Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ZBTB40	9923	broad.mit.edu	37	1	22835047	22835047	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22835047G>T	uc001bft.2	+	9	2033	c.1522G>T	c.(1522-1524)GAC>TAC	p.D508Y	ZBTB40_uc001bfu.2_Missense_Mutation_p.D508Y|ZBTB40_uc009vqi.1_Missense_Mutation_p.D396Y|ZBTB40_uc001bfv.1_Missense_Mutation_p.D137Y	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	508					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		TGTGAAACGTGACTCTGGTTC	0.483																0.629834	352.376092	355.05174	114	67	KEEP	---	---	---	---	73	61	41	37	0.544776119403	capture	Missense_Mutation	SNP	22835047	22835047	ZBTB40	1	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	17422	224
HMCN1	83872	broad.mit.edu	37	1	186121993	186121993	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186121993T>G	uc001grq.1	+	96	15237	c.15008T>G	c.(15007-15009)GTC>GGC	p.V5003G	HMCN1_uc001grs.1_Missense_Mutation_p.V572G	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5003	Nidogen G2 beta-barrel.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCTGCTGAAGTCACTGTAAAG	0.438																0.171053	122.825148	154.090868	52	252	KEEP	---	---	---	---	27	34	142	142	-1	capture	Missense_Mutation	SNP	186121993	186121993	HMCN1	1	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	7145	224
OBSCN	84033	broad.mit.edu	37	1	228559651	228559651	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228559651C>T	uc009xez.1	+	94	21216	c.21172C>T	c.(21172-21174)CCT>TCT	p.P7058S	OBSCN_uc001hsr.1_Missense_Mutation_p.P1687S	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7058	Pro-rich.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCCATGCCCTCCTGGCTCCTT	0.672					4006											0.146067	19.310707	30.039208	13	76	KEEP	---	---	---	---	16	4	49	49	-1	capture	Missense_Mutation	SNP	228559651	228559651	OBSCN	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	10717	224
KIAA1804	84451	broad.mit.edu	37	1	233518426	233518426	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233518426T>C	uc001hvt.3	+	10	3341	c.3080T>C	c.(3079-3081)ATA>ACA	p.I1027T	KIAA1804_uc001hvu.3_Missense_Mutation_p.I473T	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	1027					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				CGGCCATCTATATATGAACTG	0.428					196											0.198529	77.857881	89.352069	27	109	KEEP	---	---	---	---	12	22	57	65	-1	capture	Missense_Mutation	SNP	233518426	233518426	KIAA1804	1	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8181	224
PTPRE	5791	broad.mit.edu	37	10	129861345	129861345	+	Splice_Site	SNP	A	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129861345A>T	uc001lkb.2	+	10	905	c.626_splice	c.e10-2	p.G209_splice	PTPRE_uc009yat.2_Splice_Site_p.G220_splice|PTPRE_uc010qup.1_Splice_Site|PTPRE_uc009yau.2_Splice_Site_p.G209_splice|PTPRE_uc001lkd.2_Splice_Site_p.G151_splice|PTPRE_uc010quq.1_Splice_Site_p.G110_splice	NM_006504	NP_006495	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)				CTCTACACACAGGTCCCAAAC	0.522	Colon(52;977 1184 20575 41685)															0.036145	-12.845564	6.529576	3	80	KEEP	---	---	---	---	3	1	43	46	-1	capture	Splice_Site	SNP	129861345	129861345	PTPRE	10	A	T	T	T	1	0	0	0	0	0	0	1	0	91	7	5	4	12695	224
MEN1	4221	broad.mit.edu	37	11	64575521	64575521	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64575521G>A	uc001obj.2	-	3	584	c.511C>T	c.(511-513)CAG>TAG	p.Q171*	MEN1_uc001obk.2_Nonsense_Mutation_p.Q171*|MEN1_uc001obl.2_Nonsense_Mutation_p.Q166*|MEN1_uc001obm.2_Nonsense_Mutation_p.Q166*|MEN1_uc001obn.2_Nonsense_Mutation_p.Q171*|MEN1_uc001obo.2_Nonsense_Mutation_p.Q171*|MEN1_uc001obp.2_Nonsense_Mutation_p.Q166*|MEN1_uc001obq.2_Nonsense_Mutation_p.Q171*|MEN1_uc001obr.2_Nonsense_Mutation_p.Q171*	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	171			Missing (in MEN1).		DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	p.R171Q(1)		parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						CCCAGGGCCTGGCAGGCCCCA	0.602	Esophageal Squamous(1;83 158 15500 18603 18803 29295)				75	D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				0.52381	66.031639	66.051405	22	20	KEEP	---	---	---	---	9	14	13	14	-1	capture	Nonsense_Mutation	SNP	64575521	64575521	MEN1	11	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	9385	224
