (Potential).					integral to membrane				skin(1)	1						TCATTGCCCTCCAGAGGCTCA	0.473													105	262	---	---	---	---	PASS
LRCH1	23143	broad.mit.edu	37	13	47262104	47262104	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47262104G>T	uc001vbj.2	+	6	1176	c.940G>T	c.(940-942)GTG>TTG	p.V314L	LRCH1_uc010acp.2_Missense_Mutation_p.V314L|LRCH1_uc001vbk.2_Missense_Mutation_p.V314L|LRCH1_uc001vbl.3_Missense_Mutation_p.V314L	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)	314										ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		ACACCAGCACGTGGAAGATGG	0.448													33	57	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58207715	58207715	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58207715C>A	uc001vhq.1	+	1	1927	c.1035C>A	c.(1033-1035)AAC>AAA	p.N345K	PCDH17_uc010aec.1_Missense_Mutation_p.N345K	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	345	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TCGACCGCAACGACAATGCGC	0.657													38	69	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110866278	110866278	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110866278G>C	uc001vqw.3	-	3	351	c.229C>G	c.(229-231)CAA>GAA	p.Q77E	COL4A1_uc010agl.2_Missense_Mutation_p.Q77E	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	77					angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CTTACCTTTTGTCCTGGTGGT	0.522													5	585	---	---	---	---	PASS
OR4K2	390431	broad.mit.edu	37	14	20345323	20345323	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20345323G>T	uc001vwh.1	+	1	897	c.897G>T	c.(895-897)AGG>AGT	p.R299S		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	299	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TAGCCATGAGGAAACTGAAAA	0.343													23	207	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389653	20389653	+	Silent	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389653T>A	uc010tkw.1	+	1	888	c.888T>A	c.(886-888)GCT>GCA	p.A296A		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATATGAAGGCTGCCGTAAGGA	0.388													24	218	---	---	---	---	PASS
RNASE2	6036	broad.mit.edu	37	14	21424410	21424410	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21424410C>G	uc010aif.2	+	2	549	c.480C>G	c.(478-480)ATC>ATG	p.I160M	RNASE2_uc001vyl.1_Missense_Mutation_p.I160M	NM_002934	NP_002925	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver,	160					chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity			ovary(1)	1	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		TGGATAGAATCATCTAAGCTC	0.458													96	285	---	---	---	---	PASS
OR5AU1	390445	broad.mit.edu	37	14	21623614	21623614	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21623614C>A	uc010tlp.1	-	1	571	c.571G>T	c.(571-573)GTC>TTC	p.V191F		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	191	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GAGGCACAGACCTCAGGAGAC	0.502													16	59	---	---	---	---	PASS
OR5AU1	390445	broad.mit.edu	37	14	21623615	21623615	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21623615C>A	uc010tlp.1	-	1	570	c.570G>T	c.(568-570)GAG>GAT	p.E190D		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	190	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		AGGCACAGACCTCAGGAGACA	0.507													15	59	---	---	---	---	PASS
OR10G2	26534	broad.mit.edu	37	14	22102181	22102181	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22102181A>G	uc010tmc.1	-	1	818	c.818T>C	c.(817-819)CTG>CCG	p.L273P		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	273	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		TGCCCCATCCAGGGGGTCTTT	0.542													18	67	---	---	---	---	PASS
KLHL28	54813	broad.mit.edu	37	14	45403624	45403624	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45403624C>G	uc001wvq.2	-	3	1283	c.1037G>C	c.(1036-1038)GGC>GCC	p.G346A	KLHL28_uc001wvr.2_Missense_Mutation_p.G346A	NM_017658	NP_060128	Q9NXS3	KLH28_HUMAN	BTB (POZ) domain containing 5	346	Kelch 2.									ovary(1)	1						GATAGTGACGCCAGGACGCAC	0.393													42	143	---	---	---	---	PASS
SDCCAG1	9147	broad.mit.edu	37	14	50295371	50295371	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50295371C>T	uc001wxc.2	-	14	1455	c.1387G>A	c.(1387-1389)GTT>ATT	p.V463I	SDCCAG1_uc010anj.1_Missense_Mutation_p.V463I|SDCCAG1_uc010tqi.1_Missense_Mutation_p.V463I|SDCCAG1_uc001wxe.2_Missense_Mutation_p.V421I|SDCCAG1_uc001wxd.1_5'UTR|SDCCAG1_uc010anq.1_Missense_Mutation_p.V234I	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1	463						cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		CTGAGATCAACATCTACAAGT	0.333													31	191	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63174853	63174853	+	Silent	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63174853A>G	uc001xfx.2	-	11	2391	c.2340T>C	c.(2338-2340)GAT>GAC	p.D780D	KCNH5_uc001xfy.2_3'UTR	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	780	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GTTCCATGGCATCACGGTTGT	0.493													51	98	---	---	---	---	PASS
TTLL5	23093	broad.mit.edu	37	14	76420762	76420762	+	Intron	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76420762T>C	uc001xrx.2	+						TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		CTTTCTCTTTTTCAGATCCTG	0.343													70	224	---	---	---	---	PASS
POMT2	29954	broad.mit.edu	37	14	77746415	77746415	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77746415G>A	uc001xti.2	-	17	1935	c.1734C>T	c.(1732-1734)CGC>CGT	p.R578R	POMT2_uc001xth.1_Silent_p.R276R	NM_013382	NP_037514	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	578					protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CCCCTGAGAAGCGTAGGCCCT	0.597													46	64	---	---	---	---	PASS
VIPAR	63894	broad.mit.edu	37	14	77894748	77894748	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77894748C>G	uc001xtt.1	-	20	1764	c.1426G>C	c.(1426-1428)GAG>CAG	p.E476Q	VIPAR_uc001xtu.1_Missense_Mutation_p.E476Q|VIPAR_uc010tvj.1_Missense_Mutation_p.E427Q|VIPAR_uc001xtv.1_Missense_Mutation_p.E476Q	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	476					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						TTCTCCTCCTCTGCTGATCCT	0.483													59	57	---	---	---	---	PASS
VIPAR	63894	broad.mit.edu	37	14	77915633	77915633	+	Intron	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77915633C>T	uc001xtt.1	-						VIPAR_uc001xtu.1_Intron|VIPAR_uc010tvj.1_Intron|VIPAR_uc001xtv.1_Intron	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894						endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						TGCTGTAACTCACCCTATACT	0.284													52	71	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103802424	103802424	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103802424G>A	uc001ymq.2	+	4	646	c.124G>A	c.(124-126)GTT>ATT	p.V42I	EIF5_uc001ymr.2_Missense_Mutation_p.V42I|EIF5_uc001yms.2_Missense_Mutation_p.V42I|EIF5_uc001ymt.2_Missense_Mutation_p.V42I|EIF5_uc001ymu.2_Missense_Mutation_p.V42I|SNORA28_uc001ymv.1_5'Flank	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	42					regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			CATGGTTGACGTTGCAAAGGC	0.413													26	162	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105406083	105406083	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105406083G>A	uc010axc.1	-	7	15825	c.15705C>T	c.(15703-15705)TTC>TTT	p.F5235F	AHNAK2_uc001ypx.2_Silent_p.F5135F	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5235						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAGAAACAAGGAACTCTTTGA	0.542													149	676	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105420878	105420878	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105420878G>T	uc010axc.1	-	7	1030	c.910C>A	c.(910-912)CTC>ATC	p.L304I	AHNAK2_uc001ypx.2_Missense_Mutation_p.L204I	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	304						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCACCGTGAGCTGGGCCTCT	0.652													9	61	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106347400	106347400	+	RNA	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106347400G>T	uc010tyt.1	-	3213		c.50474C>A								Parts of antibodies, mostly variable regions.												0						CATTGTGGTAGCCGCTGCTAT	0.567													5	96	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106691831	106691831	+	RNA	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106691831C>T	uc010tyt.1	-	754		c.20532G>A								Parts of antibodies, mostly variable regions.												0						GAGACCCACTCCAGCCCCTTC	0.537													100	331	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106691966	106691966	+	RNA	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106691966C>A	uc010tyt.1	-	754		c.20397G>T								Parts of antibodies, mostly variable regions.												0						AGCTGCACCTCACACTGGACA	0.522													49	225	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106691978	106691978	+	RNA	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106691978C>G	uc010tyt.1	-	754		c.20385G>C								Parts of antibodies, mostly variable regions.												0						CACTGGACACCTGCAAACAGA	0.527													54	252	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106926211	106926211	+	RNA	SNP	C	A	A	rs116899367	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106926211C>A	uc010tyt.1	-	235		c.10344G>T			uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						TAATACAAGGCGGTGTCCTCA	0.512													84	558	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107078546	107078546	+	RNA	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107078546G>T	uc010tyt.1	-	117		c.5744C>A								Parts of antibodies, mostly variable regions.												0						CGTTGTCCACGAGCCTGTCGC	0.532													19	76	---	---	---	---	PASS
RPUSD2	27079	broad.mit.edu	37	15	40861942	40861942	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40861942G>C	uc001zmd.1	+	1	406	c.406G>C	c.(406-408)GAG>CAG	p.E136Q		NM_152260	NP_689473	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing	136					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			skin(1)	1		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		TTATTACTTCGAGGGCGGCCT	0.617													14	14	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41279304	41279304	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41279304C>T	uc001zni.2	-	31	4030	c.3817G>A	c.(3817-3819)GAG>AAG	p.E1273K	INO80_uc010ucu.1_RNA	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	1273	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						TTCTCCAACTCTTCGTCGTCT	0.463													30	62	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42742495	42742495	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42742495T>A	uc001zpw.2	-	2	2241	c.1906A>T	c.(1906-1908)AGA>TGA	p.R636*	ZFP106_uc001zpu.2_5'Flank|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron|ZFP106_uc010udh.1_Nonsense_Mutation_p.R419*|ZFP106_uc001zpy.1_Nonsense_Mutation_p.R659*	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	636						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		GATAGCTCTCTAGAAGTCTTC	0.453													109	258	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43314927	43314927	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43314927T>C	uc001zqq.2	-	26	2878	c.2812A>G	c.(2812-2814)ACA>GCA	p.T938A	UBR1_uc010udk.1_Missense_Mutation_p.T938A	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	938					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AAGTCAAATGTTACTTCTTCT	0.333													20	47	---	---	---	---	PASS
B2M	567	broad.mit.edu	37	15	45003747	45003747	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45003747G>A	uc001zuc.2	+	1	63	c.3G>A	c.(1-3)ATG>ATA	p.M1I	B2M_uc010uek.1_Missense_Mutation_p.M1I|B2M_uc010bdx.1_Missense_Mutation_p.M1I	NM_004048	NP_004039	P61769	B2MG_HUMAN	beta-2-microglobulin precursor	1					antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding	p.M1V(2)		ovary(2)|skin(1)	3		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GGGCCGAGATGTCTCGCTCCG	0.612													35	66	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50264806	50264806	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50264806T>A	uc001zxu.2	-	13	1358	c.1216A>T	c.(1216-1218)AGA>TGA	p.R406*	ATP8B4_uc010ber.2_Nonsense_Mutation_p.R279*|ATP8B4_uc010ufd.1_Nonsense_Mutation_p.R279*|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	406	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ATGGAACATCTTTTAAAGGTC	0.388													21	62	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71211506	71211506	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71211506T>C	uc002asw.2	+	7	932	c.685T>C	c.(685-687)TTG>CTG	p.L229L	LRRC49_uc002asu.2_Silent_p.L219L|LRRC49_uc002asx.2_Silent_p.L185L|LRRC49_uc010ukf.1_Silent_p.L234L|LRRC49_uc002asy.2_5'UTR|LRRC49_uc002asz.2_Silent_p.L201L	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	229	LRR 6.					cytoplasm|microtubule				ovary(1)	1						TGAACTTAACTTGCGACACAA	0.328													50	144	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	71952965	71952965	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71952965G>C	uc002atb.1	+	7	1328	c.1249G>C	c.(1249-1251)GTG>CTG	p.V417L	THSD4_uc002atd.1_Missense_Mutation_p.V91L|THSD4_uc010ukg.1_Missense_Mutation_p.V57L|THSD4_uc002ate.2_Missense_Mutation_p.V57L	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	417						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TGTGTCGGGCGTGTTTAAGCA	0.552													51	156	---	---	---	---	PASS
SYNM	23336	broad.mit.edu	37	15	99672069	99672069	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99672069C>T	uc002bup.2	+	6	3624	c.3504C>T	c.(3502-3504)AGC>AGT	p.S1168S	SYNM_uc002buo.2_Intron|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	1168	Tail.|Interaction with TLN1 and VCL.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						CCGGAGCCAGCCGGTCTGTGA	0.612													3	44	---	---	---	---	PASS
