Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11B	984	broad.mit.edu	37	1	1582296	1582296	+	Intron	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1582296C>G	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|CDK11B_uc010nyr.1_5'Flank	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						aacattttctctttggccttt	0.000													5	74	---	---	---	---	PASS
PRAMEF10	343071	broad.mit.edu	37	1	12955444	12955444	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12955444G>T	uc001auo.2	-	2	308	c.235C>A	c.(235-237)CAA>AAA	p.Q79K		NM_001039361	NP_001034450	O60809	PRA10_HUMAN	PRAME family member 10	79											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGACAGCTTGCAAGGTCTCC	0.592													16	29	---	---	---	---	PASS
ALDH4A1	8659	broad.mit.edu	37	1	19203974	19203974	+	Missense_Mutation	SNP	T	C	C	rs145243354	byFrequency	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19203974T>C	uc001bbb.2	-	10	1349	c.1073A>G	c.(1072-1074)CAC>CGC	p.H358R	ALDH4A1_uc010ocu.1_Missense_Mutation_p.H298R|ALDH4A1_uc001bbc.2_Missense_Mutation_p.H358R	NM_170726	NP_733844	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4A1 isoform a precursor	358					proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)	CCACAGCGAGTGCGGCACGTA	0.692													8	9	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22206613	22206613	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22206613T>C	uc001bfj.2	-	17	2370	c.2330A>G	c.(2329-2331)TAT>TGT	p.Y777C	HSPG2_uc009vqd.2_Missense_Mutation_p.Y778C	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	777	Laminin EGF-like 2.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GCAGTGGCCATACACAGGGTC	0.498													14	20	---	---	---	---	PASS
C1orf38	9473	broad.mit.edu	37	1	28209122	28209122	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28209122T>C	uc001bpc.3	+	4	1315	c.1287T>C	c.(1285-1287)AGT>AGC	p.S429S	C1orf38_uc001boz.2_Intron|C1orf38_uc001bpa.2_Intron|C1orf38_uc010ofn.1_Silent_p.S233S|C1orf38_uc010ofo.1_Silent_p.S300S	NM_001105556	NP_001099026	Q5TEJ8	THMS2_HUMAN	basement membrane-induced gene isoform 3	429	CABIT 2.				cell adhesion|inflammatory response					ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;2.52e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCTGGCAGTTTCGTGGAGG	0.607													22	22	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34191058	34191058	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34191058G>T	uc001bxn.1	-	17	2496	c.2467C>A	c.(2467-2469)CAC>AAC	p.H823N	CSMD2_uc001bxm.1_Missense_Mutation_p.H863N	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	823	CUB 5.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGGTCCCGTGGTAAACCCCG	0.542													15	21	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39783071	39783071	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39783071C>T	uc010ois.1	+	30	3994	c.3789C>T	c.(3787-3789)CTC>CTT	p.L1263L	MACF1_uc001cda.1_Silent_p.L1171L|MACF1_uc001cdc.1_Silent_p.L350L|MACF1_uc009vvq.1_Silent_p.L320L|MACF1_uc001cdb.1_Silent_p.L350L	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1263	LRR 8.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTGCCCAGCTCGAGATTCGGT	0.468													6	36	---	---	---	---	PASS
DPH2	1802	broad.mit.edu	37	1	44437888	44437888	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44437888C>T	uc001ckz.2	+	5	1422	c.1227C>T	c.(1225-1227)GAC>GAT	p.D409D	DPH2_uc001cla.2_Silent_p.D181D|DPH2_uc010okk.1_Silent_p.D274D|DPH2_uc001clb.2_Silent_p.D333D|ATP6V0B_uc001clc.2_5'Flank|ATP6V0B_uc001cld.2_5'Flank|ATP6V0B_uc001cle.2_5'Flank|ATP6V0B_uc001clf.2_5'Flank	NM_001384	NP_001375	Q9BQC3	DPH2_HUMAN	diphthamide biosynthesis protein 2 isoform a	409					peptidyl-diphthamide biosynthetic process from peptidyl-histidine	cytoplasm				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				AAACCCCAGACGTGTCACTCA	0.577													10	63	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52705178	52705178	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52705178G>A	uc001cto.2	+	4	2261	c.2089G>A	c.(2089-2091)GTA>ATA	p.V697I	ZFYVE9_uc001ctn.2_Missense_Mutation_p.V697I|ZFYVE9_uc001ctp.2_Missense_Mutation_p.V697I	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	697					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						TCCAGTATGGGTACCGGATTC	0.478													29	27	---	---	---	---	PASS
DIRAS3	9077	broad.mit.edu	37	1	68512774	68512774	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68512774G>A	uc001ded.2	-	2	502	c.207C>T	c.(205-207)ACC>ACT	p.T69T	uc001deb.1_Intron|uc001dec.1_Intron	NM_004675	NP_004666	O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	69	Effector region (Potential).				regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						TATTTTCAATGGTCGGCAGGT	0.602													16	99	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70587560	70587560	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70587560T>C	uc001dep.2	+	25	4634	c.4604T>C	c.(4603-4605)CTT>CCT	p.L1535P	LRRC7_uc009wbg.2_Missense_Mutation_p.L819P|LRRC7_uc001deq.2_Missense_Mutation_p.L729P	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1535	PDZ.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						CAACGTGAGCTTACTGTCTAA	0.328													24	38	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038743	75038743	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038743G>A	uc001dgg.2	-	14	2870	c.2651C>T	c.(2650-2652)ACA>ATA	p.T884I		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	884	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTCAAGCACTGTGAGCATCAA	0.512													92	154	---	---	---	---	PASS
GBP2	2634	broad.mit.edu	37	1	89578310	89578310	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89578310C>G	uc001dmz.1	-	8	1478	c.1207G>C	c.(1207-1209)GAT>CAT	p.D403H	GBP2_uc001dmy.1_RNA	NM_004120	NP_004111	P32456	GBP2_HUMAN	guanylate binding protein 2,	403					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)	1		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		ATGCAACAATCTGATGATGCT	0.423													45	74	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103548491	103548491	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103548491G>T	uc001dul.2	-	2	462	c.144C>A	c.(142-144)CAC>CAA	p.H48Q	COL11A1_uc001dum.2_Missense_Mutation_p.H48Q|COL11A1_uc001dun.2_Missense_Mutation_p.H48Q|COL11A1_uc009weh.2_Missense_Mutation_p.H48Q	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	48	TSP N-terminal.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTGGAGAATTGTGAAAATCTA	0.348													22	49	---	---	---	---	PASS
NBPF7	343505	broad.mit.edu	37	1	120384085	120384085	+	Silent	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120384085G>C	uc010oxk.1	-	3	1098	c.477C>G	c.(475-477)TCC>TCG	p.S159S		NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN	hypothetical protein LOC343505	159						cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)		CCTGCCCCTGGGAGTTGTCAT	0.577													36	79	---	---	---	---	PASS
FDPS	2224	broad.mit.edu	37	1	155288667	155288667	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155288667A>T	uc001fkc.2	+	8	1013	c.794A>T	c.(793-795)TAC>TTC	p.Y265F	RAG1AP1_uc010pey.1_Intron|FDPS_uc001fkd.2_Missense_Mutation_p.Y199F|FDPS_uc001fke.2_Missense_Mutation_p.Y265F|FDPS_uc001fkf.2_Missense_Mutation_p.Y199F|C1orf104_uc001fkh.1_Intron|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank|RUSC1_uc009wqn.1_5'Flank	NM_002004	NP_001995	P14324	FPPS_HUMAN	farnesyl diphosphate synthase isoform a	265					cholesterol biosynthetic process|interspecies interaction between organisms|isoprenoid biosynthetic process	cytosol|nucleus	dimethylallyltranstransferase activity|geranyltranstransferase activity|metal ion binding				0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	ATTGTCAAGTACAAGACAGCT	0.522													48	122	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156917607	156917607	+	Silent	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156917607C>A	uc001fqo.2	-	24	3215	c.2175G>T	c.(2173-2175)GTG>GTT	p.V725V	ARHGEF11_uc010phu.1_Silent_p.V141V|ARHGEF11_uc001fqn.2_Silent_p.V765V	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	725					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TTAGCCCAGCCACCACATCCT	0.592													3	36	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157514128	157514128	+	Silent	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157514128C>A	uc001fqu.2	-	5	926	c.768G>T	c.(766-768)GGG>GGT	p.G256G	FCRL5_uc009wsm.2_Silent_p.G256G|FCRL5_uc010phv.1_Silent_p.G256G|FCRL5_uc010phw.1_Silent_p.G171G|FCRL5_uc001fqv.1_Silent_p.G256G|FCRL5_uc010phx.1_Silent_p.G7G	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	256	Extracellular (Potential).|Ig-like C2-type 2.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACCAGTAGAACCCTGAATCTT	0.512													71	157	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158325720	158325720	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158325720G>A	uc001fse.2	+	4	968	c.729G>A	c.(727-729)ATG>ATA	p.M243I	CD1E_uc010pid.1_Missense_Mutation_p.M241I|CD1E_uc010pie.1_Missense_Mutation_p.M144I|CD1E_uc010pif.1_Missense_Mutation_p.M54I|CD1E_uc001fsd.2_Missense_Mutation_p.M243I|CD1E_uc001fsk.2_Missense_Mutation_p.M153I|CD1E_uc001fsj.2_Missense_Mutation_p.M153I|CD1E_uc001fsc.2_Missense_Mutation_p.M54I|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Missense_Mutation_p.M54I|CD1E_uc001fsf.2_Missense_Mutation_p.M243I|CD1E_uc001fry.2_Missense_Mutation_p.M243I|CD1E_uc001fsg.2_Missense_Mutation_p.M54I|CD1E_uc001fsh.2_Missense_Mutation_p.M54I|CD1E_uc001fsi.2_Missense_Mutation_p.M243I|CD1E_uc009wsv.2_Missense_Mutation_p.M144I|CD1E_uc001frz.2_Missense_Mutation_p.M153I|CD1E_uc009wsw.2_Missense_Mutation_p.M1I	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	243	Ig-like.				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					TGTGGGTGATGTGGATGCGGG	0.637													40	49	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159902338	159902338	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159902338G>A	uc001fur.2	-	10	1407	c.1209C>T	c.(1207-1209)ACC>ACT	p.T403T	IGSF9_uc001fuq.2_Silent_p.T387T|IGSF9_uc001fup.2_5'Flank	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	403	Ig-like 4.|Extracellular (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			AGGGCCCGGCGGTACCAAGAC	0.642													22	49	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171509443	171509443	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171509443A>G	uc010pmg.1	+	16	3098	c.2832A>G	c.(2830-2832)GCA>GCG	p.A944A	BAT2L2_uc010pmh.1_5'UTR	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	944							protein C-terminus binding				0						AACCATCTGCAGGCATTCCTA	0.433													5	23	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174340115	174340115	+	Splice_Site	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174340115A>G	uc001gjx.2	+	12	1661	c.1466_splice	c.e12-2	p.E489_splice	RABGAP1L_uc009wwq.1_Splice_Site_p.E501_splice|RABGAP1L_uc001gjw.2_Splice_Site_p.E452_splice|RABGAP1L_uc001gjy.2_Splice_Site_p.E157_splice|RABGAP1L_uc001gjz.2_Splice_Site_p.E136_splice	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						TTTCTTCTGCAGAGAGTGATA	0.348													21	54	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176769233	176769233	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176769233G>T	uc001gkz.2	+	21	6331	c.5167G>T	c.(5167-5169)GAC>TAC	p.D1723Y	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1723	Sushi 5.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ATGGCACCCAGACCCCGTCTT	0.483													29	104	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176915118	176915118	+	Silent	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176915118A>T	uc001glc.2	-	13	2405	c.2193T>A	c.(2191-2193)GGT>GGA	p.G731G	ASTN1_uc001glb.1_Silent_p.G731G|ASTN1_uc001gld.1_Silent_p.G731G|ASTN1_uc009wwx.1_Silent_p.G731G	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	739					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GGTTGTTGTAACCAAAGAACA	0.493													34	138	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183101650	183101650	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183101650G>A	uc001gpy.3	+	21	3939	c.3682G>A	c.(3682-3684)GAG>AAG	p.E1228K		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1228	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AACAGCATTTGAGATTGAAGA	0.398													39	62	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185970840	185970840	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185970840A>T	uc001grq.1	+	28	4544	c.4315A>T	c.(4315-4317)ACT>TCT	p.T1439S		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1439	Ig-like C2-type 11.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TATTGCAGGCACTTCTCAGAA	0.373													37	62	---	---	---	---	PASS
IGFN1	91156	broad.mit.edu	37	1	201193908	201193908	+	Silent	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201193908T>A	uc001gwc.2	+	10	2644	c.1872T>A	c.(1870-1872)CCT>CCA	p.P624P	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						TTCTGATCCCTGTGGCTGGAC	0.587													3	44	---	---	---	---	PASS
MYOG	4656	broad.mit.edu	37	1	203054889	203054889	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203054889C>T	uc001gzd.2	-	1	489	c.201G>A	c.(199-201)CCG>CCA	p.P67P		NM_002479	NP_002470	P15173	MYOG_HUMAN	myogenin	67					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			skin(2)	2						TACACGCCCACGGCAGGCACT	0.682													53	66	---	---	---	---	PASS
ADORA1	134	broad.mit.edu	37	1	203134990	203134990	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203134990A>G	uc001gze.1	+	4	1376	c.943A>G	c.(943-945)ATT>GTT	p.I315V	FMOD_uc010pqi.1_Intron|ADORA1_uc001gzf.1_Missense_Mutation_p.I315V|ADORA1_uc010pqg.1_Missense_Mutation_p.I247V|ADORA1_uc009xak.1_3'UTR|ADORA1_uc010pqh.1_Missense_Mutation_p.I348V	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	315	Cytoplasmic (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)	TGCACCTCCCATTGACGAGGA	0.577													25	56	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203452423	203452423	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203452423G>T	uc001gzs.2	+	2	311	c.111G>T	c.(109-111)AGG>AGT	p.R37S	PRELP_uc001gzt.2_Missense_Mutation_p.R37S	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	37					skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			GCAGACCCAGGCCCAGGCCCA	0.657													32	48	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235972254	235972254	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235972254G>A	uc001hxj.2	-	5	2039	c.1864C>T	c.(1864-1866)CAG>TAG	p.Q622*	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Nonsense_Mutation_p.Q622*	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	622					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CCTCCTAACTGATCCAAAATA	0.348									Chediak-Higashi_syndrome				33	98	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235972330	235972330	+	Silent	SNP	G	C	C	rs148614675	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235972330G>C	uc001hxj.2	-	5	1963	c.1788C>G	c.(1786-1788)CTC>CTG	p.L596L	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Silent_p.L596L	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	596					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TAAAAGCATGGAGCAAAGGAA	0.388									Chediak-Higashi_syndrome				43	123	---	---	---	---	PASS
NID1	4811	broad.mit.edu	37	1	236189398	236189398	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236189398G>A	uc001hxo.2	-	8	1884	c.1782C>T	c.(1780-1782)CCC>CCT	p.P594P	NID1_uc009xgd.2_Silent_p.P594P	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	594	Nidogen G2 beta-barrel.				cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	CATCTCGCTCGGGCTCAGTCA	0.597													20	58	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240976970	240976970	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240976970G>T	uc001hyv.2	-	13	1234	c.904C>A	c.(904-906)CCT>ACT	p.P302T	RGS7_uc010pyh.1_Missense_Mutation_p.P276T|RGS7_uc010pyj.1_Missense_Mutation_p.P218T|RGS7_uc001hyu.2_Missense_Mutation_p.P302T|RGS7_uc009xgn.1_Missense_Mutation_p.P249T|RGS7_uc001hyw.2_Missense_Mutation_p.P302T|RGS7_uc001hyt.2_Missense_Mutation_p.P134T	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	302	G protein gamma.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GGGTTAGAAGGGTCAGGTGGC	0.423													13	42	---	---	---	---	PASS
KCNK3	3777	broad.mit.edu	37	2	26951214	26951214	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26951214G>A	uc002rhn.2	+	2	1126	c.963G>A	c.(961-963)CTG>CTA	p.L321L		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	321	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGAGAAGCTGCAGTACTCCA	0.687													3	19	---	---	---	---	PASS
ZNF512	84450	broad.mit.edu	37	2	27823603	27823603	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27823603G>T	uc002rla.2	+	6	590	c.503G>T	c.(502-504)AGT>ATT	p.S168I	ZNF512_uc010ylv.1_Missense_Mutation_p.S89I|ZNF512_uc010ylw.1_Missense_Mutation_p.S139I|ZNF512_uc002rlb.2_Missense_Mutation_p.S89I|ZNF512_uc010ylx.1_Missense_Mutation_p.S89I|ZNF512_uc002rlc.2_Missense_Mutation_p.S89I|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Missense_Mutation_p.S61I	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512	168					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					GATAAAGGCAGTGTCTCCTGC	0.433													32	72	---	---	---	---	PASS
PPM1B	5495	broad.mit.edu	37	2	44428810	44428810	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44428810A>G	uc002rtt.2	+	2	900	c.472A>G	c.(472-474)AGG>GGG	p.R158G	PPM1B_uc002rts.2_Missense_Mutation_p.R158G|PPM1B_uc002rtu.2_Missense_Mutation_p.R158G|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Missense_Mutation_p.R158G|PPM1B_uc002rtx.2_Missense_Mutation_p.R158G	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	158					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGTTCTGTATAGGAATGGACA	0.453													35	101	---	---	---	---	PASS
FOXN2	3344	broad.mit.edu	37	2	48602067	48602067	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48602067C>T	uc002rwh.1	+	7	1096	c.781C>T	c.(781-783)CCT>TCT	p.P261S		NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor	261					embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			AGGTGAGAAGCCTCTTCCTCT	0.378													16	38	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63631438	63631438	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63631438C>A	uc002sch.2	-	10	1626	c.1180G>T	c.(1180-1182)GTT>TTT	p.V394F	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.V235F|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.V202F|C2orf86_uc002sci.1_Missense_Mutation_p.V370F|C2orf86_uc010fcr.1_Missense_Mutation_p.V284F	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	394	WD 2.				cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						TTGCTGCCAACTAGCAGAATG	0.458													31	93	---	---	---	---	PASS