KRTAP5-11	440051	broad.mit.edu	37	11	71293418	71293418	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71293418T>G	uc001oqu.2	-	1	504	c.466A>C	c.(466-468)ATC>CTC	p.I156L		NM_001005405	NP_001005405	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11	156						keratin filament					0						GAGCCTCAGATCTTACACTGG	0.308																0.017442	-38.020672	7.166974	3	169	KEEP	---	---	---	---	2	2	127	105	-1	capture	Missense_Mutation	SNP	71293418	71293418	KRTAP5-11	11	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	8480	224
RAB30	27314	broad.mit.edu	37	11	82693315	82693315	+	Silent	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82693315G>A	uc001ozu.2	-	6	765	c.504C>T	c.(502-504)TGC>TGT	p.C168C	RAB30_uc009yve.2_Silent_p.C166C|RAB30_uc010rst.1_Silent_p.C166C|RAB30_uc001ozv.2_3'UTR	NM_014488	NP_055303	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	168					protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0						TGATGAGTCGGCATGCTAAGT	0.438																0.03125	-23.373484	7.387951	4	124	KEEP	---	---	---	---	1	3	72	67	-1	capture	Silent	SNP	82693315	82693315	RAB30	11	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	12814	224
HELB	92797	broad.mit.edu	37	12	66698566	66698566	+	Silent	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66698566G>A	uc001sti.2	+	2	271	c.243G>A	c.(241-243)CCG>CCA	p.P81P	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	81					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		GACGTTTTCCGATAACAGGTG	0.378																0.020513	-43.579932	6.651251	4	191	KEEP	---	---	---	---	4	3	104	116	-1	capture	Silent	SNP	66698566	66698566	HELB	12	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	6971	224
CABP1	9478	broad.mit.edu	37	12	121098105	121098105	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121098105G>A	uc001tyu.2	+	3	859	c.792G>A	c.(790-792)ATG>ATA	p.M264I	CABP1_uc001tyv.2_Missense_Mutation_p.M121I|CABP1_uc001tyw.2_Missense_Mutation_p.M61I|CABP1_uc001tyx.2_Missense_Mutation_p.M106I	NM_001033677	NP_001028849	Q9NZU7	CABP1_HUMAN	calcium binding protein 1 isoform 3	264	EF-hand 2.					cell cortex|cell junction|Golgi apparatus|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|calcium-dependent protein binding|enzyme inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCACCGAGATGGAGCTCATCG	0.542																0.034483	-14.153925	6.367617	3	84	KEEP	---	---	---	---	1	2	41	55	-1	capture	Missense_Mutation	SNP	121098105	121098105	CABP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	2507	224
HERC2	8924	broad.mit.edu	37	15	28389261	28389261	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28389261G>A	uc001zbj.2	-	73	11367	c.11261C>T	c.(11260-11262)GCG>GTG	p.A3754V		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3754					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGCGAGGCCGCAAGGCGAGG	0.537					1580											0.029126	-40.922731	9.323307	6	200	KEEP	---	---	---	---	3	4	103	127	-1	capture	Missense_Mutation	SNP	28389261	28389261	HERC2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6984	224
RNF40	9810	broad.mit.edu	37	16	30774843	30774843	+	Silent	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30774843G>A	uc002dzq.2	+	4	528	c.405G>A	c.(403-405)GGG>GGA	p.G135G	C16orf93_uc002dzm.2_5'Flank|C16orf93_uc002dzn.2_5'Flank|C16orf93_uc002dzo.2_5'Flank|C16orf93_uc002dzp.2_5'Flank|RNF40_uc010caa.2_Silent_p.G135G|RNF40_uc010cab.2_Silent_p.G135G|RNF40_uc010vfa.1_Intron|RNF40_uc002dzr.2_Silent_p.G135G|RNF40_uc010vfb.1_Intron	NM_014771	NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40	135					histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding			central_nervous_system(1)	1			Colorectal(24;0.198)			CATGTGATGGGACTCCTCTCC	0.612																0.144144	22.364231	35.870607	16	95	KEEP	---	---	---	---	9	8	45	56	-1	capture	Silent	SNP	30774843	30774843	RNF40	16	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	13385	224