HBM	3042	broad.mit.edu	37	16	216099	216099	+	Intron	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:216099G>A	uc002cfu.1	+							NM_001003938	NP_001003938	Q6B0K9	HBM_HUMAN	hemoglobin mu chain							hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		all_cancers(16;1.62e-06)|all_epithelial(16;4.01e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				GTCGGTAGAGGCGGGGTCTCC	0.697													6	6	---	---	---	---	PASS
CP110	9738	broad.mit.edu	37	16	19556465	19556465	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19556465C>A	uc002dgl.3	+	10	2883	c.2636C>A	c.(2635-2637)GCA>GAA	p.A879E	CP110_uc002dgk.3_Missense_Mutation_p.A879E			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;	879					centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						GTAATGGATGCAGCTGAAAGA	0.353													4	119	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20471458	20471458	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20471458C>G	uc010bwe.2	+	3	261	c.22C>G	c.(22-24)CAG>GAG	p.Q8E	ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Missense_Mutation_p.Q8E|ACSM2A_uc002dhg.3_Missense_Mutation_p.Q8E|ACSM2A_uc010vay.1_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	8					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						GCGAAAAGTTCAGGGACTTTG	0.498													11	36	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21108759	21108759	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21108759G>T	uc010vbe.1	-	18	2582	c.2582C>A	c.(2581-2583)GCC>GAC	p.A861D		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	861	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CTTCAGCATGGCCTGCAGAAG	0.463													65	161	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53504378	53504378	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53504378A>T	uc002ehi.3	+	16	2447	c.2329A>T	c.(2329-2331)ATC>TTC	p.I777F	RBL2_uc002ehj.2_Missense_Mutation_p.I487F|RBL2_uc010vgw.1_Intron	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	777	Spacer.|Pocket; binds E1A.				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						GACAGGCTCCATCCAGCCCCT	0.512													18	27	---	---	---	---	PASS
ZNF23	7571	broad.mit.edu	37	16	71482506	71482506	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71482506T>C	uc002faf.2	-	6	2236	c.1422A>G	c.(1420-1422)AAA>AAG	p.K474K	ZNF23_uc002fad.2_Silent_p.K416K|ZNF23_uc002fae.2_Silent_p.K416K|ZNF23_uc010vmf.1_Silent_p.K416K|ZNF23_uc002fag.2_Silent_p.K416K|ZNF23_uc002fah.2_Silent_p.K474K|ZNF23_uc002fai.2_Silent_p.K513K	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	474					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		ATTCAAAAGGTTTCTCCCCAG	0.433													26	82	---	---	---	---	PASS
ZNF23	7571	broad.mit.edu	37	16	71482585	71482585	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71482585T>A	uc002faf.2	-	6	2157	c.1343A>T	c.(1342-1344)TAT>TTT	p.Y448F	ZNF23_uc002fad.2_Missense_Mutation_p.Y390F|ZNF23_uc002fae.2_Missense_Mutation_p.Y390F|ZNF23_uc010vmf.1_Missense_Mutation_p.Y390F|ZNF23_uc002fag.2_Missense_Mutation_p.Y390F|ZNF23_uc002fah.2_Missense_Mutation_p.Y448F|ZNF23_uc002fai.2_Missense_Mutation_p.Y487F	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	448	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		ATTACACTCATAGGGCTTCTC	0.458													7	71	---	---	---	---	PASS
ZNF23	7571	broad.mit.edu	37	16	71482587	71482587	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71482587G>A	uc002faf.2	-	6	2155	c.1341C>T	c.(1339-1341)CCC>CCT	p.P447P	ZNF23_uc002fad.2_Silent_p.P389P|ZNF23_uc002fae.2_Silent_p.P389P|ZNF23_uc010vmf.1_Silent_p.P389P|ZNF23_uc002fag.2_Silent_p.P389P|ZNF23_uc002fah.2_Silent_p.P447P|ZNF23_uc002fai.2_Silent_p.P486P	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	447					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TACACTCATAGGGCTTCTCCC	0.458													6	68	---	---	---	---	PASS
MLKL	197259	broad.mit.edu	37	16	74712798	74712798	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74712798T>C	uc002fdb.2	-	7	1478	c.1037A>G	c.(1036-1038)AAG>AGG	p.K346R	MLKL_uc002fdc.2_Intron	NM_152649	NP_689862	Q8NB16	MLKL_HUMAN	mixed lineage kinase domain-like isoform 1	346	Protein kinase.						ATP binding|protein binding|protein kinase activity			stomach(2)	2						CACACTCACCTTCACTTGGTA	0.517													26	67	---	---	---	---	PASS
FA2H	79152	broad.mit.edu	37	16	74761134	74761134	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74761134G>T	uc002fde.1	-						FA2H_uc010vmy.1_Intron	NM_024306	NP_077282	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase						cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity				0						GCTCAGGGAAGAGCTCACCAG	0.577											OREG0023942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	32	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75512582	75512582	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512582C>T	uc002fef.2	-	3	1325	c.1145G>A	c.(1144-1146)GGC>GAC	p.G382D	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.G382D	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	382	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CCAAGTGAAGCCGTTCAGGCC	0.642													43	78	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	915092	915092	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:915092C>T	uc002fsd.2	-	19	2205	c.2095G>A	c.(2095-2097)GAT>AAT	p.D699N	ABR_uc002fse.2_Missense_Mutation_p.D653N|ABR_uc010vqf.1_Missense_Mutation_p.D150N|ABR_uc010vqg.1_Missense_Mutation_p.D481N|ABR_uc002fsg.2_Missense_Mutation_p.D662N|ABR_uc002fsh.1_Missense_Mutation_p.D307N|ABR_uc002fsf.2_Missense_Mutation_p.D236N	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	699	Rho-GAP.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		TCACTGGCATCGAAGACGGCC	0.642													33	88	---	---	---	---	PASS
METT10D	79066	broad.mit.edu	37	17	2405605	2405605	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2405605C>T	uc002fut.2	-	2	169	c.21G>A	c.(19-21)ATG>ATA	p.M7I	METT10D_uc002fuu.3_RNA|METT10D_uc010cka.2_Intron|METT10D_uc002fuv.2_Missense_Mutation_p.M7I|METT10D_uc010vqx.1_RNA|METT10D_uc010vqy.1_5'UTR	NM_024086	NP_076991	Q86W50	MET16_HUMAN	methyltransferase 10 domain containing	7							methyltransferase activity				0						TTCTTGCATGCATTGATTTAC	0.308													5	203	---	---	---	---	PASS
OR1D4	8385	broad.mit.edu	37	17	2966397	2966397	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2966397A>G	uc010vra.1	-	1	559	c.559T>C	c.(559-561)TGT>CGT	p.C187R		NM_003552	NP_003543			olfactory receptor, family 1, subfamily D,												0						CGAGGCCCACAGAAGGTCACC	0.557													6	42	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577532	7577532	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577532G>A	uc002gim.2	-	7	943	c.749C>T	c.(748-750)CCC>CTC	p.P250L	TP53_uc002gig.1_Missense_Mutation_p.P250L|TP53_uc002gih.2_Missense_Mutation_p.P250L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P118L|TP53_uc010cng.1_Missense_Mutation_p.P118L|TP53_uc002gii.1_Missense_Mutation_p.P118L|TP53_uc010cnh.1_Missense_Mutation_p.P250L|TP53_uc010cni.1_Missense_Mutation_p.P250L|TP53_uc002gij.2_Missense_Mutation_p.P250L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.P157L|TP53_uc002gio.2_Missense_Mutation_p.P118L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	250	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> L (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|RP -> SS (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|P -> Q (in sporadic cancers; somatic mutation).|P -> A (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P250L(37)|p.P250S(12)|p.0?(7)|p.P250P(4)|p.P250F(3)|p.P250N(2)|p.P250A(2)|p.M246_P250delMNRRP(2)|p.P250Q(2)|p.P250_L252delPIL(2)|p.P250H(1)|p.P250_I251insXXXXXX(1)|p.N247_P250delNRRP(1)|p.P250T(1)|p.P250_T253delPILT(1)|p.R249_P250insR(1)|p.R249_I251delRPI(1)|p.R248_P250delRRP(1)|p.P250_I251insXXXXXXX(1)|p.R249_T256delRPILTIIT(1)|p.I251fs*94(1)|p.R249_P250>SS(1)|p.R249_P250delRP(1)|p.P250_I251insX(1)|p.P250fs*14(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGTGAGGATGGGCCTCCGGTT	0.577		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			38	81	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11784586	11784586	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11784586C>A	uc002gne.2	+	55	10730	c.10662C>A	c.(10660-10662)CAC>CAA	p.H3554Q	DNAH9_uc010coo.2_Missense_Mutation_p.H2848Q|DNAH9_uc002gnf.2_5'Flank	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3554	AAA 5 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCATCCTCCACACCAAGCTGG	0.512													36	139	---	---	---	---	PASS
TEKT3	64518	broad.mit.edu	37	17	15234796	15234796	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15234796C>A	uc002gon.2	-	3	294	c.107G>T	c.(106-108)CGC>CTC	p.R36L		NM_031898	NP_114104	Q9BXF9	TEKT3_HUMAN	tektin 3	36					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		GTGGGGAAAGCGGTCCCTGTA	0.537													38	80	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16068452	16068452	+	Silent	SNP	A	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16068452A>G	uc002gpo.2	-	5	699	c.459T>C	c.(457-459)CAT>CAC	p.H153H	NCOR1_uc002gpn.2_Silent_p.H153H|NCOR1_uc002gpp.1_Silent_p.H44H|NCOR1_uc002gpr.2_Silent_p.H44H|NCOR1_uc002gps.1_Silent_p.H153H|NCOR1_uc010coz.1_5'UTR|NCOR1_uc010cpb.1_Silent_p.H153H|NCOR1_uc010cpa.1_Silent_p.H153H|NCOR1_uc002gpu.2_Silent_p.H153H	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	153	Interaction with ZBTB33 and HEXIM1.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATGGAGCTTCATGTTTGCCTC	0.383													16	257	---	---	---	---	PASS
CORO6	84940	broad.mit.edu	37	17	27944542	27944542	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27944542C>G	uc002hel.2	-	5	731	c.729G>C	c.(727-729)CAG>CAC	p.Q243H	CORO6_uc002hem.2_Intron|CORO6_uc002hen.2_5'UTR	NM_032854	NP_116243	Q6QEF8	CORO6_HUMAN	coronin 6	243	WD 4.				actin cytoskeleton organization	actin cytoskeleton	actin filament binding				0						CCAGCTCTCGCTGGCTCATGC	0.697													16	32	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32955625	32955625	+	Missense_Mutation	SNP	C	G	G	rs79883914		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32955625C>G	uc002hif.2	+	4	1100	c.772C>G	c.(772-774)CGG>GGG	p.R258G		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	258	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		TACCAAGTCACGGAGTGGCCA	0.612													13	28	---	---	---	---	PASS
EZH1	2145	broad.mit.edu	37	17	40861923	40861923	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40861923G>T	uc002iaz.2	-	13	1579	c.1434C>A	c.(1432-1434)ATC>ATA	p.I478I	EZH1_uc002iba.2_Silent_p.I469I|EZH1_uc010wgt.1_Silent_p.I408I|EZH1_uc010wgu.1_Silent_p.I484I|EZH1_uc010wgv.1_Silent_p.I438I|EZH1_uc010wgw.1_Silent_p.I339I|EZH1_uc010cyp.2_Silent_p.I379I|EZH1_uc010cyq.2_Silent_p.I395I|EZH1_uc010cyo.1_Silent_p.I141I|EZH1_uc010cyr.1_Silent_p.I130I	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1	478					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GCAGCTTCAGGATAAGTGATT	0.498													55	144	---	---	---	---	PASS
FMNL1	752	broad.mit.edu	37	17	43320608	43320608	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43320608G>T	uc002iin.2	+	17	2334	c.2134G>T	c.(2134-2136)GCC>TCC	p.A712S	FMNL1_uc002iiq.2_Missense_Mutation_p.A290S|FMNL1_uc010dag.2_RNA	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	712	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						ACTCATTGAGGCCAACCGGGC	0.627													9	190	---	---	---	---	PASS
ACSF2	80221	broad.mit.edu	37	17	48551024	48551024	+	Splice_Site	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48551024A>T	uc002iqu.2	+	13	1580	c.1476_splice	c.e13-2	p.G492_splice	ACSF2_uc010wml.1_Splice_Site_p.G449_splice|ACSF2_uc010wmm.1_Splice_Site_p.G517_splice|ACSF2_uc010wmn.1_Splice_Site_p.G479_splice|ACSF2_uc010wmo.1_Splice_Site_p.G332_splice|ACSF2_uc010dbt.1_Splice_Site	NM_025149	NP_079425	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2 precursor						fatty acid metabolic process	mitochondrion	ATP binding|ligase activity				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CTTTCCTTACAGAGATGTCGC	0.423													136	153	---	---	---	---	PASS
DGKE	8526	broad.mit.edu	37	17	54921412	54921412	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54921412A>T	uc002iur.2	+	3	677	c.497A>T	c.(496-498)GAG>GTG	p.E166V	DGKE_uc002ius.1_Missense_Mutation_p.E166V	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	166	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					GTACATGATGAGTGCATGAAA	0.323													18	83	---	---	---	---	PASS
SKA2	348235	broad.mit.edu	37	17	57232389	57232389	+	Intron	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57232389C>T	uc002ixd.2	-						PRR11_uc002ixf.1_5'Flank|PRR11_uc002ixg.1_5'Flank|SKA2_uc010dde.1_Missense_Mutation_p.G19D|SKA2_uc002ixe.2_Intron	NM_182620	NP_872426	Q8WVK7	SKA2_HUMAN	spindle and KT associated 2 isoform 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						TCTGGTCCAGCCTCCGCCGCC	0.592													111	105	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	58945988	58945988	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58945988G>C	uc002iyv.3	+	8	637	c.528G>C	c.(526-528)GAG>GAC	p.E176D	BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Missense_Mutation_p.E176D|BCAS3_uc002iyw.3_Missense_Mutation_p.E172D	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	176						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTACTGGGGAGATGGTCAAGT	0.333													82	75	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62042025	62042025	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62042025C>T	uc002jds.1	-	9	1332	c.1255G>A	c.(1255-1257)GCT>ACT	p.A419T		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	419	I.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	GTCTTGCCAGCTGCTCGAAGG	0.567													9	41	---	---	---	---	PASS