CAPG	822	broad.mit.edu	37	2	85628714	85628714	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85628714C>A	uc002spl.1	-	4	539	c.289G>T	c.(289-291)GAG>TAG	p.E97*	CAPG_uc002spm.1_Nonsense_Mutation_p.E97*|CAPG_uc010ysq.1_Nonsense_Mutation_p.E97*|CAPG_uc010fgi.1_Nonsense_Mutation_p.E97*|CAPG_uc010fgj.1_5'UTR	NM_001747	NP_001738	P40121	CAPG_HUMAN	gelsolin-like capping protein	97					barbed-end actin filament capping|protein complex assembly	F-actin capping protein complex|melanosome|nuclear membrane|nucleolus	actin binding				0						CCCTGCACCTCGCGGTGCTGC	0.647													3	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89544262	89544262	+	RNA	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89544262G>T	uc010ytr.1	-	14		c.1923C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TACCACTGTGGGAGGCCAGTG	0.557													25	68	---	---	---	---	PASS
TEKT4	150483	broad.mit.edu	37	2	95539830	95539830	+	Silent	SNP	G	A	A	rs35031477		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95539830G>A	uc002stw.1	+	3	783	c.690G>A	c.(688-690)CCG>CCA	p.P230P	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	230					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						AGGCTCATCCGTACTCCACCA	0.662													15	38	---	---	---	---	PASS
TEKT4	150483	broad.mit.edu	37	2	95542363	95542363	+	Missense_Mutation	SNP	C	A	A	rs112631866		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95542363C>A	uc002stw.1	+	6	1250	c.1157C>A	c.(1156-1158)GCG>GAG	p.A386E	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	386	Potential.				cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						CTTCTAGAAGCGGAGCAGTCC	0.597													4	17	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96949340	96949340	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96949340G>A	uc002svu.2	-	33	4782	c.4696C>T	c.(4696-4698)CGC>TGC	p.R1566C	SNRNP200_uc002svt.2_Missense_Mutation_p.R176C|SNRNP200_uc010yuj.1_RNA|SNRNP200_uc002svv.1_Missense_Mutation_p.R93C	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1566	Helicase C-terminal 2.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						GTCTGCTTGCGAGACGGCACA	0.592													9	98	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121744085	121744085	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121744085G>A	uc010flp.2	+	12	2218	c.2188G>A	c.(2188-2190)GAG>AAG	p.E730K	GLI2_uc002tmq.1_Missense_Mutation_p.E402K|GLI2_uc002tmr.1_Missense_Mutation_p.E385K|GLI2_uc002tmt.3_Missense_Mutation_p.E402K|GLI2_uc002tmu.3_Missense_Mutation_p.E385K|GLI2_uc002tmw.1_Missense_Mutation_p.E713K	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	730					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GCACCGGTTCGAGCAGCTCAA	0.647													26	27	---	---	---	---	PASS
TUBA3D	113457	broad.mit.edu	37	2	132237844	132237844	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132237844C>A	uc002tsu.3	+	4	685	c.578C>A	c.(577-579)ACG>AAG	p.T193K		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	193					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		ACCACCCACACGACCCTGGAA	0.542													42	151	---	---	---	---	PASS
MIR663B	100302269	broad.mit.edu	37	2	133014622	133014622	+	RNA	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133014622C>A	hsa-mir-663b|MI0006336	-			c.32C>A			NCRNA00164_uc002ttj.3_Intron																	0						ACCGCAGCGACCCGCCTAGGA	0.697													4	15	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135745182	135745182	+	Silent	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135745182A>T	uc002tue.1	-	7	1291	c.1260T>A	c.(1258-1260)GTT>GTA	p.V420V	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.V307V|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Silent_p.V148V|YSK4_uc002tui.3_Silent_p.V437V	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	420							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TATGTAATGAAACTCTTTTTG	0.348													23	87	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157445	145157445	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157445G>T	uc002tvu.2	-	8	1789	c.1309C>A	c.(1309-1311)CAG>AAG	p.Q437K	ZEB2_uc002tvv.2_Missense_Mutation_p.Q431K|ZEB2_uc010zbm.1_Missense_Mutation_p.Q408K|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.Q466K	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	437	SMAD-MH2 binding domain (By similarity).					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCTAAGTGCTGCATTGGACTC	0.468													38	61	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179529454	179529454	+	Silent	SNP	A	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179529454A>C	uc010zfk.1	-	12	1115	c.567T>G	c.(565-567)GCT>GCG	p.A189A	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTTGGAGAGCTTCAGGCA	0.383													8	40	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179576820	179576820	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179576820C>T	uc010zfg.1	-	93	24229	c.24005G>A	c.(24004-24006)AGA>AAA	p.R8002K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R4663K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8929							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGTAGTGGGTCTCAATTTTGT	0.408													23	48	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179628932	179628932	+	Silent	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179628932G>T	uc010zfg.1	-	43	10310	c.10086C>A	c.(10084-10086)GCC>GCA	p.A3362A	TTN_uc010zfh.1_Silent_p.A3316A|TTN_uc010zfi.1_Silent_p.A3316A|TTN_uc010zfj.1_Silent_p.A3316A|TTN_uc002umz.1_Silent_p.A23A|TTN_uc002unb.2_Silent_p.A3362A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTGAAAACGGGCTGGCTGCC	0.453													12	77	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179635941	179635941	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179635941C>A	uc010zfg.1	-	34	8337	c.8113G>T	c.(8113-8115)GAA>TAA	p.E2705*	TTN_uc010zfh.1_Nonsense_Mutation_p.E2659*|TTN_uc010zfi.1_Nonsense_Mutation_p.E2659*|TTN_uc010zfj.1_Nonsense_Mutation_p.E2659*|TTN_uc002unb.2_Nonsense_Mutation_p.E2705*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2705							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACTTGCCTTCAACTTTGAGT	0.368													20	57	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196681439	196681439	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196681439G>T	uc002utj.3	-	51	9775	c.9674C>A	c.(9673-9675)CCC>CAC	p.P3225H		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3225					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CTGGTACATGGGCTCAATGTT	0.383													18	43	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202582799	202582799	+	Splice_Site	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202582799C>A	uc002uyo.2	-	24	4192	c.3836_splice	c.e24+1	p.F1279_splice	ALS2_uc010ftl.2_Splice_Site	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1						cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						TAGTTACTCACAAAACTTTAG	0.323													8	48	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220342649	220342649	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220342649C>A	uc010fwg.2	+	22	4849	c.4849C>A	c.(4849-4851)CGC>AGC	p.R1617S		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1617	Protein kinase 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTACTTGCGGCGCATAGTGGA	0.647													22	93	---	---	---	---	PASS
PSMD1	5707	broad.mit.edu	37	2	231951878	231951878	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231951878T>C	uc002vrn.1	+	16	1997	c.1866T>C	c.(1864-1866)CTT>CTC	p.L622L	PSMD1_uc002vrm.1_Silent_p.L622L|PSMD1_uc010fxu.1_Silent_p.L486L	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1	622	PC 7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TAGAATCACTTGGGTTCATTC	0.333													10	52	---	---	---	---	PASS
TRPM8	79054	broad.mit.edu	37	2	234854669	234854669	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234854669T>A	uc002vvh.2	+	7	909	c.869T>A	c.(868-870)ATT>AAT	p.I290N	TRPM8_uc010fyj.2_5'UTR	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	290	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GAGCGCACTATTCAAGGTCAG	0.473													6	43	---	---	---	---	PASS
ZNF167	55888	broad.mit.edu	37	3	44611698	44611698	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44611698C>A	uc010hin.2	+	6	1484	c.1096C>A	c.(1096-1098)CTG>ATG	p.L366M	ZNF167_uc003cnh.2_RNA|ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Missense_Mutation_p.L215M|ZNF167_uc003cnj.2_Missense_Mutation_p.L366M|ZNF167_uc003cnk.2_Intron	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN	zinc finger protein 167 isoform 1	366					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)		ACATCCACCTCTGTCTTCCAG	0.373													4	102	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49689524	49689524	+	Silent	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49689524G>T	uc003cxe.3	+	5	2649	c.2535G>T	c.(2533-2535)CGG>CGT	p.R845R		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	845					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCATGCGACGGCAGATTCTCG	0.622													6	19	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52521868	52521868	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52521868G>T	uc011beg.1	+	17	2432	c.2360G>T	c.(2359-2361)AGT>ATT	p.S787I	NISCH_uc003ded.3_Missense_Mutation_p.S787I|NISCH_uc003dee.3_Missense_Mutation_p.S276I|NISCH_uc003deg.1_RNA	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	787	Interaction with LIMK (By similarity).|Interaction with ITGA5 (By similarity).|Interaction with PAK1 (By similarity).				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		GTACGGCACAGTGAGAACACG	0.592													6	15	---	---	---	---	PASS
STAB1	23166	broad.mit.edu	37	3	52538511	52538511	+	Silent	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52538511C>G	uc003dej.2	+	11	1259	c.1185C>G	c.(1183-1185)GGC>GGG	p.G395G	STAB1_uc003dei.1_Silent_p.G395G	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	395	Extracellular (Potential).|FAS1 1.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCACAGCGGGCCCTTTCACCG	0.622													8	36	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98188464	98188464	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98188464C>A	uc003dsm.2	+	1	44	c.44C>A	c.(43-45)ACA>AAA	p.T15K		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	15	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						TTTATCCTCACAGGATTTACA	0.403													22	164	---	---	---	---	PASS
CEP97	79598	broad.mit.edu	37	3	101474392	101474392	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101474392C>G	uc003dvk.1	+	7	874	c.847C>G	c.(847-849)CAA>GAA	p.Q283E	CEP97_uc010hpm.1_Missense_Mutation_p.Q249E|CEP97_uc011bhf.1_Missense_Mutation_p.Q283E|CEP97_uc003dvl.1_5'UTR|CEP97_uc003dvm.1_Missense_Mutation_p.Q121E	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	283						centrosome|nucleus	protein binding			ovary(2)	2						ACTAGGTCTTCAAACTGCAGA	0.448													15	59	---	---	---	---	PASS
FAM55C	91775	broad.mit.edu	37	3	101535662	101535662	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101535662C>T	uc003dvn.2	+	7	1583	c.946C>T	c.(946-948)CAA>TAA	p.Q316*	FAM55C_uc010hpn.2_Nonsense_Mutation_p.Q316*	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN	hypothetical protein LOC91775 precursor	316						extracellular region				ovary(1)|pancreas(1)|skin(1)	3						AGAACTATCTCAAGGCTCAGG	0.343													20	91	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114070156	114070156	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114070156C>T	uc003ebi.2	-	4	949	c.769G>A	c.(769-771)GGC>AGC	p.G257S	ZBTB20_uc003ebj.2_Missense_Mutation_p.G184S|ZBTB20_uc010hqp.2_Missense_Mutation_p.G184S|ZBTB20_uc003ebk.2_Missense_Mutation_p.G184S|ZBTB20_uc003ebl.2_Missense_Mutation_p.G184S|ZBTB20_uc003ebm.2_Missense_Mutation_p.G184S|ZBTB20_uc003ebn.2_Missense_Mutation_p.G184S|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	257					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GAGCGCTCGCCGCTGCCATTC	0.647													10	73	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128986886	128986886	+	Intron	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128986886G>A	uc003els.2	+						COPG_uc010htb.2_Intron	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1						COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						CCTAAATGGTGAGTCATTCCC	0.507													3	26	---	---	---	---	PASS
TFDP2	7029	broad.mit.edu	37	3	141678557	141678557	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141678557G>A	uc003eun.3	-	11	1389	c.1010C>T	c.(1009-1011)GCG>GTG	p.A337V	TFDP2_uc003euk.3_Missense_Mutation_p.A250V|TFDP2_uc010hur.2_Missense_Mutation_p.A277V|TFDP2_uc003eul.3_Missense_Mutation_p.A277V|TFDP2_uc011bnf.1_Missense_Mutation_p.A240V|TFDP2_uc011bng.1_Missense_Mutation_p.A201V|TFDP2_uc003eum.3_Missense_Mutation_p.A277V	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization	337					cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						CAGGGATTTCGCAAGTTTCAG	0.423													34	172	---	---	---	---	PASS
EIF2A	83939	broad.mit.edu	37	3	150301669	150301669	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150301669G>C	uc003eya.2	+	14	1745	c.1729G>C	c.(1729-1731)GAG>CAG	p.E577Q	SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Missense_Mutation_p.E450Q|EIF2A_uc003eyc.2_Missense_Mutation_p.E450Q|EIF2A_uc011bnv.1_Missense_Mutation_p.E552Q|EIF2A_uc011bnw.1_Missense_Mutation_p.E516Q|EIF2A_uc003eyd.2_Missense_Mutation_p.E352Q|uc003eye.1_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A	577	Potential.				regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCTTCTCCAGGAGCTGGAAGA	0.338													5	74	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167223158	167223158	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167223158T>C	uc003fev.1	-	13	2071	c.1765A>G	c.(1765-1767)AGA>GGA	p.R589G	WDR49_uc003feu.1_Missense_Mutation_p.R414G|WDR49_uc011bpd.1_Missense_Mutation_p.R554G|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	589										large_intestine(1)|ovary(1)|skin(1)	3						CAGGTACTTCTTTCCTTATAT	0.269													5	65	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178916806	178916806	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178916806G>A	uc003fjk.2	+	2	350	c.193G>A	c.(193-195)GAA>AAA	p.E65K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	65	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCTTCAAGATGAATCTTCTTA	0.368		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			15	137	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179576902	179576902	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179576902G>T	uc003fki.1	-	8	900	c.770C>A	c.(769-771)TCT>TAT	p.S257Y	PEX5L_uc011bqd.1_Missense_Mutation_p.S214Y|PEX5L_uc011bqe.1_Missense_Mutation_p.S65Y|PEX5L_uc011bqf.1_Missense_Mutation_p.S149Y|PEX5L_uc003fkj.1_Missense_Mutation_p.S222Y|PEX5L_uc010hxd.1_Missense_Mutation_p.S255Y|PEX5L_uc011bqg.1_Missense_Mutation_p.S233Y|PEX5L_uc011bqh.1_Missense_Mutation_p.S198Y	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	257					protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			GTGGTTTCTAGAAAGTAATGC	0.373													12	70	---	---	---	---	PASS
B3GNT5	84002	broad.mit.edu	37	3	182988594	182988594	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182988594T>C	uc003flk.2	+	2	1538	c.1008T>C	c.(1006-1008)GCT>GCC	p.A336A	MCF2L2_uc003fli.1_Intron|MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|B3GNT5_uc003fll.2_Silent_p.A336A|B3GNT5_uc003flm.2_Silent_p.A336A	NM_032047	NP_114436	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal	336	Lumenal (Potential).				central nervous system development|glycolipid biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity|galactosyltransferase activity			ovary(1)	1	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGAAGAATGCTACAGATCCTA	0.353													46	42	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184010029	184010029	+	3'UTR	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184010029C>A	uc003fni.3	+	19					ECE2_uc003fnl.3_3'UTR|ECE2_uc003fnm.3_3'UTR|ECE2_uc003fnk.3_3'UTR	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTGGTAGACCTGGATCAGGG	0.607													12	63	---	---	---	---	PASS
TMEM175	84286	broad.mit.edu	37	4	951970	951970	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:951970C>G	uc003gbq.2	+	11	1299	c.1201C>G	c.(1201-1203)CAG>GAG	p.Q401E	TMEM175_uc003gbr.2_Missense_Mutation_p.Q319E|TMEM175_uc003gbu.2_Missense_Mutation_p.Q319E|TMEM175_uc003gbs.2_Missense_Mutation_p.Q284E|TMEM175_uc003gbt.2_Missense_Mutation_p.Q284E|TMEM175_uc003gbv.2_Missense_Mutation_p.Q284E|TMEM175_uc010ibm.2_Missense_Mutation_p.Q217E	NM_032326	NP_115702	Q9BSA9	TM175_HUMAN	transmembrane protein 175	401						integral to membrane					0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCTGCTGCACCAGGCGGAGAC	0.667													11	19	---	---	---	---	PASS
AFAP1	60312	broad.mit.edu	37	4	7820899	7820899	+	Splice_Site	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7820899C>T	uc003gkg.1	-	7	1000	c.727_splice	c.e7-1	p.V243_splice	AFAP1_uc011bwk.1_Splice_Site_p.V243_splice	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						CTTTGATCACCTATAAAAAGC	0.502													10	16	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39322122	39322122	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39322122C>G	uc003gty.1	-	9	1110	c.976G>C	c.(976-978)GAA>CAA	p.E326Q	RFC1_uc003gtx.1_Missense_Mutation_p.E326Q|RFC1_uc003gtz.1_Missense_Mutation_p.E210Q	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	326				E -> K (in Ref. 1; AAA16121).	DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						GAGCTCTCTTCTTTTCTTTTC	0.368													13	30	---	---	---	---	PASS
C4orf35	85438	broad.mit.edu	37	4	71201337	71201337	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71201337C>T	uc003hff.2	+	1	667	c.581C>T	c.(580-582)TCC>TTC	p.S194F		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	194						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				TATAATTCCTCCATCAAATCC	0.478													9	31	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110865192	110865192	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110865192G>A	uc003hzy.3	+	4	1156	c.704G>A	c.(703-705)GGA>GAA	p.G235E	EGF_uc011cfu.1_Missense_Mutation_p.G235E|EGF_uc011cfv.1_Missense_Mutation_p.G235E	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	235	LDL-receptor class B 4.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	GATTATGATGGAGGTTCTGTC	0.343													12	33	---	---	---	---	PASS