KRTAP1-1	81851	broad.mit.edu	37	17	39197186	39197186	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39197186C>T	uc002hvw.1	-	1	528	c.464G>A	c.(463-465)CGC>CAC	p.R155H		NM_030967	NP_112229	Q07627	KRA11_HUMAN	keratin associated protein 1-1	155						extracellular region|keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GTAGGATGGGCGGCAGCAGGA	0.637																0.226667	37.6669	42.790144	17	58	KEEP	---	---	---	---	11	10	35	34	-1	capture	Missense_Mutation	SNP	39197186	39197186	KRTAP1-1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8422	224
C19orf10	56005	broad.mit.edu	37	19	4668644	4668644	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4668644C>T	uc002may.2	-	2	257	c.188G>A	c.(187-189)TGT>TAT	p.C63Y		NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor	63						ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AGTGAACATACACGTATATTT	0.313																0.37234	93.892674	95.241369	35	59	KEEP	---	---	---	---	21	25	30	41	-1	capture	Missense_Mutation	SNP	4668644	4668644	C19orf10	19	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	1892	224
ZNF317	57693	broad.mit.edu	37	19	9267420	9267420	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9267420C>T	uc002mku.2	+	3	433	c.158C>T	c.(157-159)TCC>TTC	p.S53F	ZNF317_uc010xkm.1_Silent_p.F94F|ZNF317_uc002mkv.2_5'UTR|ZNF317_uc002mkw.2_Missense_Mutation_p.S53F|ZNF317_uc002mkx.2_5'UTR|ZNF317_uc002mky.2_5'UTR	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	53					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGTGTTGGTTCCCAGGTGCAC	0.527																0.407821	215.434099	216.764951	73	106	KEEP	---	---	---	---	39	41	51	67	-1	capture	Missense_Mutation	SNP	9267420	9267420	ZNF317	19	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17715	224
MAN2B1	4125	broad.mit.edu	37	19	12763065	12763065	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12763065C>G	uc002mub.2	-	16	2024	c.1948G>C	c.(1948-1950)GAC>CAC	p.D650H	MAN2B1_uc010dyv.1_Missense_Mutation_p.D649H	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	650					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						CTTTCGTTGTCACCTATACTG	0.597																0.018405	-35.926488	6.639466	3	160	KEEP	---	---	---	---	1	3	86	91	-1	capture	Missense_Mutation	SNP	12763065	12763065	MAN2B1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	9130	224
TMEM147	10430	broad.mit.edu	37	19	36037641	36037641	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36037641C>T	uc002oaj.1	+	4	372	c.275C>T	c.(274-276)GCC>GTC	p.A92V	uc010eec.1_5'Flank|uc002oag.2_5'Flank|TMEM147_uc002oai.1_Missense_Mutation_p.A43V|TMEM147_uc002oak.1_Missense_Mutation_p.P2S	NM_032635	NP_116024	Q9BVK8	TM147_HUMAN	transmembrane protein 147	92						endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TCCCGGAATGCCGGCAAGGGA	0.572																0.025974	-31.673678	6.568146	4	150	KEEP	---	---	---	---	3	1	84	75	-1	capture	Missense_Mutation	SNP	36037641	36037641	TMEM147	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15945	224
EXOSC5	56915	broad.mit.edu	37	19	41895788	41895788	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41895788G>A	uc002oqo.2	-	4	430	c.407C>T	c.(406-408)GCC>GTC	p.A136V	CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron	NM_020158	NP_064543	Q9NQT4	EXOS5_HUMAN	exosome component Rrp46	136					DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|protein binding|RNA binding				0						CATGCAGGCGGCATTCAGACA	0.448																0.029197	-26.827418	6.574509	4	133	KEEP	---	---	---	---	2	3	69	81	-1	capture	Missense_Mutation	SNP	41895788	41895788	EXOSC5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5273	224
NLRP5	126206	broad.mit.edu	37	19	56539217	56539217	+	Missense_Mutation	SNP	T	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539217T>A	uc002qmj.2	+	7	1618	c.1618T>A	c.(1618-1620)TGG>AGG	p.W540R	NLRP5_uc002qmi.2_Missense_Mutation_p.W521R	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	540	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GGAGGGAGTGTGGAATAGGAA	0.552																0.360656	56.898895	57.954391	22	39	KEEP	---	---	---	---	13	11	17	23	-1	capture	Missense_Mutation	SNP	56539217	56539217	NLRP5	19	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	10387	224