RHBDF2	79651	broad.mit.edu	37	17	74475058	74475058	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74475058G>A	uc002jrq.1	-	6	882	c.589C>T	c.(589-591)CGC>TGC	p.R197C	RHBDF2_uc002jrp.1_Missense_Mutation_p.R168C|RHBDF2_uc002jrr.1_Missense_Mutation_p.R49C|RHBDF2_uc010wtf.1_Missense_Mutation_p.R168C|RHBDF2_uc002jrs.1_Missense_Mutation_p.R192C	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	197	Cytoplasmic (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						TCCGGGTGGCGGAAGGCCCGG	0.682													24	42	---	---	---	---	PASS
MXRA7	439921	broad.mit.edu	37	17	74681218	74681218	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74681218C>A	uc002jsk.1	-	3	464	c.436G>T	c.(436-438)GGG>TGG	p.G146W	MXRA7_uc002jsl.2_Missense_Mutation_p.G146W|MXRA7_uc002jsm.2_Missense_Mutation_p.G146W	NM_001008528	NP_001008528	P84157	MXRA7_HUMAN	transmembrane anchor protein 1 isoform 1	146						integral to membrane					0						CTCAGCTTCCCGGGGCTGTAT	0.617													7	678	---	---	---	---	PASS
BAIAP2	10458	broad.mit.edu	37	17	79082295	79082295	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79082295G>A	uc002jzg.2	+	13	1629	c.1521G>A	c.(1519-1521)GCG>GCA	p.A507A	BAIAP2_uc002jyz.3_Silent_p.A507A|BAIAP2_uc002jza.2_Silent_p.A507A|BAIAP2_uc002jzc.2_Silent_p.A508A|BAIAP2_uc002jzb.2_Silent_p.A264A|BAIAP2_uc002jzd.2_Silent_p.A507A|BAIAP2_uc002jzf.2_Silent_p.A507A|BAIAP2_uc002jze.2_Silent_p.A540A|BAIAP2_uc010wuh.1_Silent_p.A429A|BAIAP2_uc002jzh.2_Silent_p.A508A|BAIAP2_uc010wui.1_Silent_p.A370A	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	507					axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			ACTATGGAGCGCGGTCCATGA	0.652													23	145	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2585114	2585114	+	Silent	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2585114A>T	uc002kli.2	+	7	764	c.582A>T	c.(580-582)ATA>ATT	p.I194I		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	194	Interaction with the N-terminus of CDCA1.|Nuclear localization.|Interaction with RB1.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						CTAATTAGATACATACTGCCA	0.338													46	119	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28913574	28913574	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28913574C>A	uc002kwp.2	+	7	919	c.707C>A	c.(706-708)GCT>GAT	p.A236D		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	236	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TATGCTCTTGCTGTAAGAGGC	0.413													19	102	---	---	---	---	PASS
ELANE	1991	broad.mit.edu	37	19	855689	855689	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:855689G>A	uc002lqb.2	+	4	530	c.492G>A	c.(490-492)GGG>GGA	p.G164G		NM_001972	NP_001963	P08246	ELNE_HUMAN	neutrophil elastase preproprotein	164	Peptidase S1.				cellular calcium ion homeostasis|negative regulation of chemokine biosynthetic process|negative regulation of chemotaxis|negative regulation of inflammatory response|negative regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of MAP kinase activity|positive regulation of smooth muscle cell proliferation|protein catabolic process|proteolysis|response to UV	cell surface|extracellular region|stored secretory granule	bacterial cell surface binding|cytokine binding|heparin binding			pancreas(1)	1					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGAACCGTGGGATCGCCAGCG	0.706									Kostmann_syndrome				42	138	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1791762	1791762	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1791762G>T	uc002ltw.2	-	20	2523	c.2289C>A	c.(2287-2289)ACC>ACA	p.T763T	ATP8B3_uc002ltv.2_Silent_p.T726T|ATP8B3_uc002ltx.2_RNA	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	763	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTGTCCCCGGTGAGCACCC	0.512													3	47	---	---	---	---	PASS
MATK	4145	broad.mit.edu	37	19	3778537	3778537	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3778537G>C	uc002lyt.2	-	13	1654	c.1254C>G	c.(1252-1254)TTC>TTG	p.F418L	MATK_uc002lyv.2_Missense_Mutation_p.F419L|MATK_uc002lyu.2_Missense_Mutation_p.F377L|MATK_uc010dtq.2_Missense_Mutation_p.F417L	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	418	Protein kinase.				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCATATGAGAAGACCTCCC	0.632													12	39	---	---	---	---	PASS
FEM1A	55527	broad.mit.edu	37	19	4793666	4793666	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4793666G>C	uc002mbf.2	+	1	1939	c.1800G>C	c.(1798-1800)CTG>CTC	p.L600L	uc002mbg.1_RNA	NM_018708	NP_061178	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a	600	ANK 9.				regulation of ubiquitin-protein ligase activity	cytoplasm	binding|ubiquitin-protein ligase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TGAATGCCCTGATCGAAGCAG	0.612													26	80	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5778597	5778597	+	Silent	SNP	C	T	T	rs2305926	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5778597C>T	uc002mda.2	+	22	2368	c.2307C>T	c.(2305-2307)GTC>GTT	p.V769V		NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	769	Cytoplasmic (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						GCAAGACGGTCTGCCAGTTCA	0.652													53	137	---	---	---	---	PASS
TUBB4	10382	broad.mit.edu	37	19	6495267	6495267	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6495267T>A	uc002mfg.1	-	4	1350	c.1243A>T	c.(1243-1245)ATG>TTG	p.M415L	TUBB4_uc002mff.1_Missense_Mutation_p.M343L|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	415					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		AGGTCATTCATGTTGCTCTCG	0.632													92	356	---	---	---	---	PASS
LDLR	3949	broad.mit.edu	37	19	11223989	11223989	+	Missense_Mutation	SNP	G	A	A	rs137943601		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11223989G>A	uc002mqk.3	+	9	1390	c.1222G>A	c.(1222-1224)GAG>AAG	p.E408K	LDLR_uc010xlk.1_Missense_Mutation_p.E408K|LDLR_uc010xll.1_Missense_Mutation_p.E367K|LDLR_uc010xlm.1_Missense_Mutation_p.E261K|LDLR_uc010xln.1_Missense_Mutation_p.E281K|LDLR_uc010xlo.1_Missense_Mutation_p.E240K	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	408	LDL-receptor class B 1.|Extracellular (Potential).		E -> K (may contribute to familial hypercholesterolemia; Algeria-1).		cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	CAACCGGCACGAGGTCAGGAA	0.627													28	73	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13325317	13325317	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13325317T>A	uc010dze.2	-	39	6076	c.5840A>T	c.(5839-5841)AAG>ATG	p.K1947M	CACNA1A_uc010xnd.1_Missense_Mutation_p.K652M|CACNA1A_uc002mwx.3_Missense_Mutation_p.K652M|CACNA1A_uc010dzc.2_Missense_Mutation_p.K1472M|CACNA1A_uc002mwy.3_Missense_Mutation_p.K1946M|CACNA1A_uc002mwv.3_Missense_Mutation_p.K463M	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	1947	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GCTCTTACACTTGTGAGGTGT	0.592													21	55	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13325326	13325326	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13325326G>A	uc010dze.2	-	39	6067	c.5831C>T	c.(5830-5832)ACA>ATA	p.T1944I	CACNA1A_uc010xnd.1_Missense_Mutation_p.T649I|CACNA1A_uc002mwx.3_Missense_Mutation_p.T649I|CACNA1A_uc010dzc.2_Missense_Mutation_p.T1469I|CACNA1A_uc002mwy.3_Missense_Mutation_p.T1943I|CACNA1A_uc002mwv.3_Missense_Mutation_p.T460I	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	1944	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	CTTGTGAGGTGTGACCAGCAG	0.602													19	55	---	---	---	---	PASS
CYP4F3	4051	broad.mit.edu	37	19	15769624	15769624	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15769624G>T	uc002nbj.2	+						CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron|CYP4F3_uc010xon.1_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GCCCAGGTAAGAGCGGCCTGT	0.577													82	282	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	16008362	16008362	+	Silent	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16008362C>A	uc002nbs.1	-	2	110	c.60G>T	c.(58-60)CTG>CTT	p.L20L	CYP4F2_uc010xot.1_Intron|CYP4F2_uc010xou.1_5'UTR	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	20					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						GCAGGAGGAGCAGCCAAGGGG	0.662													12	35	---	---	---	---	PASS
ANO8	57719	broad.mit.edu	37	19	17436171	17436171	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17436171G>A	uc002ngf.2	-	17	2845	c.2686C>T	c.(2686-2688)CGC>TGC	p.R896C	ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8	896	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(3)	3						TGCTGGTAGCGATGCTGGGCC	0.647													13	24	---	---	---	---	PASS
MAP1S	55201	broad.mit.edu	37	19	17838969	17838969	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17838969C>G	uc002nhe.1	+	5	2785	c.2776C>G	c.(2776-2778)CGA>GGA	p.R926G	MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_Missense_Mutation_p.R174G|MAP1S_uc010xpv.1_Missense_Mutation_p.R900G	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	926	Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for association with microtubules.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						GACTGCCACTCGAGGCCCGTC	0.612													9	33	---	---	---	---	PASS
SFRS14	10147	broad.mit.edu	37	19	19136416	19136416	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19136416C>A	uc002nkx.2	-	3	887	c.741G>T	c.(739-741)TTG>TTT	p.L247F	SFRS14_uc002nkz.1_Missense_Mutation_p.L261F|SFRS14_uc002nla.1_Missense_Mutation_p.L247F|SFRS14_uc002nlb.2_Missense_Mutation_p.L247F|SFRS14_uc010xqk.1_Intron	NM_014884	NP_055699	Q8IX01	SUGP2_HUMAN	splicing factor, arginine/serine-rich 14	247					mRNA processing|RNA splicing	nucleus	RNA binding				0			OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)			TCACATTTCTCAATGTGACAA	0.478													5	387	---	---	---	---	PASS
HAPLN4	404037	broad.mit.edu	37	19	19368619	19368619	+	3'UTR	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19368619T>A	uc002nmb.2	-	5					HAPLN4_uc002nmc.2_3'UTR	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			GTCCGCCTACTCCCAGCCTAG	0.557													3	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	19478981	19478981	+	IGR	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19478981C>A								KIAA0892 (9419 upstream) : GATAD2A (17661 downstream)																							CCTTCTGCCCCCACTGGACTG	0.552													16	68	---	---	---	---	PASS
ATP13A1	57130	broad.mit.edu	37	19	19762502	19762502	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19762502C>G	uc002nnh.3	-	17	2359	c.2331G>C	c.(2329-2331)GAG>GAC	p.E777D	ATP13A1_uc002nne.2_5'UTR|ATP13A1_uc002nnf.3_Missense_Mutation_p.E145D|ATP13A1_uc002nng.2_Missense_Mutation_p.E659D	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	777	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6						CCTCACCTTTCTCGGAGGGAG	0.617													10	60	---	---	---	---	PASS
KIRREL2	84063	broad.mit.edu	37	19	36352134	36352134	+	Silent	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36352134G>T	uc002ocb.3	+	9	1379	c.1167G>T	c.(1165-1167)GCG>GCT	p.A389A	KIRREL2_uc002obz.3_Silent_p.A389A|KIRREL2_uc002oca.3_Silent_p.A339A|KIRREL2_uc002occ.3_Silent_p.A336A|KIRREL2_uc002ocd.3_Silent_p.A386A	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	389	Extracellular (Potential).|Ig-like C2-type 4.			A -> V (in Ref. 1; AAP72167).	cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCGGCGCCGCGGAGGCTCGGC	0.692													7	16	---	---	---	---	PASS
KIRREL2	84063	broad.mit.edu	37	19	36352135	36352135	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36352135G>A	uc002ocb.3	+	9	1380	c.1168G>A	c.(1168-1170)GAG>AAG	p.E390K	KIRREL2_uc002obz.3_Missense_Mutation_p.E390K|KIRREL2_uc002oca.3_Missense_Mutation_p.E340K|KIRREL2_uc002occ.3_Missense_Mutation_p.E337K|KIRREL2_uc002ocd.3_Missense_Mutation_p.E387K	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	390	Extracellular (Potential).|Ig-like C2-type 4.				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGGCGCCGCGGAGGCTCGGCT	0.687													8	16	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38610161	38610161	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38610161C>A	uc002ohk.2	+	9	3016	c.2507C>A	c.(2506-2508)ACC>AAC	p.T836N		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	836					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GTCTCCAACACCCCCATCGAC	0.582													19	77	---	---	---	---	PASS
GSK3A	2931	broad.mit.edu	37	19	42738600	42738600	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42738600A>C	uc002otb.1	-	6	928	c.809T>G	c.(808-810)TTG>TGG	p.L270W	GSK3A_uc002ota.1_Missense_Mutation_p.L188W|GSK3A_uc002otc.2_RNA	NM_019884	NP_063937	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	270	Protein kinase.				insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of insulin receptor signaling pathway|negative regulation of transferase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process	beta-catenin destruction complex|cytosol	ATP binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|tau-protein kinase activity			ovary(2)|lung(2)	4		Prostate(69;0.00682)				CCCTCGGACCAACTGCTTTGC	0.602													58	136	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43690529	43690529	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43690529G>T	uc002ovu.2	-	1	160	c.29C>A	c.(28-30)ACA>AAA	p.T10K	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_5'Flank|PSG5_uc002ovx.2_Missense_Mutation_p.T10K|PSG5_uc002ovv.2_Missense_Mutation_p.T10K|PSG5_uc002ovw.2_Missense_Mutation_p.T10K	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	10					female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				GATGTGCTGTGTGCAGGGAGG	0.597													83	237	---	---	---	---	PASS
