Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ACTRT2	140625	broad.mit.edu	37	1	2938330	2938330	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2938330G>T	uc001ajz.2	+	1	285	c.80G>T	c.(79-81)GGG>GTG	p.G27V		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	27						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		GGCCTGTCTGGGGAGTTTGGA	0.577													4	27	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3527813	3527813	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3527813G>T	uc001akl.2	-	1	247	c.20C>A	c.(19-21)GCG>GAG	p.A7E		NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	7						extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CGCTGCCCTCGCCTCTTCAAG	0.776													4	4	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17298869	17298869	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17298869G>T	uc001azt.2	+	37	6051	c.5982G>T	c.(5980-5982)AAG>AAT	p.K1994N	CROCC_uc001azu.2_Missense_Mutation_p.K1290N|CROCC_uc001azv.2_Missense_Mutation_p.K330N	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1994	Gln-rich.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCACACTGAAGGGCCAGCTGC	0.627													9	21	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24383919	24383919	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24383919T>C	uc001bin.3	-	37	4412	c.4249A>G	c.(4249-4251)ACG>GCG	p.T1417A	MYOM3_uc001bil.3_Missense_Mutation_p.T310A|MYOM3_uc001bim.3_Missense_Mutation_p.T1074A	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1417	Ig-like C2-type 4.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		ACCTGGCCCGTCTCGGAGCCA	0.567													4	16	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35334339	35334339	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35334339G>T	uc001byc.2	-	7	2352	c.2352C>A	c.(2350-2352)GAC>GAA	p.D784E		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	784					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CGCGGCCTGAGTCGGGGAGGC	0.572													3	14	---	---	---	---	PASS
EPHA10	284656	broad.mit.edu	37	1	38227319	38227319	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38227319G>T	uc009vvi.2	-	3	694	c.608C>A	c.(607-609)TCG>TAG	p.S203*	EPHA10_uc001cbw.3_Nonsense_Mutation_p.S203*	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	203	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GACGCGCACCGAGACAAGCGC	0.662													7	13	---	---	---	---	PASS
C8B	732	broad.mit.edu	37	1	57422559	57422559	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57422559G>A	uc001cyp.2	-	3	341	c.274C>T	c.(274-276)CCC>TCC	p.P92S	C8B_uc010oon.1_Missense_Mutation_p.P30S|C8B_uc010ooo.1_Missense_Mutation_p.P40S	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	92	TSP type-1 1.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						AACTGAGAGGGCTGGAGCAAG	0.507													18	57	---	---	---	---	PASS
TM2D1	83941	broad.mit.edu	37	1	62190775	62190775	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62190775C>A	uc001czz.1	-	1	321	c.18G>T	c.(16-18)CCG>CCT	p.P6P		NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN	beta-amyloid binding protein precursor	6					apoptosis					ovary(1)	1						ACGGACCAGACGGCCAGGCGG	0.667													6	32	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62228831	62228831	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62228831A>G	uc001dab.2	+	3	283	c.169A>G	c.(169-171)ATC>GTC	p.I57V	INADL_uc009waf.1_Missense_Mutation_p.I57V|INADL_uc001daa.2_Missense_Mutation_p.I57V	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	57	L27.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						TCAGCAGTCCATCAAGCAACT	0.373													8	26	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94497571	94497571	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94497571G>A	uc001dqh.2	-	27	3995	c.3891C>T	c.(3889-3891)GTC>GTT	p.V1297V		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1297	Cytoplasmic.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTCGGGGGTTGACGTTTTCTC	0.512													5	77	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103444262	103444262	+	Splice_Site	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103444262A>G	uc001dul.2	-	35	3072	c.2754_splice	c.e35+1	p.R918_splice	COL11A1_uc001duk.2_Splice_Site_p.R114_splice|COL11A1_uc001dum.2_Splice_Site_p.R930_splice|COL11A1_uc001dun.2_Splice_Site_p.R879_splice|COL11A1_uc009weh.2_Splice_Site_p.R802_splice	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TATCATACGTACTCTTTCACC	0.383													22	89	---	---	---	---	PASS
GSTM3	2947	broad.mit.edu	37	1	110280086	110280086	+	Missense_Mutation	SNP	C	A	A	rs1803686		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110280086C>A	uc001dyo.2	-	8	882	c.572G>T	c.(571-573)CGT>CTT	p.R191L	GSTM3_uc001dyp.2_Missense_Mutation_p.R188L|GSTM3_uc010ovv.1_Missense_Mutation_p.R191L	NM_000849	NP_000840	P21266	GSTM3_HUMAN	glutathione S-transferase mu 3	191	GST C-terminal.				establishment of blood-nerve barrier|glutathione metabolic process|response to estrogen stimulus	cytoplasm	glutathione transferase activity|identical protein binding				0		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Colorectal(144;0.0339)|Lung(183;0.0426)|all cancers(265;0.113)|Epithelial(280;0.125)|COAD - Colon adenocarcinoma(174;0.134)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	CACCTCAAAACGGCACATGAA	0.478													8	23	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111964252	111964252	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111964252T>G	uc001eba.2	-	7	708	c.652A>C	c.(652-654)AGT>CGT	p.S218R	OVGP1_uc001eaz.2_Missense_Mutation_p.S180R|OVGP1_uc010owb.1_Intron	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	218					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CTTTCCCAACTTCCATGTAAG	0.458													3	28	---	---	---	---	PASS
C1orf161	126868	broad.mit.edu	37	1	116670900	116670900	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116670900C>T	uc001egc.1	+	6	1060	c.795C>T	c.(793-795)CAC>CAT	p.H265H		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	265											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCATGAGGCACCTGAAGGAGG	0.582													4	5	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118640417	118640417	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118640417C>T	uc001ehk.2	-	7	955	c.887G>A	c.(886-888)TGG>TAG	p.W296*		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	296						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CAAGTACTTCCAGAAAGTTTT	0.338													7	35	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144866728	144866728	+	Intron	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144866728G>A	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron|PDE4DIP_uc001ema.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAGCCCCTGCGGCCAAACCAC	0.582			T	PDGFRB	MPD								9	87	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004707	148004707	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004707G>A	uc001eqq.2	-	22	2624	c.2607C>T	c.(2605-2607)TAC>TAT	p.Y869Y	LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Silent_p.Y217Y|NBPF14_uc010pac.1_Silent_p.Y442Y	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832	869	NBPF 10.					cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					GTAGTTCAAAGTACATTGACG	0.433													75	129	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004708	148004708	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004708T>C	uc001eqq.2	-	22	2623	c.2606A>G	c.(2605-2607)TAC>TGC	p.Y869C	LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Missense_Mutation_p.Y217C|NBPF14_uc010pac.1_Missense_Mutation_p.Y442C	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832	869	NBPF 10.					cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TAGTTCAAAGTACATTGACGG	0.433													76	122	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732580	152732580	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732580C>T	uc001fal.1	+	2	574	c.516C>T	c.(514-516)TGC>TGT	p.C172C		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	172	Gln-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCAGTGTGCCAGCCTCAGG	0.522													4	84	---	---	---	---	PASS
MTX1	4580	broad.mit.edu	37	1	155180357	155180357	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155180357G>A	uc001fjb.2	+	3	723	c.617G>A	c.(616-618)CGG>CAG	p.R206Q	RAG1AP1_uc010pey.1_Intron|THBS3_uc001fix.2_5'Flank|THBS3_uc009wqi.2_5'Flank|THBS3_uc001fiz.2_5'Flank|THBS3_uc001fiy.2_5'Flank|THBS3_uc010pfu.1_5'Flank|THBS3_uc010pfv.1_5'Flank|THBS3_uc001fja.2_5'Flank|THBS3_uc009wqj.1_5'Flank|MTX1_uc001fjc.2_Missense_Mutation_p.R206Q	NM_002455	NP_002446	Q13505	MTX1_HUMAN	metaxin 1 isoform 1	206					protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	protein binding			skin(1)	1	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCTGCCCTTCGGACCAGTCAT	0.493													24	210	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156513993	156513993	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156513993C>T	uc001fpf.2	-	21	2486	c.2411G>A	c.(2410-2412)TGG>TAG	p.W804*		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	804	IQ 3.				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCGAGCTGCCCACATCCGGGC	0.572													9	108	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158614075	158614075	+	Silent	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158614075G>T	uc001fst.1	-	30	4505	c.4306C>A	c.(4306-4308)CGG>AGG	p.R1436R		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1436	Spectrin 14.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AAATCGTCCCGTTTCTTCATC	0.368													21	50	---	---	---	---	PASS
OR6K6	128371	broad.mit.edu	37	1	158725206	158725206	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158725206C>A	uc001fsw.1	+	1	601	c.601C>A	c.(601-603)CAG>AAG	p.Q201K		NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K,	201	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_hematologic(112;0.0378)					TGGCTCCAACCAGATCCACCA	0.488													37	52	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169580755	169580755	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169580755C>T	uc001ggi.3	-	7	1187	c.1122G>A	c.(1120-1122)TGG>TGA	p.W374*	SELP_uc001ggh.2_Nonsense_Mutation_p.W209*|SELP_uc009wvr.2_Nonsense_Mutation_p.W374*	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	374	Sushi 3.|Extracellular (Potential).				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	AGGGTGCAGACCAGTGTCCAG	0.527													5	59	---	---	---	---	PASS
SERPINC1	462	broad.mit.edu	37	1	173883896	173883896	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173883896G>C	uc001gjt.2	-	2	322	c.203C>G	c.(202-204)TCA>TGA	p.S68*		NM_000488	NP_000479	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C, member 1	68					blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(1)	1					Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)	CTTCTGTTCTGAGCCCTCATC	0.572											OREG0013990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	132	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198668783	198668783	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198668783C>A	uc001gur.1	+	5	563	c.383C>A	c.(382-384)TCC>TAC	p.S128Y	PTPRC_uc001gus.1_Missense_Mutation_p.S128Y|PTPRC_uc001gut.1_Intron|PTPRC_uc009wze.1_Missense_Mutation_p.S64Y|PTPRC_uc009wzf.1_Missense_Mutation_p.S64Y|PTPRC_uc010ppg.1_Missense_Mutation_p.S64Y|PTPRC_uc001guu.1_Missense_Mutation_p.S171Y|PTPRC_uc001guv.1_RNA|PTPRC_uc001guw.1_RNA	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	128	Extracellular (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TTCAGCGGCTCCGCCGCCAAT	0.532											OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	108	---	---	---	---	PASS
GNPAT	8443	broad.mit.edu	37	1	231377211	231377211	+	Intron	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231377211C>G	uc001hup.3	+						C1orf131_uc001hul.2_5'Flank|C1orf131_uc001hum.2_5'Flank|C1orf131_uc001hun.1_5'Flank|C1orf131_uc010pwd.1_5'Flank|C1orf131_uc001huo.1_5'Flank|GNPAT_uc009xfo.1_Intron|GNPAT_uc009xfp.2_Intron	NM_014236	NP_055051	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase						ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity			ovary(3)|breast(1)	4	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				CGGTAGGCGCCCAGGGAAAAG	0.602													4	52	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248486943	248486943	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248486943A>G	uc010pzk.1	-	1	928	c.928T>C	c.(928-930)TCT>CCT	p.S310P		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	310	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAATCTCCAGACTTGCCCTTT	0.373													6	40	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248569754	248569754	+	Silent	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248569754C>G	uc010pzm.1	+	1	459	c.459C>G	c.(457-459)CTC>CTG	p.L153L		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	153	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AACACTTCCTCTACCTTACCC	0.483													55	98	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1805477	1805477	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1805477G>A	uc002qxe.2	-	23	4094	c.3267C>T	c.(3265-3267)CTC>CTT	p.L1089L	MYT1L_uc002qxd.2_Silent_p.L1087L|MYT1L_uc010ewk.2_Silent_p.L85L	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1089	Potential.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCTGAGTTCTGAGTTTAATCA	0.378													5	140	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8940597	8940597	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8940597C>G	uc002qzc.2	-	9	1015	c.833G>C	c.(832-834)AGA>ACA	p.R278T	KIDINS220_uc010yiv.1_Missense_Mutation_p.R44T|KIDINS220_uc002qzd.2_Missense_Mutation_p.R236T|KIDINS220_uc010yiw.1_Missense_Mutation_p.R279T	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	278	Cytoplasmic (Potential).|ANK 9.				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGACCACCTCTGACAGCGCC	0.373													4	203	---	---	---	---	PASS
TRIB2	28951	broad.mit.edu	37	2	12864803	12864803	+	Intron	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12864803G>C	uc002rbv.3	+						TRIB2_uc010yjp.1_Intron	NM_021643	NP_067675	Q92519	TRIB2_HUMAN	tribbles homolog 2						negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			stomach(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTTGCCTTCGATACCCTCTG	0.493													48	444	---	---	---	---	PASS
NRBP1	29959	broad.mit.edu	37	2	27657403	27657403	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27657403G>C	uc002rko.2	+	6	1333	c.501G>C	c.(499-501)AAG>AAC	p.K167N	NRBP1_uc002rkq.2_Missense_Mutation_p.K167N|NRBP1_uc002rkp.2_Missense_Mutation_p.K167N|NRBP1_uc002rkr.2_5'Flank	NM_013392	NP_037524	Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein	167	Protein kinase.				ER to Golgi vesicle-mediated transport|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cell cortex|endomembrane system|lamellipodium|membrane|nucleoplasm	ATP binding|protein homodimerization activity|protein kinase activity			ovary(2)|lung(1)	3	Acute lymphoblastic leukemia(172;0.155)					AGACCAAAAAGAACCACAAGA	0.393													3	146	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29294605	29294605	+	Silent	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29294605T>C	uc002rmt.1	-	1	2523	c.2523A>G	c.(2521-2523)AAA>AAG	p.K841K		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	841					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						AAGCGAATGATTTGTCCATCA	0.582													5	120	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31637489	31637489	+	Intron	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31637489A>T	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GCTCCTACTTACCTTTCTGCC	0.507													73	62	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48808585	48808585	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48808585G>T	uc010yol.1	+	1	860	c.813G>T	c.(811-813)CAG>CAT	p.Q271H	STON1_uc002rwo.3_Missense_Mutation_p.Q271H|STON1_uc010fbm.2_Missense_Mutation_p.Q271H|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.Q271H|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.Q271H	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	271					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCAGGAGTCAGCCAAAATCCG	0.453													12	52	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915599	48915599	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915599G>T	uc002rwu.3	-	11	1407	c.1337C>A	c.(1336-1338)ACT>AAT	p.T446N	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	446	Helical; Name=3; (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGCGAATACAGTGAAAAAGCC	0.498									Familial_Male-Limited_Precocious_Puberty				4	62	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49195948	49195948	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49195948G>T	uc002rww.2	-	9	817	c.743C>A	c.(742-744)TCG>TAG	p.S248*	FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Nonsense_Mutation_p.S222*	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	248	Extracellular (Potential).|LRR 9.				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	GTTGTAAGTCGACCTGGCCCT	0.443									Gonadal_Dysgenesis_46_XX				26	30	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74597857	74597857	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74597857C>T	uc002skx.2	-	10	1250	c.939G>A	c.(937-939)ATG>ATA	p.M313I	DCTN1_uc002skv.2_Missense_Mutation_p.M179I|DCTN1_uc002sku.2_Missense_Mutation_p.M179I|DCTN1_uc002skw.1_Missense_Mutation_p.M289I|DCTN1_uc010ffd.2_Missense_Mutation_p.M293I|DCTN1_uc002sky.2_Missense_Mutation_p.M276I	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	313	Potential.				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						GCTCTTCAGCCATCTCCTTGT	0.562													14	127	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79254172	79254172	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79254172A>T	uc002snw.2	+	4	293	c.208A>T	c.(208-210)AAG>TAG	p.K70*	REG3G_uc002snx.2_Nonsense_Mutation_p.K70*|REG3G_uc010ffu.2_Intron	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	70	C-type lectin.				acute-phase response	extracellular region	sugar binding				0						GGCTTGCCAGAAGCGGCCCTC	0.552													41	49	---	---	---	---	PASS
SLC9A4	389015	broad.mit.edu	37	2	103090333	103090333	+	Missense_Mutation	SNP	C	A	A	rs140854922		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103090333C>A	uc002tbz.3	+	1	572	c.115C>A	c.(115-117)CAG>AAG	p.Q39K		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	39	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						TTCCACTGCTCAGTATGCATC	0.428													74	65	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105896848	105896848	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105896848T>G	uc002tcq.2	-	6	1538	c.1454A>C	c.(1453-1455)AAG>ACG	p.K485T	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.K255T|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.K485T	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	485					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						CTTTTTGTGCTTCTCTAGCCA	0.537													8	16	---	---	---	---	PASS