SCLT1	132320	broad.mit.edu	37	4	129867242	129867242	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129867242G>A	uc003igp.2	-	16	1865	c.1359C>T	c.(1357-1359)TTC>TTT	p.F453F	SCLT1_uc003ign.2_Silent_p.F117F|SCLT1_uc003igo.2_Silent_p.F63F|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1	453	Potential.					centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						CTGAAACCAGGAATCTTTGGT	0.348													9	35	---	---	---	---	PASS
GALNTL6	442117	broad.mit.edu	37	4	173734859	173734859	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173734859C>A	uc003isv.2	+	7	1644	c.908C>A	c.(907-909)CCC>CAC	p.P303H		NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6	303	Lumenal (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						AGGGCAGATCCCAGCGACCCT	0.552													5	19	---	---	---	---	PASS
GLRA3	8001	broad.mit.edu	37	4	175565117	175565117	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175565117G>A	uc003ity.1	-	10	1718	c.1215C>T	c.(1213-1215)CAC>CAT	p.H405H	GLRA3_uc003itz.1_Silent_p.H390H	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a	405	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	CCTGGACAGGGTGGTTGGGGC	0.502													27	52	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31299680	31299680	+	Silent	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31299680C>A	uc003jhe.1	+	5	1079	c.753C>A	c.(751-753)ACC>ACA	p.T251T	CDH6_uc003jhd.1_Silent_p.T251T	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	251	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						TATCTGGGACCACCACCGTGA	0.478													17	50	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31435975	31435975	+	Intron	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31435975C>A	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						ATGGACGCTACAAAAAAAAAA	0.289													6	27	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41049468	41049468	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41049468C>A	uc003jmj.3	-	14	1905	c.1415G>T	c.(1414-1416)AGT>ATT	p.S472I	HEATR7B2_uc003jmi.3_Missense_Mutation_p.S27I	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	472							binding			ovary(6)|central_nervous_system(2)	8						TCTGATGATACTAAACAGGGG	0.483													9	27	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45695818	45695818	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45695818C>A	uc003jok.2	-	1	403	c.378G>T	c.(376-378)AGG>AGT	p.R126S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	126	Involved in subunit assembly (By similarity).|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CAGTTTTAACCCTTTCCTGCT	0.587													9	21	---	---	---	---	PASS
MAP3K1	4214	broad.mit.edu	37	5	56161203	56161203	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56161203C>T	uc003jqw.3	+	5	1573	c.1072C>T	c.(1072-1074)CTG>TTG	p.L358L		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	358	SWIM-type.				cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CTGTATTCATCTGCTATTTGT	0.343													18	69	---	---	---	---	PASS
F2RL1	2150	broad.mit.edu	37	5	76129000	76129000	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76129000A>G	uc003keo.2	+	2	743	c.568A>G	c.(568-570)ATT>GTT	p.I190V		NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	190	Cytoplasmic (Potential).				blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		GAAGGCAAACATTGCCATTGG	0.502													29	105	---	---	---	---	PASS
PDE8B	8622	broad.mit.edu	37	5	76649241	76649241	+	Intron	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76649241T>C	uc003kfa.2	+						PDE8B_uc003kfb.2_Intron|PDE8B_uc003kfc.2_Intron|PDE8B_uc003kfd.2_Intron|PDE8B_uc003kfe.2_Intron	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		GGTATGGTATTAGCTCACTTC	0.393													9	40	---	---	---	---	PASS
ANKRD34B	340120	broad.mit.edu	37	5	79854374	79854374	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79854374T>A	uc010jam.2	-	4	1815	c.1465A>T	c.(1465-1467)AAA>TAA	p.K489*	ANKRD34B_uc003kgw.2_Nonsense_Mutation_p.K489*|ANKRD34B_uc010jan.2_Nonsense_Mutation_p.K489*	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	489						cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		TTGAATTCTTTAGGGAAAATC	0.353													23	98	---	---	---	---	PASS
ATP6AP1L	92270	broad.mit.edu	37	5	81608539	81608539	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81608539G>T	uc003khv.2	+	9	1566	c.241G>T	c.(241-243)GTA>TTA	p.V81L	ATP6AP1L_uc003khw.2_Missense_Mutation_p.V81L	NM_001017971	NP_001017971	Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory	81					ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						CCCAACTGGCGTATATGCTCC	0.532											OREG0016689	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	129	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127729062	127729062	+	Splice_Site	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127729062C>A	uc003kuu.2	-	10	1671	c.1232_splice	c.e10-1	p.E411_splice	FBN2_uc003kuv.2_Splice_Site_p.E378_splice	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGATATTCCTCTAGAAGAAAA	0.463													4	41	---	---	---	---	PASS
PKD2L2	27039	broad.mit.edu	37	5	137257368	137257368	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137257368G>A	uc003lby.2	+	9	1428	c.1372G>A	c.(1372-1374)GGT>AGT	p.G458S	PKD2L2_uc003lbw.1_Missense_Mutation_p.G458S|PKD2L2_uc003lbx.2_Intron|PKD2L2_uc011cyi.1_Missense_Mutation_p.G66S	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	458	Extracellular (Potential).					integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TAATTTTGCTGGTATTCAGCA	0.318													11	53	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554381	140554381	+	Silent	SNP	C	T	T	rs17844474		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554381C>T	uc003lit.2	+	1	2139	c.1965C>T	c.(1963-1965)ACC>ACT	p.T655T		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	655	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCGGCCACCGCCACGCTGC	0.711													18	83	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140572222	140572222	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140572222T>A	uc003lix.2	+	1	271	c.97T>A	c.(97-99)TAT>AAT	p.Y33N		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	33	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTTGGACGTTATTCGGTGAC	0.507													29	74	---	---	---	---	PASS
SPINK7	84651	broad.mit.edu	37	5	147693698	147693698	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147693698G>A	uc003lpd.2	+	3	180	c.123G>A	c.(121-123)GTG>GTA	p.V41V	uc003lpb.1_Intron	NM_032566	NP_115955	P58062	ISK7_HUMAN	serine peptidase inhibitor, Kazal type 7	41	Kazal-like.					extracellular region	protein binding|serine-type endopeptidase inhibitor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCAGTGGTGGCCATCCCCT	0.473													22	124	---	---	---	---	PASS
RBM22	55696	broad.mit.edu	37	5	150072543	150072543	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150072543T>A	uc003lst.2	-	10	1168	c.1046A>T	c.(1045-1047)TAC>TTC	p.Y349F		NM_018047	NP_060517	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	349	Pro-rich.				protein import into nucleus, translocation	catalytic step 2 spliceosome|cytoplasm	calcium-dependent protein binding|nucleotide binding|RNA binding|zinc ion binding				0		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAGTTGAAGTAGTTGGCAGA	0.547													12	39	---	---	---	---	PASS
GABRB2	2561	broad.mit.edu	37	5	160886795	160886795	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160886795T>C	uc003lys.1	-	5	511	c.293A>G	c.(292-294)TAT>TGT	p.Y98C	GABRB2_uc011deh.1_Intron|GABRB2_uc003lyr.1_Missense_Mutation_p.Y98C|GABRB2_uc003lyt.1_Missense_Mutation_p.Y98C|GABRB2_uc010jiu.1_Missense_Mutation_p.Y35C|GABRB2_uc011dei.1_Missense_Mutation_p.Y98C	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	98	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TATTACATTATAGGACAGCCT	0.403													13	39	---	---	---	---	PASS
HIST1H3F	8968	broad.mit.edu	37	6	26250687	26250687	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26250687G>A	uc003nhg.1	-	1	149	c.147C>T	c.(145-147)CTC>CTT	p.L49L	HIST1H2BH_uc003nhh.2_5'Flank	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	49					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						GGATTTCACGGAGGGCGACAG	0.617													14	96	---	---	---	---	PASS
OR2H1	26716	broad.mit.edu	37	6	29430068	29430068	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29430068C>G	uc003nmi.2	+	3	965	c.522C>G	c.(520-522)GAC>GAG	p.D174E	OR2H1_uc003nmj.1_Missense_Mutation_p.D174E|OR2H1_uc010jri.1_Missense_Mutation_p.D96E	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H,	174	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGATAGATGACTTTTTATGTG	0.507													75	107	---	---	---	---	PASS
ANKS1A	23294	broad.mit.edu	37	6	34985396	34985396	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34985396G>C	uc003ojx.3	+	11	1712	c.1570G>C	c.(1570-1572)GGC>CGC	p.G524R	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Missense_Mutation_p.G64R|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	524						cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						CTGTACCGCTGGCCAGAGCCA	0.692													11	14	---	---	---	---	PASS
ANKS1A	23294	broad.mit.edu	37	6	34985397	34985397	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34985397G>T	uc003ojx.3	+	11	1713	c.1571G>T	c.(1570-1572)GGC>GTC	p.G524V	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Missense_Mutation_p.G64V|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	524						cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						TGTACCGCTGGCCAGAGCCAT	0.692													12	13	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66204709	66204709	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66204709T>C	uc011dxu.1	-	4	1133	c.595A>G	c.(595-597)AGC>GGC	p.S199G	EYS_uc003peq.2_Missense_Mutation_p.S199G|EYS_uc003per.1_Missense_Mutation_p.S199G|EYS_uc010kaj.1_RNA	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	199	EGF-like 1.				response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						CAATGGCAGCTATATGTCTTG	0.393													15	36	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70964731	70964731	+	Intron	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70964731C>A	uc003pfg.3	-						COL9A1_uc003pfe.3_Intron|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						TAAACACACACAAAGAAACAT	0.423													31	34	---	---	---	---	PASS
NT5E	4907	broad.mit.edu	37	6	86194989	86194989	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86194989A>T	uc003pko.3	+	4	1344	c.788A>T	c.(787-789)TAC>TTC	p.Y263F	NT5E_uc010kbr.2_Missense_Mutation_p.Y263F	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor	263					DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	GCTGGGAAGTACCCATTCATA	0.483													10	47	---	---	---	---	PASS
L3MBTL3	84456	broad.mit.edu	37	6	130460904	130460904	+	3'UTR	SNP	G	T	T	rs147270987	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130460904G>T	uc003qbt.2	+	23					L3MBTL3_uc003qbu.2_3'UTR	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		TTTGAAGATGGTGAATTCTGA	0.368													22	24	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20198665	20198665	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20198665C>A	uc003sus.3	-	5	1628	c.1319G>T	c.(1318-1320)TGT>TTT	p.C440F	MACC1_uc010kug.2_Missense_Mutation_p.C440F	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	440					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						ATCAGGATCACAGGAAAAAAT	0.348													7	42	---	---	---	---	PASS
H2AFV	94239	broad.mit.edu	37	7	44880514	44880514	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44880514T>C	uc003tma.2	-	3	334	c.179A>G	c.(178-180)GAG>GGG	p.E60G	H2AFV_uc003tlz.2_Missense_Mutation_p.E60G|H2AFV_uc003tmb.2_Intron|H2AFV_uc003tmc.2_Missense_Mutation_p.E60G|H2AFV_uc003tmd.2_Missense_Mutation_p.E34G	NM_012412	NP_036544	Q71UI9	H2AV_HUMAN	H2A histone family, member V isoform 1	60					nucleosome assembly	nucleosome|nucleus	DNA binding				0						AGTGAGGTACTCCAGAATCGC	0.502													3	18	---	---	---	---	PASS
C7orf57	136288	broad.mit.edu	37	7	48086089	48086089	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48086089T>A	uc003toh.3	+	5	595	c.383T>A	c.(382-384)GTT>GAT	p.V128D	C7orf57_uc003toi.3_Missense_Mutation_p.V2D	NM_001100159	NP_001093629	Q8NEG2	CG057_HUMAN	hypothetical protein LOC136288	128										ovary(1)	1						GATTACATGGTTCATGAAGAA	0.517													8	13	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57187608	57187608	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57187608T>C	uc010kzo.2	-	5	1785	c.1514A>G	c.(1513-1515)CAT>CGT	p.H505R		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	505	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			AAGACTTGAATGCCACTTAAA	0.368													3	60	---	---	---	---	PASS
CLDN12	9069	broad.mit.edu	37	7	90042534	90042534	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90042534G>T	uc003ukp.2	+	5	1180	c.544G>T	c.(544-546)GCT>TCT	p.A182S	CLDN12_uc003ukq.2_Missense_Mutation_p.A182S|CLDN12_uc010leq.2_Missense_Mutation_p.A182S|CLDN12_uc003ukr.2_Missense_Mutation_p.A182S|CLDN12_uc003uks.2_Missense_Mutation_p.A182S	NM_012129	NP_036261	P56749	CLD12_HUMAN	claudin 12	182	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						TATTGCTAGTGCTGGGGGCCT	0.413													52	147	---	---	---	---	PASS
TAC1	6863	broad.mit.edu	37	7	97361961	97361961	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97361961G>C	uc003uop.3	+	2	283	c.37G>C	c.(37-39)GTC>CTC	p.V13L	TAC1_uc003uoq.3_Missense_Mutation_p.V13L|TAC1_uc003uor.3_Missense_Mutation_p.V13L|TAC1_uc003uos.3_Missense_Mutation_p.V13L	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor	13					detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)	CTTTTTTCTTGTCTCCACTCA	0.468													17	104	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100551257	100551257	+	RNA	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100551257C>A	uc003uxk.1	+	1		c.508C>A			uc003uxl.1_5'UTR					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		ACCATCTACTCCACAGTCAGC	0.512													19	79	---	---	---	---	PASS
SLC26A3	1811	broad.mit.edu	37	7	107434225	107434225	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107434225A>G	uc003ver.2	-	3	444	c.233T>C	c.(232-234)GTT>GCT	p.V78A	SLC26A3_uc003ves.2_Missense_Mutation_p.V43A	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	78	Helical; (Potential).				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						GATACCAGAAACAATATCACT	0.318													12	25	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120876765	120876765	+	Intron	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120876765C>A	uc003vjq.3	+						C7orf58_uc003vjs.3_Intron|C7orf58_uc003vjt.3_Intron	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					TATTTTAATGCAGGATTGTGG	0.308													15	76	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122047603	122047603	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122047603G>A	uc010lkp.2	-	19	2900	c.2737C>T	c.(2737-2739)CGA>TGA	p.R913*	CADPS2_uc011knx.1_Nonsense_Mutation_p.R288*|CADPS2_uc003vkg.3_Nonsense_Mutation_p.R607*|CADPS2_uc010lkq.2_Nonsense_Mutation_p.R907*	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	913	Interaction with DRD2.|MHD1.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						CTGTCATTTCGGAGGAAATTA	0.438													3	19	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133812382	133812382	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133812382G>C	uc003vrm.1	+	1	278	c.262G>C	c.(262-264)GAG>CAG	p.E88Q		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	88							ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						GGCGGGATCCGAGGAGTCCTC	0.617													8	29	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149493523	149493523	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149493523C>A	uc010lpk.2	+	45	6599	c.6599C>A	c.(6598-6600)GCG>GAG	p.A2200E		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2200	F5/8 type C.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ATGGTGCAGGCGAGGTTTGTC	0.627													3	53	---	---	---	---	PASS
XPO7	23039	broad.mit.edu	37	8	21844713	21844713	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21844713G>A	uc003xaa.3	+	14	1741	c.1639G>A	c.(1639-1641)GAG>AAG	p.E547K	XPO7_uc010lti.2_Missense_Mutation_p.E556K|XPO7_uc010ltk.2_Missense_Mutation_p.E548K	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b	547					mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TGAGAAGCTAGAGTTGGCCAT	0.493													86	83	---	---	---	---	PASS
ASH2L	9070	broad.mit.edu	37	8	37963921	37963921	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37963921G>A	uc003xkt.3	+	2	272	c.214G>A	c.(214-216)GGT>AGT	p.G72S	ASH2L_uc011lbk.1_5'UTR|ASH2L_uc003xku.3_5'UTR|ASH2L_uc010lwa.2_5'UTR	NM_004674	NP_004665	Q9UBL3	ASH2L_HUMAN	ash2-like isoform a	72					hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				CGATGTAAGCGGTGGCTTGGA	0.343													3	86	---	---	---	---	PASS
PLAT	5327	broad.mit.edu	37	8	42044968	42044968	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42044968C>T	uc003xos.2	-	6	696	c.487G>A	c.(487-489)GGG>AGG	p.G163R	PLAT_uc010lxf.1_Missense_Mutation_p.G80R|PLAT_uc010lxg.1_Intron|PLAT_uc003xot.2_Missense_Mutation_p.G117R|PLAT_uc011lcm.1_Intron|PLAT_uc011lcn.1_Intron	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	163	Kringle 1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GGCCTCCGCCCGCTGTAGGGC	0.652													4	28	---	---	---	---	PASS
PENK	5179	broad.mit.edu	37	8	57354094	57354094	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57354094C>T	uc003xsz.2	-	2	622	c.541G>A	c.(541-543)GAA>AAA	p.E181K	PENK_uc003xta.3_Missense_Mutation_p.E181K	NM_006211	NP_006202	P01210	PENK_HUMAN	proenkephalin	181					neuropeptide signaling pathway	extracellular region	neuropeptide hormone activity|opioid peptide activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TTGCTCACTTCTTCCTCATTA	0.522													93	102	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67547539	67547539	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67547539C>G	uc003xwn.2	-	3	3125	c.2866G>C	c.(2866-2868)GAA>CAA	p.E956Q		NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	956					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AGTCTATCTTCAGAAGCATTA	0.403													52	44	---	---	---	---	PASS