FIGN	55137	broad.mit.edu	37	2	164467616	164467616	+	Silent	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:164467616G>A	uc002uck.1	-	3	1037	c.726C>T	c.(724-726)CTC>CTT	p.L242L		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	242	Pro-rich.					nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TGTAACTGGAGAGGTTAGAAG	0.612																0.4625	113.064591	113.162815	37	43	KEEP	---	---	---	---	17	21	25	24	-1	capture	Silent	SNP	164467616	164467616	FIGN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	5837	224
SNRPB	6628	broad.mit.edu	37	20	2443779	2443779	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2443779C>T	uc002wfz.1	-	5	678	c.515G>A	c.(514-516)CGT>CAT	p.R172H	SNRPB_uc002wga.1_Missense_Mutation_p.R172H|SNRPB_uc010zpv.1_Missense_Mutation_p.R93H|SNRPB_uc002wgb.2_Missense_Mutation_p.R172H|SNORD119_uc010gam.1_5'Flank	NM_198216	NP_937859	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptide B/B'	172				RG -> L (in Ref. 4).	histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|protein binding|RNA binding			ovary(1)	1						AGGACCCCCACGGCCAGGTGG	0.597																0.487805	282.180856	282.2074	100	105	KEEP	---	---	---	---	60	49	71	52	-1	capture	Missense_Mutation	SNP	2443779	2443779	SNRPB	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14753	224
SENP5	205564	broad.mit.edu	37	3	196613120	196613120	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196613120G>A	uc003fwz.3	+	2	1317	c.1068G>A	c.(1066-1068)TGG>TGA	p.W356*	SENP5_uc011bty.1_Nonsense_Mutation_p.W356*	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	356					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CAAACGCCTGGGACCAGTCAT	0.468	Ovarian(47;891 1095 11174 13858 51271)															0.655172	192.398822	194.247626	57	30	KEEP	---	---	---	---	30	31	13	19	-1	capture	Nonsense_Mutation	SNP	196613120	196613120	SENP5	3	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	13942	224
OR2J2	26707	broad.mit.edu	37	6	29142195	29142195	+	Silent	SNP	C	G	G			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29142195C>G	uc011dlm.1	+	1	885	c.783C>G	c.(781-783)CTC>CTG	p.L261L		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCATGTATCTCCAGCCACCAT	0.433																0.020725	-40.382972	9.258669	4	189	KEEP	---	---	---	---	1	3	104	122	-1	capture	Silent	SNP	29142195	29142195	OR2J2	6	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	10907	224
MUC17	140453	broad.mit.edu	37	7	100677921	100677921	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100677921C>T	uc003uxp.1	+	3	3277	c.3224C>T	c.(3223-3225)ACT>ATT	p.T1075I	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1075	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|16.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTGTGACCACTTATTCTCAA	0.488																0.108235	78.847048	208.037357	92	758	KEEP	---	---	---	---	54	69	458	419	-1	capture	Missense_Mutation	SNP	100677921	100677921	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	9884	224
EPHA1	2041	broad.mit.edu	37	7	143098437	143098437	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143098437G>A	uc003wcz.2	-	3	499	c.412C>T	c.(412-414)CGA>TGA	p.R138*		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	138	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				AAGGGCCGTCGGAGCTGAATG	0.592					379											0.154472	94.319126	136.377954	57	312	KEEP	---	---	---	---	25	36	170	181	-1	capture	Nonsense_Mutation	SNP	143098437	143098437	EPHA1	7	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	5120	224
ATP6V1C1	528	broad.mit.edu	37	8	104075258	104075258	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104075258C>G	uc003ykz.3	+	9	962	c.717C>G	c.(715-717)CAC>CAG	p.H239Q	ATP6V1C1_uc010mbz.2_Missense_Mutation_p.H164Q|ATP6V1C1_uc003yla.2_Missense_Mutation_p.H239Q|ATP6V1C1_uc011lhl.1_Missense_Mutation_p.H164Q	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	239					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			ACTTCAGACACAAAGCCAGAG	0.328																0.304833	277.346035	286.487696	82	187	KEEP	---	---	---	---	41	52	104	112	-1	capture	Missense_Mutation	SNP	104075258	104075258	ATP6V1C1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	1171	224