FBLN7	129804	broad.mit.edu	37	2	112945056	112945056	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112945056C>A	uc002tho.1	+	8	1564	c.1293C>A	c.(1291-1293)ACC>ACA	p.T431T	FBLN7_uc002thn.2_Missense_Mutation_p.P347Q|FBLN7_uc010fki.1_Silent_p.T385T|FBLN7_uc010fkj.1_Silent_p.T297T	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1	431					cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						CCAAGGTCACCATCTTTGTAT	0.592													36	55	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137852605	137852605	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137852605G>T	uc002tva.1	+	3	1020	c.1020G>T	c.(1018-1020)ATG>ATT	p.M340I	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.M230I	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGAAGCACATGGCTATTGGAG	0.527													16	24	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141260630	141260630	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141260630C>A	uc002tvj.1	-	54	9536	c.8564G>T	c.(8563-8565)GGG>GTG	p.G2855V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2855	Extracellular (Potential).|LDL-receptor class A 19.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAGACACCGCCCATCAGCACA	0.398										TSP Lung(27;0.18)			4	45	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141819680	141819680	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141819680G>T	uc002tvj.1	-	8	2148	c.1176C>A	c.(1174-1176)GAC>GAA	p.D392E	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	392	Extracellular (Potential).|LDL-receptor class B 4.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTCCCACATAGTCCAAGTAAA	0.408										TSP Lung(27;0.18)			4	71	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166929997	166929997	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166929997G>A	uc010zcz.1	-	1	153	c.135C>T	c.(133-135)GAC>GAT	p.D45D		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	45						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	GGCCATTTTCGTCGTCATCTT	0.448													4	188	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178936383	178936383	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178936383T>C	uc002ulq.2	-	1	1100	c.782A>G	c.(781-783)CAT>CGT	p.H261R	PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	261	GAF 1.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			TGTTCCTGCATGCACATCAAA	0.537									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				32	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179417523	179417523	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179417523C>T	uc010zfg.1	-	284	82624	c.82400G>A	c.(82399-82401)CGT>CAT	p.R27467H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R21162H|TTN_uc010zfi.1_Missense_Mutation_p.R21095H|TTN_uc010zfj.1_Missense_Mutation_p.R20970H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28394							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGAGATCACGTATAGGAGC	0.438													5	44	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179585310	179585310	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179585310C>A	uc010zfg.1	-	77	19671	c.19447G>T	c.(19447-19449)GGA>TGA	p.G6483*	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Nonsense_Mutation_p.G3144*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7410							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGGAGTTCCCGAAATTTCA	0.388													3	22	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590103	179590103	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590103A>G	uc010zfg.1	-	68	17320	c.17096T>C	c.(17095-17097)ATG>ACG	p.M5699T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.M2360T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6626							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTAAGACCATCAGTGTGGC	0.313													4	5	---	---	---	---	PASS
DUSP19	142679	broad.mit.edu	37	2	183960325	183960325	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183960325G>A	uc002upd.2	+	4	968	c.593G>A	c.(592-594)CGT>CAT	p.R198H	DUSP19_uc010frp.2_Missense_Mutation_p.R147H|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_3'UTR	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1	198					JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						GAGCAGCTTCGTACATATCAA	0.398													4	58	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802120	185802120	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802120C>A	uc002uph.2	+	4	2591	c.1997C>A	c.(1996-1998)TCC>TAC	p.S666Y		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	666						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GAATCCATATCCTTAAGTGAC	0.318													9	77	---	---	---	---	PASS
GULP1	51454	broad.mit.edu	37	2	189348175	189348175	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189348175A>G	uc010fru.2	+	4	507	c.46A>G	c.(46-48)ACA>GCA	p.T16A	GULP1_uc002uqc.3_Missense_Mutation_p.T16A|GULP1_uc002uqd.2_Missense_Mutation_p.T16A|GULP1_uc010zfw.1_Missense_Mutation_p.T16A|GULP1_uc002uqe.2_Missense_Mutation_p.T16A|GULP1_uc002uqf.2_Missense_Mutation_p.T16A|GULP1_uc002uqg.2_Missense_Mutation_p.T16A	NM_016315	NP_057399	Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing	16					apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			ATGGATGCATACACCTGAAGC	0.269													15	16	---	---	---	---	PASS
MSTN	2660	broad.mit.edu	37	2	190922267	190922267	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190922267C>T	uc002urp.2	-	3	978	c.845G>A	c.(844-846)TGT>TAT	p.C282Y		NM_005259	NP_005250	O14793	GDF8_HUMAN	myostatin precursor	282					muscle organ development|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			AGGGTAACGACAGCATCGTGA	0.418													24	32	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196581432	196581432	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196581432G>C	uc002utg.3	+	7	1982	c.1768G>C	c.(1768-1770)GAA>CAA	p.E590Q	SLC39A10_uc002uth.3_Missense_Mutation_p.E590Q|SLC39A10_uc010zgp.1_Missense_Mutation_p.E140Q	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	590					zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AGGCCAACAAGAATCCCCTCC	0.373													7	53	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196741285	196741285	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196741285G>A	uc002utj.3	-	37	6201	c.6100C>T	c.(6100-6102)CCT>TCT	p.P2034S		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2034	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TTGCCCAAAGGAGGACCAAAA	0.423													3	52	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200137131	200137131	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200137131G>A	uc002uuy.1	-	11	2822	c.2005C>T	c.(2005-2007)CAC>TAC	p.H669Y	SATB2_uc010fsq.1_Missense_Mutation_p.H551Y|SATB2_uc002uuz.1_Missense_Mutation_p.H669Y|SATB2_uc002uva.1_Missense_Mutation_p.H669Y	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	669	Homeobox.					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGCTTCACGTGGTACCGCTGG	0.567													6	65	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200137256	200137256	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200137256C>G	uc002uuy.1	-	11	2697	c.1880G>C	c.(1879-1881)GGG>GCG	p.G627A	SATB2_uc010fsq.1_Missense_Mutation_p.G509A|SATB2_uc002uuz.1_Missense_Mutation_p.G627A|SATB2_uc002uva.1_Missense_Mutation_p.G627A	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	627	Homeobox.					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTGGAGGATCCCCAGGGCTTC	0.552													8	40	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201468035	201468035	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201468035G>T	uc002uvx.2	+	7	645	c.544G>T	c.(544-546)GAT>TAT	p.D182Y		NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	182					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTGCTGTTTGGATCAAGGAAT	0.388													4	41	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201499549	201499549	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201499549A>G	uc002uvx.2	+	21	2358	c.2257A>G	c.(2257-2259)ATG>GTG	p.M753V	AOX1_uc010zhf.1_Missense_Mutation_p.M309V|AOX1_uc010fsu.2_Missense_Mutation_p.M119V	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	753					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	ACATTTTTATATGGAAACCCA	0.433													10	18	---	---	---	---	PASS
CXCR2	3579	broad.mit.edu	37	2	219000268	219000268	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219000268G>A	uc002vgz.1	+	4	969	c.744G>A	c.(742-744)CGG>CGA	p.R248R	CXCR2_uc002vha.1_Silent_p.R248R|CXCR2_uc002vhb.1_Silent_p.R248R	NM_001557	NP_001548	P25025	CXCR2_HUMAN	interleukin 8 receptor beta	248	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity			lung(1)|breast(1)	2						AGAAGCACCGGGCCATGCGGG	0.587													34	96	---	---	---	---	PASS
ZNF385D	79750	broad.mit.edu	37	3	21706457	21706457	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21706457G>T	uc003cce.2	-	2	494	c.86C>A	c.(85-87)CCA>CAA	p.P29Q	ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	29						nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						ATCCAGCGATGGTTGCAAAGG	0.522													15	19	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36898726	36898726	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36898726G>A	uc003cgj.2	-	3	1007	c.705C>T	c.(703-705)TTC>TTT	p.F235F		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	785					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TCATGTTATCGAAGTCCTGGA	0.502													29	134	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39230454	39230454	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39230454C>G	uc003cjk.1	-	2	704	c.483G>C	c.(481-483)GAG>GAC	p.E161D	XIRP1_uc003cji.2_Missense_Mutation_p.E161D|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	161	Xin 3.						actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GTGGCTTTGTCTCAAATAGCC	0.607													7	34	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41278137	41278137	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41278137G>A	uc010hia.1	+	14	2169	c.2013G>A	c.(2011-2013)AAG>AAA	p.K671K	CTNNB1_uc003ckp.2_Silent_p.K671K|CTNNB1_uc003ckq.2_Silent_p.K671K|CTNNB1_uc003ckr.2_Silent_p.K671K|CTNNB1_uc011azf.1_Silent_p.K664K|CTNNB1_uc011azg.1_Silent_p.K599K|CTNNB1_uc003cks.2_3'UTR|CTNNB1_uc003ckt.1_3'UTR	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	671					adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.E632_S681>SV(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	AAGATTACAAGAAACGGCTTT	0.448		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				4	63	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62431475	62431475	+	Intron	SNP	A	G	G	rs142747065	by1000genomes	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62431475A>G	uc003dll.2	-						CADPS_uc003dlj.1_Intron|CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GCCTTCACCTAAAGAGGAAAG	0.343													4	18	---	---	---	---	PASS
FAM19A1	407738	broad.mit.edu	37	3	68055808	68055808	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68055808G>C	uc003dnd.2	+	2	255	c.39G>C	c.(37-39)TTG>TTC	p.L13F	FAM19A1_uc003dne.2_Missense_Mutation_p.L13F|FAM19A1_uc003dng.2_Missense_Mutation_p.L13F|FAM19A1_uc003dnf.1_RNA	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine	13						endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		TCCTGTATTTGTGGATAAGTG	0.522													3	85	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983260	97983260	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983260C>T	uc003dsi.1	+	1	132	c.132C>T	c.(130-132)TTC>TTT	p.F44F		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						TACCGCTCTTCCTGGCATTCT	0.413													39	190	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108298279	108298279	+	Intron	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108298279G>A	uc003dxb.3	-						KIAA1524_uc003dxc.1_Intron|KIAA1524_uc010hpw.1_Intron	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen							cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						AATAGCTTAAGGACAAATTAG	0.284													9	51	---	---	---	---	PASS
CD96	10225	broad.mit.edu	37	3	111325605	111325605	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111325605C>T	uc003dxw.2	+	9	1364	c.1194C>T	c.(1192-1194)ACC>ACT	p.T398T	CD96_uc003dxv.2_Silent_p.T382T|CD96_uc003dxx.2_Silent_p.T382T|CD96_uc010hpy.1_Silent_p.T382T	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	398	Extracellular (Potential).|Pro/Ser/Thr-rich.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						CCCTTGACACCCAACCTTCTC	0.373									Opitz_Trigonocephaly_syndrome				10	25	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115395178	115395178	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115395178G>A	uc003ebq.2	+	2	735	c.349G>A	c.(349-351)GAT>AAT	p.D117N	GAP43_uc003ebr.2_Missense_Mutation_p.D153N	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	117					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		GGGGGAGGGTGATGCTGCCAC	0.602													6	16	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115395328	115395328	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115395328C>A	uc003ebq.2	+	2	885	c.499C>A	c.(499-501)CAA>AAA	p.Q167K	GAP43_uc003ebr.2_Missense_Mutation_p.Q203K	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	167					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		GGAGCCTAAACAAGCCGATGT	0.423													4	14	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123367818	123367818	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123367818G>T	uc003ego.2	-	26	4697	c.4415C>A	c.(4414-4416)TCT>TAT	p.S1472Y	MYLK_uc010hrr.2_5'UTR|MYLK_uc011bjv.1_Missense_Mutation_p.S272Y|MYLK_uc011bjw.1_Missense_Mutation_p.S1472Y|MYLK_uc003egp.2_Missense_Mutation_p.S1403Y|MYLK_uc003egq.2_Missense_Mutation_p.S1472Y|MYLK_uc003egr.2_Missense_Mutation_p.S1403Y|MYLK_uc003egs.2_Missense_Mutation_p.S1296Y	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1472	ATP (By similarity).|Protein kinase.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CTCCACTTACGATCCTAATCT	0.527													8	49	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148558658	148558658	+	Intron	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148558658T>C	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTCCATTTGGTAGATAGAGGC	0.438													20	116	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	155838411	155838411	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155838411C>G	uc003far.2	+	1	75	c.11C>G	c.(10-12)GCC>GGC	p.A4G	KCNAB1_uc011bon.1_Missense_Mutation_p.A4G	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	4						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ATGCTGGCAGCCCGGACAGGG	0.502													23	226	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	157081471	157081471	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157081471T>C	uc003fbj.1	-	9	1734	c.1417A>G	c.(1417-1419)ATA>GTA	p.I473V	VEPH1_uc003fbk.1_Missense_Mutation_p.I473V|VEPH1_uc010hvu.1_Missense_Mutation_p.I473V	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	473						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CTGGCTGGTATGTCTCCCCTG	0.478													12	98	---	---	---	---	PASS
RSRC1	51319	broad.mit.edu	37	3	158261214	158261214	+	Missense_Mutation	SNP	G	A	A	rs144776555		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158261214G>A	uc003fbt.2	+	9	961	c.850G>A	c.(850-852)GAT>AAT	p.D284N	RSRC1_uc003fbv.2_Missense_Mutation_p.D226N	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	284					nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			AAAAGAAATAGATCCTACCAG	0.418													15	143	---	---	---	---	PASS
RSRC1	51319	broad.mit.edu	37	3	158261220	158261220	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158261220A>C	uc003fbt.2	+	9	967	c.856A>C	c.(856-858)ACC>CCC	p.T286P	RSRC1_uc003fbv.2_Missense_Mutation_p.T228P	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	286					nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			AATAGATCCTACCAGCATCCC	0.413													16	144	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160248717	160248717	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160248717T>A	uc003fdn.2	-	7	701	c.395A>T	c.(394-396)CAG>CTG	p.Q132L		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	132	ARM 2.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AGCTTCAAACTGTAAAGAAGG	0.338													9	69	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907779	164907779	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907779G>A	uc003fej.3	-	2	1284	c.840C>T	c.(838-840)CTC>CTT	p.L280L	SLITRK3_uc003fek.2_Silent_p.L280L	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	280	LRRCT 1.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						ACAAGGGACAGAGTTCTGTCT	0.483										HNSCC(40;0.11)			28	94	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169820624	169820624	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169820624G>A	uc010hws.1	-	13	2595	c.2531C>T	c.(2530-2532)CCT>CTT	p.P844L	PHC3_uc003fgl.2_Missense_Mutation_p.P856L|PHC3_uc011bpq.1_Missense_Mutation_p.P803L	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	844					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TGCCCCATCAGGGCCACTTGG	0.438													15	91	---	---	---	---	PASS
MIR569	693154	broad.mit.edu	37	3	170824503	170824503	+	RNA	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170824503T>A	hsa-mir-569|MI0003576	-			c.46T>A			TNIK_uc003fhh.2_Intron|TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron																	0						CTGATGTTGCTTCTGATGCTG	0.348													6	187	---	---	---	---	PASS
FNDC3B	64778	broad.mit.edu	37	3	172016525	172016525	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172016525G>A	uc003fhy.2	+	9	1181	c.1009G>A	c.(1009-1011)GAA>AAA	p.E337K	FNDC3B_uc003fhz.3_Missense_Mutation_p.E337K|FNDC3B_uc003fia.2_Missense_Mutation_p.E268K	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	337	Fibronectin type-III 1.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CAGTGGAGAAGAATTAGAATG	0.368													5	231	---	---	---	---	PASS
NAALADL2	254827	broad.mit.edu	37	3	175165048	175165048	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175165048C>T	uc003fit.2	+	6	1209	c.1122C>T	c.(1120-1122)CTC>CTT	p.L374L	NAALADL2_uc003fiu.1_Silent_p.L367L|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_5'UTR	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	374	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GATCAAACCTCACCTCTCTAT	0.388													4	41	---	---	---	---	PASS
AP2M1	1173	broad.mit.edu	37	3	183900585	183900585	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183900585G>T	uc011bqx.1	+	11	1259	c.1102G>T	c.(1102-1104)GCA>TCA	p.A368S	AP2M1_uc003fmw.2_Missense_Mutation_p.A366S|AP2M1_uc003fmx.2_Missense_Mutation_p.A296S|AP2M1_uc003fmy.2_Missense_Mutation_p.A366S|AP2M1_uc011bqy.1_Missense_Mutation_p.A238S|AP2M1_uc011bqz.1_Missense_Mutation_p.A184S	NM_004068	NP_004059	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	368	MHD.				axon guidance|cellular membrane organization|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|clathrin coat of coated pit|cytosol|endocytic vesicle membrane|peroxisomal membrane	lipid binding|protein binding|transporter activity				0	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAGATCAGCGCAGAGATTGA	0.527													3	71	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196388330	196388330	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196388330G>T	uc003fwv.2	+	3	1920	c.1816G>T	c.(1816-1818)GCC>TCC	p.A606S		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	606	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TGGCTGGGGGGCCCTGCAGCA	0.632													5	164	---	---	---	---	PASS
LAP3	51056	broad.mit.edu	37	4	17585116	17585116	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17585116G>T	uc003gph.1	+	5	552	c.390G>T	c.(388-390)AGG>AGT	p.R130S	LAP3_uc010ieg.2_Missense_Mutation_p.G95V	NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3	130					proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0						CGGGGTGCAGGCAGATTCAAG	0.532													26	74	---	---	---	---	PASS
PPARGC1A	10891	broad.mit.edu	37	4	23803907	23803907	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23803907C>A	uc003gqs.2	-	11	2201	c.2081G>T	c.(2080-2082)AGG>ATG	p.R694M	PPARGC1A_uc003gqt.2_RNA	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor	694	RRM.				androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				AAAACGGTCCCTCAGTTCTGT	0.458													17	39	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46053442	46053442	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46053442G>T	uc003gxb.2	-	8	1282	c.1130C>A	c.(1129-1131)TCG>TAG	p.S377*		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	377	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TTAACATACCGAGGCTTTATT	0.318													5	12	---	---	---	---	PASS