RPL7	6129	broad.mit.edu	37	8	74203803	74203803	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74203803C>G	uc003xzg.2	-	5	544	c.522G>C	c.(520-522)TTG>TTC	p.L174F	RPL7_uc003xzh.1_Missense_Mutation_p.L134F	NM_000971	NP_000962	P18124	RL7_HUMAN	ribosomal protein L7	174					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	DNA binding|mRNA binding|protein homodimerization activity|structural constituent of ribosome				0	Breast(64;0.0954)		Epithelial(68;0.0193)|all cancers(69;0.0766)|BRCA - Breast invasive adenocarcinoma(89;0.134)			ATCGAGCAATCAAAGCGTTAT	0.393													31	34	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767532	77767532	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767532G>T	uc003yav.2	+	10	8627	c.8240G>T	c.(8239-8241)GGG>GTG	p.G2747V	ZFHX4_uc003yau.1_Missense_Mutation_p.G2792V|ZFHX4_uc003yaw.1_Missense_Mutation_p.G2747V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2747						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCTGAGGCTGGGTATGATCAA	0.443										HNSCC(33;0.089)			18	23	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87076589	87076589	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87076589C>A	uc011lfy.1	-	2	457	c.457G>T	c.(457-459)GGA>TGA	p.G153*		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	153	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			GTAAAGGATCCCTGAGCAATG	0.493													4	68	---	---	---	---	PASS
INTS8	55656	broad.mit.edu	37	8	95850755	95850755	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95850755G>A	uc003yhb.2	+	8	1052	c.926G>A	c.(925-927)TGT>TAT	p.C309Y	INTS8_uc003yha.1_Missense_Mutation_p.C309Y|INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Missense_Mutation_p.C136Y	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8	309					snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					TGTCAAGCATGTGATGTTCTT	0.378													8	179	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139207519	139207519	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139207519C>A	uc003yuy.2	-	9	1026	c.855G>T	c.(853-855)CAG>CAT	p.Q285H	FAM135B_uc003yux.2_Missense_Mutation_p.Q186H|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	285										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTGAGCACAGCTGAGAAAGTG	0.418										HNSCC(54;0.14)			38	56	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13110740	13110740	+	Splice_Site	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13110740C>A	uc010mhy.2	-	42	5689	c.5638_splice	c.e42-1	p.V1880_splice	MPDZ_uc003zkx.3_Splice_Site_p.V104_splice|MPDZ_uc003zky.3_Splice_Site_p.V443_splice|MPDZ_uc010mib.2_Splice_Site_p.V614_splice|MPDZ_uc010mhx.2_Splice_Site_p.V731_splice|MPDZ_uc011lmm.1_Splice_Site_p.V768_splice|MPDZ_uc003zkz.3_Splice_Site_p.V602_splice|MPDZ_uc010mhz.2_Splice_Site_p.V1876_splice|MPDZ_uc011lmn.1_Splice_Site_p.V1847_splice|MPDZ_uc003zlb.3_Splice_Site_p.V1880_splice	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein						interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		TATCCCCAACCTGCAAGGGAG	0.473													7	26	---	---	---	---	PASS
C9orf93	203238	broad.mit.edu	37	9	15777610	15777610	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15777610G>T	uc003zmd.2	+	19	2999	c.2684G>T	c.(2683-2685)AGA>ATA	p.R895I	C9orf93_uc003zme.2_Missense_Mutation_p.R810I|C9orf93_uc011lmu.1_Missense_Mutation_p.R903I|C9orf93_uc003zmf.1_Missense_Mutation_p.R203I	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	895											0				GBM - Glioblastoma multiforme(50;4.84e-07)		CCAAATTCCAGAATTTGTGGA	0.333													4	80	---	---	---	---	PASS
C9orf93	203238	broad.mit.edu	37	9	15777713	15777713	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15777713G>C	uc003zmd.2	+	19	3102	c.2787G>C	c.(2785-2787)AGG>AGC	p.R929S	C9orf93_uc003zme.2_Missense_Mutation_p.R844S|C9orf93_uc011lmu.1_Missense_Mutation_p.R937S|C9orf93_uc003zmf.1_Missense_Mutation_p.R237S	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	929											0				GBM - Glioblastoma multiforme(50;4.84e-07)		ACAGTAGCAGGAGTATTACAT	0.413													11	101	---	---	---	---	PASS
C9orf93	203238	broad.mit.edu	37	9	15777729	15777729	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15777729G>T	uc003zmd.2	+	19	3118	c.2803G>T	c.(2803-2805)GAA>TAA	p.E935*	C9orf93_uc003zme.2_Nonsense_Mutation_p.E850*|C9orf93_uc011lmu.1_Nonsense_Mutation_p.E943*|C9orf93_uc003zmf.1_Nonsense_Mutation_p.E243*	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	935											0				GBM - Glioblastoma multiforme(50;4.84e-07)		TACATATGTAGAAAAAGATTC	0.428													12	105	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16419556	16419556	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16419556C>A	uc003zml.2	-	7	2871	c.2731G>T	c.(2731-2733)GAC>TAC	p.D911Y	BNC2_uc011lmw.1_Missense_Mutation_p.D816Y|BNC2_uc003zmm.2_3'UTR|BNC2_uc011lmv.1_3'UTR|BNC2_uc003zmj.2_3'UTR|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.D698Y	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	911					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		TCGCGGAGGTCCTTGCTAAGG	0.532													20	146	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32633549	32633549	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32633549C>G	uc003zrg.1	-	1	2119	c.2029G>C	c.(2029-2031)GGT>CGT	p.G677R	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	677					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCTCCACCACCTGAGGCTTGC	0.448													54	53	---	---	---	---	PASS
IL11RA	3590	broad.mit.edu	37	9	34659843	34659843	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34659843G>C	uc003zvi.2	+	9	2254	c.898G>C	c.(898-900)GAT>CAT	p.D300H	IL11RA_uc011loq.1_Missense_Mutation_p.D300H|IL11RA_uc003zvj.2_Missense_Mutation_p.D300H|IL11RA_uc003zvk.2_Missense_Mutation_p.D300H|IL11RA_uc010mke.2_Missense_Mutation_p.D182H|IL11RA_uc003zvl.2_RNA	NM_004512	NP_004503	Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha isoform 1	300	Extracellular (Potential).|Fibronectin type-III 2.					integral to plasma membrane	cytokine receptor activity			skin(1)	1	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	GGACTTTCTAGATGCTGGCAC	0.612													6	55	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	111945036	111945036	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111945036A>G	uc004bdz.1	-	24	2755	c.2460T>C	c.(2458-2460)GAT>GAC	p.D820D		NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	820						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						TGGTGAAAGTATCAGGAAACG	0.418													49	78	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117099585	117099585	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117099585A>C	uc004biq.3	-	21	4204	c.4069T>G	c.(4069-4071)TAC>GAC	p.Y1357D	AKNA_uc004bin.3_Missense_Mutation_p.Y604D|AKNA_uc004bio.3_Missense_Mutation_p.Y817D|AKNA_uc004bip.3_Missense_Mutation_p.Y1276D|AKNA_uc004bir.3_Missense_Mutation_p.Y1357D|AKNA_uc004bis.3_Missense_Mutation_p.Y1357D|AKNA_uc010mve.2_Missense_Mutation_p.Y1238D	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1357					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						GGCGCATAGTACCTGAGGAGA	0.632													3	36	---	---	---	---	PASS
LARP4B	23185	broad.mit.edu	37	10	871190	871190	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:871190T>C	uc001ifs.1	-	12	1340	c.1299A>G	c.(1297-1299)GAA>GAG	p.E433E		NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	433							nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						TTGAAGGACTTTCTAATAACC	0.403													37	99	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16979726	16979726	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16979726T>C	uc001ioo.2	-	39	5843	c.5791A>G	c.(5791-5793)ACT>GCT	p.T1931A		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1931	CUB 13.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAAGATTCAGTCTGGGTACCA	0.413													9	55	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17087013	17087013	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17087013T>C	uc001ioo.2	-	25	3717	c.3665A>G	c.(3664-3666)TAC>TGC	p.Y1222C		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1222	CUB 7.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TACAGCCAGGTAATCTAAAGT	0.423													20	68	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21169795	21169795	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21169795G>A	uc001iqi.2	-	5	805	c.408C>T	c.(406-408)TTC>TTT	p.F136F	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	136	Nebulin 3.			KHDAAKGFSD -> NMMLPRILS (in Ref. 2; AAF24858).	regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CATAATCTGAGAATCCTTTGG	0.403													13	68	---	---	---	---	PASS
ARMC3	219681	broad.mit.edu	37	10	23319669	23319669	+	Silent	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23319669G>T	uc001irm.3	+	17	2273	c.2190G>T	c.(2188-2190)GTG>GTT	p.V730V	ARMC3_uc010qcv.1_Silent_p.V723V|ARMC3_uc010qcw.1_Silent_p.V467V	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	730							binding				0						TGTATGAGGTGACCAAATCAA	0.348													20	65	---	---	---	---	PASS
FAM21B	55747	broad.mit.edu	37	10	47942065	47942065	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47942065G>T	uc009xni.2	+	24	2528	c.2528G>T	c.(2527-2529)TGG>TTG	p.W843L	FAM21B_uc001jep.3_Missense_Mutation_p.W738L|FAM21B_uc001jeq.3_5'Flank	NM_018232	NP_060702	Q5SNT6	FA21B_HUMAN	hypothetical protein LOC55747	843					retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						AAAGGCATATGGAAGCCAGAA	0.378													12	40	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89720808	89720808	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89720808T>A	uc001kfb.2	+	9	1990	c.959T>A	c.(958-960)TTA>TAA	p.L320*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	320	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.T319fs*24(4)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.L320*(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GTACTTACTTTAACAAAAAAT	0.323		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			25	81	---	---	---	---	PASS
NOC3L	64318	broad.mit.edu	37	10	96121573	96121573	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96121573G>A	uc001kjq.1	-	2	154	c.66C>T	c.(64-66)GTC>GTT	p.V22V	NOC3L_uc009xuk.1_5'UTR	NM_022451	NP_071896	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog	22						nuclear speck|nucleolus	binding			ovary(1)	1		Colorectal(252;0.0897)				TTTCAAGTTTGACTTTACTAG	0.323													20	58	---	---	---	---	PASS
ENTPD7	57089	broad.mit.edu	37	10	101448486	101448486	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101448486G>C	uc001kqa.3	+	7	866	c.688G>C	c.(688-690)GGA>CGA	p.G230R	ENTPD7_uc009xwl.2_Missense_Mutation_p.G232R	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	230	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		CTTTGTTTTGGGAAGATTCGA	0.383													87	219	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108367015	108367015	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108367015A>G	uc001kym.2	-	23	3082	c.3074T>C	c.(3073-3075)CTC>CCC	p.L1025P	SORCS1_uc001kyl.2_Missense_Mutation_p.L1025P|SORCS1_uc009xxs.2_Missense_Mutation_p.L1025P|SORCS1_uc001kyn.1_Missense_Mutation_p.L1025P|SORCS1_uc001kyo.2_Missense_Mutation_p.L1025P	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	1025	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TAAGCCAGGGAGCACCGCCAC	0.567													13	34	---	---	---	---	PASS
DUSP5	1847	broad.mit.edu	37	10	112270038	112270038	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112270038T>G	uc001kzd.2	+	4	1264	c.1009T>G	c.(1009-1011)TCA>GCA	p.S337A		NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	337	Tyrosine-protein phosphatase.				endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		AGCAGGCTCTTCACTGATAGG	0.612													8	52	---	---	---	---	PASS
CARS	833	broad.mit.edu	37	11	3028114	3028114	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3028114T>C	uc001lxh.2	-	18	1969	c.1895A>G	c.(1894-1896)CAC>CGC	p.H632R	CARS_uc009ydu.2_RNA|CARS_uc001lxe.2_Missense_Mutation_p.H622R|CARS_uc001lxf.2_Missense_Mutation_p.H715R|CARS_uc001lxg.2_Missense_Mutation_p.H632R|CARS_uc010qxo.1_Missense_Mutation_p.H715R|CARS_uc010qxp.1_Missense_Mutation_p.H645R	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	632					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CCCACCTTCGTGGTCTTCAAA	0.587			T	ALK	ALCL								8	179	---	---	---	---	PASS
OR52D1	390066	broad.mit.edu	37	11	5510741	5510741	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5510741C>G	uc010qzg.1	+	1	805	c.805C>G	c.(805-807)CAC>GAC	p.H269D	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005163	NP_001005163	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGCTTTGGTCACCACGAAGT	0.512													15	50	---	---	---	---	PASS
OR52N1	79473	broad.mit.edu	37	11	5809149	5809149	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5809149T>A	uc010qzo.1	-	1	898	c.898A>T	c.(898-900)AGG>TGG	p.R300W	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CGTACCTGCCTGGTTTTCACC	0.398													24	97	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048454	6048454	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048454G>A	uc010qzw.1	-	1	481	c.481C>T	c.(481-483)CTT>TTT	p.L161F		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	161	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGTAAGAAGCGCATTCCGC	0.498													11	64	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048757	6048757	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048757C>G	uc010qzw.1	-	1	178	c.178G>C	c.(178-180)GCC>CCC	p.A60P		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	60	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCAGAGAGGCCTCCAGCTGG	0.617													10	53	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6650773	6650773	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6650773T>A	uc001mem.1	-	12	5481	c.5071A>T	c.(5071-5073)AGC>TGC	p.S1691C		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1691	Cadherin 16.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGCTTTCGCTAGAGACGCCT	0.552													3	17	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6661603	6661603	+	Silent	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6661603T>A	uc001mem.1	-	2	1652	c.1242A>T	c.(1240-1242)CTA>CTT	p.L414L		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	414	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTGGGTGCTTAGGGCAAAGT	0.557													4	10	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47330152	47330152	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47330152A>G	uc001ner.1	+	25	3961	c.3770A>G	c.(3769-3771)CAC>CGC	p.H1257R	MADD_uc001neq.2_Missense_Mutation_p.H1219R|MADD_uc001nev.1_Missense_Mutation_p.H1176R|MADD_uc001nes.1_Missense_Mutation_p.H1196R|MADD_uc001net.1_Missense_Mutation_p.H1239R|MADD_uc009yln.1_Missense_Mutation_p.H1172R|MADD_uc001neu.1_Missense_Mutation_p.H1176R|MADD_uc001nex.2_Missense_Mutation_p.H1257R|MADD_uc001nez.2_Missense_Mutation_p.H1175R|MADD_uc001new.2_Missense_Mutation_p.H1218R|MADD_uc009ylo.2_Missense_Mutation_p.H171R	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	1257					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		GGTAAAGCCCACAGCTTGAAG	0.507													11	30	---	---	---	---	PASS
OR8J1	219477	broad.mit.edu	37	11	56128131	56128131	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56128131T>A	uc010rjh.1	+	1	409	c.409T>A	c.(409-411)TCT>ACT	p.S137T		NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GGTGGTGGTGTCTCGGCGGCT	0.468													19	70	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56185408	56185408	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56185408G>T	uc010rji.1	-	1	301	c.301C>A	c.(301-303)CTG>ATG	p.L101M		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					AAACAACCCAGTTGGGTTGCA	0.453													6	34	---	---	---	---	PASS
OR5AP2	338675	broad.mit.edu	37	11	56409733	56409733	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56409733G>A	uc001njb.1	-	1	183	c.183C>T	c.(181-183)CTC>CTT	p.L61L		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						TGGGGGTGTGGAGACAGAGAT	0.433													6	40	---	---	---	---	PASS
OR5B21	219968	broad.mit.edu	37	11	58275212	58275212	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58275212C>G	uc010rki.1	-	1	367	c.367G>C	c.(367-369)GCG>CCG	p.A123P		NM_001005218	NP_001005218	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B,	123	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CTACATACCGCTGCATGGCGA	0.527													3	27	---	---	---	---	PASS
LGALS12	85329	broad.mit.edu	37	11	63279225	63279225	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63279225A>T	uc001nxa.2	+	7	967	c.626A>T	c.(625-627)GAG>GTG	p.E209V	LGALS12_uc001nxb.2_Missense_Mutation_p.E200V|LGALS12_uc001nxc.2_Missense_Mutation_p.E210V|LGALS12_uc001nxd.2_Missense_Mutation_p.E148V|LGALS12_uc001nxe.2_Missense_Mutation_p.E139V|LGALS12_uc009yot.2_Missense_Mutation_p.E169V	NM_033101	NP_149092	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12 isoform	209					apoptosis|induction of apoptosis by intracellular signals	nucleus	lactose binding			ovary(2)	2						TTCCTTCAGGAGGTGCCCTGC	0.612													11	47	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66488695	66488695	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66488695G>A	uc001ojd.2	-	2	89	c.17C>T	c.(16-18)TCA>TTA	p.S6L		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	6	Actin-binding.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GTCTGTGGGTGACAGCGTGCT	0.592													15	69	---	---	---	---	PASS