TRAPPC6A	79090	broad.mit.edu	37	19	45667444	45667444	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45667444T>A	uc002paw.2	-	4	351	c.332A>T	c.(331-333)CAG>CTG	p.Q111L	TRAPPC6A_uc002pav.2_Missense_Mutation_p.Q125L			O75865	TPC6A_HUMAN	SubName: Full=TRAPPC6Adelta29-42; SubName: Full=Trafficking protein particle complex 6A, isoform CRA_a;	111				SFPLLLPMASGLQYLEEAPKFLAFT -> KLSPPPPDGLWP AVSGGSTQVPGLH (in Ref. 1; AAF28967).	vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	guanylate cyclase activity|heme binding				0		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00872)|GBM - Glioblastoma multiforme(486;0.233)		CTCCAGATACTGCAGGCCAGA	0.647													9	18	---	---	---	---	PASS
MARK4	57787	broad.mit.edu	37	19	45797675	45797675	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45797675G>T	uc002pbb.1	+	14	1568	c.1563G>T	c.(1561-1563)GAG>GAT	p.E521D	MARK4_uc002pba.1_Missense_Mutation_p.E521D			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;	521					microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CGGGGGCTGAGCGCCCGTCAC	0.592													12	42	---	---	---	---	PASS
PLA2G4C	8605	broad.mit.edu	37	19	48571079	48571079	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48571079C>A	uc002phx.2	-	13	1469	c.1071G>T	c.(1069-1071)TGG>TGT	p.W357C	PLA2G4C_uc002phw.2_Missense_Mutation_p.W292C|PLA2G4C_uc010elr.2_Missense_Mutation_p.W357C|PLA2G4C_uc010xzd.1_Missense_Mutation_p.W367C	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC isoform 1 precursor	357	PLA2c.				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding			ovary(1)|skin(1)	2		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GAGTGGTCCCCCATTCCCACT	0.527													7	838	---	---	---	---	PASS
NTF4	4909	broad.mit.edu	37	19	49564643	49564643	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49564643G>C	uc002pmf.3	-	2	753	c.612C>G	c.(610-612)CTC>CTG	p.L204L	CGB7_uc010yah.1_Intron	NM_006179	NP_006170	P34130	NTF4_HUMAN	neurotrophin 5 preproprotein	204					adult locomotory behavior|epidermis development|ganglion mother cell fate determination|long-term memory|sensory organ boundary specification	endoplasmic reticulum lumen|extracellular region	growth factor activity				0		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		CAGTCCGGCTGAGGAGTGTGC	0.602													3	57	---	---	---	---	PASS
FLT3LG	2323	broad.mit.edu	37	19	49983548	49983548	+	Intron	SNP	T	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49983548T>G	uc010yau.1	+						FLT3LG_uc002pnv.2_Intron|FLT3LG_uc002pnw.2_Intron|FLT3LG_uc002pnu.2_Intron|FLT3LG_uc002pnx.2_Intron|FLT3LG_uc010yav.1_Intron	NM_001459	NP_001450	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand precursor						positive regulation of cell proliferation|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity				0		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		ctcCTCTTTCTCCCCAGACTC	0.373													15	34	---	---	---	---	PASS
NAPSA	9476	broad.mit.edu	37	19	50865269	50865269	+	Silent	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50865269G>C	uc002prx.2	-	3	359	c.306C>G	c.(304-306)CTC>CTG	p.L102L	NR1H2_uc002prv.3_Intron	NM_004851	NP_004842	O96009	NAPSA_HUMAN	napsin A preproprotein	102					proteolysis	extracellular region	aspartic-type endopeptidase activity				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)		ACGGGACCCAGAGATTGGAGG	0.542													10	24	---	---	---	---	PASS
MIR1283-1	100302265	broad.mit.edu	37	19	54191795	54191795	+	RNA	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54191795T>A	hsa-mir-1283-1|MI0003832	+			c.61T>A			MIR520A_hsa-mir-520a|MI0003149_5'Flank																	0						AGAAAGCGCTTCCCTTTTGAG	0.423													50	128	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55450741	55450741	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55450741C>T	uc002qih.3	-	4	1522	c.1446G>A	c.(1444-1446)CTG>CTA	p.L482L	NLRP7_uc002qig.3_Silent_p.L482L|NLRP7_uc002qii.3_Silent_p.L482L|NLRP7_uc010esk.2_Silent_p.L482L|NLRP7_uc010esl.2_Silent_p.L510L	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	482	NACHT.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CCTCCTTCTCCAGGGCGTAGA	0.592													42	138	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55708542	55708542	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55708542C>T	uc002qjq.2	-	9	2006	c.1933G>A	c.(1933-1935)GTG>ATG	p.V645M	PTPRH_uc010esv.2_Missense_Mutation_p.V467M|PTPRH_uc002qjs.2_Missense_Mutation_p.V652M	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	645	Extracellular (Potential).|Fibronectin type-III 7.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TCTGCCCACACGGTGAAATTG	0.557													33	103	---	---	---	---	PASS
TMEM190	147744	broad.mit.edu	37	19	55889435	55889435	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55889435G>C	uc002qkt.1	+	5	416	c.398G>C	c.(397-399)CGA>CCA	p.R133P		NM_139172	NP_631911	Q8WZ59	TM190_HUMAN	transmembrane protein 190 precursor	133	Cytoplasmic (Potential).					integral to membrane					0	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		TCCAAGCACCGAGGGACCAAG	0.522													22	58	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56539869	56539869	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539869C>A	uc002qmj.2	+	7	2270	c.2270C>A	c.(2269-2271)CCT>CAT	p.P757H	NLRP5_uc002qmi.2_Missense_Mutation_p.P738H	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	757						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CCTGTGGTCCCTCTATGGTGA	0.527													178	599	---	---	---	---	PASS
ZNF773	374928	broad.mit.edu	37	19	58018583	58018583	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58018583C>G	uc002qox.2	+	4	1260	c.1120C>G	c.(1120-1122)CTC>GTC	p.L374V	ZNF547_uc002qpm.3_Intron|ZNF773_uc002qoy.2_Missense_Mutation_p.L373V|ZNF773_uc002qoz.2_Intron	NM_198542	NP_940944	Q6PK81	ZN773_HUMAN	zinc finger protein 773	374	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		AAGCTCAAGCCTCATGCAACA	0.418													122	453	---	---	---	---	PASS
C19orf18	147685	broad.mit.edu	37	19	58470001	58470001	+	Missense_Mutation	SNP	G	A	A	rs139357251		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58470001G>A	uc002qqv.2	-	6	721	c.617C>T	c.(616-618)GCG>GTG	p.A206V		NM_152474	NP_689687	Q8NEA5	CS018_HUMAN	hypothetical protein LOC147685 precursor	206	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		ATTATGTGACGCATTCTTTGT	0.403													13	62	---	---	---	---	PASS
ZNF446	55663	broad.mit.edu	37	19	58991801	58991801	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58991801A>T	uc002qsz.2	+	7	1178	c.1061A>T	c.(1060-1062)CAC>CTC	p.H354L	ZNF446_uc002qta.2_Missense_Mutation_p.T326S|ZNF446_uc010eur.2_3'UTR|SLC27A5_uc002qtb.2_RNA	NM_017908	NP_060378	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	354	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CACCGGACACACACGAGTGGG	0.667													11	44	---	---	---	---	PASS
SLC27A5	10998	broad.mit.edu	37	19	59011000	59011000	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59011000C>T	uc002qtc.2	-	7	1636	c.1526G>A	c.(1525-1527)CGC>CAC	p.R509H	SLC27A5_uc002qtb.2_5'Flank	NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid	509	Cytoplasmic (Probable).				bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		TCGGGGGCCGCGGTAGCCCAC	0.657													51	195	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10631014	10631014	+	Intron	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10631014C>G	uc002wnw.2	-						JAG1_uc010gcd.1_5'UTR	NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor						angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						AATGTCTGGTCAACAAGAAAA	0.468									Alagille_Syndrome				7	40	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20278922	20278922	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20278922G>T	uc002wru.2	+	25	3390	c.3314G>T	c.(3313-3315)AGG>ATG	p.R1105M	C20orf26_uc002wrw.2_RNA	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	1105										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		TGCCTTTCTAGGGAGCCCTTC	0.478													29	91	---	---	---	---	PASS
XKR7	343702	broad.mit.edu	37	20	30584385	30584385	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30584385G>A	uc002wxe.2	+	3	1039	c.865G>A	c.(865-867)GAC>AAC	p.D289N		NM_001011718	NP_001011718	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related	289						integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGACTCGCGGGACGACAAGCG	0.701													14	33	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33623037	33623037	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33623037C>A	uc002xbk.2	-	8	974	c.940G>T	c.(940-942)GGC>TGC	p.G314C	TRPC4AP_uc010zuq.1_5'UTR|TRPC4AP_uc002xbl.2_Missense_Mutation_p.G314C|TRPC4AP_uc010zur.1_Missense_Mutation_p.G275C|TRPC4AP_uc002xbm.1_Missense_Mutation_p.G314C	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	314	Interaction with TNFRSF1A (By similarity).				protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CTGGCTGTGCCCGTTGACTCT	0.542													56	160	---	---	---	---	PASS
B4GALT5	9334	broad.mit.edu	37	20	48330202	48330202	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48330202C>A	uc002xuu.3	-	1	220	c.26G>T	c.(25-27)CGG>CTG	p.R9L		NM_004776	NP_004767	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	9	Cytoplasmic (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			GCGCGGCAGCCGCAGCAGCCC	0.647													2	0	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57828943	57828943	+	Intron	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57828943T>A	uc002yan.2	+							NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831							intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TCCTTTGCACTTTGTTGCAGG	0.448													64	227	---	---	---	---	PASS
CHODL	140578	broad.mit.edu	37	21	19635169	19635169	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19635169G>A	uc002ykv.2	+	5	1087	c.696G>A	c.(694-696)CTG>CTA	p.L232L	CHODL_uc002ykr.2_Silent_p.L191L|CHODL_uc002yks.2_Silent_p.L191L|CHODL_uc002ykt.2_Intron|CHODL_uc002yku.2_Intron	NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor	232	Helical; (Potential).				muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		TACTGATACTGGTTGCTTTTG	0.313													32	128	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22782636	22782636	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22782636G>T	uc002yld.1	+	10	1487	c.1238G>T	c.(1237-1239)TGG>TTG	p.W413L	NCAM2_uc011acb.1_Missense_Mutation_p.W271L	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	413	Ig-like C2-type 5.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TATTACTCTTGGGAAGGAAAT	0.299													13	64	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22782637	22782637	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22782637G>T	uc002yld.1	+	10	1488	c.1239G>T	c.(1237-1239)TGG>TGT	p.W413C	NCAM2_uc011acb.1_Missense_Mutation_p.W271C	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	413	Ig-like C2-type 5.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		ATTACTCTTGGGAAGGAAATC	0.299													14	64	---	---	---	---	PASS
ATP5J	522	broad.mit.edu	37	21	27096996	27096996	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27096996G>T	uc002yls.2	-						ATP5J_uc002ylt.2_Intron|ATP5J_uc002ylu.2_Intron|ATP5J_uc002ylv.2_Intron|ATP5J_uc002ylw.2_Intron	NM_001685	NP_001676	P18859	ATP5J_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain		hydrogen ion transmembrane transporter activity				0						GATCTAAGAAGAGGGGGAAAA	0.328													30	137	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38536341	38536341	+	Intron	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38536341G>T	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron|TTC3_uc002ywd.1_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				GTTTTTTGTTGTTATTTACCA	0.358													49	179	---	---	---	---	PASS
MTMR3	8897	broad.mit.edu	37	22	30416442	30416442	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30416442C>A	uc003agv.3	+	17	3122	c.2794C>A	c.(2794-2796)CCA>ACA	p.P932T	MTMR3_uc003agu.3_Missense_Mutation_p.P932T|MTMR3_uc003agw.3_Missense_Mutation_p.P932T	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	932					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CAATGGTGCCCCAGAGACTGA	0.582													5	214	---	---	---	---	PASS
INPP5J	27124	broad.mit.edu	37	22	31524495	31524495	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31524495T>C	uc003aju.3	+	9	2140	c.2048T>C	c.(2047-2049)CTA>CCA	p.L683P	INPP5J_uc003ajv.3_Missense_Mutation_p.L316P|INPP5J_uc003ajs.3_Missense_Mutation_p.L316P|INPP5J_uc011alk.1_Missense_Mutation_p.L616P|INPP5J_uc010gwg.2_Missense_Mutation_p.L248P|INPP5J_uc003ajw.2_Missense_Mutation_p.L119P|INPP5J_uc003ajt.3_Missense_Mutation_p.L315P|INPP5J_uc003ajx.2_Missense_Mutation_p.L48P|INPP5J_uc003ajy.2_Missense_Mutation_p.L48P|INPP5J_uc003ajz.2_Missense_Mutation_p.L123P	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	683	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						GACCGTATCCTATGGAAGGTC	0.597													22	49	---	---	---	---	PASS
INPP5J	27124	broad.mit.edu	37	22	31524595	31524595	+	Silent	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31524595C>T	uc003aju.3	+	9	2240	c.2148C>T	c.(2146-2148)TAC>TAT	p.Y716Y	INPP5J_uc003ajv.3_Silent_p.Y349Y|INPP5J_uc003ajs.3_Silent_p.Y349Y|INPP5J_uc011alk.1_Silent_p.Y649Y|INPP5J_uc010gwg.2_Silent_p.Y281Y|INPP5J_uc003ajw.2_Silent_p.Y152Y|INPP5J_uc003ajt.3_Silent_p.Y348Y|INPP5J_uc003ajx.2_Silent_p.Y81Y|INPP5J_uc003ajy.2_Silent_p.Y81Y|INPP5J_uc003ajz.2_Silent_p.Y156Y	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	716	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						ACATGGAATACACAGTCAGCG	0.617													18	91	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32545743	32545743	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32545743G>T	uc003amd.2	-	8	720	c.679C>A	c.(679-681)CTC>ATC	p.L227I		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	227										ovary(1)|skin(1)	2						taCTTACAGAGGTAATCTTCA	0.249													7	34	---	---	---	---	PASS