EXOC1	55763	broad.mit.edu	37	4	56734579	56734579	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56734579G>T	uc003hbe.1	+	5	651	c.493G>T	c.(493-495)GCA>TCA	p.A165S	EXOC1_uc003hbf.1_Missense_Mutation_p.A165S|EXOC1_uc003hbg.1_Missense_Mutation_p.A165S	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1	165	Potential.				exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					AGAGTTAAATGCAAGAGAAGA	0.393													9	18	---	---	---	---	PASS
UTP3	57050	broad.mit.edu	37	4	71555719	71555719	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71555719G>A	uc003hfo.2	+	1	1524	c.1325G>A	c.(1324-1326)AGA>AAA	p.R442K		NM_020368	NP_065101	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit processome component	442					brain development|chromatin modification|gene silencing	nucleolus					0			Lung(101;0.235)			AAGTTCAGAAGAGCCAAAATT	0.408													17	58	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72263358	72263358	+	Silent	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72263358G>C	uc003hfy.2	+	7	912	c.795G>C	c.(793-795)CCG>CCC	p.P265P	SLC4A4_uc010iic.2_Silent_p.P265P|SLC4A4_uc010iib.2_Silent_p.P265P|SLC4A4_uc003hfz.2_Silent_p.P265P|SLC4A4_uc003hgc.3_Silent_p.P221P|SLC4A4_uc003hga.2_Silent_p.P143P|SLC4A4_uc003hgb.3_Silent_p.P221P	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	265	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CTGATAAACCGGAGAAGGACC	0.393													8	38	---	---	---	---	PASS
ADH1B	125	broad.mit.edu	37	4	100235165	100235165	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100235165G>T	uc003hus.3	-	6	725	c.641C>A	c.(640-642)GCA>GAA	p.A214E	ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Missense_Mutation_p.A174E|ADH1B_uc011ceh.1_Missense_Mutation_p.A59E|ADH1B_uc011cei.1_Missense_Mutation_p.A174E	NM_000668	NP_000659	P00325	ADH1B_HUMAN	class I alcohol dehydrogenase, beta subunit	214					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding			ovary(1)|breast(1)	2				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Fomepizole(DB01213)|NADH(DB00157)	TGCTCCAGCTGCTTTACAGCC	0.502													38	195	---	---	---	---	PASS
TBCK	93627	broad.mit.edu	37	4	107230062	107230062	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107230062A>C	uc010ilv.2	-	2	421	c.56T>G	c.(55-57)CTG>CGG	p.L19R	TBCK_uc003hye.2_Missense_Mutation_p.L19R|TBCK_uc003hyc.2_Missense_Mutation_p.L19R|TBCK_uc003hyd.2_5'UTR|TBCK_uc003hyf.2_Missense_Mutation_p.L19R	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like	19	Protein kinase.					intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						ATCATGTGGCAGAGCCGAGGC	0.443													5	35	---	---	---	---	PASS
ADAD1	132612	broad.mit.edu	37	4	123305122	123305122	+	Splice_Site	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123305122G>C	uc003ieo.2	+	5	761	c.529_splice	c.e5+1	p.G177_splice	ADAD1_uc003iep.2_Splice_Site_p.G177_splice|ADAD1_uc003ieq.2_Splice_Site_p.G159_splice	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1						multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						GAAACATCAGGTAAATACTCT	0.333													8	22	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156629398	156629398	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156629398G>A	uc003iov.2	+	6	864	c.328G>A	c.(328-330)GAA>AAA	p.E110K	GUCY1A3_uc003iou.2_Missense_Mutation_p.E110K|GUCY1A3_uc010iqc.2_Missense_Mutation_p.E110K|GUCY1A3_uc003iow.2_Missense_Mutation_p.E110K|GUCY1A3_uc010iqd.2_Missense_Mutation_p.E110K|GUCY1A3_uc003iox.2_Missense_Mutation_p.E110K|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Missense_Mutation_p.E110K|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_Missense_Mutation_p.E110K	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	110					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GAAATCTTTGGAAAGAGAAGA	0.279													5	39	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177071097	177071097	+	Silent	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177071097T>A	uc003iuj.2	+	15	2265	c.2109T>A	c.(2107-2109)ATT>ATA	p.I703I	WDR17_uc003iuk.2_Silent_p.I679I|WDR17_uc003ium.3_Silent_p.I679I|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_5'Flank	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	703										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AAGAAATTATTGGGAACACTG	0.353													28	69	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177098642	177098642	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177098642A>C	uc003iuj.2	+	30	3842	c.3686A>C	c.(3685-3687)TAT>TCT	p.Y1229S	WDR17_uc003iuk.2_Missense_Mutation_p.Y1205S|WDR17_uc003ium.3_Missense_Mutation_p.Y1190S|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.Y440S	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	1229										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GACTCTCCGTATACACCCCCT	0.308													9	69	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186544316	186544316	+	Missense_Mutation	SNP	G	T	T	rs144923775	byFrequency	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186544316G>T	uc003iyl.2	-	13	3113	c.2255C>A	c.(2254-2256)CCG>CAG	p.P752Q	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.P852Q|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.P656Q|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.P866Q|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	752						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GCTGTTGTCCGGCAAGCTCCC	0.527													32	169	---	---	---	---	PASS
F11	2160	broad.mit.edu	37	4	187192828	187192828	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187192828C>T	uc003iza.1	+	3	454	c.121C>T	c.(121-123)CCA>TCA	p.P41S	F11_uc003iyz.2_Missense_Mutation_p.P41S	NM_000128	NP_000119	P03951	FA11_HUMAN	coagulation factor XI precursor	41	Apple 1.				blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity				0		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	GGTCTTCACACCAAGCGCCAA	0.488													33	46	---	---	---	---	PASS
ZFP42	132625	broad.mit.edu	37	4	188924097	188924097	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188924097G>T	uc003izg.1	+	3	381	c.136G>T	c.(136-138)GTG>TTG	p.V46L	ZFP42_uc003izh.1_Missense_Mutation_p.V46L|ZFP42_uc003izi.1_Missense_Mutation_p.V46L	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	46					female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TGTCAGCGCGGTGTGGGCCTT	0.567													17	35	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5186183	5186183	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5186183A>G	uc003jdl.2	+	5	920	c.782A>G	c.(781-783)AAG>AGG	p.K261R	ADAMTS16_uc003jdk.1_Missense_Mutation_p.K261R|ADAMTS16_uc003jdj.1_Missense_Mutation_p.K261R	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	261					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CAGCCTCCCAAGGAAGACCTC	0.488													28	133	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11117570	11117570	+	Missense_Mutation	SNP	C	G	G	rs141186137		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11117570C>G	uc003jfa.1	-	13	2414	c.2269G>C	c.(2269-2271)GAT>CAT	p.D757H	CTNND2_uc010itt.2_Missense_Mutation_p.D666H|CTNND2_uc011cmy.1_Missense_Mutation_p.D420H|CTNND2_uc011cmz.1_Missense_Mutation_p.D324H|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.D324H	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	757	ARM 6.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ACCTTGCTATCGATCTCACTG	0.522													33	54	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14389424	14389424	+	Silent	SNP	C	A	A	rs145624600		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14389424C>A	uc003jff.2	+	25	3981	c.3975C>A	c.(3973-3975)GGC>GGA	p.G1325G	TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Silent_p.G1276G|TRIO_uc003jfh.1_Silent_p.G974G	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	1325	DH 1.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					TGACCAGTGGCGTGGAAGAGA	0.403													4	18	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23527031	23527031	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23527031G>A	uc003jgo.2	+	11	2016	c.1834G>A	c.(1834-1836)GAG>AAG	p.E612K		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	612	C2H2-type 5.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						TGTCTGCAGGGAGTGTGGGCG	0.622										HNSCC(3;0.000094)			15	48	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40937697	40937697	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40937697A>T	uc003jmh.2	+	6	586	c.472A>T	c.(472-474)ACC>TCC	p.T158S	C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	158	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AGTCATCAATACCAAAAGTTT	0.403													7	20	---	---	---	---	PASS
SERINC5	256987	broad.mit.edu	37	5	79442032	79442032	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79442032C>T	uc003kgj.2	-	11	1248	c.1119G>A	c.(1117-1119)AAG>AAA	p.K373K	SERINC5_uc003kgk.2_Silent_p.K371K|SERINC5_uc003kgl.2_RNA|SERINC5_uc003kgm.2_Silent_p.K373K|SERINC5_uc011ctj.1_Silent_p.K373K	NM_178276	NP_840060	Q86VE9	SERC5_HUMAN	developmentally regulated protein TPO1	373	Extracellular (Potential).				phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)		GTGGTCCCTCCTTCCCCGGCT	0.507													4	114	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82816665	82816665	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82816665C>A	uc003kii.3	+	7	2896	c.2540C>A	c.(2539-2541)ACT>AAT	p.T847N	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.T847N|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	847	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		CCAAGTTTCACTGAAGATGGA	0.423													12	33	---	---	---	---	PASS
CAST	831	broad.mit.edu	37	5	96075820	96075820	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96075820G>T	uc003klz.1	+	10	790	c.628G>T	c.(628-630)GCT>TCT	p.A210S	CAST_uc003klt.2_Missense_Mutation_p.A210S|CAST_uc003klu.2_Missense_Mutation_p.A293S|CAST_uc003klv.2_Missense_Mutation_p.A271S|CAST_uc003klw.2_Missense_Mutation_p.A274S|CAST_uc003klx.2_Missense_Mutation_p.A252S|CAST_uc003kly.2_Missense_Mutation_p.A271S|CAST_uc011cuo.1_Missense_Mutation_p.A256S|CAST_uc011cup.1_Missense_Mutation_p.A161S|CAST_uc011cuq.1_Missense_Mutation_p.A58S|CAST_uc011cur.1_Missense_Mutation_p.A196S|CAST_uc011cus.1_Missense_Mutation_p.A210S|CAST_uc003kma.1_Missense_Mutation_p.A169S|CAST_uc011cut.1_Missense_Mutation_p.A138S|CAST_uc003kmb.2_Missense_Mutation_p.A169S|CAST_uc003kmc.2_Missense_Mutation_p.A210S|CAST_uc003kmd.2_Missense_Mutation_p.A188S|CAST_uc003kme.2_Missense_Mutation_p.A169S|CAST_uc003kmf.2_Missense_Mutation_p.A188S|CAST_uc003kmh.2_5'Flank|CAST_uc010jbj.2_5'Flank|CAST_uc010jbk.2_5'Flank	NM_001042443	NP_001035908	P20810	ICAL_HUMAN	calpastatin isoform i	210	Inhibitory domain 1.						calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding			central_nervous_system(3)|ovary(1)|kidney(1)	5		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		GGAACTATTGGCTGTAAGTTA	0.294													3	9	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831627	113831627	+	Silent	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831627A>G	uc003kqo.2	+	8	1945	c.1488A>G	c.(1486-1488)TTA>TTG	p.L496L	KCNN2_uc003kqp.2_Silent_p.L148L|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	496						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TTTCTGACTTAAACGAAAGGA	0.428													18	77	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140475273	140475273	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140475273C>A	uc003lil.2	+	1	1037	c.899C>A	c.(898-900)TCG>TAG	p.S300*	PCDHB2_uc003lim.1_5'UTR	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	300	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGTGCAAAATCGGGAGAACTG	0.413													4	46	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140502076	140502076	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140502076C>G	uc003lip.1	+	1	496	c.496C>G	c.(496-498)CTT>GTT	p.L166V		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	166	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGCAATGGTCTTCAAAAATA	0.433													8	24	---	---	---	---	PASS
SH3RF2	153769	broad.mit.edu	37	5	145439472	145439472	+	Silent	SNP	C	T	T	rs148067714	byFrequency	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145439472C>T	uc003lnt.2	+	9	1837	c.1599C>T	c.(1597-1599)CTC>CTT	p.L533L	SH3RF2_uc011dbl.1_Silent_p.L533L|SH3RF2_uc011dbm.1_Silent_p.L18L|SH3RF2_uc003lnu.2_Silent_p.L24L|SH3RF2_uc011dbn.1_Silent_p.L24L|SH3RF2_uc011dbo.1_5'UTR	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	533							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCCCACTCTCGTGGTAGGCT	0.627													3	36	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	156021964	156021964	+	Silent	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156021964T>C	uc003lwd.3	+	5	878	c.402T>C	c.(400-402)TAT>TAC	p.Y134Y	SGCD_uc003lwa.1_Silent_p.Y135Y|SGCD_uc003lwb.2_Silent_p.Y135Y|SGCD_uc003lwc.3_Silent_p.Y135Y	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	134	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TAGAAGCTTATGGTAAAAAAT	0.274													4	17	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161322698	161322698	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161322698A>T	uc010jiw.2	+	10	1351	c.883A>T	c.(883-885)ACA>TCA	p.T295S	GABRA1_uc010jix.2_Missense_Mutation_p.T295S|GABRA1_uc010jiy.2_Missense_Mutation_p.T295S|GABRA1_uc003lyx.3_Missense_Mutation_p.T295S|GABRA1_uc010jiz.2_Missense_Mutation_p.T295S|GABRA1_uc010jja.2_Missense_Mutation_p.T295S|GABRA1_uc010jjb.2_Missense_Mutation_p.T295S	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	295	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	CACCATGACAACATTGAGCAT	0.423													6	28	---	---	---	---	PASS
HIST1H2BI	8346	broad.mit.edu	37	6	26273498	26273498	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26273498G>C	uc003nhk.2	+	1	295	c.295G>C	c.(295-297)GTG>CTG	p.V99L	HIST1H3G_uc003nhi.2_5'Flank	NM_003525	NP_003516	P62807	H2B1C_HUMAN	histone cluster 1, H2bi	99					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						CCAAACGGCTGTGCGCCTGCT	0.592													15	62	---	---	---	---	PASS
BTN3A3	10384	broad.mit.edu	37	6	26446217	26446217	+	Intron	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26446217A>T	uc003nhz.2	+						BTN3A3_uc003nia.2_Intron|BTN3A3_uc011dkn.1_Intron	NM_006994	NP_008925	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3 isoform a							integral to membrane					0						ATCGCAGGTCAGTACCCTGCT	0.547													4	54	---	---	---	---	PASS
HIST1H2BO	8348	broad.mit.edu	37	6	27861243	27861243	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27861243G>T	uc003nkc.1	+	1	41	c.3G>T	c.(1-3)ATG>ATT	p.M1I	HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	NM_003527	NP_003518	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	1					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCTCCGCCATGCCCGACCCGG	0.502													4	32	---	---	---	---	PASS
HIST1H2BO	8348	broad.mit.edu	37	6	27861400	27861400	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27861400G>T	uc003nkc.1	+	1	198	c.160G>T	c.(160-162)GGC>TGC	p.G54C	HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	NM_003527	NP_003518	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	54					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCCCGACACCGGCATCTCATC	0.557													14	90	---	---	---	---	PASS
ZKSCAN4	387032	broad.mit.edu	37	6	28214766	28214766	+	Missense_Mutation	SNP	A	T	T	rs146547857		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28214766A>T	uc003nks.1	-	4	1003	c.759T>A	c.(757-759)CAT>CAA	p.H253Q	ZKSCAN4_uc011dlb.1_Missense_Mutation_p.H98Q	NM_019110	NP_061983	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	253	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CCAGGCTGCTATGGTTCTCCT	0.463													23	36	---	---	---	---	PASS
OR2B3	442184	broad.mit.edu	37	6	29054686	29054686	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29054686G>A	uc003nlx.2	-	1	405	c.340C>T	c.(340-342)CTT>TTT	p.L114F		NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,											skin(1)	1						ACAGCCAGAAGGAGACACTCT	0.468													6	28	---	---	---	---	PASS
OR12D2	26529	broad.mit.edu	37	6	29364805	29364805	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29364805C>G	uc003nmf.3	+	1	390	c.329C>G	c.(328-330)TCC>TGC	p.S110C		NM_013936	NP_039224	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AGCACGGAGTCCATGTTGTTC	0.498													22	33	---	---	---	---	PASS
ABCF1	23	broad.mit.edu	37	6	30553957	30553957	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30553957G>T	uc003nql.2	+	18	1855	c.1760G>T	c.(1759-1761)CGA>CTA	p.R587L	ABCF1_uc003nqm.2_Missense_Mutation_p.R549L|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1	587					inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						CAGAAATGCCGACGGAAAAAC	0.547													4	29	---	---	---	---	PASS
C6orf25	80739	broad.mit.edu	37	6	31691568	31691568	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31691568C>T	uc011doc.1	+	2	214	c.214C>T	c.(214-216)CCC>TCC	p.P72S	LY6G6C_uc003nwh.2_5'Flank|LY6G6C_uc010jtd.2_5'Flank|C6orf25_uc003nwk.2_Missense_Mutation_p.P72S|C6orf25_uc011dod.1_Missense_Mutation_p.P72S|C6orf25_uc011doe.1_Missense_Mutation_p.P72S|C6orf25_uc003nwo.2_Missense_Mutation_p.P72S|C6orf25_uc003nwn.2_Missense_Mutation_p.P72S	NM_138272	NP_612116	O95866	G6B_HUMAN	G6B protein isoform G6b-B precursor	72	Extracellular (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	heparin binding|receptor activity				0						GAGCGGGACCCCCACCGTGCC	0.697													11	37	---	---	---	---	PASS
KIFC1	3833	broad.mit.edu	37	6	33373395	33373395	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33373395C>T	uc003oef.3	+	7	1973	c.1523C>T	c.(1522-1524)TCC>TTC	p.S508F	KIFC1_uc011drf.1_Missense_Mutation_p.S500F	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	508	Kinesin-motor.				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0						GTCCCTGTCTCCTGTGAGAAA	0.587													5	10	---	---	---	---	PASS
GNMT	27232	broad.mit.edu	37	6	42930890	42930890	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42930890C>T	uc003otd.2	+	4	538	c.532C>T	c.(532-534)CGC>TGC	p.R178C	uc003ote.1_5'Flank	NM_018960	NP_061833	Q14749	GNMT_HUMAN	glycine N-methyltransferase	178		Substrate (By similarity).			protein homotetramerization|protein modification process|S-adenosylmethionine metabolic process		folic acid binding|glycine binding|glycine N-methyltransferase activity				0	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	CATTGATCATCGCAACTACGA	0.517													5	26	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49582417	49582417	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49582417G>A	uc003ozk.3	-	5	852	c.790C>T	c.(790-792)CGA>TGA	p.R264*	RHAG_uc010jzl.2_Nonsense_Mutation_p.R264*|RHAG_uc010jzm.2_Nonsense_Mutation_p.R264*	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	264	Cytoplasmic (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					AGCTTGCCTCGGTGCTCCACT	0.498													3	67	---	---	---	---	PASS
KHDRBS2	202559	broad.mit.edu	37	6	62604627	62604627	+	Silent	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62604627A>G	uc003peg.2	-	6	970	c.723T>C	c.(721-723)GGT>GGC	p.G241G		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	241	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		GGGTAGGGACACCTCTTGCTA	0.592													9	44	---	---	---	---	PASS