ARAP1	116985	broad.mit.edu	37	11	72424248	72424248	+	Silent	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72424248C>A	uc001osu.2	-	5	909	c.720G>T	c.(718-720)GGG>GGT	p.G240G	ARAP1_uc001osv.2_Silent_p.G240G|ARAP1_uc001osr.2_5'UTR|ARAP1_uc001oss.2_5'UTR|ARAP1_uc009yth.2_5'UTR|ARAP1_uc010rre.1_5'UTR	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	240					actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						TGGCTGGGGCCCCCGGCCCCT	0.667													10	49	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85445045	85445045	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85445045C>A	uc010rth.1	-	6	1600	c.1324G>T	c.(1324-1326)GAA>TAA	p.E442*	SYTL2_uc010rtg.1_Nonsense_Mutation_p.E443*|SYTL2_uc010rti.1_Nonsense_Mutation_p.E442*|SYTL2_uc010rtj.1_Nonsense_Mutation_p.E394*|SYTL2_uc001pbf.3_Nonsense_Mutation_p.E442*|SYTL2_uc010rtf.1_Nonsense_Mutation_p.E300*	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	442					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TCTTTGGGTTCATTGATGGTT	0.388													20	135	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88337890	88337890	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88337890C>A	uc001pcq.2	-	4	1590	c.1390G>T	c.(1390-1392)GGA>TGA	p.G464*	GRM5_uc009yvm.2_Nonsense_Mutation_p.G464*	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	464	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	CAATACCTTCCTGGAGAGTCT	0.423													7	33	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92714753	92714753	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92714753C>A	uc001pdk.1	+	2	467	c.364C>A	c.(364-366)CTG>ATG	p.L122M		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	122	Helical; Name=3; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	TGTGATGGGCCTGAGCGTCAT	0.597													23	84	---	---	---	---	PASS
CCDC67	159989	broad.mit.edu	37	11	93097451	93097451	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93097451G>C	uc001pdq.2	+	5	523	c.423G>C	c.(421-423)CAG>CAC	p.Q141H	CCDC67_uc001pdo.1_Missense_Mutation_p.Q141H|CCDC67_uc001pdp.2_Missense_Mutation_p.Q141H	NM_181645	NP_857596	Q05D60	CCD67_HUMAN	coiled-coil domain containing 67	141	Potential.									ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				ATTTGAACCAGAAATTAGAGG	0.333													6	49	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105483132	105483132	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105483132C>A	uc001pix.2	+	3	664	c.218C>A	c.(217-219)ACA>AAA	p.T73K	GRIA4_uc001piu.1_Missense_Mutation_p.T73K|GRIA4_uc001piw.2_Missense_Mutation_p.T73K|GRIA4_uc001piv.2_Missense_Mutation_p.T73K|GRIA4_uc009yxk.1_Missense_Mutation_p.T73K|GRIA4_uc001pit.2_Missense_Mutation_p.T73K	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	73	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	AACATTGAGACAGCCAACAGT	0.398													5	67	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105836665	105836665	+	Intron	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105836665C>A	uc001pix.2	+						GRIA4_uc001piw.2_Intron|GRIA4_uc010rvm.1_Intron|GRIA4_uc009yxl.1_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TATGTTTTATCGTTTCAAGAA	0.368													7	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	113111520	113111520	+	IGR	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113111520G>T								NCAM1 (-37637 upstream) : NCAM1 (-279525 downstream)																							GCATCTGCTAGCTCGTCTACC	0.443													28	166	---	---	---	---	PASS
DPAGT1	1798	broad.mit.edu	37	11	118971749	118971749	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118971749A>G	uc001pvi.2	-	2	681	c.261T>C	c.(259-261)TGT>TGC	p.C87C	DPAGT1_uc001pvj.2_Intron|DPAGT1_uc009zaq.2_RNA|DPAGT1_uc001pvk.2_5'UTR|DPAGT1_uc010ryz.1_Silent_p.C87C|DPAGT1_uc001pvm.1_5'Flank|DPAGT1_uc010rza.1_Intron	NM_001382	NP_001373	Q9H3H5	GPT_HUMAN	UDP-N-acetylglucosamine-dolichyl-phosphate	87	Lumenal (Potential).				dolichol biosynthetic process|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|protein oligomerization	integral to endoplasmic reticulum membrane|microsome	phospho-N-acetylmuramoyl-pentapeptide-transferase activity|transferase activity, transferring glycosyl groups|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity			breast(2)|ovary(1)	3	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		GGAATGCCTTACACTGCTCCT	0.537											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	46	---	---	---	---	PASS
OR8A1	390275	broad.mit.edu	37	11	124440849	124440849	+	Silent	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124440849C>A	uc010san.1	+	1	885	c.885C>A	c.(883-885)ACC>ACA	p.T295T		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	295	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		TGTTCTACACCACGGTAATCC	0.478													8	33	---	---	---	---	PASS
EI24	9538	broad.mit.edu	37	11	125448072	125448072	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125448072C>A	uc001qca.2	+	6	602	c.360C>A	c.(358-360)TTC>TTA	p.F120L	EI24_uc001qcb.2_Missense_Mutation_p.F120L|EI24_uc010sbd.1_RNA|EI24_uc009zbl.2_Missense_Mutation_p.F120L|EI24_uc001qcc.2_RNA|EI24_uc010sbe.1_Missense_Mutation_p.F106L|EI24_uc010sbf.1_RNA	NM_004879	NP_004870	O14681	EI24_HUMAN	etoposide induced 2.4 isoform 1	120	Helical; (Potential).				apoptosis|autophagy|induction of apoptosis|negative regulation of cell growth	endoplasmic reticulum membrane|integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		GGCTGGAATTCTTCCTCACGT	0.453													4	72	---	---	---	---	PASS
GLB1L3	112937	broad.mit.edu	37	11	134181039	134181039	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134181039G>A	uc009zdf.2	+	13	1622	c.1262G>A	c.(1261-1263)TGG>TAG	p.W421*	GLB1L3_uc010scu.1_3'UTR|GLB1L3_uc001qho.3_RNA	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3	421					carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		CTCCCGCTGTGGGACGCCCTA	0.597													29	92	---	---	---	---	PASS
KCNA5	3741	broad.mit.edu	37	12	5154154	5154154	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5154154C>A	uc001qni.2	+	1	1070	c.841C>A	c.(841-843)CTG>ATG	p.L281M		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	281						Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4						TGAACGTGAGCTGCTCCGCCA	0.692													59	47	---	---	---	---	PASS
KLRF1	51348	broad.mit.edu	37	12	9997097	9997097	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9997097G>T	uc010sgw.1	+	7	732	c.668G>T	c.(667-669)AGT>ATT	p.S223I	KLRF1_uc009zgw.2_Missense_Mutation_p.S174I|KLRF1_uc009zgx.2_RNA|KLRF1_uc001qwm.2_RNA|KLRF1_uc009zgy.2_RNA|KLRF1_uc009zgz.2_3'UTR|KLRF1_uc009zha.2_RNA	NM_016523	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F,	224	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1						ACCTGCAGCAGTGTTTTCAAA	0.333													30	30	---	---	---	---	PASS
PLBD1	79887	broad.mit.edu	37	12	14659942	14659942	+	Silent	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14659942G>T	uc001rcc.1	-	9	1458	c.1297C>A	c.(1297-1299)CGA>AGA	p.R433R		NM_024829	NP_079105	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	433					lipid catabolic process	extracellular region	hydrolase activity				0						ATTTTGGCTCGTGGAGCTAAA	0.423													72	64	---	---	---	---	PASS
ERP27	121506	broad.mit.edu	37	12	15068528	15068528	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15068528T>C	uc001rco.2	-	6	690	c.669A>G	c.(667-669)GCA>GCG	p.A223A		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	223						endoplasmic reticulum lumen				breast(1)	1						TCTGGTAAATTGCCAAAGCTG	0.413													10	99	---	---	---	---	PASS
ANO6	196527	broad.mit.edu	37	12	45810620	45810620	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45810620A>G	uc001roo.2	+	17	2485	c.2150A>G	c.(2149-2151)AAA>AGA	p.K717R	ANO6_uc010sld.1_Missense_Mutation_p.K717R|ANO6_uc010sle.1_Missense_Mutation_p.K717R|ANO6_uc010slf.1_Missense_Mutation_p.K738R|ANO6_uc010slg.1_Missense_Mutation_p.K699R	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	717	Cytoplasmic (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						GTACCAGAGAAAGCCCAAGAC	0.483													13	50	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46320223	46320223	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46320223A>G	uc001rox.2	-	11	3548	c.3261T>C	c.(3259-3261)TTT>TTC	p.F1087F	SFRS2IP_uc001row.2_Silent_p.F772F|SFRS2IP_uc001roy.1_Silent_p.F1161F	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	1087					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		CTTTATAGGCAAAACTACTTC	0.428													9	74	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48368475	48368475	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48368475T>C	uc001rqu.2	-	52	4238	c.4057A>G	c.(4057-4059)ATC>GTC	p.I1353V	COL2A1_uc001rqt.2_Missense_Mutation_p.I134V|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.I1284V	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1353	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCACCATTGATGGTTTCTCCA	0.493													48	137	---	---	---	---	PASS
DCD	117159	broad.mit.edu	37	12	55042031	55042031	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55042031G>A	uc001sgj.2	-	1	119	c.57C>T	c.(55-57)GCC>GCT	p.A19A	DCD_uc009znt.2_Silent_p.A19A|DCD_uc009znu.2_RNA	NM_053283	NP_444513	P81605	DCD_HUMAN	dermcidin preproprotein	19					defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			ovary(1)	1		Myeloproliferative disorder(1001;0.0255)				CATACTCACAGGCACAGACCA	0.572													3	29	---	---	---	---	PASS
MDM2	4193	broad.mit.edu	37	12	69214094	69214094	+	Intron	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69214094C>T	uc001sui.2	+						MDM2_uc009zri.2_Intron|MDM2_uc009zqx.2_Intron|MDM2_uc009zqw.2_Intron|MDM2_uc001suk.2_Intron|MDM2_uc009zqy.1_Intron|MDM2_uc001sun.3_Intron|MDM2_uc009zqz.2_Intron|MDM2_uc009zra.2_Intron|MDM2_uc001sum.1_Intron|MDM2_uc009zrd.2_Intron|MDM2_uc009zrc.2_Intron|MDM2_uc009zre.2_Intron|MDM2_uc009zrf.2_Intron|MDM2_uc001suo.2_Intron|MDM2_uc009zrg.2_Intron|MDM2_uc009zrh.2_Intron	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2						cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTTTTTTTTTCTGTCTACAAG	0.299			A		sarcoma|glioma|colorectal|other								7	49	---	---	---	---	PASS
MIR1279	100302182	broad.mit.edu	37	12	69666975	69666975	+	RNA	SNP	A	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69666975A>C	hsa-mir-1279|MI0006426	-			c.24A>C			CPSF6_uc001sut.3_3'UTR|CPSF6_uc001suu.3_3'UTR|CPSF6_uc010stk.1_3'UTR																	0						ATTAGAAAGAAGCAATATGAA	0.294													14	52	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81741394	81741394	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81741394G>C	uc001szo.1	-	18	2311	c.2150C>G	c.(2149-2151)TCT>TGT	p.S717C	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	643										ovary(3)|lung(2)|pancreas(1)	6						ACTGGGGGGAGATGAACTGGC	0.557													21	82	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94603390	94603390	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94603390A>G	uc001tdc.2	+	5	1713	c.1464A>G	c.(1462-1464)GTA>GTG	p.V488V		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	488	Extracellular (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						GAGATTGTGTACATTCAGAGA	0.398													40	153	---	---	---	---	PASS
GNPTAB	79158	broad.mit.edu	37	12	102161813	102161813	+	Splice_Site	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102161813A>G	uc001tit.2	-	11	1587	c.1408_splice	c.e11+1	p.G470_splice	GNPTAB_uc001tiu.1_Silent_p.G470G	NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase						cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2						ACACATCCTTACCAGAGCAAT	0.393													13	34	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112528673	112528673	+	Intron	SNP	T	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112528673T>G	uc001ttm.2	-						NAA25_uc001ttn.3_Intron|NAA25_uc009zvz.1_Intron|NAA25_uc009zwa.1_Intron	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20							cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						TAAAACCTGATAGCAACAAAA	0.393													20	75	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120575346	120575346	+	Intron	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120575346C>T	uc001txo.2	-							NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCAGTCCCCTCACCTTAGTGA	0.378													15	64	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132561125	132561125	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132561125C>G	uc001ujn.2	+	51	9121	c.9086C>G	c.(9085-9087)TCT>TGT	p.S3029C	EP400_uc001ujl.2_Missense_Mutation_p.S3028C|EP400_uc001ujm.2_Missense_Mutation_p.S2948C|EP400_uc001ujp.2_Missense_Mutation_p.S239C|EP400_uc010tbo.1_Silent_p.L95L	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	3065					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAAGTTGCCTCTGCTTCCCAG	0.448													7	23	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25009391	25009391	+	Silent	SNP	T	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25009391T>G	uc001upl.2	-	31	3994	c.3888A>C	c.(3886-3888)ACA>ACC	p.T1296T		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1296					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GTTCAGTTGCTGTTGGTTTAC	0.433													26	58	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33225993	33225993	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33225993A>T	uc010abf.2	+	3	319	c.161A>T	c.(160-162)GAG>GTG	p.E54V	PDS5B_uc001uun.2_Missense_Mutation_p.E54V|PDS5B_uc001uuo.2_Missense_Mutation_p.E54V|PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	54					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GAAGAAAAGGAGCTTTATTTA	0.338													38	81	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20444720	20444720	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20444720A>T	uc010tkx.1	+	1	1043	c.1043A>T	c.(1042-1044)AAG>ATG	p.K348M		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	348	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTAGAAACAAAGTAAACTTAT	0.393													4	20	---	---	---	---	PASS
RNF31	55072	broad.mit.edu	37	14	24626559	24626559	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24626559G>T	uc001wmn.1	+	15	2803	c.2554G>T	c.(2554-2556)GAC>TAC	p.D852Y	RNF31_uc001wml.1_Missense_Mutation_p.D701Y|RNF31_uc010alg.1_Missense_Mutation_p.D611Y|RNF31_uc001wmo.1_Missense_Mutation_p.D319Y|RNF31_uc001wmp.2_RNA|RNF31_uc010alh.1_Missense_Mutation_p.D36Y	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	852					CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		ACGCATGAACGACCCAGAATA	0.557													6	24	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42361008	42361008	+	Silent	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42361008T>A	uc001wvm.2	+	4	3139	c.1941T>A	c.(1939-1941)ACT>ACA	p.T647T	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	647	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		AAAGAAAGACTGGCACAAAGC	0.468										HNSCC(30;0.082)			6	21	---	---	---	---	PASS
WDHD1	11169	broad.mit.edu	37	14	55458047	55458047	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55458047G>C	uc001xbm.1	-	12	1303	c.1225C>G	c.(1225-1227)CAC>GAC	p.H409D	WDHD1_uc010aom.1_5'UTR|WDHD1_uc001xbn.1_Missense_Mutation_p.H286D	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	409						cytoplasm|nucleoplasm	DNA binding			skin(1)	1						GGTAGATTGTGAATGCTGCCT	0.428													16	65	---	---	---	---	PASS
ZBTB1	22890	broad.mit.edu	37	14	64990087	64990087	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64990087G>A	uc001xhh.3	+	4	2296	c.1865G>A	c.(1864-1866)CGA>CAA	p.R622Q	ZBTB1_uc010aqg.2_Missense_Mutation_p.R622Q|ZBTB1_uc001xhi.2_Missense_Mutation_p.R622Q	NM_001123329	NP_001116801	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1 isoform	622	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		CGTCAGTTGCGACTGCACAAT	0.403													6	90	---	---	---	---	PASS
SIPA1L1	26037	broad.mit.edu	37	14	72085580	72085580	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72085580C>T	uc001xms.2	+	3	1953	c.1605C>T	c.(1603-1605)TAC>TAT	p.Y535Y	SIPA1L1_uc001xmt.2_Silent_p.Y535Y|SIPA1L1_uc001xmu.2_Silent_p.Y535Y|SIPA1L1_uc001xmv.2_Silent_p.Y535Y|SIPA1L1_uc010ttm.1_Silent_p.Y10Y	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	535					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CGTACAACTACCGAATAATTT	0.403													9	44	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73653560	73653560	+	Splice_Site	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73653560G>C	uc001xnr.2	+	6	765	c.481_splice	c.e6-1	p.V161_splice	PSEN1_uc001xnv.2_Splice_Site_p.V157_splice|PSEN1_uc010ark.2_Splice_Site_p.V157_splice|PSEN1_uc001xnt.1_Splice_Site|PSEN1_uc001xnu.2_Splice_Site|uc010ttv.1_5'Flank	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467						amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TTCTTTTCTAGGTCATCCATG	0.269													28	107	---	---	---	---	PASS
ASB2	51676	broad.mit.edu	37	14	94420705	94420705	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94420705C>A	uc001ycc.1	-	2	781	c.292G>T	c.(292-294)GCA>TCA	p.A98S	ASB2_uc001ycd.2_Missense_Mutation_p.A146S|ASB2_uc001yce.1_Missense_Mutation_p.A44S	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	98	ANK 2.				intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CCATAGTATGCGGCCTCGTGC	0.607													10	35	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96707244	96707244	+	Silent	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96707244G>T	uc010avm.1	+	3	775	c.579G>T	c.(577-579)CTG>CTT	p.L193L	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_Silent_p.L166L|BDKRB2_uc001yfg.2_Silent_p.L193L	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	193	Helical; Name=4; (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		CACCCATGCTGGTGTTCCGGA	0.587													14	62	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96707245	96707245	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96707245G>T	uc010avm.1	+	3	776	c.580G>T	c.(580-582)GTG>TTG	p.V194L	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_Missense_Mutation_p.V167L|BDKRB2_uc001yfg.2_Missense_Mutation_p.V194L	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	194	Helical; Name=4; (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		ACCCATGCTGGTGTTCCGGAC	0.587													14	60	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107034795	107034795	+	RNA	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107034795G>A	uc010tyt.1	-	154		c.7438C>T			uc001ysz.2_Silent_p.I95I					Parts of antibodies, mostly variable regions.												0						AGGCGGTGCTGATGGACTTGT	0.582													18	59	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22861915	22861915	+	Silent	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22861915G>C	uc001yur.3	+	14	2065	c.1935G>C	c.(1933-1935)CTG>CTC	p.L645L	TUBGCP5_uc001yuq.2_Silent_p.L645L|TUBGCP5_uc010axz.1_Silent_p.L232L	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	645					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ATGATCCACTGCTTGCCATTA	0.433													25	76	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34130138	34130138	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34130138C>A	uc001zhi.2	+	89	12027	c.11957C>A	c.(11956-11958)CCA>CAA	p.P3986Q	RYR3_uc010bar.2_Missense_Mutation_p.P3981Q	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3986					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTCCATGAGCCAGCCAAGGAC	0.453													19	87	---	---	---	---	PASS