ISX	91464	broad.mit.edu	37	22	35463085	35463085	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35463085G>T	uc003anj.2	+	1	956	c.5G>T	c.(4-6)TGT>TTT	p.C2F	ISX_uc011amg.1_5'UTR	NM_001008494	NP_001008494	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	2						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)	5						CCCTCAATGTGTGCTGAGGTG	0.617													21	66	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36737470	36737470	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36737470C>G	uc003apg.2	-	3	666	c.435G>C	c.(433-435)GAG>GAC	p.E145D	MYH9_uc003aph.1_Missense_Mutation_p.E9D|MYH9_uc003api.1_Missense_Mutation_p.E145D	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	145	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GAGGGGGCATCTCGTGCCTCT	0.517			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				79	210	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37482458	37482458	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37482458C>T	uc003aqs.1	-	8	979	c.865G>A	c.(865-867)GTG>ATG	p.V289M	TMPRSS6_uc003aqt.1_Missense_Mutation_p.V280M|TMPRSS6_uc003aqu.2_Missense_Mutation_p.V280M	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	289	CUB 1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CAGCCGTACACCCTGGCAGAA	0.552													3	3	---	---	---	---	PASS
IL2RB	3560	broad.mit.edu	37	22	37539680	37539680	+	Intron	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37539680C>T	uc003aqv.1	-							NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor						interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AAGTGCCTGCCGGGCAAGATG	0.612													4	124	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38121544	38121544	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38121544C>A	uc003atr.2	+	7	3252	c.2981C>A	c.(2980-2982)CCT>CAT	p.P994H	TRIOBP_uc003atu.2_Missense_Mutation_p.P822H|TRIOBP_uc003atq.1_Missense_Mutation_p.P994H|TRIOBP_uc003ats.1_Missense_Mutation_p.P822H	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	994					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					ACTTCCTCACCTGTGTACCCC	0.647													5	531	---	---	---	---	PASS
SUN2	25777	broad.mit.edu	37	22	39176922	39176922	+	Intron	SNP	T	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39176922T>A	uc010gxr.1	-						DNAL4_uc003awj.2_Intron	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN	unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2						CCTGCACTGCTGGCAATACCT	0.562													22	72	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41574090	41574090	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41574090C>A	uc003azl.3	+	31	6770	c.6375C>A	c.(6373-6375)CAC>CAA	p.H2125Q		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	2125	Interaction with HTLV-1 Tax.|Interaction with NCOA2.				apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						AGGGGGTCCACTCCAATCCAG	0.627			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				22	88	---	---	---	---	PASS
PACSIN2	11252	broad.mit.edu	37	22	43308058	43308058	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43308058C>T	uc010gzg.2	-	2	251	c.29G>A	c.(28-30)GGA>GAA	p.G10E	PACSIN2_uc003bdg.3_Missense_Mutation_p.G10E|PACSIN2_uc003bde.3_Missense_Mutation_p.G10E|PACSIN2_uc003bdf.3_Missense_Mutation_p.G10E	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in	10					actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				CACTTCTACTCCAACGGAATC	0.473													28	130	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	44004396	44004396	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44004396G>A	uc003bdy.1	-	22	2862	c.2647C>T	c.(2647-2649)CTC>TTC	p.L883F	EFCAB6_uc003bdz.1_Missense_Mutation_p.L731F|EFCAB6_uc010gzi.1_Missense_Mutation_p.L731F|EFCAB6_uc010gzj.1_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	883	EF-hand 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				CTTGGTGTGAGGGGAATATCA	0.448													26	90	---	---	---	---	PASS
TBC1D22A	25771	broad.mit.edu	37	22	47189457	47189457	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47189457C>G	uc003bib.2	+	3	314	c.179C>G	c.(178-180)ACC>AGC	p.T60S	TBC1D22A_uc010haf.2_Missense_Mutation_p.T30S|TBC1D22A_uc003bic.2_Missense_Mutation_p.T60S|TBC1D22A_uc003bie.2_Missense_Mutation_p.T41S|TBC1D22A_uc003bid.2_RNA|TBC1D22A_uc010hag.2_RNA|TBC1D22A_uc003bif.2_Missense_Mutation_p.T13S	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	60						intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		AGGGTCAGCACCTTCCAGGAG	0.592													33	126	---	---	---	---	PASS
LMF2	91289	broad.mit.edu	37	22	50942847	50942847	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50942847T>C	uc003blp.2	-	12	1671	c.1640A>G	c.(1639-1641)TAT>TGT	p.Y547C	LMF2_uc010hba.2_Missense_Mutation_p.Y369C|LMF2_uc003blo.2_Missense_Mutation_p.Y522C	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	547						endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GTGGAAGGGATACCTGGCCAC	0.547													7	36	---	---	---	---	PASS
GYG2	8908	broad.mit.edu	37	X	2778075	2778075	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2778075C>A	uc004cqs.1	+	8	1181	c.899C>A	c.(898-900)GCG>GAG	p.A300E	GYG2_uc004cqt.1_Missense_Mutation_p.A269E|GYG2_uc004cqu.1_Missense_Mutation_p.A269E|GYG2_uc004cqv.1_Missense_Mutation_p.A114E|GYG2_uc004cqw.1_Missense_Mutation_p.A260E|GYG2_uc004cqx.1_Missense_Mutation_p.A269E|GYG2_uc010ndc.1_Missense_Mutation_p.A114E	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	300					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGCGTCCAAGCGGGGGAAGCA	0.577													6	7	---	---	---	---	PASS
VCX3B	425054	broad.mit.edu	37	X	8433594	8433594	+	Splice_Site	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8433594G>T	uc010ndo.2	+	2	409	c.102_splice	c.e2+1	p.K34_splice	VCX3B_uc011mht.1_Splice_Site_p.K34_splice|VCX3B_uc004csd.1_Splice_Site_p.K34_splice	NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B							nucleolus					0						GAAGAAGAAGGTGAGTGACCC	0.637													4	155	---	---	---	---	PASS
BEND2	139105	broad.mit.edu	37	X	18195717	18195717	+	Silent	SNP	G	T	T	rs149324488		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18195717G>T	uc004cyj.3	-	10	1756	c.1602C>A	c.(1600-1602)CTC>CTA	p.L534L	BEND2_uc010nfb.2_Silent_p.L443L	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	534	BEN 1.									ovary(3)|kidney(1)|central_nervous_system(1)	5						TGTTCGGGTCGAGGGATTGGC	0.388													174	212	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29973457	29973457	+	Silent	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29973457T>C	uc004dby.2	+	11	2119	c.1611T>C	c.(1609-1611)ATT>ATC	p.I537I		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	537	Cytoplasmic (Potential).|TIR.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TGACGGTCATTAAATGGCATG	0.413													25	39	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41060306	41060306	+	Intron	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41060306C>G	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						ATCTTTCCTTCTCTCAGCTTG	0.478													3	45	---	---	---	---	PASS
DDX3X	1654	broad.mit.edu	37	X	41201857	41201857	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41201857G>A	uc004dfe.2	+	5	1249	c.394G>A	c.(394-396)GAT>AAT	p.D132N	DDX3X_uc010nhf.1_Missense_Mutation_p.D116N|DDX3X_uc004dff.2_Missense_Mutation_p.D132N|DDX3X_uc011mkq.1_Missense_Mutation_p.D116N|DDX3X_uc011mkr.1_Missense_Mutation_p.D132N|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA|DDX3X_uc011mkt.1_RNA	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3	132					interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						TGACAAATCAGATGAAGATGA	0.453										HNSCC(61;0.18)			56	55	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54776340	54776340	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54776340G>A	uc004dtj.2	-	13	3960	c.3930C>T	c.(3928-3930)TCC>TCT	p.S1310S		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	1310					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						ACAGGACATAGGAGAGGTAGG	0.592													10	16	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64748148	64748148	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64748148G>A	uc004dwa.1	-	7	1020	c.948C>T	c.(946-948)TGC>TGT	p.C316C	LAS1L_uc004dwc.1_Silent_p.C316C|LAS1L_uc004dwd.1_Silent_p.C274C	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	316						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						ACCTGTTCTCGCATGTAACGC	0.498											OREG0019826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	13	---	---	---	---	PASS
LPAR4	2846	broad.mit.edu	37	X	78010794	78010794	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78010794C>A	uc010nme.2	+	2	833	c.428C>A	c.(427-429)CCT>CAT	p.P143H		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	143	Cytoplasmic (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						ATTGTCTATCCTTTTCGATCT	0.463													59	71	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78426664	78426664	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78426664G>T	uc004edg.1	+	1	196	c.160G>T	c.(160-162)GCT>TCT	p.A54S		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	54	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						AACAAAACGAGCTGTGATATT	0.383										HNSCC(63;0.18)			5	14	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78427455	78427455	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78427455A>T	uc004edg.1	+	1	987	c.951A>T	c.(949-951)AAA>AAT	p.K317N		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	317	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						TCCATGCAAAATCCTTTGTGA	0.393										HNSCC(63;0.18)			44	47	---	---	---	---	PASS
ITM2A	9452	broad.mit.edu	37	X	78622693	78622693	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78622693T>C	uc004edh.2	-	1	355	c.20A>G	c.(19-21)AAT>AGT	p.N7S	ITM2A_uc011mqr.1_Missense_Mutation_p.N7S	NM_004867	NP_004858	O43736	ITM2A_HUMAN	integral membrane protein 2A	7						integral to membrane	protein binding			lung(2)	2						GGTAGGGGTATTGAAGGCGAT	0.592													14	8	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128574	83128574	+	Silent	SNP	G	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128574G>A	uc004eei.1	+	4	879	c.858G>A	c.(856-858)AAG>AAA	p.K286K	CYLC1_uc004eeh.1_Silent_p.K285K	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	286	1.				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						ATACAAAGAAGGACACAAAAA	0.303													18	16	---	---	---	---	PASS
ARMCX6	54470	broad.mit.edu	37	X	100871326	100871326	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100871326G>T	uc004ehx.2	-	3	630	c.285C>A	c.(283-285)AAC>AAA	p.N95K	ARMCX6_uc004ehy.2_Missense_Mutation_p.N95K	NM_019007	NP_061880	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	95						integral to membrane					0						GGTGTGCTCGGTTGGCCTTGC	0.532													96	135	---	---	---	---	PASS
BEX1	55859	broad.mit.edu	37	X	102318111	102318111	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102318111C>G	uc004ejt.1	-	3	332	c.92G>C	c.(91-93)GGG>GCG	p.G31A		NM_018476	NP_060946	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	31					cell differentiation|nervous system development	cytoplasm|nucleus				ovary(1)	1						CAAGGGCTCCCCTTTATTAGC	0.488													260	302	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118215378	118215378	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118215378G>T	uc004era.3	-	14	5044	c.5044C>A	c.(5044-5046)CCA>ACA	p.P1682T		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1682										ovary(4)|skin(1)	5						GGCTCAACTGGGTTCTGGAAC	0.478													125	118	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122319751	122319751	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122319751C>G	uc004etq.3	+	3	470	c.177C>G	c.(175-177)AAC>AAG	p.N59K	GRIA3_uc004etr.3_Missense_Mutation_p.N59K|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.N43K|GRIA3_uc010nqs.1_Missense_Mutation_p.N59K	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	59	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	AGTTATACAACACCAACCAGA	0.458													55	67	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122757717	122757717	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122757717G>C	uc004etu.2	-	28	3456	c.3424C>G	c.(3424-3426)CAA>GAA	p.Q1142E	THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_5'Flank	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1142					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TCCAAAGCTTGACCCAGATTC	0.363													54	63	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152814999	152814999	+	Silent	SNP	C	T	T	rs140403057		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152814999C>T	uc004fht.1	+	9	1509	c.1383C>T	c.(1381-1383)TGC>TGT	p.C461C	ATP2B3_uc004fhs.1_Silent_p.C461C	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	461	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGATGCCTGCGAGACCATGG	0.592													5	224	---	---	---	---	PASS
DDX3Y	8653	broad.mit.edu	37	Y	15023843	15023843	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15023843G>C	uc004fsu.1	+	5	553	c.244G>C	c.(244-246)GGT>CGT	p.G82R	DDX3Y_uc010nwv.1_Missense_Mutation_p.G82R|DDX3Y_uc011naq.1_Missense_Mutation_p.G82R|DDX3Y_uc004fsv.2_Missense_Mutation_p.G82R|DDX3Y_uc010nww.1_Intron|DDX3Y_uc011nar.1_Missense_Mutation_p.G79R	NM_001122665	NP_001116137	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3,	82						cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|RNA binding				0						AGGAAAGCCTGGTTATTTCAG	0.383													85	99	---	---	---	---	PASS