KHDRBS2	202559	broad.mit.edu	37	6	62887082	62887082	+	Intron	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62887082G>T	uc003peg.2	-							NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		AAGTATATATGGTAGTACCTT	0.279													20	36	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75865550	75865550	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75865550T>C	uc003phs.2	-	16	3437	c.3271A>G	c.(3271-3273)AGA>GGA	p.R1091G	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1091	Fibronectin type-III 8.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTGAGGTTTCTAGGAGACTTA	0.413													37	51	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85472425	85472425	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85472425C>T	uc003pkl.1	-	2	334	c.334G>A	c.(334-336)GCG>ACG	p.A112T	TBX18_uc010kbq.1_5'UTR	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	112					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CCCGGTGACGCCAGAGGGGAA	0.711													10	14	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97613216	97613216	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97613216C>A	uc003ppb.2	-	21	3393	c.3127G>T	c.(3127-3129)GAT>TAT	p.D1043Y	C6orf167_uc011eaf.1_Missense_Mutation_p.D1003Y	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	1043					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TGTCCAAGATCTGAAACATAT	0.383													11	50	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100838775	100838775	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100838775G>A	uc003pqj.3	-	11	1970	c.1763C>T	c.(1762-1764)CCC>CTC	p.P588L	SIM1_uc010kcu.2_Missense_Mutation_p.P588L	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	588	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TTGGTCTGAGGGGGCTTTCCT	0.463													9	43	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102124644	102124644	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102124644T>G	uc003pqp.3	+	4	937	c.688T>G	c.(688-690)TGT>GGT	p.C230G	GRIK2_uc003pqn.2_Missense_Mutation_p.C230G|GRIK2_uc003pqo.3_Missense_Mutation_p.C230G|GRIK2_uc010kcw.2_Missense_Mutation_p.C230G	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	230	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	AATCTTTGATTGTAGCCATGA	0.338													16	37	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117662333	117662333	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117662333C>A	uc003pxp.1	-	30	5243	c.5044G>T	c.(5044-5046)GTT>TTT	p.V1682F	ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1682	Fibronectin type-III 8.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ATGAGGTTAACATTCAATGGA	0.358			T	GOPC|ROS1	glioblastoma|NSCLC								3	46	---	---	---	---	PASS
GOPC	57120	broad.mit.edu	37	6	117896684	117896684	+	Intron	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117896684G>A	uc003pxu.2	-						GOPC_uc003pxq.1_5'Flank|GOPC_uc003pxv.2_Intron|GOPC_uc010keg.1_RNA	NM_020399	NP_065132	Q9HD26	GOPC_HUMAN	golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		taacatcttggaactacttct	0.119			O	ROS1	glioblastoma								6	18	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123545265	123545265	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123545265C>G	uc003pzj.1	-	39	2009	c.1987G>C	c.(1987-1989)GAT>CAT	p.D663H	TRDN_uc010kem.1_Missense_Mutation_p.D164H	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	663	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		GCTGGTACATCTTCAACATCT	0.328													7	19	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	132004193	132004193	+	Splice_Site	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132004193G>C	uc003qcu.3	+	13	1359	c.1012_splice	c.e13-1	p.V338_splice	ENPP3_uc010kfo.1_Splice_Site|ENPP3_uc010kfp.1_Splice_Site|ENPP3_uc010kfq.2_Splice_Site|ENPP3_uc003qcv.2_Splice_Site_p.V338_splice	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TTATTTTTCAGGTAATTAAAG	0.363													12	36	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133703559	133703559	+	Silent	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133703559T>A	uc003qec.3	+	3	521	c.63T>A	c.(61-63)GTT>GTA	p.V21V	EYA4_uc011ecq.1_Silent_p.V21V|EYA4_uc011ecr.1_Silent_p.V21V|EYA4_uc003qed.3_Silent_p.V21V|EYA4_uc003qee.3_Silent_p.V21V|EYA4_uc011ecs.1_Silent_p.V21V	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	21					anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		AATCAGATGTTTCACAATCTC	0.373													32	88	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495154	134495154	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495154G>A	uc003qen.3	-	3	306	c.217C>T	c.(217-219)CCT>TCT	p.P73S	SGK1_uc003qeo.3_Missense_Mutation_p.P168S|SGK1_uc011ect.1_Missense_Mutation_p.P63S|SGK1_uc011ecu.1_Missense_Mutation_p.P73S|SGK1_uc011ecv.1_Missense_Mutation_p.P87S|SGK1_uc011ecw.1_Missense_Mutation_p.P101S	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	73					apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GGAGGAGAAGGGTTGGCATTC	0.438													16	48	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144768371	144768371	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144768371G>T	uc003qkt.2	+	14	1731	c.1639G>T	c.(1639-1641)GAA>TAA	p.E547*	UTRN_uc010khq.1_Nonsense_Mutation_p.E547*	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	547	Interaction with SYNM.|Spectrin 4.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTGGTTAACCGAAAAAGAAGA	0.358													4	17	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152673328	152673328	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152673328C>A	uc010kiw.2	-	70	12016	c.11414G>T	c.(11413-11415)CGG>CTG	p.R3805L	SYNE1_uc003qot.3_Missense_Mutation_p.R3790L|SYNE1_uc003qou.3_Missense_Mutation_p.R3805L|SYNE1_uc010kja.1_Missense_Mutation_p.R510L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3805	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTGTTCTTTCCGGACAGTGCT	0.443										HNSCC(10;0.0054)			30	107	---	---	---	---	PASS
TIAM2	26230	broad.mit.edu	37	6	155485735	155485735	+	Splice_Site	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155485735G>T	uc003qqb.2	+	10	3487	c.2214_splice	c.e10+1	p.L738_splice	TIAM2_uc003qqe.2_Splice_Site_p.L738_splice|TIAM2_uc010kjj.2_Splice_Site_p.L271_splice|TIAM2_uc003qqf.2_Splice_Site_p.L90_splice|TIAM2_uc011efl.1_Splice_Site_p.L50_splice|TIAM2_uc003qqg.2_Splice_Site_p.L50_splice	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CCATGCTCTGGTAAGTTCCTG	0.597													25	85	---	---	---	---	PASS
RADIL	55698	broad.mit.edu	37	7	4917519	4917519	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4917519G>A	uc003snj.1	-	2	425	c.252C>T	c.(250-252)ACC>ACT	p.T84T	RADIL_uc003sng.1_RNA|RADIL_uc011jwd.1_RNA	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	84	Ras-associating.				cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		TGGAGGTGCCGGTGGCCAGGA	0.682													3	45	---	---	---	---	PASS
NEUROD6	63974	broad.mit.edu	37	7	31378224	31378224	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31378224G>A	uc003tch.2	-	2	1012	c.659C>T	c.(658-660)CCA>CTA	p.P220L		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	220					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						CCCATGCCCTGGGGGAGTGGT	0.527													18	53	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42007296	42007296	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42007296G>C	uc011kbh.1	-	14	2420	c.2329C>G	c.(2329-2331)CAC>GAC	p.H777D	GLI3_uc011kbg.1_Missense_Mutation_p.H718D	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	777					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						AGTTTTACGTGCTCCATCCAT	0.502									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				27	75	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42018290	42018290	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42018290C>A	uc011kbh.1	-	11	1646	c.1555G>T	c.(1555-1557)GAC>TAC	p.D519Y	GLI3_uc011kbg.1_Missense_Mutation_p.D460Y	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	519	C2H2-type 2.				negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						CTTGAGCAGTCCAGCCACCTG	0.448									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				12	40	---	---	---	---	PASS
MDH2	4191	broad.mit.edu	37	7	75692906	75692906	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75692906C>G	uc003ueo.2	+	6	715	c.629C>G	c.(628-630)TCT>TGT	p.S210C	MDH2_uc003uep.2_Missense_Mutation_p.S103C|MDH2_uc011kgh.1_Missense_Mutation_p.S168C	NM_005918	NP_005909	P40926	MDHM_HUMAN	mitochondrial malate dehydrogenase precursor	210					gluconeogenesis|malate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus|plasma membrane	binding|L-malate dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					NADH(DB00157)	CCCCTGATCTCTCAGGTACAC	0.562													3	62	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82538240	82538240	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82538240G>A	uc003uhx.2	-	8	13679	c.13390C>T	c.(13390-13392)CCG>TCG	p.P4464S	PCLO_uc003uhv.2_Missense_Mutation_p.P4464S	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4395					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AATCTTTCCGGCAGTTTTCGG	0.423													27	37	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92983068	92983068	+	Silent	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92983068A>G	uc003umo.2	+	26	2708	c.2580A>G	c.(2578-2580)GTA>GTG	p.V860V	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Silent_p.V830V|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Silent_p.V580V	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	860											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GAACTATTGTAGAAGGGTAAG	0.328													17	101	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94047860	94047860	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94047860C>A	uc003ung.1	+	33	2492	c.2021C>A	c.(2020-2022)GCT>GAT	p.A674D	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_RNA	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	674					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AGAGATGGTGCTCGTGTGAGT	0.348										HNSCC(75;0.22)			13	49	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99159994	99159994	+	Intron	SNP	T	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99159994T>G	uc003urh.2	+						ZNF655_uc003urf.2_RNA|ZNF655_uc003urc.2_Missense_Mutation_p.F76V|ZNF655_uc010lfz.2_Intron|ZNF655_uc003ure.2_RNA|ZNF655_uc010lga.2_Intron|ZNF655_uc010lgb.2_Missense_Mutation_p.F76V|ZNF655_uc003uri.2_Intron|ZNF655_uc010lgc.2_Intron|ZNF655_uc003urj.2_Intron	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a						G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					ATTTCAGGAGTTTGTGACATT	0.478													15	57	---	---	---	---	PASS
ZNF3	7551	broad.mit.edu	37	7	99669489	99669489	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99669489G>C	uc003usq.2	-	6	925	c.618C>G	c.(616-618)AGC>AGG	p.S206R	ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_Missense_Mutation_p.S206R|ZNF3_uc010lgj.2_Missense_Mutation_p.S170R|ZNF3_uc003uss.2_Missense_Mutation_p.S213R|ZNF3_uc003ust.3_Missense_Mutation_p.S206R	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2	206	C2H2-type 1.				cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			TAAAGCTCTTGCTACATTCAT	0.438													10	152	---	---	---	---	PASS
ZNF3	7551	broad.mit.edu	37	7	99669784	99669784	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99669784G>T	uc003usq.2	-	6	630	c.323C>A	c.(322-324)TCA>TAA	p.S108*	ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_Nonsense_Mutation_p.S108*|ZNF3_uc010lgj.2_Nonsense_Mutation_p.S72*|ZNF3_uc003uss.2_Nonsense_Mutation_p.S115*|ZNF3_uc003ust.3_Nonsense_Mutation_p.S108*	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2	108	KRAB.				cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			GACCCCATGTGATCTTGTGTC	0.413													10	192	---	---	---	---	PASS
PUS7	54517	broad.mit.edu	37	7	105098242	105098242	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105098242G>A	uc003vcx.2	-	16	2200	c.1981C>T	c.(1981-1983)CGC>TGC	p.R661C	PUS7_uc010lji.2_Missense_Mutation_p.R667C|PUS7_uc003vcy.2_Missense_Mutation_p.R661C|PUS7_uc003vcz.1_Missense_Mutation_p.R661C	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 homolog	661					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			breast(1)	1						ACTGCTCAGCGAAGCCAGGTT	0.448													9	149	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120737851	120737851	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120737851G>A	uc003vjq.3	+	6	1162	c.715G>A	c.(715-717)GTG>ATG	p.V239M	C7orf58_uc003vjr.1_Missense_Mutation_p.V239M|C7orf58_uc003vjs.3_Missense_Mutation_p.V239M|C7orf58_uc003vjt.3_Missense_Mutation_p.V19M|C7orf58_uc010lkk.1_Missense_Mutation_p.V19M	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	239						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					GAAGCCACGTGTGTGGAAACC	0.443													12	93	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122769455	122769455	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122769455T>C	uc003vkm.2	-	9	1038	c.1013A>G	c.(1012-1014)CAA>CGA	p.Q338R	SLC13A1_uc010lks.2_Missense_Mutation_p.Q214R	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	338						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	CCCAAGCTTTTGGTATTCTTG	0.279													15	46	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123594320	123594320	+	Silent	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123594320C>G	uc003vld.2	+	4	1098	c.696C>G	c.(694-696)CCC>CCG	p.P232P	SPAM1_uc003vle.2_Silent_p.P232P|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Silent_p.P232P|SPAM1_uc010lku.2_Silent_p.P232P	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	232					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	ATAAGAAACCCGGTTACAATG	0.368													4	109	---	---	---	---	PASS
ZNF800	168850	broad.mit.edu	37	7	127014786	127014786	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127014786C>A	uc003vlx.1	-	5	867	c.604G>T	c.(604-606)GAA>TAA	p.E202*	ZNF800_uc003vlw.1_Nonsense_Mutation_p.E105*|ZNF800_uc003vly.1_Nonsense_Mutation_p.E202*|ZNF800_uc010lla.2_Nonsense_Mutation_p.E202*	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	202					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GGTGCAACTTCATCTGTAACA	0.438													17	120	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142013428	142013428	+	Intron	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013428C>A	uc011kro.1	+						uc011krp.1_Intron|uc003vxg.2_Missense_Mutation_p.L95I|uc003vxh.1_Missense_Mutation_p.L92I					SubName: Full=V_segment translation product; Flags: Fragment;																		TCTCTTAAACCTTCACCTACA	0.517													16	115	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142326998	142326998	+	Intron	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142326998C>T	uc011krp.1	+						uc011krr.1_Intron|uc003vzo.2_Missense_Mutation_p.S99L					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		ACTGTGACATCGGCCCAAAAG	0.478													39	67	---	---	---	---	PASS
OR9A2	135924	broad.mit.edu	37	7	142723348	142723348	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142723348T>A	uc003wcc.1	-	1	872	c.872A>T	c.(871-873)GAC>GTC	p.D291V		NM_001001658	NP_001001658	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A,	291	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	Melanoma(164;0.059)					TTTGACTTTGTCATTCCGAAG	0.458													21	55	---	---	---	---	PASS
SGCZ	137868	broad.mit.edu	37	8	14095170	14095170	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14095170G>T	uc003wwq.2	-	4	1015	c.355C>A	c.(355-357)CAG>AAG	p.Q119K	SGCZ_uc010lss.2_Missense_Mutation_p.Q72K	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta	106	Extracellular (Potential).				cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CTGTCAGACTGTAAGACCAGC	0.373													42	118	---	---	---	---	PASS
KIAA0146	23514	broad.mit.edu	37	8	48309125	48309125	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48309125C>G	uc003xqd.2	+	6	724	c.715C>G	c.(715-717)CAG>GAG	p.Q239E	KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Missense_Mutation_p.Q239E|KIAA0146_uc010lxs.2_5'UTR|KIAA0146_uc011ldc.1_Missense_Mutation_p.Q169E|KIAA0146_uc011ldd.1_Missense_Mutation_p.Q179E|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	239											0		Lung NSC(58;0.175)				GCATACACCTCAGAAACCCAC	0.368													5	115	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52258417	52258417	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52258417A>G	uc003xqu.3	-	20	4093	c.3992T>C	c.(3991-3993)ATG>ACG	p.M1331T	PXDNL_uc003xqt.3_Intron	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1331					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ACTTAACTCCATATCCTTATC	0.373													7	13	---	---	---	---	PASS
OPRK1	4986	broad.mit.edu	37	8	54142277	54142277	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54142277G>A	uc003xrh.1	-	3	1098	c.723C>T	c.(721-723)ATC>ATT	p.I241I	OPRK1_uc003xri.1_Silent_p.I241I|OPRK1_uc010lyc.1_Silent_p.I152I	NM_000912	NP_000903	P41145	OPRK_HUMAN	opioid receptor, kappa 1	241	Helical; Name=5; (Potential).				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)	AGACGATGATGATGAGGACAG	0.532													8	35	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72958748	72958748	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72958748G>A	uc003xza.2	-	17	2236	c.2061C>T	c.(2059-2061)AAC>AAT	p.N687N	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	687	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TTGAACTTACGTTGAGGGCTG	0.219													13	56	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72977745	72977745	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72977745C>G	uc003xza.2	-	4	668	c.493G>C	c.(493-495)GGA>CGA	p.G165R		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	165	Cytoplasmic (Potential).|ANK 4.					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GCTGTGTTTCCATTTTCTCCT	0.338													6	23	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89053787	89053787	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89053787A>G	uc003yeb.3	-	10	2008	c.1726T>C	c.(1726-1728)TGC>CGC	p.C576R		NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	576	Helical; (Potential).				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						ACAAGGAGGCATAAGGCCAAG	0.473													16	70	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	105263969	105263969	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105263969C>T	uc003yls.2	+	28	4266	c.4025C>T	c.(4024-4026)CCA>CTA	p.P1342L	RIMS2_uc003ylp.2_Missense_Mutation_p.P1324L|RIMS2_uc003ylq.2_Missense_Mutation_p.P1138L|RIMS2_uc003ylr.2_Missense_Mutation_p.P1163L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1386					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CTAGTAGATCCAACCTTGGCC	0.433										HNSCC(12;0.0054)			28	102	---	---	---	---	PASS
TRHR	7201	broad.mit.edu	37	8	110100167	110100167	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110100167C>A	uc003ymz.3	+	1	442	c.426C>A	c.(424-426)GCC>GCA	p.A142A		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	142	Cytoplasmic (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			TTTCCAGAGCCAAAAAGATTA	0.403													12	40	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113418827	113418827	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113418827C>A	uc003ynu.2	-	35	5894	c.5735G>T	c.(5734-5736)GGA>GTA	p.G1912V	CSMD3_uc003yns.2_Missense_Mutation_p.G1114V|CSMD3_uc003ynt.2_Missense_Mutation_p.G1872V|CSMD3_uc011lhx.1_Missense_Mutation_p.G1808V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1912	Sushi 10.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGCTATGGATCCATGGAGAAT	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			25	32	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113418828	113418828	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113418828C>A	uc003ynu.2	-	35	5893	c.5734G>T	c.(5734-5736)GGA>TGA	p.G1912*	CSMD3_uc003yns.2_Nonsense_Mutation_p.G1114*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.G1872*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.G1808*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1912	Sushi 10.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GCTATGGATCCATGGAGAATA	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			26	34	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118170057	118170057	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118170057C>A	uc003yoh.2	+	4	776	c.546C>A	c.(544-546)TCC>TCA	p.S182S	SLC30A8_uc010mcz.2_Silent_p.S133S|SLC30A8_uc011lia.1_Silent_p.S133S|SLC30A8_uc003yog.2_Silent_p.S133S	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	182	Helical; (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TCATCGTTTCCAGCTGCGCAG	0.537													13	52	---	---	---	---	PASS