PGBD4	161779	broad.mit.edu	37	15	34396022	34396022	+	Silent	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34396022A>T	uc001zho.2	+	1	1749	c.1290A>T	c.(1288-1290)GCA>GCT	p.A430A	C15orf24_uc001zhm.2_5'Flank|C15orf24_uc001zhn.2_5'Flank	NM_152595	NP_689808	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	430											0		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		ATATGGGAGCAGTGGACTCGG	0.378													9	54	---	---	---	---	PASS
ZNF770	54989	broad.mit.edu	37	15	35275459	35275459	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35275459C>T	uc001ziw.2	-	3	488	c.177G>A	c.(175-177)GTG>GTA	p.V59V		NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	59	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TTTTATGACACACATCACATT	0.343													9	70	---	---	---	---	PASS
CASC4	113201	broad.mit.edu	37	15	44673094	44673094	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44673094A>G	uc001zto.1	+	8	1291	c.992A>G	c.(991-993)GAC>GGC	p.D331G	CASC4_uc001ztp.2_Missense_Mutation_p.D331G|CASC4_uc001ztq.2_Missense_Mutation_p.D331G	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a	331	Lumenal (Potential).					integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		TCAAACTTGGACAGTGAACCC	0.398													16	41	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50904864	50904864	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50904864C>A	uc001zyt.3	-	16	2197	c.1933G>T	c.(1933-1935)GGT>TGT	p.G645C	TRPM7_uc010bew.1_Missense_Mutation_p.G645C|TRPM7_uc001zyu.2_Missense_Mutation_p.G203C	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	645	Cytoplasmic (Potential).				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GATTCTTCACCATGTTGCCAT	0.413													24	86	---	---	---	---	PASS
SCG3	29106	broad.mit.edu	37	15	52005588	52005588	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52005588T>C	uc002abh.2	+	11	1674	c.1266T>C	c.(1264-1266)CAT>CAC	p.H422H	SCG3_uc010ufz.1_Silent_p.H190H	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor	422					platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)		TGAAGAAACATGACAAAAAGG	0.368													13	63	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62315669	62315669	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62315669G>C	uc002agz.2	-	8	639	c.565C>G	c.(565-567)CAA>GAA	p.Q189E	VPS13C_uc002aha.2_Missense_Mutation_p.Q146E|VPS13C_uc002ahb.1_Missense_Mutation_p.Q189E|VPS13C_uc002ahc.1_Missense_Mutation_p.Q146E	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	189					protein localization					ovary(2)	2						TTTATTACTTGAGTTGCCAAT	0.234													4	17	---	---	---	---	PASS
IQCH	64799	broad.mit.edu	37	15	67786640	67786640	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67786640G>A	uc002aqo.1	+	20	2953	c.2906G>A	c.(2905-2907)CGC>CAC	p.R969H	IQCH_uc002aqq.1_Missense_Mutation_p.R626H|IQCH_uc002aqp.1_Silent_p.S609S|uc002aqr.1_Intron	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	969										skin(3)|ovary(1)	4				Colorectal(3;0.0856)		ACCTTTGCTCGCCATCTCTTC	0.403													5	22	---	---	---	---	PASS
NEO1	4756	broad.mit.edu	37	15	73581536	73581536	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73581536G>A	uc002avm.3	+	25	3841	c.3699G>A	c.(3697-3699)ATG>ATA	p.M1233I	NEO1_uc010ukx.1_Missense_Mutation_p.M1222I|NEO1_uc010uky.1_Missense_Mutation_p.M1233I|NEO1_uc010ukz.1_Missense_Mutation_p.M646I|NEO1_uc002avn.3_Missense_Mutation_p.M871I	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor	1233	Cytoplasmic (Potential).				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						GGCGAGGAATGAGACCAAAAA	0.498													4	24	---	---	---	---	PASS
SNX33	257364	broad.mit.edu	37	15	75942733	75942733	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75942733G>T	uc002bau.2	+	1	1386	c.1290G>T	c.(1288-1290)ATG>ATT	p.M430I	IMP3_uc002bat.2_5'Flank|SNX33_uc002bav.2_Intron	NM_153271	NP_695003	Q8WV41	SNX33_HUMAN	sorting nexin 33	430	BAR.				cell communication		phosphatidylinositol binding|protein binding			ovary(1)	1						CCTTCCAGATGGACCCCCCCT	0.567													28	65	---	---	---	---	PASS
CHRNB4	1143	broad.mit.edu	37	15	78921980	78921980	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78921980T>A	uc002bed.1	-	5	779	c.667A>T	c.(667-669)ACT>TCT	p.T223S	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.T41S	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	223	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						AAGTCGTAAGTCACGTCCACG	0.552													15	65	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79298629	79298629	+	Silent	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79298629G>C	uc002beq.2	-	15	2388	c.2013C>G	c.(2011-2013)CTC>CTG	p.L671L	RASGRF1_uc002bep.2_Silent_p.L658L|RASGRF1_uc010blm.1_Silent_p.L580L|RASGRF1_uc002ber.3_Silent_p.L658L|RASGRF1_uc010unh.1_Silent_p.L66L	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	671	N-terminal Ras-GEF.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GGAAGGTGTTGAGGAAGTCGA	0.567													10	62	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2813737	2813737	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2813737G>C	uc002crk.2	+	11	3757	c.3208G>C	c.(3208-3210)GAT>CAT	p.D1070H	SRRM2_uc002crj.1_Missense_Mutation_p.D974H|SRRM2_uc002crl.1_Missense_Mutation_p.D1070H|SRRM2_uc010bsu.1_Missense_Mutation_p.D974H	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1070	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CCACAGATCTGATACTTCAAG	0.463													18	81	---	---	---	---	PASS
RSL1D1	26156	broad.mit.edu	37	16	11933713	11933713	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11933713T>C	uc002dbp.1	-	8	1058	c.985A>G	c.(985-987)ACA>GCA	p.T329A	RSL1D1_uc010buv.1_Missense_Mutation_p.T328A|RSL1D1_uc010uyw.1_Missense_Mutation_p.T109A|RSL1D1_uc010buw.2_RNA	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	329					regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TTCTTCACTGTAGTATCACCA	0.323													34	163	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15841519	15841519	+	Silent	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15841519G>C	uc002ddy.2	-	19	2426	c.2319C>G	c.(2317-2319)GGC>GGG	p.G773G	MYH11_uc002ddv.2_Silent_p.G780G|MYH11_uc002ddw.2_Silent_p.G773G|MYH11_uc002ddx.2_Silent_p.G780G|MYH11_uc010bvg.2_Silent_p.G605G	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	773	Actin-binding (By similarity).|Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						GGGCCAGGACGCCAGTTCGGA	0.502			T	CBFB	AML								15	57	---	---	---	---	PASS
RBBP6	5930	broad.mit.edu	37	16	24582460	24582460	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24582460A>G	uc002dmh.2	+	18	5113	c.4073A>G	c.(4072-4074)AAT>AGT	p.N1358S	RBBP6_uc002dmi.2_Missense_Mutation_p.N1324S|RBBP6_uc010bxr.2_Missense_Mutation_p.N518S|RBBP6_uc002dmk.2_Missense_Mutation_p.N1191S	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1358					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		AAGCCATCAAATATAGTCAAG	0.358													16	33	---	---	---	---	PASS
NSMCE1	197370	broad.mit.edu	37	16	27238086	27238086	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27238086G>A	uc002doi.1	-	6	653	c.555C>T	c.(553-555)CCC>CCT	p.P185P	NSMCE1_uc002doj.1_RNA	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog	185					DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						TCACCGCGTCGGGGTACGTCT	0.647													13	67	---	---	---	---	PASS
TAOK2	9344	broad.mit.edu	37	16	29998067	29998067	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29998067G>T	uc002dva.1	+	16	3257	c.2474G>T	c.(2473-2475)AGT>ATT	p.S825I	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Intron|TAOK2_uc002dvc.1_Intron|TAOK2_uc010bzm.1_Missense_Mutation_p.S832I|TAOK2_uc002dvd.1_Missense_Mutation_p.S652I	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	825	Glu-rich.				actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						GGAGCCCCTAGTCCCAGTCCA	0.562													11	55	---	---	---	---	PASS
HIRIP3	8479	broad.mit.edu	37	16	30006746	30006746	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30006746G>C	uc002dve.2	-	2	565	c.104C>G	c.(103-105)GCT>GGT	p.A35G	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|INO80E_uc002dvg.1_5'Flank|INO80E_uc002dvh.1_5'Flank|INO80E_uc002dvi.1_5'Flank|INO80E_uc002dvj.1_5'Flank|INO80E_uc002dvk.1_5'Flank|HIRIP3_uc002dvf.2_Missense_Mutation_p.A35G	NM_003609	NP_003600	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	35					chromatin assembly or disassembly	nucleus	protein binding			central_nervous_system(1)	1						GCCCGAGTGAGCTAAGTACCT	0.662													12	36	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30970167	30970167	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30970167G>A	uc002ead.1	+	2	801	c.115G>A	c.(115-117)GTG>ATG	p.V39M	SETD1A_uc002eae.1_Missense_Mutation_p.V39M	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	39					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						TTCTCAGAAGGTGTACCGCTA	0.607													8	85	---	---	---	---	PASS
C16orf78	123970	broad.mit.edu	37	16	49430325	49430325	+	Intron	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49430325C>T	uc002efr.2	+							NM_144602	NP_653203	Q8WTQ4	CP078_HUMAN	hypothetical protein LOC123970											central_nervous_system(1)	1						GGCATCTGTCCAATTTCAGAT	0.517													6	22	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56902279	56902279	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56902279G>T	uc010ccm.2	+	3	529	c.500G>T	c.(499-501)GGC>GTC	p.G167V	SLC12A3_uc002ekd.3_Missense_Mutation_p.G167V|SLC12A3_uc010ccn.2_Missense_Mutation_p.G166V	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	167	Helical; (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GCCCAGGCAGGCATCGGTGAG	0.607													5	5	---	---	---	---	PASS
KIAA0513	9764	broad.mit.edu	37	16	85100812	85100812	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85100812T>G	uc002fiu.2	+	2	355	c.135T>G	c.(133-135)AGT>AGG	p.S45R	KIAA0513_uc002fis.3_Missense_Mutation_p.S45R|KIAA0513_uc010voj.1_Missense_Mutation_p.S45R|KIAA0513_uc002fit.2_Missense_Mutation_p.S45R	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764	45						cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		CATCAGAGAGTGAGACCACTG	0.642													9	14	---	---	---	---	PASS
YWHAE	7531	broad.mit.edu	37	17	1265201	1265201	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1265201A>G	uc002fsj.2	-	3	518	c.366T>C	c.(364-366)TAT>TAC	p.Y122Y	YWHAE_uc002fsk.2_Silent_p.Y100Y|YWHAE_uc010vqh.1_Intron|YWHAE_uc010vqi.1_Intron	NM_006761	NP_006752	P62258	1433E_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase	122					apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding			lung(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		CCTACATTTTATAATAGAAAA	0.353													9	23	---	---	---	---	PASS
DHX33	56919	broad.mit.edu	37	17	5357289	5357289	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5357289C>G	uc002gca.2	-	7	1161	c.1159G>C	c.(1159-1161)GAG>CAG	p.E387Q	DHX33_uc002gbz.2_Missense_Mutation_p.E158Q|DHX33_uc002gcb.2_Missense_Mutation_p.E214Q|DHX33_uc010clf.2_Missense_Mutation_p.E163Q	NM_020162	NP_064547	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	387	Helicase C-terminal.					nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|pancreas(1)	2						GCTAACACCTCAAGACCACTG	0.532													6	23	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	A	A	rs121913344		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577022G>A	uc002gim.2	-	8	1110	c.916C>T	c.(916-918)CGA>TGA	p.R306*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.R306*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R174*|TP53_uc010cng.1_Nonsense_Mutation_p.R174*|TP53_uc002gii.1_Nonsense_Mutation_p.R174*|TP53_uc010cnh.1_Nonsense_Mutation_p.R306*|TP53_uc010cni.1_Nonsense_Mutation_p.R306*|TP53_uc002gij.2_Nonsense_Mutation_p.R306*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	306	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		R -> Q (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R306*(99)|p.0?(7)|p.?(3)|p.R306R(2)|p.R306fs*39(2)|p.K305fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGCTTACCTCGCTTAGTGCTC	0.562	R306*(MFE296_ENDOMETRIUM)|R306*(HCC1937_BREAST)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			14	51	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10318686	10318686	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10318686G>T	uc002gmm.2	-	8	759	c.664C>A	c.(664-666)CAA>AAA	p.Q222K	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	222	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						CTGATGATTTGATCTTCCAGA	0.512									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				17	66	---	---	---	---	PASS
ANKRD13B	124930	broad.mit.edu	37	17	27934886	27934886	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27934886G>A	uc002hei.2	+	2	354	c.241G>A	c.(241-243)GGC>AGC	p.G81S	ANKRD13B_uc002heh.2_5'UTR|ANKRD13B_uc002hej.2_RNA	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	81	ANK 2.										0						GAATCGCAGCGGCTGGACAGG	0.692													7	29	---	---	---	---	PASS
ITGB3	3690	broad.mit.edu	37	17	45368430	45368430	+	Silent	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45368430T>C	uc002ilj.2	+	9	1256	c.1236T>C	c.(1234-1236)TGT>TGC	p.C412C	ITGB3_uc002ili.1_Silent_p.C412C|ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	412	Extracellular (Potential).				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	TCAAGTCTTGTATGGGACTCA	0.537													11	81	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901477	51901477	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901477G>A	uc002iua.2	+	1	1239	c.1083G>A	c.(1081-1083)GGG>GGA	p.G361G	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	361	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						AGATTTATGGGGGCAAGGTGT	0.463													9	72	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58262956	58262956	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58262956G>C	uc002iyo.1	-	30	3985	c.3699C>G	c.(3697-3699)ATC>ATG	p.I1233M	USP32_uc002iyn.1_Missense_Mutation_p.I903M	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	1233					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TGTCCAGGTTGATGGGCTCGG	0.542													14	42	---	---	---	---	PASS
TTYH2	94015	broad.mit.edu	37	17	72218788	72218788	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72218788C>T	uc002jkc.2	+	2	325	c.294C>T	c.(292-294)CTC>CTT	p.L98L	TTYH2_uc010wqw.1_Silent_p.L77L	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1	98	Helical; Name=2; (Potential).					chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						TGGCCGGGCTCATCTGCTGGT	0.632													9	29	---	---	---	---	PASS
MEX3C	51320	broad.mit.edu	37	18	48702952	48702952	+	Silent	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48702952A>G	uc002lfc.3	-	2	1749	c.1749T>C	c.(1747-1749)GGT>GGC	p.G583G		NM_016626	NP_057710	Q5U5Q3	MEX3C_HUMAN	ring finger and KH domain containing 2	583						cytoplasm|nucleus	RNA binding|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		AACTATTGGTACCATTAGAAA	0.463													7	55	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	49867237	49867237	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49867237T>G	uc002lfe.1	+	1	667	c.80T>G	c.(79-81)CTT>CGT	p.L27R		NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	27	Extracellular (Potential).|Ig-like C2-type 1.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGCGCGCATCTTCAAGTAACC	0.493													18	77	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50985708	50985708	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50985708A>G	uc002lfe.1	+	24	4086	c.3499A>G	c.(3499-3501)AAG>GAG	p.K1167E	DCC_uc010dpf.1_Missense_Mutation_p.K802E	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	1167	Cytoplasmic (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AAATATTGAAAAGCCATCTGG	0.532													25	72	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56247322	56247322	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56247322C>A	uc002lhj.3	-	4	900	c.686G>T	c.(685-687)AGA>ATA	p.R229I		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	229							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						GTGGCAACATCTGTCTTGTTT	0.413													49	158	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64178906	64178906	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64178906C>G	uc002lkc.1	-	10	1613	c.1475G>C	c.(1474-1476)AGT>ACT	p.S492T	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Intron	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	492	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				ATCCACTGCACTGATAGTCTG	0.313													14	95	---	---	---	---	PASS
GALR1	2587	broad.mit.edu	37	18	74980688	74980688	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74980688A>T	uc002lms.3	+	3	1377	c.880A>T	c.(880-882)AGC>TGC	p.S294C		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	294	Cytoplasmic (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCTGGCGTACAGCAATTCCTC	0.488													22	75	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8130934	8130934	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8130934G>A	uc002mjf.2	-	63	8320	c.8299C>T	c.(8299-8301)CGG>TGG	p.R2767W	FBN3_uc002mje.2_Missense_Mutation_p.R563W	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2767						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GGCCCCGGCCGCCTCCGCCCC	0.682													5	80	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8203327	8203327	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8203327C>T	uc002mjf.2	-	8	1008	c.987G>A	c.(985-987)CCG>CCA	p.P329P		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	329	TB 2.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCTCAGGGACCGGGCCAGCTG	0.682													4	24	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9010965	9010965	+	Intron	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9010965A>G	uc002mkp.2	-						MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGAGTTGAATACTCACTGCTG	0.517													8	56	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9074309	9074309	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9074309C>A	uc002mkp.2	-	3	13341	c.13137G>T	c.(13135-13137)ATG>ATT	p.M4379I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4381	Thr-rich.|Extracellular (Potential).|Ser-rich.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AAGATTCTGTCATTATCAGAG	0.468													4	79	---	---	---	---	PASS