KDM5D	8284	broad.mit.edu	37	Y	21894629	21894629	+	Splice_Site	SNP	C	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21894629C>A	uc004fug.2	-	9	1222	c.934_splice	c.e9-1	p.I312_splice	KDM5D_uc011naz.1_Splice_Site_p.I312_splice|KDM5D_uc010nwy.2_Splice_Site_p.I255_splice|KDM5D_uc011nba.1_Splice_Site_p.I312_splice|KDM5D_uc004fuh.2_Splice_Site_p.I267_splice	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D isoform						chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)	ATGAGTCAATCTACCAAAAAA	0.363													6	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	5796433	5796452	+	IGR	DEL	ATAGATAGATAGATAGATAC	-	-	rs61763304		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5796433_5796452delATAGATAGATAGATAGATAC								AJAP1 (952583 upstream) : NPHP4 (126418 downstream)																							agatagatagatagatagatagatagatacatacatacat	0.032													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34789507	34789508	+	IGR	INS	-	T	T	rs71029034		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34789507_34789508insT								C1orf94 (104778 upstream) : MIR552 (345692 downstream)																							tccttccttcctccttccttcc	0.025													6	3	---	---	---	---	
SCMH1	22955	broad.mit.edu	37	1	41582429	41582430	+	Intron	INS	-	A	A	rs147072574	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41582429_41582430insA	uc001cgo.2	-						SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Intron|SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgs.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron|SCMH1_uc010ojs.1_Intron	NM_001031694	NP_001026864	Q96GD3	SCMH1_HUMAN	sex comb on midleg 1 isoform 1						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				CCTTATAGTCTAATATATTCCT	0.361													1	5	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86324301	86324301	+	Intron	DEL	T	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86324301delT	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CCTTATTTTCtccctccttcc	0.025													4	2	---	---	---	---	
ATP1A1	476	broad.mit.edu	37	1	116933159	116933159	+	Intron	DEL	T	-	-	rs71766078		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116933159delT	uc001ege.2	+						ATP1A1_uc010owv.1_Intron|ATP1A1_uc010oww.1_Intron|ATP1A1_uc010owx.1_Intron	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a						ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	ttcttttttgttttttttttt	0.299													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54907447	54907450	+	IGR	DEL	TCTT	-	-	rs71408782		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54907447_54907450delTCTT								SPTBN1 (8865 upstream) : EML6 (44699 downstream)																							ttcttttttctctttctttctttc	0.132													11	5	---	---	---	---	
C2orf86	51057	broad.mit.edu	37	2	63589393	63589394	+	Intron	INS	-	TT	TT	rs67493046		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63589393_63589394insTT	uc002sch.2	-						C2orf86_uc002sce.2_Intron|C2orf86_uc002scf.2_Intron|C2orf86_uc010ypu.1_Intron|C2orf86_uc002scg.2_Intron	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						GGTAGAATCCCTTTTTTTTTTT	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73410440	73410440	+	IGR	DEL	G	-	-	rs113492830		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73410440delG								RAB11FIP5 (70294 upstream) : NOTO (18946 downstream)																							aaggaaggaagggaaagaagg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	101230533	101230540	+	IGR	DEL	TTTCTTTC	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101230533_101230540delTTTCTTTC								PDCL3 (37332 upstream) : NPAS2 (206073 downstream)																							tctttctttgtttctttctttctttctt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102193327	102193328	+	IGR	INS	-	TC	TC	rs71914306		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102193327_102193328insTC								RFX8 (102162 upstream) : MAP4K4 (121160 downstream)																							gtgtgtgtgtgtgtgtgtgtgt	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	181555616	181555617	+	IGR	DEL	TG	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181555616_181555617delTG								CWC22 (683776 upstream) : UBE2E3 (289495 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.277													4	2	---	---	---	---	
UBE2E3	10477	broad.mit.edu	37	2	181925618	181925618	+	Intron	DEL	T	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181925618delT	uc002unq.1	+						UBE2E3_uc002unr.1_Intron|UBE2E3_uc010fri.1_Intron	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						ttttttttAGTTAGCTTTAAA	0.303													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	215562789	215562789	+	IGR	DEL	C	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215562789delC								VWC2L (122136 upstream) : BARD1 (30486 downstream)																							TGCAGGGTAACCCAGGCTGCC	0.507													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232445309	232445311	+	IGR	DEL	GGA	-	-	rs111897916		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232445309_232445311delGGA								NMUR1 (50127 upstream) : C2orf57 (12301 downstream)																							agaagaagagggaggaggaggag	0.000													3	5	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1442969	1442972	+	Intron	DEL	AATT	-	-	rs34787015		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1442969_1442972delAATT	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CTGTGATTAGAATTAATATATTTC	0.314													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40538610	40538613	+	IGR	DEL	GCGC	-	-	rs71618941		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40538610_40538613delGCGC								ZNF619 (8496 upstream) : ZNF620 (8917 downstream)																							gtgtgtgtgtgcgcgcgcgcgcgt	0.118													4	3	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49318925	49318926	+	Intron	DEL	AC	-	-	rs74991211		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49318925_49318926delAC	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		atatatatatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139633546	139633547	+	IGR	INS	-	TT	TT	rs71916747		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139633546_139633547insTT								NMNAT3 (236706 upstream) : CLSTN2 (20480 downstream)																							Ttgtgtgtgtgtgtgtgtgtgt	0.297													4	4	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173919131	173919146	+	Intron	DEL	AGGAATGAAGGAAGGA	-	-	rs141892977		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173919131_173919146delAGGAATGAAGGAAGGA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ggaaggtgggaggaatgaaggaaggaaggaaggaag	0.097													6	7	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175010382	175010383	+	Intron	INS	-	AC	AC	rs150395131	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175010382_175010383insAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TGAGTTGGGATacacacacaca	0.277													7	7	---	---	---	---	
N4BP2	55728	broad.mit.edu	37	4	40143745	40143750	+	Intron	DEL	AGGGAG	-	-	rs794004		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40143745_40143750delAGGGAG	uc003guy.3	+						N4BP2_uc010ifq.2_Intron|N4BP2_uc010ifr.2_Intron	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2							cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						gggagaccatagggagagggggaggg	0.126													4	3	---	---	---	---	
GABRB1	2560	broad.mit.edu	37	4	47427497	47427498	+	Intron	INS	-	GATAGATA	GATAGATA	rs144288589	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47427497_47427498insGATAGATA	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TGGATGATGATgatagatagat	0.257													4	6	---	---	---	---	
ADH1C	126	broad.mit.edu	37	4	100261040	100261041	+	Intron	INS	-	A	A	rs138827617	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100261040_100261041insA	uc003huu.2	-							NM_000669	NP_000660	P00326	ADH1G_HUMAN	class I alcohol dehydrogenase, gamma subunit						ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)	AGTGCTTTCACAAAAAAAATCA	0.327									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	125391768	125391771	+	IGR	DEL	TCTT	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125391768_125391771delTCTT								LOC285419 (540250 upstream) : ANKRD50 (193697 downstream)																							tctccctttctctttctttctttc	0.049													9	5	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139964069	139964069	+	Intron	DEL	A	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964069delA	uc003ihl.2	+						CCRN4L_uc003ihk.1_Intron	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					actccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
GUCY1B3	2983	broad.mit.edu	37	4	156721094	156721094	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156721094delC	uc003ipc.2	+	9	1210	c.1043delC	c.(1042-1044)GCCfs	p.A348fs	GUCY1B3_uc011cio.1_Frame_Shift_Del_p.A370fs|GUCY1B3_uc011cip.1_Frame_Shift_Del_p.A328fs|GUCY1B3_uc003ipd.2_Frame_Shift_Del_p.A276fs|GUCY1B3_uc010iqf.2_Frame_Shift_Del_p.A348fs|GUCY1B3_uc010iqg.2_Frame_Shift_Del_p.A276fs|GUCY1B3_uc011ciq.1_Frame_Shift_Del_p.A276fs	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	348					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		CTGCATGATGCCACGCGCGAT	0.458													81	48	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2681707	2681712	+	IGR	DEL	AGAAAG	-	-	rs10592047		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2681707_2681712delAGAAAG								IRX4 (798827 upstream) : IRX2 (64569 downstream)																							aaagaaagaaagaaagagagaaagaa	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3382101	3382102	+	IGR	DEL	AC	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3382101_3382102delAC								C5orf38 (626589 upstream) : IRX1 (214066 downstream)																							ACCCCCCAAAacacacacacac	0.213													4	2	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14798600	14798601	+	Intron	INS	-	T	T	rs78753908		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14798600_14798601insT	uc003jfm.3	-							NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						CGCGGTCTCtattttttttttt	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	33111479	33111480	+	IGR	DEL	GT	-	-	rs10544573		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33111479_33111480delGT								C5orf23 (319660 upstream) : TARS (329322 downstream)																							attaaataaggtgtgtgtgtgt	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44716765	44716766	+	IGR	INS	-	GAAG	GAAG	rs144322268	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44716765_44716766insGAAG								FGF10 (327981 upstream) : MRPS30 (92261 downstream)																							gaaggaagcaagaaggaaggaa	0.000													12	6	---	---	---	---	
MIER3	166968	broad.mit.edu	37	5	56224818	56224819	+	Intron	INS	-	CACACACACACACA	CACACACACACACA	rs146870702		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56224818_56224819insCACACACACACACA	uc003jrd.1	-						MIER3_uc003jqz.1_Intron|MIER3_uc003jra.1_Intron|MIER3_uc003jrb.1_Intron|MIER3_uc003jrc.1_Intron	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		actctctctctcacacacacac	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77965489	77965490	+	IGR	INS	-	AAAGA	AAAGA	rs140350170	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77965489_77965490insAAAGA								LHFPL2 (20841 upstream) : ARSB (107549 downstream)																							gaaaggaaaggaaagaaaagaa	0.158													8	6	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170384077	170384080	+	Intron	DEL	ACAC	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170384077_170384080delACAC	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ctgtctcaaaacacacacacacac	0.098			T	TRD@	ALL								4	2	---	---	---	---	
RUFY1	80230	broad.mit.edu	37	5	179036199	179036200	+	Intron	DEL	CT	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179036199_179036200delCT	uc003mka.1	+						RUFY1_uc003mkb.1_Intron|RUFY1_uc003mkc.1_Intron|RUFY1_uc003mkd.1_Intron	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a						endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ctgagcaagactctatctcaaa	0.193										HNSCC(44;0.11)			2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	179513203	179513204	+	IGR	DEL	TT	-	-	rs146020552		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179513203_179513204delTT								RNF130 (14094 upstream) : RASGEF1C (14592 downstream)																							AAGAGATTAGtttttttttttt	0.208													4	2	---	---	---	---	
ZSCAN23	222696	broad.mit.edu	37	6	28403542	28403542	+	Intron	DEL	A	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28403542delA	uc003nli.3	-						ZSCAN23_uc003nlh.2_Intron|ZSCAN23_uc010jrf.1_Intron|ZSCAN23_uc011dli.1_Intron	NM_001012455	NP_001012458	Q3MJ62	ZSC23_HUMAN	zinc finger protein 390						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGTCTGGCATAAAAAAAAAAT	0.443													4	3	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38952247	38952248	+	Intron	DEL	CA	-	-	rs34819199		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38952247_38952248delCA	uc003ooe.1	+						DNAH8_uc003oog.1_3'UTR	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						cacacacatgcacacacacaca	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	49540187	49540188	+	IGR	INS	-	TCCTTCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCTTCCT			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49540187_49540188insTCCTTCCTTCCTTCCTTCCT								C6orf141 (10562 upstream) : RHAG (32705 downstream)																							TATcttccttctccttccttcc	0.109													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	72051677	72051680	+	IGR	DEL	TGTT	-	-	rs3071004	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72051677_72051680delTGTT								OGFRL1 (39704 upstream) : MIR30C2 (34983 downstream)																							tgtgtgtgtgtgtTTCAGAACAAA	0.319													5	3	---	---	---	---	