EXT1	2131	broad.mit.edu	37	8	119122430	119122430	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119122430C>G	uc003yok.1	-	1	1629	c.856G>C	c.(856-858)GTC>CTC	p.V286L		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	286	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CCGTTATGGACGTGATATAAG	0.512			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				13	56	---	---	---	---	PASS
COLEC10	10584	broad.mit.edu	37	8	120116039	120116039	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120116039G>A	uc003yoo.2	+	5	444	c.347G>A	c.(346-348)GGT>GAT	p.G116D		NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor	116						collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			CATTTAAAAGGTACTGTCTGT	0.378													4	74	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131797705	131797705	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131797705C>A	uc003ytd.3	-	16	3333	c.3077G>T	c.(3076-3078)CGA>CTA	p.R1026L	ADCY8_uc010mds.2_Missense_Mutation_p.R895L	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1026	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GTCTTGAAATCGGTCTTCACC	0.507										HNSCC(32;0.087)			5	40	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385656	33385656	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385656T>A	uc003zst.2	-	7	906	c.734A>T	c.(733-735)CAG>CTG	p.Q245L	SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Missense_Mutation_p.Q188L|AQP7_uc010mjs.2_Missense_Mutation_p.Q153L|AQP7_uc010mjt.2_Missense_Mutation_p.Q153L|AQP7_uc011lnx.1_Missense_Mutation_p.Q245L|AQP7_uc011lny.1_Missense_Mutation_p.Q244L|AQP7_uc003zss.3_Missense_Mutation_p.Q153L|AQP7_uc011lnz.1_Missense_Mutation_p.Q153L|AQP7_uc011loa.1_Silent_p.T113T	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	245	Extracellular (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CCTGAAGACCTGTTTGCCCCA	0.597													3	62	---	---	---	---	PASS
CLTA	1211	broad.mit.edu	37	9	36211679	36211679	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36211679G>A	uc003zzc.2	+	7	817	c.655G>A	c.(655-657)GAC>AAC	p.D219N	CLTA_uc003zzd.2_Missense_Mutation_p.D207N|CLTA_uc003zze.2_Missense_Mutation_p.D189N|CLTA_uc011lpk.1_Missense_Mutation_p.D201N|CLTA_uc003zzf.1_Intron	NM_007096	NP_009027	P09496	CLCA_HUMAN	clathrin, light polypeptide A isoform b	219					axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol	structural molecule activity			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)			CCGGCTGTGTGACTTTAACCC	0.557													4	49	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79996916	79996916	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79996916G>A	uc004akr.2	+	68	9362	c.9102G>A	c.(9100-9102)GAG>GAA	p.E3034E	VPS13A_uc004akp.3_Silent_p.E3034E|VPS13A_uc004akq.3_Silent_p.E3034E|VPS13A_uc004aks.2_Silent_p.E2995E	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	3034					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CTGAAGTGGAGAGTCTGCGAC	0.338													7	34	---	---	---	---	PASS
SLC46A2	57864	broad.mit.edu	37	9	115652604	115652604	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115652604G>T	uc004bgk.2	-	1	590	c.358C>A	c.(358-360)CGC>AGC	p.R120S		NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	120	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	symporter activity			central_nervous_system(1)	1						AGCCCGAGGCGGGAGAGCAGG	0.672													10	34	---	---	---	---	PASS
FAM73B	84895	broad.mit.edu	37	9	131825921	131825921	+	Intron	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131825921G>A	uc004bxa.2	+						FAM73B_uc004bwy.2_Intron|FAM73B_uc004bwz.2_Intron|FAM73B_uc011mbn.1_Intron	NM_032809	NP_116198	Q7L4E1	FA73B_HUMAN	hypothetical protein LOC84895							integral to membrane				skin(1)	1						GTAGCAGGGGGTGGGGTGGGG	0.567													11	10	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133942459	133942459	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133942459C>T	uc004caa.1	+	14	2558	c.2460C>T	c.(2458-2460)GCC>GCT	p.A820A		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	820	Laminin EGF-like 8.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		ACCCCAATGCCGTGGGCAACT	0.637													3	35	---	---	---	---	PASS
NUP214	8021	broad.mit.edu	37	9	134074366	134074366	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134074366G>A	uc004cag.2	+	29	5596	c.5485G>A	c.(5485-5487)GCA>ACA	p.A1829T	NUP214_uc004cah.2_Missense_Mutation_p.A1819T|NUP214_uc004cai.2_Missense_Mutation_p.A1259T|NUP214_uc010mzg.2_RNA|NUP214_uc011mcg.1_Missense_Mutation_p.A655T|NUP214_uc011mcf.1_Missense_Mutation_p.A606T|NUP214_uc010mzh.1_Missense_Mutation_p.A343T|NUP214_uc010mzi.1_Missense_Mutation_p.A343T	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	1829	Pro/Ser/Thr-rich.|11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CACCACAACAGCAGCAACCTC	0.502			T	DEK|SET|ABL1	AML|T-ALL								10	46	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8115917	8115917	+	Silent	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8115917G>T	uc001ika.2	+	6	1820	c.1263G>T	c.(1261-1263)CCG>CCT	p.P421P	GATA3_uc001ijz.2_Silent_p.P422P	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	421					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						CGCCCACGCCGATGCACCCGC	0.647			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						11	21	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28229604	28229604	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28229604T>A	uc009xky.2	-	13	1972	c.1874A>T	c.(1873-1875)AAA>ATA	p.K625I	ARMC4_uc010qds.1_Missense_Mutation_p.K150I|ARMC4_uc010qdt.1_Missense_Mutation_p.K317I|ARMC4_uc001itz.2_Missense_Mutation_p.K625I|ARMC4_uc010qdu.1_Missense_Mutation_p.K317I	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	625	ARM 3.						binding			ovary(4)|skin(2)	6						GATGGCTTCTTTATTCGTATG	0.532													46	48	---	---	---	---	PASS
MTPAP	55149	broad.mit.edu	37	10	30625753	30625753	+	Silent	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30625753G>T	uc001iva.3	-	4	822	c.759C>A	c.(757-759)ACC>ACA	p.T253T	MTPAP_uc001ivb.3_Silent_p.T383T	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	253					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						TGAGGTTTCTGGTTTCATCTA	0.353													63	399	---	---	---	---	PASS
ZNF248	57209	broad.mit.edu	37	10	38120707	38120707	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38120707C>A	uc001izd.1	-	6	2075	c.1576G>T	c.(1576-1578)GGG>TGG	p.G526W	ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Missense_Mutation_p.G526W	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	526	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAGGTTTTCCCACATTCATTA	0.403													25	54	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43325852	43325852	+	Silent	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43325852C>G	uc001jaj.2	+	22	3958	c.3600C>G	c.(3598-3600)CGC>CGG	p.R1200R		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1200					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity	p.R1200G(1)		ovary(2)|upper_aerodigestive_tract(1)	3						CCGTCATACGCGAGCCTCATG	0.512													3	46	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68687494	68687494	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687494T>A	uc001jmz.1	+	2	1370	c.820T>A	c.(820-822)TTC>ATC	p.F274I	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.F274I	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	274	Extracellular (Potential).|LRR 9.					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						ACCCAGTGTTTTCCAGTGTGT	0.458													54	68	---	---	---	---	PASS
TYSND1	219743	broad.mit.edu	37	10	71899765	71899765	+	Missense_Mutation	SNP	C	T	T	rs148744638	byFrequency	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71899765C>T	uc001jqr.2	-	4	1770	c.1616G>A	c.(1615-1617)CGT>CAT	p.R539H	TYSND1_uc001jqq.2_RNA|TYSND1_uc001jqs.2_3'UTR|TYSND1_uc001jqt.2_RNA	NM_173555	NP_775826	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1 isoform a	539					proteolysis	peroxisome	serine-type endopeptidase activity			large_intestine(1)	1						GTCCAGCTCACGGAGGCCACC	0.672													4	54	---	---	---	---	PASS
USP54	159195	broad.mit.edu	37	10	75279616	75279616	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75279616G>A	uc001juo.2	-	17	2634	c.2617C>T	c.(2617-2619)CAG>TAG	p.Q873*	USP54_uc010qkk.1_Nonsense_Mutation_p.Q55*|USP54_uc001juk.2_Intron|USP54_uc001jul.2_Intron|USP54_uc001jum.2_Intron|USP54_uc001jun.2_Intron|USP54_uc001jup.2_Nonsense_Mutation_p.Q873*	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	873					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					TGCGACGGCTGCTGTGGTGAT	0.552													14	15	---	---	---	---	PASS
ZMIZ1	57178	broad.mit.edu	37	10	81058301	81058301	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81058301A>G	uc001kaf.2	+	15	2202	c.1630A>G	c.(1630-1632)ATC>GTC	p.I544V	ZMIZ1_uc001kag.2_Missense_Mutation_p.I420V	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	544	Pro-rich.				transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCCGCCTGACATCAAGCCAAA	0.662													18	26	---	---	---	---	PASS
IFIT3	3437	broad.mit.edu	37	10	91099423	91099423	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91099423G>A	uc001kgf.2	+	2	1240	c.1011G>A	c.(1009-1011)GAG>GAA	p.E337E	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron|IFIT3_uc001kgg.2_Silent_p.E337E	NM_001549	NP_001540	O14879	IFIT3_HUMAN	interferon-induced protein with	337					type I interferon-mediated signaling pathway		protein binding			central_nervous_system(1)	1						ATCTCGCTGAGTTCCTGGAGA	0.423													21	35	---	---	---	---	PASS
SLIT1	6585	broad.mit.edu	37	10	98819234	98819234	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98819234G>A	uc001kmw.2	-	11	1320	c.1068C>T	c.(1066-1068)CTC>CTT	p.L356L	SLIT1_uc009xvh.1_Silent_p.L366L	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	356					axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TCAGGGAGCGGAGGCCCTGGA	0.617													6	21	---	---	---	---	PASS
CCDC147	159686	broad.mit.edu	37	10	106209899	106209899	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106209899C>A	uc001kyh.2	+	17	2581	c.2447C>A	c.(2446-2448)ACC>AAC	p.T816N		NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147	816	Potential.									ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GAGAAACTTACCAATGAGCTC	0.328													16	86	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106918650	106918650	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106918650C>A	uc001kyi.1	+	11	1857	c.1630C>A	c.(1630-1632)CCC>ACC	p.P544T		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	544	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCCATTTTAGCCCTTCTGTTC	0.473													12	39	---	---	---	---	PASS
C10orf46	143384	broad.mit.edu	37	10	120514170	120514170	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120514170G>A	uc001lds.1	-	1	589	c.105C>T	c.(103-105)CCC>CCT	p.P35P	C10orf46_uc010qst.1_RNA	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46	35	Pro-rich.				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		GAGGTGGCAGGGGCTGCCGGA	0.701													11	18	---	---	---	---	PASS
TIAL1	7073	broad.mit.edu	37	10	121347733	121347733	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121347733C>A	uc001lei.1	-	2	624	c.60G>T	c.(58-60)GTG>GTT	p.V20V	TIAL1_uc001leh.1_5'UTR|TIAL1_uc001lej.1_Silent_p.V20V|TIAL1_uc001lek.1_5'UTR|TIAL1_uc009xzi.1_Intron|TIAL1_uc010qtb.1_5'UTR	NM_003252	NP_003243	Q01085	TIAR_HUMAN	TIA-1 related protein isoform 1	20	RRM 1.				apoptosis|defense response|induction of apoptosis|regulation of transcription from RNA polymerase II promoter	lysosome|nucleus|stress granule	nucleotide binding|RNA binding			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		GGACTTCTGTCACATCTCTGG	0.378													18	29	---	---	---	---	PASS
ATE1	11101	broad.mit.edu	37	10	123600614	123600614	+	Silent	SNP	G	A	A	rs150860078	byFrequency	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123600614G>A	uc001lfp.2	-	9	1222	c.1140C>T	c.(1138-1140)GGC>GGT	p.G380G	ATE1_uc001lfq.2_Silent_p.G380G|ATE1_uc010qtr.1_Silent_p.G265G|ATE1_uc010qts.1_Silent_p.G284G|ATE1_uc010qtt.1_Silent_p.G373G|ATE1_uc001lfr.2_Silent_p.G81G|ATE1_uc009xzu.2_RNA	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2	380					protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				CAGAGTAGACGCCCAAAGACA	0.363													3	4	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124390692	124390692	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124390692G>A	uc001lgk.1	+	46	5960	c.5854G>A	c.(5854-5856)GAT>AAT	p.D1952N	DMBT1_uc001lgl.1_Missense_Mutation_p.D1942N|DMBT1_uc001lgm.1_Missense_Mutation_p.D1324N|DMBT1_uc009xzz.1_Missense_Mutation_p.D1952N|DMBT1_uc010qtx.1_Missense_Mutation_p.D672N|DMBT1_uc009yab.1_Missense_Mutation_p.D655N|DMBT1_uc009yac.1_Missense_Mutation_p.D246N	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1952	SRCR 14.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CACCCTGGACGATGTAGAGTG	0.557													22	50	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3794901	3794901	+	Silent	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3794901A>G	uc001lyh.2	-	6	855	c.564T>C	c.(562-564)TGT>TGC	p.C188C	NUP98_uc001lyi.2_Silent_p.C188C|NUP98_uc001lyj.1_Silent_p.C188C|NUP98_uc001lyk.1_Silent_p.C188C|NUP98_uc010qxv.1_Silent_p.C151C	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	188	Gly/Thr-rich.				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TAGCAGTAATACACTGGTGCT	0.363			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								7	25	---	---	---	---	PASS
OR52N5	390075	broad.mit.edu	37	11	5799050	5799050	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5799050C>T	uc010qzn.1	-	1	815	c.815G>A	c.(814-816)CGT>CAT	p.R272H	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N,	272	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		TCCCCCAAAACGGTGGGCAAA	0.453													17	17	---	---	---	---	PASS
OR2D3	120775	broad.mit.edu	37	11	6942355	6942355	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6942355C>A	uc010rav.1	+	1	123	c.123C>A	c.(121-123)ATC>ATA	p.I41I		NM_001004684	NP_001004684	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D,	41	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGACCCAGATCCTGCTATTTA	0.433													24	43	---	---	---	---	PASS
OR5P3	120066	broad.mit.edu	37	11	7847314	7847314	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7847314A>G	uc010rbg.1	-	1	206	c.206T>C	c.(205-207)GTA>GCA	p.V69A		NM_153445	NP_703146	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCCAATGTCTACAAAGGCCAA	0.443													3	49	---	---	---	---	PASS
ALX4	60529	broad.mit.edu	37	11	44286627	44286627	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44286627G>A	uc001myb.2	-	4	1117	c.1013C>T	c.(1012-1014)CCC>CTC	p.P338L		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	338					hair follicle development						0						AGAGCCAGGGGGGTGGGCATG	0.687													10	10	---	---	---	---	PASS
OR4S1	256148	broad.mit.edu	37	11	48328546	48328546	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48328546C>T	uc010rhu.1	+	1	772	c.772C>T	c.(772-774)CGT>TGT	p.R258C		NM_001004725	NP_001004725	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CATGTACATTCGTCCCTCCAC	0.488													37	47	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	55761150	55761150	+	IGR	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761150C>T								OR7E5P (7269 upstream) : OR5F1 (8 downstream)																							GATTTTTAGCCAAACAATCAC	0.328													9	18	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861449	55861449	+	Silent	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861449A>T	uc010rix.1	+	1	666	c.666A>T	c.(664-666)TCA>TCT	p.S222S		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					TCATCATCTCAGCCATCCTGA	0.468													36	41	---	---	---	---	PASS
OR8H1	219469	broad.mit.edu	37	11	56057959	56057959	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56057959T>A	uc010rje.1	-	1	580	c.580A>T	c.(580-582)ATT>TTT	p.I194F		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					ATGATTTCAATGTCGTATGTG	0.428													11	64	---	---	---	---	PASS
PLAC1L	219990	broad.mit.edu	37	11	59814493	59814493	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59814493C>G	uc001nol.2	+	4	609	c.424C>G	c.(424-426)CAG>GAG	p.Q142E		NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor	142						extracellular region				ovary(2)|skin(1)	3						TGCTGACTTTCAGACAACAGC	0.373													4	78	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61081072	61081072	+	Silent	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61081072G>T	uc001nrc.3	-	16	2194	c.1968C>A	c.(1966-1968)CCC>CCA	p.P656P	DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Silent_p.P656P	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	656	Interaction with CDT1.|Interaction with CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						AGATGACAGTGGGGCGGTCAG	0.483								NER					5	21	---	---	---	---	PASS
ACTN3	89	broad.mit.edu	37	11	66330314	66330314	+	Silent	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66330314A>T	uc001oio.1	+	21	2454	c.2436A>T	c.(2434-2436)GCA>GCT	p.A812A	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	812	EF-hand 2.|2; possibly ancestral.				focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						ACCCCAACGCAGCTGGGGTGG	0.567													18	122	---	---	---	---	PASS
IGHMBP2	3508	broad.mit.edu	37	11	68696686	68696686	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68696686G>T	uc001ook.1	+	8	1198	c.1096G>T	c.(1096-1098)GAG>TAG	p.E366*	IGHMBP2_uc001ooj.1_RNA|IGHMBP2_uc001ool.1_5'Flank	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	366	Leu-rich.				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GTTGCTGCCCGAGAGCTACTT	0.652													25	46	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78381535	78381535	+	Missense_Mutation	SNP	C	A	A	rs140341040	by1000genomes	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78381535C>A	uc001ozl.3	-	32	6318	c.5855G>T	c.(5854-5856)CGC>CTC	p.R1952L	ODZ4_uc001ozk.3_Missense_Mutation_p.R177L|ODZ4_uc009yvb.1_Missense_Mutation_p.R536L	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1952	YD 7.|Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						AGAAGAGAGGCGGTCATTCTT	0.542													12	34	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82879675	82879675	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82879675G>A	uc001ozx.3	+	8	2643	c.2298G>A	c.(2296-2298)ACG>ACA	p.T766T	PCF11_uc010rsu.1_Silent_p.T897T	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	766	Gly-rich.				mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						ATGGCCCAACGAAGATGATTT	0.488													12	41	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92714750	92714750	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92714750G>T	uc001pdk.1	+	2	464	c.361G>T	c.(361-363)GGC>TGC	p.G121C		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	121	Helical; Name=3; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	CTTTGTGATGGGCCTGAGCGT	0.597													22	66	---	---	---	---	PASS