PLVAP	83483	broad.mit.edu	37	19	17476301	17476301	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17476301C>T	uc002ngk.1	-	3	1023	c.973G>A	c.(973-975)GTG>ATG	p.V325M		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	325	Potential.|Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0						TCCTTCTCCACCTTCTGTTTC	0.657													9	45	---	---	---	---	PASS
B3GNT3	10331	broad.mit.edu	37	19	17918984	17918984	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17918984G>A	uc002nhk.1	+	2	453	c.368G>A	c.(367-369)CGC>CAC	p.R123H	B3GNT3_uc002nhl.1_Missense_Mutation_p.R123H|B3GNT3_uc010ebd.1_Missense_Mutation_p.R123H|B3GNT3_uc010ebe.1_Missense_Mutation_p.R123H	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal	123	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						TATGTGCGCCGCGAGCTGCTG	0.682													6	20	---	---	---	---	PASS
UPF1	5976	broad.mit.edu	37	19	18964165	18964165	+	Intron	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18964165C>A	uc002nkg.2	+						UPF1_uc002nkf.2_Intron	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1						cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TGATAGTATCCTTCATGTGAA	0.592													3	25	---	---	---	---	PASS
GMIP	51291	broad.mit.edu	37	19	19746283	19746283	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19746283C>A	uc002nnd.2	-	15	1618	c.1501G>T	c.(1501-1503)GGC>TGC	p.G501C	GMIP_uc010xrb.1_Missense_Mutation_p.G475C|GMIP_uc010xrc.1_Missense_Mutation_p.G472C	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	501	Phorbol-ester/DAG-type.				negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						TTGGCTGGGCCCCGCAGTCGC	0.647													10	40	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363818	22363818	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363818A>T	uc002nqs.1	-	3	1019	c.701T>A	c.(700-702)TTT>TAT	p.F234Y		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	234	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GGATCGATTAAAAGCTTTGCC	0.368													20	118	---	---	---	---	PASS
ZNF235	9310	broad.mit.edu	37	19	44792469	44792469	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44792469C>G	uc002oza.3	-	5	1222	c.1119G>C	c.(1117-1119)AAG>AAC	p.K373N	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.K369N|ZNF235_uc010xwx.1_Missense_Mutation_p.K287N	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog	373					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)				ATCTATAGGGCTTCTCTCCTG	0.448													13	48	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47422517	47422517	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47422517A>G	uc010ekv.2	+	1	585	c.585A>G	c.(583-585)ATA>ATG	p.I195M		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	195					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		AAAAGCCCATAGTGGTGGTCC	0.433													15	41	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49813646	49813646	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49813646G>A	uc002pmz.2	-	3	771	c.537C>T	c.(535-537)GCC>GCT	p.A179A	SLC6A16_uc002pna.2_Silent_p.A179A|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	179	Helical; Name=2; (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CAATCCAGGGGGCAATGATCT	0.577													4	21	---	---	---	---	PASS
KLK2	3817	broad.mit.edu	37	19	51379830	51379830	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51379830G>C	uc002ptv.2	+	3	350	c.309G>C	c.(307-309)ATG>ATC	p.M103I	KLK2_uc010eog.2_Missense_Mutation_p.M1I|KLK2_uc010yck.1_Missense_Mutation_p.M103I|KLK2_uc002ptu.2_Missense_Mutation_p.M103I|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_Missense_Mutation_p.M86I|KLK2_uc010ycm.1_Missense_Mutation_p.M1I|KLK2_uc010eoh.2_Missense_Mutation_p.M1I	NM_005551	NP_005542	P20151	KLK2_HUMAN	kallikrein 2, prostatic isoform 1	103	Peptidase S1.				proteolysis		serine-type endopeptidase activity			ovary(1)|skin(1)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		TCTACAATATGAGCCTTCTGA	0.552			T	ETV4	prostate								14	34	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51920564	51920564	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51920564T>A	uc002pwo.2	-	2	809	c.193A>T	c.(193-195)ACT>TCT	p.T65S	SIGLEC10_uc002pwp.2_Missense_Mutation_p.T65S|SIGLEC10_uc002pwq.2_Missense_Mutation_p.T65S|SIGLEC10_uc002pwr.2_Missense_Mutation_p.T65S|SIGLEC10_uc010ycy.1_Missense_Mutation_p.T65S|SIGLEC10_uc010ycz.1_Missense_Mutation_p.T65S|SIGLEC10_uc010eow.2_Intron|SIGLEC10_uc002pws.1_Missense_Mutation_p.T49S	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	65	Extracellular (Potential).|Ig-like V-type.				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GTTGTCTCAGTCACTGCTTTG	0.602													12	43	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51958760	51958760	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51958760C>T	uc002pwt.2	-	4	1030	c.963G>A	c.(961-963)AGG>AGA	p.R321R	SIGLEC8_uc010yda.1_Silent_p.R212R|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Silent_p.R228R	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	321	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCCCTTCATCCCTCACGTGCA	0.642													9	44	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52941413	52941413	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52941413C>G	uc002pzk.2	+	4	800	c.739C>G	c.(739-741)CGA>GGA	p.R247G	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.R234G	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	247	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACAACATCAACGAATCCATAC	0.373													13	49	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53612105	53612105	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53612105C>A	uc002qax.2	-	7	1686	c.1337G>T	c.(1336-1338)AGC>ATC	p.S446I	ZNF415_uc002qat.2_Missense_Mutation_p.S410I|ZNF415_uc002qaw.2_Missense_Mutation_p.S398I|ZNF415_uc010yds.1_Missense_Mutation_p.S398I|ZNF415_uc010ydt.1_Missense_Mutation_p.S398I|ZNF415_uc002qau.2_Missense_Mutation_p.S385I|ZNF415_uc002qav.2_Missense_Mutation_p.S410I|ZNF415_uc002qba.2_Missense_Mutation_p.S168I|ZNF415_uc002qay.2_Missense_Mutation_p.S385I|ZNF415_uc002qaz.2_Missense_Mutation_p.S446I	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;	446	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		CCTTGCAAGGCTTGAAGTCTG	0.418													16	53	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55086951	55086951	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55086951G>T	uc002qgg.3	+	5	973	c.884G>T	c.(883-885)TGC>TTC	p.C295F	LILRA2_uc010ern.2_Missense_Mutation_p.C295F|LILRA2_uc002qgf.2_Missense_Mutation_p.C295F|LILRA2_uc010yfe.1_Missense_Mutation_p.C295F|LILRA2_uc010yff.1_Missense_Mutation_p.C283F|LILRA2_uc010ero.2_Missense_Mutation_p.C283F|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	295	Ig-like C2-type 3.|Extracellular (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		CAGTACAGATGCTACAGTGCA	0.667													26	49	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57642610	57642610	+	Missense_Mutation	SNP	A	G	G	rs117302403	byFrequency	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57642610A>G	uc002qny.2	+	4	2923	c.2567A>G	c.(2566-2568)TAC>TGC	p.Y856C		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	856					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGGTTCACATACAACGATCTA	0.448													5	41	---	---	---	---	PASS
C20orf46	55321	broad.mit.edu	37	20	1161626	1161626	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1161626C>T	uc010gaa.1	-	3	856	c.637G>A	c.(637-639)GGC>AGC	p.G213S	C20orf46_uc002weq.1_Missense_Mutation_p.G213S	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN	hypothetical protein LOC55321	213						integral to membrane	protein binding			ovary(1)	1						GAGCCCTTGCCGGGGACGAAG	0.637													12	53	---	---	---	---	PASS
ATRN	8455	broad.mit.edu	37	20	3515969	3515969	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3515969G>T	uc002wim.2	+	2	570	c.480G>T	c.(478-480)TGG>TGT	p.W160C	ATRN_uc002wil.2_Missense_Mutation_p.W160C	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	160	Extracellular (Potential).|CUB.				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						AGTGCACGTGGCTCATTGAAG	0.333													7	26	---	---	---	---	PASS
PRNP	5621	broad.mit.edu	37	20	4680300	4680300	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4680300A>G	uc002wku.2	+	2	797	c.434A>G	c.(433-435)TAT>TGT	p.Y145C	PRNP_uc002wkv.2_Missense_Mutation_p.Y145C|PRNP_uc002wkw.2_Missense_Mutation_p.Y145C|PRNP_uc002wkx.2_Missense_Mutation_p.Y145C|PRNP_uc002wkt.1_Missense_Mutation_p.Y115C|PRNP_uc002wky.2_Missense_Mutation_p.Y145C|PRNP_uc010gbe.1_Missense_Mutation_p.Y145C	NM_001080122	NP_001073591	P04156	PRIO_HUMAN	prion protein preproprotein	145	Interaction with GRB2, ERI3 and SYN1 (By similarity).				axon guidance|cell cycle arrest|cellular copper ion homeostasis|metabolic process|negative regulation of activated T cell proliferation|negative regulation of calcineurin-NFAT signaling pathway|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-2 production|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell receptor signaling pathway|protein homooligomerization|response to oxidative stress	anchored to membrane|endoplasmic reticulum|extrinsic to membrane|Golgi apparatus|membrane raft|nucleus|plasma membrane	copper ion binding|identical protein binding|microtubule binding			central_nervous_system(1)	1					Tetracycline(DB00759)	GGCAGTGACTATGAGGACCGT	0.552													7	27	---	---	---	---	PASS
TMX4	56255	broad.mit.edu	37	20	7963097	7963097	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7963097T>A	uc002wmx.1	-	8	984	c.851A>T	c.(850-852)AAC>ATC	p.N284I		NM_021156	NP_066979	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	284	Glu-rich.				cell redox homeostasis|electron transport chain|transport	integral to membrane					0						AGCAGCCAAGTTGtcctcctc	0.313													16	64	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20232288	20232288	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20232288G>A	uc002wru.2	+	20	2285	c.2209G>A	c.(2209-2211)GTT>ATT	p.V737I	C20orf26_uc010zse.1_Missense_Mutation_p.V717I|C20orf26_uc002wrw.2_RNA|C20orf26_uc002wrv.2_Missense_Mutation_p.V93I	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	737										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		GTGCTCCTGGGTTAATGTCGT	0.522													25	109	---	---	---	---	PASS
GGTLC1	92086	broad.mit.edu	37	20	23966372	23966372	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23966372C>T	uc002wts.2	-	5	596	c.463G>A	c.(463-465)GTG>ATG	p.V155M	GGTLC1_uc002wtu.2_Missense_Mutation_p.V155M	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	155							gamma-glutamyltransferase activity			ovary(1)	1						GGCTCCTCCACGGCCCACTTC	0.612													14	84	---	---	---	---	PASS
STK4	6789	broad.mit.edu	37	20	43623803	43623803	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43623803G>T	uc002xnb.2	+	6	688	c.598G>T	c.(598-600)GGA>TGA	p.G200*	STK4_uc010ggx.2_Nonsense_Mutation_p.G200*|STK4_uc010ggy.2_Nonsense_Mutation_p.G145*|STK4_uc010ggw.1_Nonsense_Mutation_p.G200*	NM_006282	NP_006273	Q13043	STK4_HUMAN	serine/threonine kinase 4	200	Protein kinase.				apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				TCAGGAAATTGGATACAACTG	0.453													14	68	---	---	---	---	PASS
APCDD1L	164284	broad.mit.edu	37	20	57042222	57042222	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57042222G>T	uc002xze.1	-	3	867	c.681C>A	c.(679-681)GAC>GAA	p.D227E	APCDD1L_uc010zzp.1_Missense_Mutation_p.D238E	NM_153360	NP_699191	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated	227						integral to membrane				ovary(1)	1	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			TCTCCGCCGGGTCGGTGTGGA	0.731													3	22	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57828032	57828032	+	Splice_Site	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57828032G>T	uc002yan.2	+	4	4028	c.4028_splice	c.e4-1	p.G1343_splice		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831							intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TCCCCTTGCAGGTCTGAATCT	0.463													11	23	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58342370	58342370	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58342370C>T	uc002yau.2	+	5	1138	c.671C>T	c.(670-672)TCC>TTC	p.S224F	PHACTR3_uc002yat.2_Missense_Mutation_p.S221F|PHACTR3_uc010zzw.1_Missense_Mutation_p.S183F|PHACTR3_uc002yav.2_Missense_Mutation_p.S183F|PHACTR3_uc002yaw.2_Missense_Mutation_p.S183F|PHACTR3_uc002yax.2_Intron	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	224	Pro-rich.					nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CTGGAGAGATCCGTGGGCCAG	0.622													9	30	---	---	---	---	PASS
NTSR1	4923	broad.mit.edu	37	20	61340778	61340778	+	Silent	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61340778C>T	uc002ydf.2	+	1	590	c.219C>T	c.(217-219)CTC>CTT	p.L73L		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	73	Helical; Name=1; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			ACCTGGCGCTCTTCGTGGTGG	0.662													4	20	---	---	---	---	PASS
MYT1	4661	broad.mit.edu	37	20	62851172	62851172	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62851172C>G	uc002yii.2	+	13	2442	c.2078C>G	c.(2077-2079)CCC>CGC	p.P693R	MYT1_uc002yih.2_Missense_Mutation_p.P395R|MYT1_uc002yij.2_Missense_Mutation_p.P352R	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	693	Ser-rich.				cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					agcagcagcCCCGGTGTGAAG	0.537													4	22	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22652925	22652925	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22652925G>C	uc002yld.1	+	2	332	c.83G>C	c.(82-84)AGC>ACC	p.S28T	NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Missense_Mutation_p.S53T	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	28	Ig-like C2-type 1.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		ATTTCACTTAGCAAAGTAGAG	0.308													7	22	---	---	---	---	PASS
KRTAP6-3	337968	broad.mit.edu	37	21	31964914	31964914	+	Silent	SNP	C	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31964914C>G	uc002yom.2	+	1	156	c.150C>G	c.(148-150)GGC>GGG	p.G50G		NM_181605	NP_853636			keratin associated protein 6-3												0						tgggctttggctatggaggcc	0.050													6	18	---	---	---	---	PASS
C21orf62	56245	broad.mit.edu	37	21	34165977	34165977	+	3'UTR	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34165977G>T	uc010glz.2	-	4					C21orf49_uc002yqs.2_Intron|C21orf49_uc002yqu.3_Intron|C21orf49_uc002yqt.2_Intron|C21orf62_uc011adt.1_3'UTR|C21orf62_uc011adu.1_3'UTR	NM_001162495	NP_001155967	Q9NYP8	CU062_HUMAN	hypothetical protein LOC56245											ovary(1)	1		Myeloproliferative disorder(46;0.0255)				CACAGTTGTGGGTAGGGATAC	0.473													5	27	---	---	---	---	PASS
SH3BGR	6450	broad.mit.edu	37	21	40824044	40824044	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40824044G>T	uc002yya.2	+	1	265	c.211G>T	c.(211-213)GCT>TCT	p.A71S	SH3BGR_uc002yxz.2_Intron	NM_007341	NP_031367	P55822	SH3BG_HUMAN	SH3-binding domain and glutamic acid-rich	71					protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		AGTGTTTGTTGCTACATCTTC	0.483													41	146	---	---	---	---	PASS
KRTAP10-8	386681	broad.mit.edu	37	21	46032517	46032517	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46032517T>C	uc002zfo.1	+	1	522	c.500T>C	c.(499-501)GTG>GCG	p.V167A	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	167	19 X 5 AA repeats of C-C-X(3).|11.					keratin filament				large_intestine(1)|breast(1)	2						GCCTGCTGTGTGCCCATCTGC	0.617													44	183	---	---	---	---	PASS
KRTAP10-8	386681	broad.mit.edu	37	21	46032668	46032668	+	Missense_Mutation	SNP	C	G	G	rs139387695		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46032668C>G	uc002zfo.1	+	1	673	c.651C>G	c.(649-651)TGC>TGG	p.C217W	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	217	19 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)|breast(1)	2						gccctgtgtgccggcctgcct	0.274													15	56	---	---	---	---	PASS
LSS	4047	broad.mit.edu	37	21	47647612	47647612	+	Intron	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47647612G>C	uc002zij.2	-						LSS_uc011afv.1_Intron|LSS_uc002zil.2_Intron|LSS_uc002zik.2_Intron|MCM3APAS_uc002zim.2_5'Flank|MCM3APAS_uc002zin.2_5'Flank	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1						cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					CTTCTGCAAAGAGATCGAAAA	0.478													7	53	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17468980	17468980	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17468980G>T	uc002zlw.2	-	3	664	c.556C>A	c.(556-558)CTC>ATC	p.L186I	GAB4_uc010gqs.1_Missense_Mutation_p.L169I	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	186										large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TCTTGGGGGAGGTGCTGATGG	0.612													7	17	---	---	---	---	PASS
CECR5	27440	broad.mit.edu	37	22	17619472	17619472	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17619472C>A	uc002zmf.2	-	7	931	c.903G>T	c.(901-903)TGG>TGT	p.W301C	CECR5_uc002zmd.2_Missense_Mutation_p.W112C|CECR5_uc002zme.2_Missense_Mutation_p.W93C|CECR5_uc002zmg.2_Intron|CECR5_uc002zmh.2_Missense_Mutation_p.W271C	NM_033070	NP_149061	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	301							hydrolase activity				0		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				TGGGGGCGGCCCAGCCCCGCC	0.602													28	121	---	---	---	---	PASS
TXNRD2	10587	broad.mit.edu	37	22	19865642	19865642	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19865642T>G	uc011ahc.1	-	16	1449	c.1416A>C	c.(1414-1416)GAA>GAC	p.E472D	TXNRD2_uc002zql.1_Missense_Mutation_p.E226D|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Missense_Mutation_p.E471D|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Missense_Mutation_p.E122D	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	472					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					CTTGAGTAACTTCGCCTGCGT	0.602													8	20	---	---	---	---	PASS
ZNF280A	129025	broad.mit.edu	37	22	22869016	22869016	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22869016C>A	uc002zwe.2	-	2	1192	c.939G>T	c.(937-939)ATG>ATT	p.M313I	LOC96610_uc011aim.1_Intron	NM_080740	NP_542778	P59817	Z280A_HUMAN	zinc finger protein 280A	313					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TCATGTGATTCATAAACTTAA	0.473													20	89	---	---	---	---	PASS