SLC17A5	26503	broad.mit.edu	37	6	74320415	74320415	+	Intron	DEL	A	-	-	rs10707321		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74320415delA	uc003phn.3	-						SLC17A5_uc010kax.2_Intron|SLC17A5_uc010kay.2_Intron|SLC17A5_uc011dyo.1_Intron	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin						anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity			skin(5)|central_nervous_system(1)	6						ATTTCATGAGAAAAAAAAAAT	0.308													4	2	---	---	---	---	
MYO6	4646	broad.mit.edu	37	6	76486370	76486371	+	Intron	INS	-	GT	GT	rs138812712	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76486370_76486371insGT	uc003pih.1	+						MYO6_uc003pig.1_Intron	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		agaaacgtgcagtgtgtgtgtg	0.119													4	2	---	---	---	---	
TPBG	7162	broad.mit.edu	37	6	83074571	83074572	+	5'UTR	INS	-	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83074571_83074572insT	uc003pjn.3	+	3					TPBG_uc010kbj.2_5'UTR|TPBG_uc003pjo.2_5'UTR	NM_006670	NP_006661	Q13641	TPBG_HUMAN	trophoblast glycoprotein precursor						cell adhesion	integral to plasma membrane				central_nervous_system(1)	1		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CGAGAGGAAAGTTTTTTTTTTC	0.703													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138156122	138156123	+	Intron	INS	-	AGGC	AGGC	rs56232106	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138156122_138156123insAGGC	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																		ggaaggaaggaaggcaggctct	0.035													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148619848	148619849	+	IGR	INS	-	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148619848_148619849insG								SAMD5 (728691 upstream) : SASH1 (43880 downstream)																							gaaggaaggaagaaggaaggga	0.015													3	3	---	---	---	---	
PPIL4	85313	broad.mit.edu	37	6	149862317	149862317	+	Intron	DEL	T	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149862317delT	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		AAAATATTACTTTTTTTTTTT	0.259													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945312	945313	+	Intron	INS	-	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945312_945313insA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aaggagaaagggaaaggagaaa	0.000													4	2	---	---	---	---	
SEPT7P2	641977	broad.mit.edu	37	7	45764990	45764991	+	Intron	INS	-	GGAA	GGAA			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45764990_45764991insGGAA	uc003tnh.2	-						SEPT7P2_uc003tnf.3_RNA	NR_024271				Homo sapiens mRNA; cDNA DKFZp313J1114 (from clone DKFZp313J1114).												0						gaaaagaaaagggaaggaagga	0.005													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68223761	68223762	+	IGR	INS	-	AGGG	AGGG	rs2428835	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68223761_68223762insAGGG								None (None upstream) : AUTS2 (840143 downstream)																							ggaaggaaggaagggagggagg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	69014157	69014158	+	IGR	DEL	TG	-	-	rs35688332		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69014157_69014158delTG								None (None upstream) : AUTS2 (49747 downstream)																							CCTCAgtgtttgtgtgtgtgtg	0.208													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98472505	98472507	+	IGR	DEL	TTG	-	-	rs112543159		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98472505_98472507delTTG								TMEM130 (4832 upstream) : TRRAP (3606 downstream)																							tctagcctTTttgttgttgttgt	0.030													1	5	---	---	---	---	
WDR91	29062	broad.mit.edu	37	7	134880705	134880706	+	Intron	INS	-	A	A			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134880705_134880706insA	uc003vsp.2	-						WDR91_uc010lmq.2_Intron|WDR91_uc010lmr.2_Intron	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91											breast(2)|ovary(1)|skin(1)	4						tctcaataaggaaaaaaaaaaa	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739484	155739487	+	IGR	DEL	TTCC	-	-	rs72203088		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739484_155739487delTTCC								SHH (134517 upstream) : C7orf4 (593698 downstream)																							ttctttctctttccttccttcctt	0.000													4	6	---	---	---	---	
ASPH	444	broad.mit.edu	37	8	62437927	62437930	+	Intron	DEL	ACAT	-	-	rs71992492		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62437927_62437930delACAT	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	acacacacacacatacacacacGC	0.314													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81121519	81121520	+	IGR	DEL	TA	-	-	rs113126430		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81121519_81121520delTA								TPD52 (37683 upstream) : ZBTB10 (276334 downstream)																							tgtgtgtgtgtatgtgtgtgtg	0.213													0	6	---	---	---	---	
SYBU	55638	broad.mit.edu	37	8	110656747	110656747	+	Intron	DEL	C	-	-	rs113990026		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110656747delC	uc003ynj.3	-						SYBU_uc003yni.3_5'Flank|SYBU_uc003ynk.3_Intron|SYBU_uc010mco.2_Intron|SYBU_uc003ynl.3_Intron|SYBU_uc010mcp.2_Intron|SYBU_uc010mcq.2_Intron|SYBU_uc003yno.3_Intron|SYBU_uc010mcr.2_Intron|SYBU_uc003ynm.3_Intron|SYBU_uc003ynn.3_Intron|SYBU_uc010mcs.2_Intron|SYBU_uc010mct.2_Intron|SYBU_uc010mcu.2_Intron|SYBU_uc003ynp.3_Intron|SYBU_uc010mcv.2_Intron|uc003ynq.1_Intron	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein							cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						ACCACCACCTCCTTCCACCTT	0.602													1	5	---	---	---	---	
TG	7038	broad.mit.edu	37	8	133929267	133929270	+	Intron	DEL	CATG	-	-	rs117248462	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133929267_133929270delCATG	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_5'Flank|TG_uc003ytx.1_5'Flank	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ttcctccctccatgcctccctccc	0.098													4	2	---	---	---	---	
LOC642929	642929	broad.mit.edu	37	9	43143338	43143338	+	Intron	DEL	A	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43143338delA	uc004acy.3	-							NR_027472				Homo sapiens clone HLS_IMAGE_1031047 mRNA sequence.												0						gacttcgtctaaaaaaaaaaa	0.149													8	4	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119626038	119626038	+	Intron	DEL	C	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119626038delC	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GATGGTTAAACCCCAGAGACA	0.373													25	19	---	---	---	---	
PPP2R4	5524	broad.mit.edu	37	9	131882706	131882706	+	Intron	DEL	G	-	-	rs3124504		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131882706delG	uc004bxm.1	+						PPP2R4_uc004bxl.1_Intron|PPP2R4_uc011mbo.1_Intron|PPP2R4_uc010myr.1_Intron|PPP2R4_uc004bxn.1_Intron|PPP2R4_uc004bxo.1_Intron|PPP2R4_uc011mbp.1_Intron|PPP2R4_uc011mbq.1_Intron|PPP2R4_uc010mys.1_Intron	NM_178001	NP_821068	Q15257	PTPA_HUMAN	protein phosphatase 2A, regulatory subunit B'						ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		tccgtctcaagaaaaaaaaaa	0.164													15	9	---	---	---	---	
BRD3	8019	broad.mit.edu	37	9	136917000	136917001	+	Intron	INS	-	A	A	rs71503377		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136917000_136917001insA	uc004cew.2	-						BRD3_uc004cex.2_Intron	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3							nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		tgtgtgtgtgttgttttttttg	0.099			T	NUT|C15orf55	lethal midline carcinoma of young people								9	4	---	---	---	---	
MAN1B1	11253	broad.mit.edu	37	9	139997479	139997480	+	Intron	DEL	GT	-	-	rs72549982		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139997479_139997480delGT	uc004cld.2	+						MAN1B1_uc011meo.1_Intron|MAN1B1_uc011mep.1_Intron|MAN1B1_uc010ncc.2_Intron|MAN1B1_uc004clf.1_5'Flank|MAN1B1_uc004clg.1_5'Flank	NM_016219	NP_057303	Q9UKM7	MA1B1_HUMAN	alpha 1,2-mannosidase						oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|endoplasmic reticulum quality control compartment|integral to membrane	alpha-mannosidase activity|calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(1)|central_nervous_system(1)	2	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CAGGTCGGTGGTGTTACATTCA	0.545													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8555355	8555355	+	IGR	DEL	C	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8555355delC								GATA3 (438193 upstream) : None (None downstream)																							ttccttccttccttccttcct	0.234													4	2	---	---	---	---	
PPP3CB	5532	broad.mit.edu	37	10	75245667	75245668	+	Intron	DEL	TG	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75245667_75245668delTG	uc001jue.2	-						PPP3CB_uc001juf.2_Intron|PPP3CB_uc001jug.2_Intron|PPP3CB_uc001jui.2_Intron|PPP3CB_uc001juh.2_Intron	NM_021132	NP_066955	P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta											skin(1)	1	Prostate(51;0.0119)					cctggctaattgtgtgtgtgtg	0.000													4	2	---	---	---	---	
KRTAP5-5	439915	broad.mit.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	-	-	rs144216147		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651191_1651199delGGCTGTGGA	uc001lty.2	+	1	159_167	c.121_129delGGCTGTGGA	c.(121-129)GGCTGTGGAdel	p.GCG47del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47_49						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggctccggctgtggaggctgtgggg	0.129													21	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	21747095	21747104	+	IGR	DEL	TTTGTGTGTT	-	-	rs71034542		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21747095_21747104delTTTGTGTGTT								NELL1 (149868 upstream) : ANO5 (467618 downstream)																							tgtgtgtgtgtttgtgtgtttgtgtgtgtg	0.000													6	10	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26584941	26584944	+	Intron	DEL	TCTG	-	-	rs150672240	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26584941_26584944delTCTG	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Intron|MUC15_uc001mqx.2_Intron|MUC15_uc001mqy.2_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TGTTTCTCTCTCtgtgtgtgtgtg	0.230													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	86736370	86736371	+	IGR	INS	-	C	C	rs138581182	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86736370_86736371insC								FZD4 (69937 upstream) : TMEM135 (12694 downstream)																							agagtgagactccatctcaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90673972	90673973	+	IGR	INS	-	AG	AG	rs141485156	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90673972_90673973insAG								MIR1261 (71602 upstream) : None (None downstream)																							gaaagaaagaaaaagaaagaaa	0.000													4	2	---	---	---	---	
BUD13	84811	broad.mit.edu	37	11	116631787	116631787	+	Intron	DEL	T	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116631787delT	uc001ppn.2	-						BUD13_uc001ppo.2_Intron|BUD13_uc009yzc.2_Intron	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1											large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		ATTATTATTAttttttttttt	0.179													4	3	---	---	---	---	
ADAMTS8	11095	broad.mit.edu	37	11	130287129	130287130	+	Intron	INS	-	TTAAA	TTAAA	rs146577586	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130287129_130287130insTTAAA	uc001qgg.3	-							NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1						negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TTATTGAGCTTTTAAATTAAAT	0.297													10	6	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131762041	131762043	+	Intron	DEL	TTC	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131762041_131762043delTTC	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ctcctcctctttcttcttcttct	0.256													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	1772962	1772962	+	IGR	DEL	A	-	-	rs112021138		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1772962delA								WNT5B (16585 upstream) : ADIPOR2 (27285 downstream)																							ggaaggagggaaaggagggaa	0.005													5	4	---	---	---	---	
EFCAB4B	84766	broad.mit.edu	37	12	3775496	3775497	+	Intron	INS	-	GT	GT			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3775496_3775497insGT	uc001qmj.2	-						EFCAB4B_uc010sen.1_Intron|EFCAB4B_uc010seo.1_Intron|EFCAB4B_uc001qmi.1_Intron	NM_032680	NP_116069	Q9BSW2	EFC4B_HUMAN	EF-hand calcium binding domain 4B isoform c						activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			AGGACGGCtgcgtgtgtgtgtg	0.426													7	5	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881068	109881069	+	Intron	DEL	TA	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881068_109881069delTA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						tatgtgtacgtatatgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110073520	110073521	+	IGR	INS	-	T	T			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073520_110073521insT								MVK (38450 upstream) : C12orf34 (78669 downstream)																							atcatcacagcaccaccaccat	0.000													4	2	---	---	---	---	
FBRSL1	57666	broad.mit.edu	37	12	133161402	133161403	+	3'UTR	DEL	TT	-	-	rs142171092	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133161402_133161403delTT	uc001ukf.2	+	17						NM_001142641	NP_001136113	Q9HCM7	FBSL_HUMAN	fibrosin-like 1											central_nervous_system(2)	2						TAAAGGCTGATTTTacacacac	0.431													1	5	---	---	---	---	