ANKK1	255239	broad.mit.edu	37	11	113266902	113266902	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113266902C>T	uc001pny.2	+	5	890	c.796C>T	c.(796-798)CGC>TGC	p.R266C		NM_178510	NP_848605	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	266	Protein kinase.						ATP binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|ovary(1)|breast(1)	8		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CCTGATGAAACGCTGCTGGGA	0.622													11	61	---	---	---	---	PASS
CBL	867	broad.mit.edu	37	11	119144743	119144743	+	Intron	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119144743C>G	uc001pwe.2	+							NM_005188	NP_005179	P22681	CBL_HUMAN	Cas-Br-M (murine) ecotropic retroviral						epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		AGGTAGGACACTAAAAAAGTT	0.348									CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome				11	51	---	---	---	---	PASS
BLID	414899	broad.mit.edu	37	11	121986551	121986551	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121986551C>T	uc001pyf.2	-	1	373	c.80G>A	c.(79-81)GGA>GAA	p.G27E	LOC399959_uc009zba.2_Intron	NM_001001786	NP_001001786	Q8IZY5	BLID_HUMAN	BRCC2 protein	27					apoptosis	mitochondrion					0		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)		CTCTATCCATCCTGTGTAGAG	0.468											OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	35	---	---	---	---	PASS
BSX	390259	broad.mit.edu	37	11	122852332	122852332	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122852332C>A	uc010rzs.1	-	1	48	c.48G>T	c.(46-48)AGG>AGT	p.R16S		NM_001098169	NP_001091639	Q3C1V8	BSH_HUMAN	brain specific homeobox	16											0		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		AGGATGTGGGCCTCTGAGAAG	0.607													4	7	---	---	---	---	PASS
ESAM	90952	broad.mit.edu	37	11	124626148	124626148	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124626148C>A	uc001qav.3	-	4	735	c.562G>T	c.(562-564)GAT>TAT	p.D188Y	ESAM_uc010sao.1_Intron|ESAM_uc001qau.3_Missense_Mutation_p.D115Y|ESAM_uc001qaw.3_RNA|ESAM_uc001qax.3_RNA|ESAM_uc009zbi.2_Missense_Mutation_p.D188Y	NM_138961	NP_620411	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule precursor	188	Extracellular (Potential).|Ig-like C2-type.				blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction					0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		AGCTGCCGATCCCACTGGTAT	0.572													7	12	---	---	---	---	PASS
CLECL1	160365	broad.mit.edu	37	12	9885563	9885563	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9885563A>C	uc001qwj.2	-	1	298	c.298T>G	c.(298-300)TTT>GTT	p.F100V		NM_172004	NP_742001	Q8IZS7	CLCL1_HUMAN	type II transmembrane protein DCAL1	100	Extracellular (Potential).					integral to membrane|plasma membrane	sugar binding				0						TGAAGTGGAAACGCGAGTTCT	0.398													14	85	---	---	---	---	PASS
TAS2R9	50835	broad.mit.edu	37	12	10962127	10962127	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10962127A>T	uc001qyx.2	-	1	641	c.548T>A	c.(547-549)CTG>CAG	p.L183Q	TAS2R8_uc010shh.1_5'Flank	NM_023917	NP_076406	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	183	Helical; Name=5; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			skin(1)	1						CCCCAGGTTCAGGGTTAACTG	0.393													90	51	---	---	---	---	PASS
APOLD1	81575	broad.mit.edu	37	12	12940477	12940477	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12940477T>C	uc001rau.3	+	2	815	c.731T>C	c.(730-732)CTG>CCG	p.L244P	DDX47_uc001rav.2_Intron|APOLD1_uc001raw.3_Missense_Mutation_p.L213P	NM_001130415	NP_001123887	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1 isoform 1	244	Potential.				angiogenesis|cell differentiation|lipid transport|lipoprotein metabolic process	extracellular region|integral to membrane|plasma membrane	lipid binding			ovary(1)	1		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		ACCGGGGCTCTGGACGAACTC	0.637													74	37	---	---	---	---	PASS
HOXC10	3226	broad.mit.edu	37	12	54383205	54383205	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54383205T>C	uc001sen.2	+	2	1102	c.1004T>C	c.(1003-1005)CTG>CCG	p.L335P	uc001seo.2_5'Flank|MIR196A2_hsa-mir-196a-2|MI0000279_5'Flank	NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	335					positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						ATCCGGGAACTGACCTCCAAT	0.318											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	13	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57115156	57115156	+	Intron	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57115156G>A	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Missense_Mutation_p.P53L|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Missense_Mutation_p.P53L|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						GCACTGTTGTGGGGCAGGAGA	0.572			T	BCL6	NHL								7	14	---	---	---	---	PASS
R3HDM2	22864	broad.mit.edu	37	12	57663634	57663634	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57663634C>T	uc009zpm.1	-	13	1481	c.1446G>A	c.(1444-1446)ACG>ACA	p.T482T	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_Silent_p.T177T|R3HDM2_uc001snr.2_Silent_p.T209T|R3HDM2_uc001sns.2_Silent_p.T482T|R3HDM2_uc001snt.2_Silent_p.T496T|R3HDM2_uc009zpn.1_Silent_p.T105T	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	482	Gln-rich.					nucleus	nucleic acid binding			ovary(2)	2						GGGGCTGACCCGTGGAAGCCA	0.572													24	41	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57864776	57864776	+	Silent	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57864776G>T	uc001snx.2	+	12	2331	c.2253G>T	c.(2251-2253)CTG>CTT	p.L751L	GLI1_uc009zpq.2_Silent_p.L623L	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	751					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			CAGGCTCTCTGCCTCTTGGGC	0.592													37	49	---	---	---	---	PASS
WIF1	11197	broad.mit.edu	37	12	65461562	65461562	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65461562G>T	uc001ssk.2	-	5	692	c.547C>A	c.(547-549)CCA>ACA	p.P183T		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	183	EGF-like 1.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CACCCGCCTGGGCACTCAGCT	0.488			T	HMGA2	pleomorphic salivary gland adenoma								11	17	---	---	---	---	PASS
WIF1	11197	broad.mit.edu	37	12	65461563	65461563	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65461563G>T	uc001ssk.2	-	5	691	c.546C>A	c.(544-546)TGC>TGA	p.C182*		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	182	EGF-like 1.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		ACCCGCCTGGGCACTCAGCTT	0.483			T	HMGA2	pleomorphic salivary gland adenoma								12	17	---	---	---	---	PASS
MSRB3	253827	broad.mit.edu	37	12	65856932	65856932	+	Intron	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65856932C>T	uc001ssn.2	+						MSRB3_uc001ssm.2_Intron|MSRB3_uc009zqp.2_Intron	NM_198080	NP_932346	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3 isoform 1						protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		TCTTCTCTTTCAGTGTGGTGC	0.443													4	126	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78400650	78400650	+	Silent	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78400650T>A	uc001syp.2	+	8	1505	c.1332T>A	c.(1330-1332)CCT>CCA	p.P444P	NAV3_uc001syo.2_Silent_p.P444P	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	444						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAGTGTCACCTAAGTTGGCCC	0.408										HNSCC(70;0.22)			23	74	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85450481	85450481	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85450481C>A	uc001tac.2	+	8	2021	c.1910C>A	c.(1909-1911)TCA>TAA	p.S637*	LRRIQ1_uc001tab.1_Nonsense_Mutation_p.S637*|LRRIQ1_uc001taa.1_Nonsense_Mutation_p.S612*	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	637										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		GAAATTTATTCAAAATCCAAA	0.299													13	22	---	---	---	---	PASS
LUM	4060	broad.mit.edu	37	12	91498030	91498030	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91498030C>A	uc001tbm.2	-	3	1318	c.929G>T	c.(928-930)CGT>CTT	p.R310L	LUM_uc001tbn.2_RNA	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	310	LRR 11.				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						GCCATCCAAACGCAAATGCTT	0.373													9	36	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94618035	94618035	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94618035C>T	uc001tdc.2	+	7	1983	c.1734C>T	c.(1732-1734)TTC>TTT	p.F578F		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	578	Extracellular (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						TGTTCTCCTTCGGTTCTTGGA	0.373													13	118	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	100377872	100377872	+	Intron	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100377872C>A	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GAGCTGGTGCCCGTCCTTACC	0.567													7	52	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124335548	124335548	+	Silent	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124335548T>A	uc001uft.3	+	34	5887	c.5862T>A	c.(5860-5862)CCT>CCA	p.P1954P		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1954	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGTTCAGGCCTGTGGTCGTGA	0.632													3	51	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131555400	131555400	+	Intron	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131555400C>A	uc001uit.3	+						GPR133_uc010tbm.1_Intron|GPR133_uc009zyo.2_5'UTR	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCCATGTGGTCATGGAGTGTC	0.597													4	105	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20012252	20012252	+	Missense_Mutation	SNP	C	T	T	rs140738972		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20012252C>T	uc001umd.2	-	15	1226	c.1015G>A	c.(1015-1017)GAA>AAA	p.E339K	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.E228K|TPTE2_uc001ume.2_Missense_Mutation_p.E262K|TPTE2_uc009zzm.2_Missense_Mutation_p.E10K|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Missense_Mutation_p.E10K	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	339	Phosphatase tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AAAAATATTTCGGAGGCAATA	0.284													19	20	---	---	---	---	PASS
SPG20	23111	broad.mit.edu	37	13	36909772	36909772	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36909772G>C	uc001uvn.2	-	3	466	c.196C>G	c.(196-198)CAC>GAC	p.H66D	SPG20_uc010ten.1_Missense_Mutation_p.H66D|SPG20_uc001uvm.2_Missense_Mutation_p.H66D|SPG20_uc001uvo.2_Missense_Mutation_p.H66D|SPG20_uc001uvq.2_Missense_Mutation_p.H66D|SPG20_uc001uvp.2_Missense_Mutation_p.H66D	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	66	MIT.				cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		GGACCTGTGTGTTCAGACTCT	0.433													33	35	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329160	88329160	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329160A>T	uc001vln.2	+	2	1736	c.1517A>T	c.(1516-1518)AAC>ATC	p.N506I	SLITRK5_uc010tic.1_Missense_Mutation_p.N265I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	506	Extracellular (Potential).|LRR 11.					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CCGGTCCCAAACCTCCAGCTG	0.532													27	47	---	---	---	---	PASS
GPR180	160897	broad.mit.edu	37	13	95273375	95273375	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95273375G>C	uc001vly.2	+	6	858	c.780G>C	c.(778-780)TTG>TTC	p.L260F	GPR180_uc001vlz.2_Missense_Mutation_p.L159F|GPR180_uc010afi.2_Missense_Mutation_p.L21F	NM_180989	NP_851320	Q86V85	GP180_HUMAN	G protein-coupled receptor 180 precursor	260	Helical; (Potential).					integral to membrane				breast(1)	1	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					ACTTACTTTTGAGTCTATGCA	0.393													6	62	---	---	---	---	PASS
LRP10	26020	broad.mit.edu	37	14	23342530	23342530	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23342530C>T	uc001whd.2	+	3	643	c.90C>T	c.(88-90)GAC>GAT	p.D30D	LRP10_uc001whe.2_5'Flank	NM_014045	NP_054764	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein	30	CUB 1.|Extracellular (Potential).				endocytosis	coated pit|integral to membrane				central_nervous_system(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		CTTGTGAGGACCCCCCAGCAG	0.612											OREG0022588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	49	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26917512	26917512	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26917512C>A	uc001wpy.2	-	5	1495	c.1177G>T	c.(1177-1179)GCT>TCT	p.A393S	NOVA1_uc001wpz.2_Missense_Mutation_p.A369S|NOVA1_uc001wqa.2_Missense_Mutation_p.A271S	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	396	Ala-rich.				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		TTGGTTGCAGCAGTAGCAGCA	0.512													3	19	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44975233	44975233	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44975233G>A	uc001wvn.2	-	1	1267	c.958C>T	c.(958-960)CCT>TCT	p.P320S		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	320	Pro-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TCTTCAGCAGGTGGAGGCTGA	0.507													13	45	---	---	---	---	PASS
KTN1	3895	broad.mit.edu	37	14	56139935	56139935	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56139935T>C	uc001xcb.2	+	41	4035	c.3733T>C	c.(3733-3735)TAT>CAT	p.Y1245H	KTN1_uc001xce.2_Intron|KTN1_uc001xcc.2_Missense_Mutation_p.Y1245H|KTN1_uc001xcd.2_Intron|KTN1_uc010trb.1_Intron|KTN1_uc001xcf.1_Intron|KTN1_uc010aoq.2_Intron|KTN1_uc010trc.1_Intron|KTN1_uc001xcg.2_Intron	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	1245	Lumenal (Potential).|Potential.				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						TGATGATTCATATTCTGAAGC	0.368			T	RET	papillary thryoid								4	18	---	---	---	---	PASS
SERPINA3	12	broad.mit.edu	37	14	95081224	95081224	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95081224T>A	uc001ydp.2	+	2	525	c.446T>A	c.(445-447)CTG>CAG	p.L149Q	SERPINA3_uc001ydo.3_Missense_Mutation_p.L174Q|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.L149Q|SERPINA3_uc001yds.2_Missense_Mutation_p.L149Q|SERPINA3_uc010avg.2_Missense_Mutation_p.L149Q	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	149					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		CAACTCAGTCTGCTGGACAGG	0.547													9	29	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25223391	25223391	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25223391G>T	uc001ywp.1	+	12	1501	c.611G>T	c.(610-612)GGG>GTG	p.G204V	SNRPN_uc001ywq.1_Missense_Mutation_p.G204V|SNRPN_uc001ywr.1_Missense_Mutation_p.G204V|SNRPN_uc001yws.1_Missense_Mutation_p.G204V|SNRPN_uc001ywt.1_Missense_Mutation_p.G204V|SNRPN_uc001ywv.1_Missense_Mutation_p.G207V|SNRPN_uc001yww.1_Missense_Mutation_p.G204V|SNRPN_uc001ywx.1_Missense_Mutation_p.G204V|SNRPN_uc001ywz.1_RNA|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	204	Repeat-rich region.				RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CCACCAATTGGGCTTCCCCCT	0.537									Prader-Willi_syndrome				17	75	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42644329	42644329	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42644329A>T	uc001zpi.2	+	24	3051	c.2737A>T	c.(2737-2739)ATC>TTC	p.I913F	CAPN3_uc001zpk.1_Intron|CAPN3_uc001zpl.1_Intron|CAPN3_uc010udf.1_5'Flank|CAPN3_uc010udg.1_5'Flank	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	913					carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		GGAGGTCCGCATCATATGACA	0.493													4	19	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51839432	51839432	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51839432C>A	uc002abf.2	-	7	966	c.741G>T	c.(739-741)ATG>ATT	p.M247I	DMXL2_uc010ufy.1_Missense_Mutation_p.M247I|DMXL2_uc010bfa.2_Missense_Mutation_p.M247I	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	247	WD 3.					cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		CTAACCTGGGCATATACTTGC	0.318													5	33	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	54025310	54025310	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54025310G>C	uc002acj.2	-	2	79	c.37C>G	c.(37-39)CAG>GAG	p.Q13E	WDR72_uc010bfi.1_Missense_Mutation_p.Q13E	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	13										lung(1)|skin(1)	2				all cancers(107;0.0511)		GGGGCCTTCTGTCCCCAGAGT	0.498													11	44	---	---	---	---	PASS
CCPG1	9236	broad.mit.edu	37	15	55669237	55669237	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55669237C>T	uc002acv.1	-	5	529	c.364G>A	c.(364-366)GTT>ATT	p.V122I	CCPG1_uc002acy.2_Missense_Mutation_p.V122I|DYX1C1_uc010ugh.1_RNA|CCPG1_uc002acw.1_5'UTR|CCPG1_uc002acx.2_Missense_Mutation_p.V122I|CCPG1_uc010bfk.1_Missense_Mutation_p.V122I|CCPG1_uc002acz.1_Missense_Mutation_p.V122I	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2	122	Cytoplasmic (Potential).|Interaction with MCF2L and SRC (By similarity).				cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		ACAATGACAACTTCTTGATTT	0.398													12	53	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	71633537	71633537	+	Intron	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71633537T>A	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						CAGTTTCTTCTGGGATATCTT	0.318													9	40	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86123578	86123578	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86123578C>T	uc002blv.1	+	7	2449	c.2279C>T	c.(2278-2280)TCA>TTA	p.S760L	AKAP13_uc002blt.1_Missense_Mutation_p.S760L|AKAP13_uc002blu.1_Missense_Mutation_p.S760L|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	760					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GAGGTGGTTTCACATCCACAT	0.428													5	40	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90347814	90347814	+	Missense_Mutation	SNP	G	T	T	rs17240268	byFrequency	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90347814G>T	uc002bop.3	-	5	1224	c.932C>A	c.(931-933)GCG>GAG	p.A311E		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	311	Extracellular.|Interaction with HCoV-229E.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	GCCGTGGCCCGCCGCAATGGC	0.602													3	59	---	---	---	---	PASS