HPS4	89781	broad.mit.edu	37	22	26860679	26860679	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26860679C>A	uc003acl.2	-	11	1576	c.917G>T	c.(916-918)TGG>TTG	p.W306L	HPS4_uc003aci.2_Missense_Mutation_p.W301L|HPS4_uc003acj.2_Missense_Mutation_p.W170L|HPS4_uc003ack.2_Missense_Mutation_p.W97L|HPS4_uc003acn.2_Missense_Mutation_p.W152L|HPS4_uc010gvd.1_Missense_Mutation_p.W324L|HPS4_uc003ach.2_Missense_Mutation_p.W41L	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a	306					lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						TGGGGTGGTCCAGGCCATGGA	0.587									Hermansky-Pudlak_syndrome				3	43	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28196401	28196401	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28196401G>C	uc003adj.2	-	1	1086	c.131C>G	c.(130-132)CCC>CGC	p.P44R		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	44							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						AGGGCCAGGGGGCCCCCCAGT	0.642			T	ETV6	AML|meningioma								8	71	---	---	---	---	PASS
SLC5A4	6527	broad.mit.edu	37	22	32625228	32625228	+	Silent	SNP	G	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32625228G>A	uc003ami.2	-	11	1235	c.1233C>T	c.(1231-1233)ACC>ACT	p.T411T		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	411	Extracellular (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						TCCGCATCTTGGTGTAGAGGT	0.552													25	68	---	---	---	---	PASS
SREBF2	6721	broad.mit.edu	37	22	42262852	42262852	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42262852A>G	uc003bbi.2	+	2	275	c.106A>G	c.(106-108)AGT>GGT	p.S36G	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	36	Transcriptional activation (acidic).|Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4						GCAATTTGTCAGTAATCAAGT	0.348													29	137	---	---	---	---	PASS
TLR7	51284	broad.mit.edu	37	X	12905134	12905134	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12905134A>T	uc004cvc.2	+	3	1646	c.1507A>T	c.(1507-1509)AAT>TAT	p.N503Y		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	503	Extracellular (Potential).|LRR 16.				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	TCTAAGTAAAAATAGTATATT	0.368													38	74	---	---	---	---	PASS
CXorf23	256643	broad.mit.edu	37	X	19973694	19973694	+	Intron	SNP	T	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19973694T>A	uc004czp.2	-						CXorf23_uc010nfn.2_Intron|CXorf23_uc011mjg.1_Intron|CXorf23_uc004czo.2_Intron	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643							mitochondrion				lung(1)|skin(1)	2						CCTAGAATAATTTGCAAATGT	0.313													15	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26179633	26179633	+	IGR	SNP	G	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26179633G>C								MAGEB18 (20781 upstream) : MAGEB6 (30924 downstream)																							CACTGAAGAGGAGGTCTGGAA	0.498													36	41	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148709	34148709	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148709C>T	uc004ddg.2	-	1	1720	c.1687G>A	c.(1687-1689)GCT>ACT	p.A563T		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	563										ovary(4)|central_nervous_system(1)	5						GACTCTGGAGCTTTGGGAGGC	0.562													3	27	---	---	---	---	PASS
LPAR4	2846	broad.mit.edu	37	X	78011260	78011260	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78011260C>A	uc010nme.2	+	2	1299	c.894C>A	c.(892-894)TGC>TGA	p.C298*		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	298	Helical; Name=7; (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						TCACCTTGTGCCTTGCAACTC	0.423													20	29	---	---	---	---	PASS
DCX	1641	broad.mit.edu	37	X	110653548	110653548	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110653548G>T	uc004epd.2	-	2	494	c.322C>A	c.(322-324)CCT>ACT	p.P108T	DCX_uc011msv.1_Missense_Mutation_p.P108T|DCX_uc004epe.2_Missense_Mutation_p.P27T|DCX_uc004epf.2_Missense_Mutation_p.P27T|DCX_uc004epg.2_Missense_Mutation_p.P27T	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	108					axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						GTGGGGCTAGGCAACCCATTC	0.493													28	38	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111155954	111155954	+	Nonsense_Mutation	SNP	G	T	T	rs141725174		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111155954G>T	uc004epl.1	-	3	1384	c.465C>A	c.(463-465)TAC>TAA	p.Y155*	TRPC5_uc004epm.1_Nonsense_Mutation_p.Y155*	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	155	Cytoplasmic (Potential).|ANK 4.				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						TGATGATTTCGTAGTTGTTGG	0.507													11	19	---	---	---	---	PASS
PASD1	139135	broad.mit.edu	37	X	150844595	150844595	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150844595G>T	uc004fev.3	+	16	2634	c.2302G>T	c.(2302-2304)GAC>TAC	p.D768Y		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	768						nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGCAACGTGACTCAAATAA	0.567													15	20	---	---	---	---	PASS
LOC728855	728855	broad.mit.edu	37	1	149649078	149649079	+	Intron	INS	-	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149649078_149649079insA	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						AGAGAGCCTTCAAAACCTCTTA	0.426													13	8	---	---	---	---	
TRIM58	25893	broad.mit.edu	37	1	248031399	248031399	+	Intron	DEL	C	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248031399delC	uc001ido.2	+						OR2W3_uc001idp.1_Intron	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AATTAGGCTGCCTGGGGTTTG	0.502													2	5	---	---	---	---	
C2orf44	80304	broad.mit.edu	37	2	24253662	24253663	+	3'UTR	DEL	AG	-	-	rs137952507		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24253662_24253663delAG	uc002rep.2	-	4					C2orf44_uc010eya.2_3'UTR	NM_025203	NP_079479	Q9H6R7	CB044_HUMAN	hypothetical protein LOC80304 isoform 1								protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGGAAACAGGGGGAAACCA	0.525													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	44293372	44293373	+	IGR	INS	-	T	T	rs112109764	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44293372_44293373insT								LRPPRC (70228 upstream) : PPM1B (102627 downstream)																							TTTTGTTTTTGTTTTGTTTTTT	0.332													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131378845	131378846	+	IGR	INS	-	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131378845_131378846insT								LOC150527 (71374 upstream) : C2orf14 (58777 downstream)																							AGATAAGAGGGTTTTTTTTGGT	0.371													4	2	---	---	---	---	
SP100	6672	broad.mit.edu	37	2	231282534	231282535	+	Intron	INS	-	T	T	rs146449542	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231282534_231282535insT	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron|SP100_uc010zmb.1_Intron|SP100_uc002vqq.1_Intron|SP100_uc002vqr.1_Intron|SP100_uc010zmc.1_Intron|SP100_uc002vqv.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ggtgtttgtcctttttttcgtg	0.089													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	59192467	59192470	+	IGR	DEL	CTTC	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59192467_59192470delCTTC								C3orf67 (156709 upstream) : FHIT (542568 downstream)																							TATTTAGCCTcttccttccttcct	0.127													4	2	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69299441	69299442	+	Intron	INS	-	GTGT	GTGT	rs150662802	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69299441_69299442insGTGT	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_Intron|FRMD4B_uc011bga.1_5'Flank	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ACtgtgtgtgcgtgtgtgtgtg	0.376													4	2	---	---	---	---	
POLQ	10721	broad.mit.edu	37	3	121238522	121238523	+	Intron	INS	-	A	A	rs80321773		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121238522_121238523insA	uc003eee.3	-							NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		gactccgtctcaaaaaaaaaaa	0.099								DNA_polymerases_(catalytic_subunits)					9	4	---	---	---	---	
NCK1	4690	broad.mit.edu	37	3	136665184	136665185	+	Intron	INS	-	A	A			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136665184_136665185insA	uc003erh.2	+						NCK1_uc011bme.1_Intron	NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1						axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						CTGGGTattttaaaaaaaagag	0.183													31	15	---	---	---	---	
EIF2A	83939	broad.mit.edu	37	3	150280507	150280507	+	Intron	DEL	A	-	-	rs5853483		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150280507delA	uc003eya.2	+						SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Intron|EIF2A_uc003eyc.2_Intron|EIF2A_uc011bnv.1_Intron|EIF2A_uc011bnw.1_Intron|EIF2A_uc003eyd.2_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A						regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGTGGGGGGGAAAAAGTTATA	0.333													6	7	---	---	---	---	
SAMD7	344658	broad.mit.edu	37	3	169642737	169642738	+	Intron	INS	-	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169642737_169642738insT	uc003fgd.2	+						SAMD7_uc003fge.2_Intron|SAMD7_uc011bpo.1_Intron	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7											skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TTGCTGGTTTGTTTTTTTTTTT	0.317													12	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	63861794	63861797	+	IGR	DEL	GAAG	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63861794_63861797delGAAG								LPHN3 (923627 upstream) : None (None downstream)																							agggagagaagaaggaaggaagga	0.152													4	2	---	---	---	---	
FAM105B	90268	broad.mit.edu	37	5	14681342	14681343	+	Intron	INS	-	T	T	rs71603726		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14681342_14681343insT	uc003jfk.2	+							NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)					TTTTTCTTGCCTTTTTTTTTTT	0.337													3	3	---	---	---	---	
FAM172A	83989	broad.mit.edu	37	5	93386303	93386303	+	Intron	DEL	A	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93386303delA	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0						AAAAAGGAACAAAAAAAAAAA	0.214													9	5	---	---	---	---	
CDK19	23097	broad.mit.edu	37	6	110962843	110962844	+	Intron	INS	-	GAAA	GAAA	rs66614793		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110962843_110962844insGAAA	uc003puh.1	-						CDK19_uc003pui.1_Intron|CDK19_uc011eax.1_Intron	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						aggaggaaagggaaagaaagga	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747283	134747286	+	IGR	DEL	TCTT	-	-	rs67886112		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747283_134747286delTCTT								SGK1 (108087 upstream) : ALDH8A1 (491243 downstream)																							tccctctccctctttctttctttc	0.034													4	2	---	---	---	---	
TBP	6908	broad.mit.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	CAG	CAG	rs72320253		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170871013_170871014insCAG	uc003qxt.2	+	3	421_422	c.189_190insCAG	c.(187-192)insCAG	p.95_96insQ	TBP_uc003qxu.2_In_Frame_Ins_p.95_96insQ|TBP_uc011ehf.1_In_Frame_Ins_p.75_76insQ|TBP_uc011ehg.1_In_Frame_Ins_p.95_96insQ	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein	95_96					cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.183													32	24	---	---	---	---	
LOC729156	729156	broad.mit.edu	37	7	66304731	66304731	+	Intron	DEL	T	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66304731delT	uc003tvj.1	-							NR_003934				Homo sapiens cDNA FLJ36054 fis, clone TESTI2018290.												0						TTTCTTTCCCttttttttttt	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111616811	111616812	+	IGR	INS	-	C	C			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111616811_111616812insC								None (None upstream) : ACTL7B (59 downstream)																							TAAGCCCGACTCCCCCCTACCC	0.505													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	99823423	99823430	+	IGR	DEL	TCTTTCTT	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99823423_99823430delTCTTTCTT								CRTAC1 (32838 upstream) : C10orf28 (70951 downstream)																							cctccctccctctttctttctttctttc	0.000													4	2	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGCCTCACCCCCCCCGCC	0.607													4	2	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99690140	99690141	+	Intron	DEL	CT	-	-	rs146778355		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99690140_99690141delCT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TTTTTTCACACTCTCACTGTAA	0.208													7	4	---	---	---	---	
HYOU1	10525	broad.mit.edu	37	11	118916977	118916978	+	Intron	INS	-	TT	TT	rs1784301		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118916977_118916978insTT	uc001puu.2	-						HYOU1_uc001put.2_Intron|HYOU1_uc010ryu.1_Intron|HYOU1_uc010ryv.1_Intron|HYOU1_uc001pux.3_Intron	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor							endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		cgtgcctggccttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126223118	126223118	+	Intron	DEL	G	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126223118delG	uc001qdq.1	-						uc001qdr.1_Intron|ST3GAL4_uc001qds.2_5'Flank|ST3GAL4_uc001qdt.2_5'Flank|ST3GAL4_uc009zcc.2_5'Flank|ST3GAL4_uc009zcd.2_5'Flank|ST3GAL4_uc001qdu.2_5'Flank|ST3GAL4_uc001qdv.2_5'Flank					Homo sapiens cDNA FLJ39051 fis, clone NT2RP7011452.																		ggaaagacaagaaaaagagag	0.000													4	4	---	---	---	---	
SLC48A1	55652	broad.mit.edu	37	12	48174351	48174351	+	3'UTR	DEL	C	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48174351delC	uc001rqd.2	+	3					SLC48A1_uc001rqc.2_Intron	NM_017842	NP_060312	Q6P1K1	HRG1_HUMAN	heme-responsive gene 1						transport	endosome membrane|integral to membrane|lysosomal membrane					0						ttttttttttctttttttttt	0.199													16	16	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494862	49494863	+	Intron	INS	-	A	A	rs145985167	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494862_49494863insA	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						GCCCTCCTTTCAAATTAAGTCT	0.317													4	2	---	---	---	---	
DIP2B	57609	broad.mit.edu	37	12	51122130	51122130	+	Intron	DEL	A	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51122130delA	uc001rwv.2	+						DIP2B_uc009zlt.2_Intron	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						aactccatctaaaaaaaaaaa	0.124													6	3	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176033	92176034	+	Intron	INS	-	A	A	rs143282961	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176033_92176034insA	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				gactccatctcaaaaaaacaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101656176	101656177	+	IGR	INS	-	GGAA	GGAA			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101656176_101656177insGGAA								MIR656 (123038 upstream) : DIO3OS (362383 downstream)																							ATTggaagcagggaaggaagga	0.262													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106934205	106934206	+	Intron	DEL	AA	-	-	rs35485687		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106934205_106934206delAA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						ctaaaaagtgaaaaaaaaaaaa	0.203													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23610060	23610061	+	5'Flank	INS	-	G	G			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23610060_23610061insG	uc001ywf.2	-											DQ583953																		AGGCAGGAAGAGGGGGCTCCCA	0.639													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48058484	48058484	+	Intron	DEL	G	-	-	rs528882	by1000genomes	TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058484delG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTTTTTTTTTGTTGTTATGGG	0.358													6	3	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532277	10532277	+	Intron	DEL	T	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532277delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aatttttgggttttttttttt	0.000													6	6	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18893710	18893710	+	Intron	DEL	A	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18893710delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TGttttaaataaaaaaaaaaa	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28649818	28649818	+	Intron	DEL	A	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28649818delA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GAGTGCAGACAAGATGGGGCC	0.582													3	3	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57951556	57951557	+	Intron	DEL	AC	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57951556_57951557delAC	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						acacacacatacacacacacac	0.119													4	2	---	---	---	---	
PLCG2	5336	broad.mit.edu	37	16	81954997	81954997	+	Intron	DEL	T	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81954997delT	uc002fgt.2	+						PLCG2_uc010chg.1_Frame_Shift_Del_p.N810fs	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						GCCaaaataattttttttttt	0.368													4	2	---	---	---	---	
JPH3	57338	broad.mit.edu	37	16	87717665	87717665	+	Intron	DEL	G	-	-			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87717665delG	uc002fkd.2	+						JPH3_uc010vou.1_Intron	NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN	junctophilin 3						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)		GCCCGTTGTTGGGGGGTTGGC	0.537													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50554195	50554196	+	Intron	INS	-	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50554195_50554196insT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AAGAGCAGTTATTTTTTTTTTC	0.381													6	4	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45666582	45666582	+	Intron	DEL	C	-	-	rs72021582		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666582delC	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GTGCCTAAGACCCCCCCCCCG	0.672													4	4	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29745509	29745510	+	Intron	INS	-	T	T			TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29745509_29745510insT	uc003afj.2	-						AP1B1_uc003afi.2_Intron|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron|AP1B1_uc011ako.1_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						TCTGAGttttgttttttttttt	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13500860	13500860	+	IGR	DEL	G	-	-	rs76607402		TCGA-22-5489-01A-01D-1632-08	TCGA-22-5489-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13500860delG								None (None upstream) : None (None downstream)																							TGATTTCTAAGACTTTTGAAA	0.274													11	6	---	---	---	---	