RNF17	56163	broad.mit.edu	37	13	25339027	25339028	+	Intron	DEL	GT	-	-	rs67031602	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25339027_25339028delGT	uc001upr.2	+						RNF17_uc010tdd.1_Intron|RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc001upq.1_Intron	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ACCTTGTGGGgtgtgtgtgtgt	0.317													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55014796	55014797	+	IGR	INS	-	TTTT	TTTT			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55014796_55014797insTTTT								MIR1297 (128613 upstream) : None (None downstream)																							tttcaggttcctttTTTTTTTT	0.188													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	64499777	64499779	+	IGR	DEL	TCC	-	-	rs71824884		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64499777_64499779delTCC								OR7E156P (183076 upstream) : None (None downstream)																							cttccttccttccttccttcctt	0.089													4	2	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111143547	111143550	+	Intron	DEL	TGTT	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111143547_111143550delTGTT	uc001vqx.2	+							NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GCGCGGTGTCTGTTTGTTCCAAGC	0.564													9	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	46574150	46574153	+	IGR	DEL	GAAG	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46574150_46574153delGAAG								C14orf106 (851545 upstream) : RPL10L (546069 downstream)																							agggacgaaagaaggaaggaagga	0.221													4	2	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52188477	52188478	+	Intron	INS	-	AGGGA	AGGGA	rs113641824		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52188477_52188478insAGGGA	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron|FRMD6_uc001wzf.2_Intron|FRMD6_uc001wzg.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					aggaaggaaggagggaaggagg	0.198													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57659594	57659595	+	IGR	DEL	AC	-	-	rs71450324		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57659594_57659595delAC								OTX2 (382410 upstream) : EXOC5 (9601 downstream)																							TGGGGGCTCTacacacacacac	0.361													3	3	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2495727	2495728	+	Intron	INS	-	TT	TT	rs141290345	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2495727_2495728insTT	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				tttgttttgtgttgtttttttt	0.282													8	5	---	---	---	---	
ACSM2A	123876	broad.mit.edu	37	16	20481193	20481194	+	Intron	DEL	TA	-	-	rs35082249		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20481193_20481194delTA	uc010bwe.2	+						ACSM2A_uc010bwd.1_Intron|ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						aacacaagggtatttttttttt	0.000													11	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25031511	25031512	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs7498498	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25031511_25031512insGGAAGGAA								ARHGAP17 (4836 upstream) : LCMT1 (91535 downstream)																							gaaggaaggacggaaggaagga	0.144													19	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66203427	66203432	+	IGR	DEL	AAAGAA	-	-	rs142904820	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66203427_66203432delAAAGAA								LOC283867 (593224 upstream) : CDH5 (197093 downstream)																							ggaaggaaagaaagaaagaaaagaaa	0.024													4	2	---	---	---	---	
ITGAE	3682	broad.mit.edu	37	17	3651513	3651513	+	Intron	DEL	G	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3651513delG	uc002fwo.3	-							NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ctgctttggtgggaaagcaga	0.010													4	2	---	---	---	---	
PSMB6	5694	broad.mit.edu	37	17	4696906	4696915	+	5'Flank	DEL	AGAAAAGAAA	-	-	rs145922777		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4696906_4696915delAGAAAAGAAA	uc002fzb.2	+							NM_002798	NP_002789	P28072	PSB6_HUMAN	proteasome beta 6 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity			ovary(2)	2						aaagaaaaggagaaaagaaaagaaaagaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46754509	46754512	+	IGR	DEL	CCTT	-	-	rs143755906		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46754509_46754512delCCTT								MIR196A1 (44588 upstream) : PRAC (44580 downstream)																							ttccttcctcccttccttccttcc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48378238	48378318	+	IGR	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAAAGGAAGGAAA	-	-	rs71146978	by1000genomes	TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48378238_48378318delGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAAAGGAAGGAAA								TMEM92 (19394 upstream) : XYLT2 (45075 downstream)																							agaaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaagaaggaaggaaggaaaggaaggaaagaaggaagga	0.064													4	2	---	---	---	---	
KIF2B	84643	broad.mit.edu	37	17	51902235	51902236	+	Frame_Shift_Ins	INS	-	G	G			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51902235_51902236insG	uc002iua.2	+	1	1997_1998	c.1841_1842insG	c.(1840-1842)AAGfs	p.K614fs	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	614					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						ATTTCAGGGAAGGGATCTAGCC	0.426													216	102	---	---	---	---	
ICAM2	3384	broad.mit.edu	37	17	62091998	62092001	+	Intron	DEL	AGAG	-	-	rs9896912		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62091998_62092001delAGAG	uc002jdw.3	-						ICAM2_uc010ded.2_Intron|ICAM2_uc002jdx.3_Intron|ICAM2_uc002jdv.3_Intron|ICAM2_uc010wpx.1_Intron	NM_001099788	NP_001093258	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor						cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1						aaagaaagaaagagagagagagaa	0.000													3	6	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71466120	71466121	+	Intron	INS	-	GCGC	GCGC	rs10622822		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71466120_71466121insGCGC	uc010dfm.2	-							NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						CATTTGCGACTGCGCGCGCGCG	0.426													4	4	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75409170	75409171	+	Intron	DEL	GT	-	-	rs3047410		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75409170_75409171delGT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc002jtx.1_Intron|SEPT9_uc010wtl.1_Intron	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			CGGGTGGGGCgtgtgtgtgtgt	0.153													5	3	---	---	---	---	
FSCN2	25794	broad.mit.edu	37	17	79498345	79498353	+	Intron	DEL	TGATGGTGG	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79498345_79498353delTGATGGTGG	uc010wup.1	+						FSCN2_uc010wuo.1_Intron	NM_012418	NP_036550	O14926	FSCN2_HUMAN	fascin 2 isoform 1						actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			gtggtggtgatgatggtggtggtggtgat	0.000													7	4	---	---	---	---	
ZNF397	84307	broad.mit.edu	37	18	32825471	32825474	+	Frame_Shift_Del	DEL	CTAA	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32825471_32825474delCTAA	uc010dmp.2	+	4	958_961	c.802_805delCTAA	c.(802-807)CTAACTfs	p.L268fs	ZNF397_uc010dmq.2_Intron|ZNF397_uc010dmr.2_Intron|ZNF397_uc002kyj.2_Intron	NM_001135178	NP_001128650	Q8NF99	ZN397_HUMAN	zinc finger protein 397 isoform 1	268_269					viral reproduction	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATGCTTGATTCTAACTACAGACTC	0.417													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	52833398	52833399	+	IGR	DEL	GT	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52833398_52833399delGT								CCDC68 (206659 upstream) : TCF4 (56163 downstream)																							TAACTCATAGgtgtgtgtgtgt	0.337													4	2	---	---	---	---	
ALPK2	115701	broad.mit.edu	37	18	56232964	56232971	+	Intron	DEL	TTCCTTCC	-	-	rs74183271		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56232964_56232971delTTCCTTCC	uc002lhj.3	-							NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase								ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CTCTTTTTTGttccttccttccttcctt	0.091													4	5	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7515569	7515569	+	Intron	DEL	G	-	-	rs12974506		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7515569delG	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_Intron	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				ATGTTAATGCGGGATCTTGCT	0.433													9	4	---	---	---	---	
AKAP8	10270	broad.mit.edu	37	19	15466373	15466373	+	Intron	DEL	T	-	-	rs71333368		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15466373delT	uc002nav.2	-						AKAP8_uc010dzy.2_Intron	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8						signal transduction	nuclear matrix				ovary(1)|breast(1)	2						TATTCTGCAAttttttttttt	0.219													6	3	---	---	---	---	
HKR1	284459	broad.mit.edu	37	19	37852826	37852827	+	Intron	DEL	AC	-	-	rs11344990		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37852826_37852827delAC	uc002ogb.2	+						HKR1_uc002ofx.2_Intron|HKR1_uc002ofy.2_Intron|HKR1_uc002oga.2_Intron|HKR1_uc010xto.1_Intron|HKR1_uc002ogc.2_Intron|HKR1_uc010xtp.1_Intron|HKR1_uc002ogd.2_Intron	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aaaaaaaaaaacaaaaaaacaa	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																							Gacacgcacgcacgcgcgcgcg	0.183													4	4	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332935	1332936	+	Intron	INS	-	C	C	rs34296791		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332935_1332936insC	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	cttccttccttccttccttcct	0.005													6	4	---	---	---	---	
PTPRA	5786	broad.mit.edu	37	20	2895092	2895095	+	Intron	DEL	TGTG	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2895092_2895095delTGTG	uc010zqb.1	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron			P18433	PTPRA_HUMAN	SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						tttcttgctctgtgtgtgtgtgtg	0.000													5	3	---	---	---	---	
VSTM2L	128434	broad.mit.edu	37	20	36572311	36572311	+	Intron	DEL	C	-	-	rs33961791		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36572311delC	uc002xhk.3	+							NM_080607	NP_542174	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				GATCTTGGGACCCCCCCCCCC	0.418													9	4	---	---	---	---	
SLC9A8	23315	broad.mit.edu	37	20	48494743	48494743	+	Intron	DEL	A	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48494743delA	uc002xuv.1	+						SLC9A8_uc010zym.1_Intron|SLC9A8_uc010gic.2_Intron|SLC9A8_uc010gid.2_Intron	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8							Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTCTTTTGTTAAAAAAAAAAA	0.303													4	3	---	---	---	---	
PCK1	5105	broad.mit.edu	37	20	56136889	56136901	+	Intron	DEL	TGCACAAAAGCTC	-	-	rs66514941		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56136889_56136901delTGCACAAAAGCTC	uc002xyn.3	+						PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			ATGAGGTGTGTGCACAAAAGCTCTGCCAACTAG	0.451													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15211745	15211746	+	IGR	INS	-	TAT	TAT			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15211745_15211746insTAT								POTED (197839 upstream) : C21orf15 (3709 downstream)																							GAATTAAAAGCCACCTTAAGAG	0.381													4	3	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45839549	45839551	+	Intron	DEL	TGA	-	-	rs149049149		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839549_45839551delTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gtagtgatggtgatgatgatggt	0.000													4	2	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26413051	26413054	+	Intron	DEL	CTCC	-	-	rs144669857		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26413051_26413054delCTCC	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ctctgtgcctctccctccctccct	0.078													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1895506	1895509	+	IGR	DEL	CTTC	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1895506_1895509delCTTC								ASMT (133533 upstream) : DHRSX (242048 downstream)																							ttctttctttcttccttccttcct	0.000													6	3	---	---	---	---	
WWC3	55841	broad.mit.edu	37	X	10109659	10109659	+	3'UTR	DEL	A	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10109659delA	uc004csx.3	+	23					WWC3_uc010nds.2_3'UTR|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3											ovary(4)	4						CACATTTTGTAAAAAAAAAAA	0.279													8	4	---	---	---	---	
GAGE2A	729447	broad.mit.edu	37	X	49208295	49208296	+	Intron	INS	-	TAT	TAT			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49208295_49208296insTAT	uc004dnr.3	+						GAGE12J_uc004dnl.3_Intron|GAGE13_uc004dnn.3_Intron|GAGE8_uc011mne.1_Intron|GAGE8_uc011mnf.1_Intron|GAGE8_uc011mng.1_Intron|GAGE8_uc004dnq.3_Intron|GAGE2A_uc004dnv.3_In_Frame_Ins_p.9_10insY|GAGE10_uc010nis.2_Intron|GAGE12J_uc004dnk.3_Intron|GAGE2D_uc004dnp.3_Intron|GAGE2C_uc004dno.3_Intron|GAGE8_uc011mnh.1_Intron|GAGE2C_uc004dnu.3_In_Frame_Ins_p.9_10insY|GAGE2D_uc010njc.2_In_Frame_Ins_p.9_10insY|GAGE2D_uc004dnt.3_In_Frame_Ins_p.9_10insY|GAGE8_uc011mni.1_In_Frame_Ins_p.9_10insY	NM_001127212	NP_001120684	Q6NT46	GAG2A_HUMAN	G antigen 2A												0	Ovarian(276;0.236)					GAAGATCGACCTATCGGCCTAG	0.465													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	65719136	65719136	+	IGR	DEL	G	-	-			TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65719136delG								HEPH (231908 upstream) : EDA2R (96347 downstream)																							GTGGACCACCGGGTGAACTTG	0.567													7	8	---	---	---	---	
NCRNA00182	100302692	broad.mit.edu	37	X	73506653	73506654	+	Intron	INS	-	A	A	rs71700920		TCGA-22-4595-01A-01D-1267-08	TCGA-22-4595-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73506653_73506654insA	uc010nlq.1	-						NCRNA00182_uc004ebr.1_Intron					Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0						acctgtcccttaaaaaaaaaaa	0.158													3	3	---	---	---	---	