DECR2	26063	broad.mit.edu	37	16	457540	457540	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:457540G>A	uc002chb.2	+	4	423	c.317G>A	c.(316-318)AGA>AAA	p.R106K	DECR2_uc002chc.2_Missense_Mutation_p.R22K|DECR2_uc010bqv.2_Missense_Mutation_p.R22K|DECR2_uc002chd.2_Missense_Mutation_p.R22K|DECR2_uc002che.1_RNA	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2	106						peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				GAGTTTGGCAGAATCGACATT	0.607													13	60	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2129556	2129556	+	Splice_Site	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2129556A>T	uc002con.2	+	29	3391	c.3285_splice	c.e29-2	p.S1095_splice	TSC2_uc010bsd.2_Splice_Site_p.S1095_splice|TSC2_uc002coo.2_Splice_Site_p.S1051_splice|TSC2_uc010uvv.1_Splice_Site_p.S1015_splice|TSC2_uc010uvw.1_Splice_Site_p.S1003_splice|TSC2_uc002cop.2_Splice_Site_p.S851_splice	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1						cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				TTCTCTTCTCAGCTCCAGCCC	0.692			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				6	5	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19501870	19501870	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19501870C>T	uc002dgc.3	+	18	3476	c.2727C>T	c.(2725-2727)TTC>TTT	p.F909F	TMC5_uc010vaq.1_Silent_p.F857F|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Silent_p.F909F|TMC5_uc002dgd.1_Silent_p.F663F|TMC5_uc002dge.3_Silent_p.F663F|TMC5_uc002dgf.3_Silent_p.F592F|TMC5_uc002dgg.3_Silent_p.F550F	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	909	Helical; (Potential).					integral to membrane				skin(1)	1						ACTTCTTTTTCATCCTCACCC	0.517													5	111	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20693760	20693760	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20693760G>A	uc002dhm.1	-	3	497	c.429C>T	c.(427-429)ATC>ATT	p.I143I	ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_Silent_p.I143I	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	143					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						CCTTCAACAGGATGGTCGCAG	0.463													8	19	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21011702	21011702	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21011702G>T	uc010vbe.1	-	43	6265	c.6265C>A	c.(6265-6267)CTC>ATC	p.L2089I		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2089	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GGAAGGTGGAGAAGGAAGTTG	0.483													16	37	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48149466	48149466	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48149466C>T	uc002efc.1	-	13	2195	c.1849G>A	c.(1849-1851)GTC>ATC	p.V617I	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	617	ABC transporter 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				TCGGAGTAGACAGCGCGGGCC	0.627													7	40	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61823381	61823381	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61823381G>T	uc002eog.1	-	8	1535	c.1283C>A	c.(1282-1284)TCC>TAC	p.S428Y	CDH8_uc002eoh.2_Missense_Mutation_p.S197Y	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	428	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CCGGTCGATGGAAAACCTACA	0.423													14	35	---	---	---	---	PASS
SMPD3	55512	broad.mit.edu	37	16	68404963	68404963	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68404963C>T	uc002ewa.2	-	3	1544	c.1122G>A	c.(1120-1122)TTG>TTA	p.L374L	SMPD3_uc010cfe.2_Silent_p.L374L|SMPD3_uc010vlh.1_Silent_p.L374L	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN	neutral sphingomyelin phosphodiesterase 3	374	Lumenal (Potential).				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GCTGCTCTTTCAATTTGGTGG	0.602													7	25	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	71220757	71220757	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71220757C>G	uc002ezr.2	-	2	170	c.42G>C	c.(40-42)CAG>CAC	p.Q14H	HYDIN_uc010cfz.1_5'UTR|HYDIN_uc002ezv.2_Missense_Mutation_p.Q14H|HYDIN_uc010vmc.1_Missense_Mutation_p.Q31H|HYDIN_uc010vmd.1_Missense_Mutation_p.Q41H|HYDIN_uc002ezw.3_Missense_Mutation_p.Q31H	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	14										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				CCAATCCCATCTGAACAGCCC	0.378													11	80	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71713410	71713410	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71713410A>T	uc002fax.2	-	6	925	c.919T>A	c.(919-921)TCC>ACC	p.S307T	PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Missense_Mutation_p.S307T|PHLPP2_uc002fay.1_Missense_Mutation_p.S307T	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	307	LRR 3.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						TTATTATGGGACAAGTTCAGG	0.383													6	55	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195412	3195412	+	Silent	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195412A>G	uc002fvh.1	-	1	465	c.465T>C	c.(463-465)GCT>GCC	p.A155A		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	155	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						CGTTGGTGAAAGCACAAGCCC	0.577													16	70	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5035697	5035697	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5035697G>A	uc002gau.1	+	12	2392	c.162G>A	c.(160-162)ACG>ACA	p.T54T	USP6_uc002gav.1_Silent_p.T54T|USP6_uc010ckz.1_5'UTR|USP6_uc002gaw.2_Silent_p.T115T|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	54					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						ACAGTGAGACGGAGCTGCCTC	0.662			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								17	75	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	A	A	rs121912651		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577539G>A	uc002gim.2	-	7	936	c.742C>T	c.(742-744)CGG>TGG	p.R248W	TP53_uc002gig.1_Missense_Mutation_p.R248W|TP53_uc002gih.2_Missense_Mutation_p.R248W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116W|TP53_uc010cng.1_Missense_Mutation_p.R116W|TP53_uc002gii.1_Missense_Mutation_p.R116W|TP53_uc010cnh.1_Missense_Mutation_p.R248W|TP53_uc010cni.1_Missense_Mutation_p.R248W|TP53_uc002gij.2_Missense_Mutation_p.R248W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155W|TP53_uc002gio.2_Missense_Mutation_p.R116W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(516)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGGGCCTCCGGTTCATGCCG	0.577	R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO680N_OESOPHAGUS)|R248W(SW837_LARGE_INTESTINE)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(RD_SOFT_TISSUE)|R248W(VCAP_PROSTATE)|R248W(JIMT1_BREAST)|R248W(GCT_SOFT_TISSUE)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(786O_KIDNEY)|R248W(COLO320_LARGE_INTESTINE)|R248W(LXF289_LUNG)|R248W(LUDLU1_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(HCC2157_BREAST)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			14	8	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7696114	7696114	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7696114G>C	uc002giu.1	+	46	7299	c.7285G>C	c.(7285-7287)GTT>CTT	p.V2429L		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2429	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CGCCCAGAGCGTTCTGCAGTC	0.632													9	26	---	---	---	---	PASS
TRIM16	10626	broad.mit.edu	37	17	15516031	15516031	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15516031C>T	uc002gor.1	-	11	2373	c.2036G>A	c.(2035-2037)TGG>TAG	p.W679*	CDRT1_uc002gov.3_Nonsense_Mutation_p.W369*			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;	Error:Variant_position_missing_in_O95361_after_alignment					histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TCTCAACTTCCACTTCGGATG	0.463													26	161	---	---	---	---	PASS
FAM27L	284123	broad.mit.edu	37	17	21826125	21826125	+	RNA	SNP	T	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21826125T>G	uc002gyz.2	+	2		c.235T>G				NR_028336				Homo sapiens family with sequence similarity 27-like, mRNA (cDNA clone MGC:35151 IMAGE:5169482), complete cds.												0				UCEC - Uterine corpus endometrioid carcinoma (53;0.11)|BRCA - Breast invasive adenocarcinoma(1;0.00463)		CAGCCAAGGATAAAAGCCCCA	0.527													17	25	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29486068	29486068	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29486068C>G	uc002hgg.2	+	3	578	c.245C>G	c.(244-246)TCT>TGT	p.S82C	NF1_uc002hge.1_Missense_Mutation_p.S82C|NF1_uc002hgf.1_Missense_Mutation_p.S82C|NF1_uc002hgh.2_Missense_Mutation_p.S82C|NF1_uc010csn.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	82			S -> F (in NF1).		actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.0?(5)|p.?(4)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTATATCTCTCTCAGTTGATT	0.328			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			3	53	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30519306	30519306	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30519306C>A	uc002hgz.2	+	9	866	c.627C>A	c.(625-627)CTC>CTA	p.L209L	RHOT1_uc002hgw.2_Silent_p.L209L|RHOT1_uc002hgy.2_Silent_p.L209L|RHOT1_uc002hha.2_Silent_p.L82L|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Silent_p.L82L|RHOT1_uc010wby.1_Silent_p.L209L|RHOT1_uc002hhb.2_Silent_p.L188L|RHOT1_uc002hgv.2_Silent_p.L209L	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3	209	EF-hand 1.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				ATGCTGAACTCAACTTCTTTC	0.299													8	56	---	---	---	---	PASS
IKZF3	22806	broad.mit.edu	37	17	37947744	37947744	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37947744G>A	uc002hsu.2	-	5	579	c.517C>T	c.(517-519)CCT>TCT	p.P173S	IKZF3_uc002htd.2_Missense_Mutation_p.P139S|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Missense_Mutation_p.P139S|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Missense_Mutation_p.P173S|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Missense_Mutation_p.P173S|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Missense_Mutation_p.P173S|IKZF3_uc002htb.2_RNA|IKZF3_uc010cwh.2_Missense_Mutation_p.P86S|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1	173					B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CACTTAAAAGGTTTTTCCCCT	0.458													23	135	---	---	---	---	PASS
KRTAP1-3	81850	broad.mit.edu	37	17	39190888	39190888	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39190888C>A	uc002hvv.2	-	1	220	c.186G>T	c.(184-186)CAG>CAT	p.Q62H		NM_030966	NP_112228	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	72			Missing (in allele KAP1.9).			extracellular region|keratin filament	structural constituent of epidermis				0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCAGCTTGGCTGGCAGCAAC	0.612													17	54	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40318470	40318470	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40318470C>A	uc002hzb.2	-	10	2018	c.1685G>T	c.(1684-1686)AGG>ATG	p.R562M		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	562	Cytoplasmic (Potential).|cNMP.				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CAGGCAGCCCCTGCTCGCTGC	0.607													7	28	---	---	---	---	PASS
TTLL6	284076	broad.mit.edu	37	17	46865372	46865372	+	Intron	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46865372G>A	uc010wlo.1	-						TTLL6_uc002iob.2_Intron|TTLL6_uc010dbi.2_Intron|TTLL6_uc002ioc.2_Intron|TTLL6_uc002iod.2_Intron	NM_001130918	NP_001124390	Q8N841	TTLL6_HUMAN	tubulin tyrosine ligase-like family, member 6							cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0						CTGTTGGGAAGCAGAACATGG	0.478													32	71	---	---	---	---	PASS
SPATA20	64847	broad.mit.edu	37	17	48631635	48631635	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48631635G>A	uc002irf.2	+	14	2074	c.1933G>A	c.(1933-1935)GCC>ACC	p.A645T	SPATA20_uc002irc.2_Missense_Mutation_p.A312T|SPATA20_uc002ire.2_Missense_Mutation_p.A601T|SPATA20_uc002ird.2_Missense_Mutation_p.A661T|SPATA20_uc002irg.2_RNA	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	645					cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGAGCCCAGCGCCAATTCCGT	0.612													3	30	---	---	---	---	PASS
RNF43	54894	broad.mit.edu	37	17	56435050	56435050	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56435050G>A	uc002iwf.2	-	8	4043	c.2087C>T	c.(2086-2088)GCA>GTA	p.A696V	RNF43_uc010wnv.1_Missense_Mutation_p.A655V|RNF43_uc002iwh.3_Missense_Mutation_p.A696V|RNF43_uc002iwg.3_Missense_Mutation_p.A696V|RNF43_uc010dcw.2_Missense_Mutation_p.A569V	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	696	Pro-rich.|Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAAGGGGTGTGCCTCTGGGGA	0.592													33	89	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59112076	59112076	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59112076G>T	uc002iyv.3	+	18	1841	c.1732G>T	c.(1732-1734)GAA>TAA	p.E578*	BCAS3_uc010wow.1_Nonsense_Mutation_p.E350*|BCAS3_uc002iyu.3_Nonsense_Mutation_p.E563*|BCAS3_uc002iyw.3_Nonsense_Mutation_p.E559*|BCAS3_uc002iyy.3_Nonsense_Mutation_p.E334*|BCAS3_uc002iyz.3_Nonsense_Mutation_p.E132*|BCAS3_uc002iza.3_Nonsense_Mutation_p.E117*	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	578						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GATGGGCGGAGAATTTTGTGT	0.338													25	53	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61607532	61607532	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61607532G>A	uc002jay.2	+	3	468	c.388G>A	c.(388-390)GAG>AAG	p.E130K	KCNH6_uc002jax.1_Missense_Mutation_p.E130K|KCNH6_uc010wpl.1_Missense_Mutation_p.E7K|KCNH6_uc010wpm.1_Missense_Mutation_p.E130K|KCNH6_uc002jaz.1_Missense_Mutation_p.E130K	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	130	PAC.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	TCTCAACTTCGAGGACCTGGC	0.622													24	37	---	---	---	---	PASS
CCDC47	57003	broad.mit.edu	37	17	61838333	61838333	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61838333T>A	uc002jbs.3	-	6	1012	c.676A>T	c.(676-678)AAG>TAG	p.K226*	CCDC47_uc010ddx.2_Nonsense_Mutation_p.K226*|CCDC47_uc002jbt.2_Nonsense_Mutation_p.K226*	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor	226						integral to membrane	protein binding				0						TCTTGTCTCTTGAGGAACTGA	0.398													4	17	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80044224	80044224	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80044224G>A	uc002kdu.2	-	22	3755	c.3638C>T	c.(3637-3639)CCT>CTT	p.P1213L	FASN_uc002kdw.1_Missense_Mutation_p.P429L	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	1213					energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	GCTGAGCAGAGGGTCCTCTGG	0.662													4	7	---	---	---	---	PASS
KCTD1	284252	broad.mit.edu	37	18	24035721	24035721	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24035721C>T	uc002kvw.2	-	5	1320	c.760G>A	c.(760-762)GAG>AAG	p.E254K	KCTD1_uc010xbj.1_Missense_Mutation_p.E862K|KCTD1_uc010xbk.1_Missense_Mutation_p.E254K|KCTD1_uc002kvy.2_3'UTR	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain	254					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			TCCAGAGGCTCTTGCTTTATC	0.498													167	107	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47431074	47431074	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47431074G>A	uc002leb.2	-	20	2827	c.2539C>T	c.(2539-2541)CGG>TGG	p.R847W	MYO5B_uc002lea.2_5'Flank	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	847	IQ 3.|Arg-rich.|IQ 4.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		AACATGGCCCGGGTGAAGGCC	0.587													4	44	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55020255	55020255	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55020255C>A	uc002lgn.2	+	1	535	c.178C>A	c.(178-180)CGG>AGG	p.R60R		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	60	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		CGCGGGATTCCGGTGAGTGCG	0.597													3	16	---	---	---	---	PASS
NETO1	81832	broad.mit.edu	37	18	70417720	70417720	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70417720A>T	uc002lkw.2	-	9	1402	c.1118T>A	c.(1117-1119)GTC>GAC	p.V373D	NETO1_uc002lkx.1_Missense_Mutation_p.V372D|NETO1_uc002lky.1_Missense_Mutation_p.V373D	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3	373	Cytoplasmic (Potential).				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TTTCCTTTGGACATACTTTTT	0.453													8	43	---	---	---	---	PASS
LPPR3	79948	broad.mit.edu	37	19	814740	814740	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:814740G>T	uc002lpx.1	-	6	673	c.609C>A	c.(607-609)TTC>TTA	p.F203L	LPPR3_uc010dru.1_Missense_Mutation_p.F115L|LPPR3_uc002lpw.1_Missense_Mutation_p.F203L|LPPR3_uc002lpy.1_5'UTR	NM_024888	NP_079164	Q6T4P5	LPPR3_HUMAN	plasticity-related protein 2	203						integral to membrane	phosphatidate phosphatase activity				0						GCTGGGACGGGAAGGTCTTCC	0.672													10	7	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10476261	10476261	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10476261C>T	uc002moc.3	-	7	1321	c.943G>A	c.(943-945)GAG>AAG	p.E315K	TYK2_uc010dxe.2_Missense_Mutation_p.E130K|TYK2_uc002mod.2_Missense_Mutation_p.E315K	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	315	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			ACCAGCACCTCGTGGGTTGGG	0.682													4	51	---	---	---	---	PASS
QTRT1	81890	broad.mit.edu	37	19	10822892	10822892	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10822892G>A	uc002mpr.2	+	6	727	c.702G>A	c.(700-702)GAG>GAA	p.E234E	DNM2_uc010dxk.2_5'Flank	NM_031209	NP_112486	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	234					queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity			skin(1)	1			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			GCGGGGGTGAGAGCAAGTCGC	0.617													14	41	---	---	---	---	PASS
TNPO2	30000	broad.mit.edu	37	19	12813658	12813658	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12813658T>C	uc002muo.2	-	20	2469	c.2284A>G	c.(2284-2286)AAG>GAG	p.K762E	TNPO2_uc002mup.2_Missense_Mutation_p.K854E|TNPO2_uc002muq.2_Missense_Mutation_p.K762E|TNPO2_uc002mur.2_Missense_Mutation_p.K762E	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)	762	HEAT 13.				intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						AGCAGTGTCTTGGGTGTGTTG	0.607													35	108	---	---	---	---	PASS
NFIX	4784	broad.mit.edu	37	19	13136140	13136140	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13136140G>A	uc010xmx.1	+	2	410	c.357G>A	c.(355-357)AAG>AAA	p.K119K	NFIX_uc002mwd.2_Silent_p.K111K|NFIX_uc002mwe.2_Silent_p.K103K|NFIX_uc002mwf.2_Silent_p.K114K|NFIX_uc002mwg.1_Silent_p.K110K			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	111	CTF/NF-I.				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CCGACCAGAAGGGCAAGATCC	0.617													17	20	---	---	---	---	PASS
LPHN1	22859	broad.mit.edu	37	19	14263176	14263176	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14263176G>A	uc010xnn.1	-	22	3905	c.3609C>T	c.(3607-3609)CTC>CTT	p.L1203L	LPHN1_uc010xno.1_Silent_p.L1198L|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	1203	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						ACTCGGCGATGAGGGTGTTGT	0.612													8	60	---	---	---	---	PASS
NOTCH3	4854	broad.mit.edu	37	19	15303038	15303038	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15303038G>T	uc002nan.2	-	4	488	c.412C>A	c.(412-414)CCC>ACC	p.P138T	NOTCH3_uc002nao.1_Missense_Mutation_p.P138T	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	138	Extracellular (Potential).|EGF-like 3.				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CGTCCATCGGGCCCCACTGAG	0.687													3	7	---	---	---	---	PASS
GLT25D1	79709	broad.mit.edu	37	19	17691562	17691562	+	Silent	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17691562C>T	uc002nhc.1	+	11	1461	c.1449C>T	c.(1447-1449)CGC>CGT	p.R483R	GLT25D1_uc010eax.1_Silent_p.R211R|GLT25D1_uc010eay.1_Silent_p.R12R	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1	483					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0						CTGTGCCTCGCGTGAGGAACC	0.657													15	20	---	---	---	---	PASS
GLT25D1	79709	broad.mit.edu	37	19	17692173	17692173	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17692173C>T	uc002nhc.1	+	12	1801	c.1789C>T	c.(1789-1791)CAG>TAG	p.Q597*	GLT25D1_uc010eay.1_Nonsense_Mutation_p.Q126*	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1	597					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0						GATGCGGGAGCAGCAGGCACT	0.602													17	40	---	---	---	---	PASS
GPATCH1	55094	broad.mit.edu	37	19	33592443	33592443	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33592443G>A	uc002nug.1	+	9	1357	c.1043G>A	c.(1042-1044)GGA>GAA	p.G348E		NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	348						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					ATTTTGGATGGATTTTCCTTG	0.303													7	63	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36333109	36333109	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36333109G>A	uc002oby.2	-	19	2580	c.2580C>T	c.(2578-2580)ACC>ACT	p.T860T	NPHS1_uc010eem.1_5'Flank	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	860	Ig-like C2-type 8.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCAGTGGAGGGTGGCAGAAC	0.607													6	7	---	---	---	---	PASS
ZNF585A	199704	broad.mit.edu	37	19	37644505	37644505	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37644505T>A	uc002ofo.1	-	5	527	c.296A>T	c.(295-297)GAG>GTG	p.E99V	ZNF585A_uc002ofm.1_Missense_Mutation_p.E44V|ZNF585A_uc002ofn.1_Missense_Mutation_p.E44V	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	99					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCATAATTTCTCTCCTGTTGG	0.313													15	137	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41597756	41597756	+	Silent	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41597756G>T	uc002opt.2	+	5	783	c.774G>T	c.(772-774)ACG>ACT	p.T258T		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	258					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	ACCAGCGCACGCTGGATCCCA	0.587													28	20	---	---	---	---	PASS
ZNF180	7733	broad.mit.edu	37	19	44981071	44981071	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44981071G>C	uc002ozf.3	-	5	1909	c.1627C>G	c.(1627-1629)CAC>GAC	p.H543D	ZNF180_uc002ozh.3_Missense_Mutation_p.H200D|ZNF180_uc002ozi.3_Missense_Mutation_p.H516D|ZNF180_uc002ozg.3_Missense_Mutation_p.H542D|ZNF180_uc010ejm.2_Missense_Mutation_p.H518D	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	543	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				TCTCCAGTGTGAGTTCTTTGA	0.428													6	83	---	---	---	---	PASS
ZSCAN4	201516	broad.mit.edu	37	19	58189579	58189579	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58189579C>A	uc002qpu.2	+	5	1305	c.608C>A	c.(607-609)ACT>AAT	p.T203N		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	203					telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCGAAAACTACTCGAGTAAAT	0.393													3	32	---	---	---	---	PASS
MYL9	10398	broad.mit.edu	37	20	35177629	35177629	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35177629G>T	uc002xfl.1	+	4	590	c.496G>T	c.(496-498)GGC>TGC	p.G166C	uc002xfk.3_Intron|MYL9_uc002xfm.1_Missense_Mutation_p.G112C	NM_006097	NP_006088	P24844	MYL9_HUMAN	myosin regulatory light chain 9 isoform a	166	EF-hand 3.				axon guidance|muscle contraction|regulation of muscle contraction	cytosol|muscle myosin complex	calcium ion binding|structural constituent of muscle				0	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CCTCAAACATGGCGCCAAGGA	0.602													5	35	---	---	---	---	PASS
GTSF1L	149699	broad.mit.edu	37	20	42355044	42355044	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42355044G>T	uc002xld.2	-	1	599	c.291C>A	c.(289-291)TGC>TGA	p.C97*	GTSF1L_uc002xlc.2_Intron	NM_176791	NP_789761	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like isoform 1	97							metal ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGCTGGGAAGGCAGGGTGAGA	0.493													14	36	---	---	---	---	PASS
FAM65C	140876	broad.mit.edu	37	20	49218870	49218870	+	Silent	SNP	C	A	A	rs78064464	byFrequency	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49218870C>A	uc002xvm.2	-	13	1704	c.1386G>T	c.(1384-1386)CCG>CCT	p.P462P	FAM65C_uc010zyt.1_Silent_p.P466P|FAM65C_uc010zyu.1_RNA|FAM65C_uc002xvn.1_Silent_p.P462P	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876	462										ovary(2)	2						GCTCTGCAAACGGGCCTCCAG	0.662													6	16	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58381249	58381249	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58381249A>C	uc002yau.2	+	8	1795	c.1328A>C	c.(1327-1329)AAA>ACA	p.K443T	PHACTR3_uc002yat.2_Missense_Mutation_p.K440T|PHACTR3_uc010zzw.1_Missense_Mutation_p.K402T|PHACTR3_uc002yav.2_Missense_Mutation_p.K402T|PHACTR3_uc002yaw.2_Missense_Mutation_p.K402T|PHACTR3_uc002yax.2_Missense_Mutation_p.K332T	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	443	RPEL 3.|Required for PP1CA binding and inhibition of PP1 activity.					nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AAGCTTTCCAAGTAAGTGGCA	0.592													16	32	---	---	---	---	PASS
KRTAP6-1	337966	broad.mit.edu	37	21	31986059	31986059	+	Silent	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31986059G>A	uc002yop.2	-	1	165	c.165C>T	c.(163-165)TCC>TCT	p.S55S	KRTAP20-1_uc011ade.1_5'Flank	NM_181602	NP_853633	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	55						cytosol|intermediate filament					0						AGCCACAGAGGGAGCGGGAGC	0.582													25	31	---	---	---	---	PASS
KRTAP10-3	386682	broad.mit.edu	37	21	45978072	45978072	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45978072G>C	uc002zfj.1	-	1	572	c.527C>G	c.(526-528)TCC>TGC	p.S176C	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	176	18 X 5 AA repeats of C-C-X(3).			Missing (in Ref. 3; AAI33678).		keratin filament				skin(1)	1						GGCACAGCAGGAGGGGATGGG	0.721													3	40	---	---	---	---	PASS
KRTAP10-4	386672	broad.mit.edu	37	21	45994014	45994014	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45994014C>T	uc002zfk.1	+	1	409	c.379C>T	c.(379-381)CCC>TCC	p.P127S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	127	36 X 5 AA repeats of C-C-X(3).|10.					keratin filament					0						GTGCTGTGTGCCCGTCTGCTG	0.642													5	102	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735461	22735461	+	RNA	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735461C>T	uc011aim.1	+	46		c.5257C>T								Parts of antibodies, mostly variable regions.												0						TCTGGGACCCCCGGGCAGAGG	0.562													22	24	---	---	---	---	PASS
OSBP2	23762	broad.mit.edu	37	22	31289716	31289716	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31289716G>A	uc003aiy.1	+	11	2290	c.2186G>A	c.(2185-2187)CGG>CAG	p.R729Q	OSBP2_uc011ala.1_Missense_Mutation_p.R563Q|OSBP2_uc010gwc.1_Missense_Mutation_p.R556Q|OSBP2_uc011alb.1_Missense_Mutation_p.R680Q|OSBP2_uc003aiz.1_Missense_Mutation_p.R728Q|OSBP2_uc003aja.1_Missense_Mutation_p.R362Q|OSBP2_uc011alc.1_Missense_Mutation_p.R471Q|OSBP2_uc003ajb.2_Missense_Mutation_p.R274Q|OSBP2_uc011ald.1_Missense_Mutation_p.R273Q|OSBP2_uc010gwd.1_Missense_Mutation_p.R274Q	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	729					lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						GAGGCAGCCCGGAAGGTAAGC	0.592													11	12	---	---	---	---	PASS
PLCXD1	55344	broad.mit.edu	37	X	200847	200847	+	5'UTR	SNP	C	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:200847C>T	uc004cpc.2	+	2					PLCXD1_uc011mgx.1_RNA	NM_018390	NP_060860	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid metabolic process		phospholipase C activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCCAGGGCTCACCTCTGATG	0.438													5	104	---	---	---	---	PASS
FAM48B1	100130302	broad.mit.edu	37	X	24382663	24382663	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24382663G>A	uc011mjx.1	+	1	1786	c.1786G>A	c.(1786-1788)GCG>ACG	p.A596T		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1						CATAAAAATAGCGCCAGCCAT	0.557													14	4	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69595965	69595965	+	Silent	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69595965C>A	uc004dyg.2	+	18	2066	c.1939C>A	c.(1939-1941)CGG>AGG	p.R647R	KIF4A_uc010nkw.2_Silent_p.R647R|KIF4A_uc004dyf.1_Silent_p.R647R	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	647	Potential.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						GAAAAACCAGCGGGTACAGTT	0.363													20	6	---	---	---	---	PASS
POU3F4	5456	broad.mit.edu	37	X	82763715	82763715	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82763715G>T	uc004eeg.2	+	1	447	c.383G>T	c.(382-384)GGC>GTC	p.G128V		NM_000307	NP_000298	P49335	PO3F4_HUMAN	POU domain, class 3, transcription factor 4	128					sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						ACGTCAAGCGGCCAACCCCTC	0.667													3	13	---	---	---	---	PASS
KLHL4	56062	broad.mit.edu	37	X	86773098	86773098	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86773098C>A	uc004efb.2	+	1	384	c.202C>A	c.(202-204)CCT>ACT	p.P68T	KLHL4_uc004efa.2_Missense_Mutation_p.P68T	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	68						cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						AAGCAACAGTCCTGTCCACCA	0.517													15	12	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177805	89177805	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177805C>A	uc004efe.2	+	2	770	c.721C>A	c.(721-723)CCA>ACA	p.P241T		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	241						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						AGAGCCTAATCCATGATTGAT	0.463													22	12	---	---	---	---	PASS
SERPINA7	6906	broad.mit.edu	37	X	105279133	105279133	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105279133A>T	uc004eme.1	-	2	882	c.866T>A	c.(865-867)CTG>CAG	p.L289Q	SERPINA7_uc010npd.2_Missense_Mutation_p.L289Q|SERPINA7_uc010npe.1_Missense_Mutation_p.L289Q	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	289					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	CCACTTCTTCAGTGTTTTAGA	0.483													7	118	---	---	---	---	PASS
HTR2C	3358	broad.mit.edu	37	X	114082653	114082653	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114082653G>C	uc004epu.1	+	5	1165	c.437G>C	c.(436-438)TGC>TCC	p.C146S	HTR2C_uc010nqc.1_Missense_Mutation_p.C146S|HTR2C_uc004epv.1_Missense_Mutation_p.C146S	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C	146	Helical; Name=3; (By similarity).				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	ATGCACCTCTGCGCTATATCG	0.428													42	27	---	---	---	---	PASS
CDR1	1038	broad.mit.edu	37	X	139866289	139866289	+	Silent	SNP	A	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139866289A>G	uc004fbg.1	-	1	435	c.243T>C	c.(241-243)TTT>TTC	p.F81F	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	81	23 X 6 AA approximate repeats.|14.										0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				TGTCTTCCAGAAAATCCTTGT	0.463													4	68	---	---	---	---	PASS
GPATCH4	54865	broad.mit.edu	37	1	156568672	156568673	+	Intron	INS	-	G	G			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156568672_156568673insG	uc001fpm.2	-						GPATCH4_uc001fpl.2_Intron	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1							intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATGGACTACATGGGGGGGTAAT	0.465													16	8	---	---	---	---	
FCRL4	83417	broad.mit.edu	37	1	157558862	157558862	+	Intron	DEL	A	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157558862delA	uc001fqw.2	-						FCRL4_uc010phy.1_Intron	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor							integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CATTGGAGGGAAAATATGAAA	0.378													10	8	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39085574	39085575	+	Intron	DEL	TG	-	-	rs144247886		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39085574_39085575delTG	uc002rrf.2	-						DHX57_uc002rre.2_Intron|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				CACATGACTCTGAGACTATTTG	0.327													4	7	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190541843	190541843	+	Intron	DEL	T	-	-	rs67184798		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541843delT	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ACTTCTTAAATtttttttttt	0.169													4	4	---	---	---	---	
CDK15	65061	broad.mit.edu	37	2	202698423	202698425	+	Intron	DEL	TCT	-	-	rs66588345		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202698423_202698425delTCT	uc002uyt.2	+						CDK15_uc010ftm.2_Intron|CDK15_uc002uys.2_Intron|CDK15_uc010ftn.1_Intron|CDK15_uc010fto.1_Intron	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	AATGTAAAAAtcttcttcttctt	0.310													3	7	---	---	---	---	
TBC1D5	9779	broad.mit.edu	37	3	17469888	17469889	+	Intron	DEL	TG	-	-	rs35081140		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17469888_17469889delTG	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						TAATATTAtatgtgtgtgtgtg	0.228													4	2	---	---	---	---	
HHLA2	11148	broad.mit.edu	37	3	108095324	108095324	+	Intron	DEL	T	-	-	rs111477207		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108095324delT	uc003dwy.3	+						HHLA2_uc011bhl.1_Intron|HHLA2_uc010hpu.2_Intron|HHLA2_uc003dwz.2_Intron	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor							integral to membrane				ovary(1)	1						TTAAGTTCTCTTTTTTTTTCC	0.378													11	5	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183521660	183521660	+	Intron	DEL	A	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183521660delA	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TTTTTTCTTTAAAAAAAAAAA	0.328													9	4	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7656930	7656931	+	Intron	DEL	AC	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7656930_7656931delAC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TTGTGCGTGTacacacacacac	0.485													6	3	---	---	---	---	
ADAM19	8728	broad.mit.edu	37	5	156847662	156847662	+	Intron	DEL	G	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156847662delG	uc003lww.1	-									Q9H013	ADA19_HUMAN	SubName: Full=cDNA FLJ34145 fis, clone FCBBF3011867, highly similar to ADAM 19 (EC 3.4.24.-);						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			aaaaaaaaaaGAGGATCAACA	0.194													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165983	180165984	+	IGR	INS	-	C	C	rs2054696	by1000genomes	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165983_180165984insC								FLT4 (89359 upstream) : OR2Y1 (139 downstream)																							tgttccccccgccaccaaaaaa	0.188													4	2	---	---	---	---	
RNF217	154214	broad.mit.edu	37	6	125330620	125330620	+	Intron	DEL	A	-	-	rs112538609		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125330620delA	uc003pzs.2	+						RNF217_uc003pzr.2_Intron|RNF217_uc003pzt.2_Intron	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		AAGAAGGCAGAAAAAAAAAAG	0.348													2	4	---	---	---	---	
ARPC1A	10552	broad.mit.edu	37	7	98957059	98957059	+	Intron	DEL	A	-	-	rs144347064		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98957059delA	uc003upx.1	+						ARPC1A_uc010lfu.1_Intron|ARPC1A_uc003upy.1_Intron|ARPC1A_uc011kit.1_Intron	NM_006409	NP_006400	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex subunit 1A						actin cytoskeleton organization|regulation of actin filament polymerization	actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			actcggtctcaaaaaaaaaaa	0.244													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33662182	33662193	+	IGR	DEL	CTGTAGCCCCAA	-	-	rs113011049		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33662182_33662193delCTGTAGCCCCAA								ANXA2P2 (36652 upstream) : PTENP1 (11314 downstream)																							GAGACATCCTCTGTAGCCCCAACTGTGCCATG	0.505													1	5	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69420250	69420251	+	Intron	INS	-	CTTA	CTTA			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69420250_69420251insCTTA	uc004afn.2	+							NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						TTATTATTCATCTTTTATTAAA	0.257													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	54173277	54173277	+	IGR	DEL	C	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54173277delC								DKK1 (95861 upstream) : MBL2 (351864 downstream)																							TAAAAACAGGCtttttttttt	0.179													6	3	---	---	---	---	
CCDC109A	90550	broad.mit.edu	37	10	74628326	74628326	+	Intron	DEL	G	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74628326delG	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					aaaaaaaaaaGAGAGCTATTA	0.199													6	3	---	---	---	---	
PNLIP	5406	broad.mit.edu	37	10	118307590	118307591	+	Intron	DEL	CA	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118307590_118307591delCA	uc001lcm.2	+							NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	Tacacacacgcacacacacaca	0.144													4	2	---	---	---	---	
DCHS1	8642	broad.mit.edu	37	11	6652521	6652523	+	Intron	DEL	CTC	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6652521_6652523delCTC	uc001mem.1	-							NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCACCAATTCTCCTCTCTCCAC	0.591													30	27	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67829386	67829387	+	Intron	INS	-	A	A			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67829386_67829387insA	uc001onj.2	-						CHKA_uc001onk.2_Intron|uc001onl.1_5'Flank	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	GGAGTAGGAAGAAAAAAAAAAA	0.406													4	2	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	100378031	100378031	+	5'UTR	DEL	C	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100378031delC	uc001tge.1	-	1					ANKS1B_uc001tgf.1_5'UTR|ANKS1B_uc009ztt.1_5'UTR	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CTCACCGACTCCCCCACAGAG	0.607													16	13	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100806371	100806371	+	Intron	DEL	A	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100806371delA	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						aagtaaagttaaaaaaaaaaa	0.109													3	3	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32792815	32792815	+	Intron	DEL	A	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32792815delA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		actccaactcaaaaaaaaaaa	0.159													6	4	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23299147	23299147	+	Intron	DEL	A	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23299147delA	uc001yvq.2	-						HERC2P2_uc001yvo.3_Intron|HERC2P2_uc001yvp.3_Intron					Homo sapiens mRNA for KIAA0393 protein, partial cds.												0						ACATTCAAAGAAAAAAAAAAA	0.313													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11607900	11607900	+	Intron	DEL	T	-	-	rs11364560		TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11607900delT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTGCTCCTACttttttttttt	0.284													4	2	---	---	---	---	
CPD	1362	broad.mit.edu	37	17	28771163	28771163	+	Intron	DEL	A	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28771163delA	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						AGAGTACACGAAAAAAAAAAA	0.378													4	2	---	---	---	---	
KRT34	3885	broad.mit.edu	37	17	39538142	39538142	+	Intron	DEL	C	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39538142delC	uc002hwm.2	-							NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34						epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				ATATGGCCAACCCCCTCACCT	0.522													47	28	---	---	---	---	
ANAPC11	51529	broad.mit.edu	37	17	79852591	79852591	+	Intron	DEL	C	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79852591delC	uc002kbv.1	+						ANAPC11_uc002kbw.1_Intron|ANAPC11_uc002kbx.1_Intron|ANAPC11_uc002kby.1_Intron|ANAPC11_uc002kbz.1_Intron|ANAPC11_uc002kca.1_Intron|ANAPC11_uc002kcb.1_Intron|ANAPC11_uc002kcc.1_Intron|ANAPC11_uc010dih.1_Intron	NM_016476	NP_057560	Q9NYG5	APC11_HUMAN	APC11 anaphase promoting complex subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	zinc ion binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			Gtttcattttctttttttttt	0.259													4	4	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544277	80544278	+	Intron	INS	-	A	A	rs149999499	by1000genomes	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544277_80544278insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggcgggggggaaag	0.000													4	2	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652847	53652852	+	Intron	DEL	GCCGGT	-	-	rs11091285	by1000genomes	TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652847_53652852delGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggtgccgggactg	0.199													5	20	---	---	---	---	
CAPN6	827	broad.mit.edu	37	X	110491786	110491786	+	Intron	DEL	G	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110491786delG	uc004epc.1	-						CAPN6_uc011msu.1_Intron	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6						microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						GGCTTGCGAAGGAAACTGAAC	0.488													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13496206	13496206	+	IGR	DEL	G	-	-			TCGA-22-5471-01A-01D-1632-08	TCGA-22-5471-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13496206delG								None (None upstream) : None (None downstream)																							CTTCTGTCATGTGAAATAATT	0.318													6	3	---	---	---	---	