LRRC6	23639	broad.mit.edu	37	8	133645122	133645122	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133645122C>T	uc003ytk.2	-	5	591	c.517G>A	c.(517-519)GAA>AAA	p.E173K	LRRC6_uc003ytl.2_RNA	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6	173						cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGATCTTTTTCCTGCTCTCTG	0.398																0.473171	593.658362	593.911191	194	216	KEEP	---	---	---	---	109	93	118	115	-1	capture	Missense_Mutation	SNP	133645122	133645122	LRRC6	8	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8931	224
CDKN2B	1030	broad.mit.edu	37	9	22006044	22006044	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:22006044G>T	uc003zpo.2	-	2	719	c.359C>A	c.(358-360)GCC>GAC	p.A120D	MTAP_uc003zpi.1_Intron|CDKN2BAS_uc010miw.1_Intron|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron|CDKN2B_uc003zpn.2_3'UTR	NM_004936	NP_004927	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B isoform 1	120	ANK 4.				cell cycle arrest|cellular response to nutrient|G1 phase of mitotic cell cycle|G2/M transition of mitotic cell cycle|megakaryocyte differentiation|mitotic cell cycle G1/S transition checkpoint|negative regulation of epithelial cell proliferation|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		CCGCTCCTCGGCCAAGTCCAC	0.701					1							Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				0.705882	71.706957	72.994705	24	10	KEEP	---	---	---	---	10	15	6	6	0.4	capture	Missense_Mutation	SNP	22006044	22006044	CDKN2B	9	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	3133	224
CDKN2B	1030	broad.mit.edu	37	9	22006068	22006068	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:22006068C>A	uc003zpo.2	-	2	695	c.335G>T	c.(334-336)TGG>TTG	p.W112L	MTAP_uc003zpi.1_Intron|CDKN2BAS_uc010miw.1_Intron|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron|CDKN2B_uc003zpn.2_3'UTR	NM_004936	NP_004927	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B isoform 1	112	ANK 4.				cell cycle arrest|cellular response to nutrient|G1 phase of mitotic cell cycle|G2/M transition of mitotic cell cycle|megakaryocyte differentiation|mitotic cell cycle G1/S transition checkpoint|negative regulation of epithelial cell proliferation|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		CAGACGACCCCAGGCATCGCG	0.726					1							Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				0.69697	72.234649	73.376781	23	10	KEEP	---	---	---	---	8	16	6	6	0.666666666667	capture	Missense_Mutation	SNP	22006068	22006068	CDKN2B	9	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	3133	224
OTC	5009	broad.mit.edu	37	X	38260629	38260629	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:38260629T>C	uc004def.3	+	5	702	c.488T>C	c.(487-489)CTG>CCG	p.L163P		NM_000531	NP_000522	P00480	OTC_HUMAN	ornithine carbamoyltransferase precursor	163					arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity			ovary(1)|breast(1)	2					L-Citrulline(DB00155)|L-Ornithine(DB00129)	ATCAATGGGCTGTCAGATTTG	0.408																0.692308	219.55139	222.550372	63	28	KEEP	---	---	---	---	36	34	15	16	-1	capture	Missense_Mutation	SNP	38260629	38260629	OTC	23	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	11205	224
HUWE1	10075	broad.mit.edu	37	X	53569470	53569470	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53569470G>A	uc004dsp.2	-	74	11812	c.11410C>T	c.(11410-11412)CGG>TGG	p.R3804W	HUWE1_uc004dsn.2_Missense_Mutation_p.R2612W|HUWE1_uc004dsq.1_Missense_Mutation_p.R104W	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3804					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TCCTCCCTCCGGACAGACGCC	0.502																0.03	-17.863753	6.383217	3	97	KEEP	---	---	---	---	1	2	60	55	-1	capture	Missense_Mutation	SNP	53569470	53569470	HUWE1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	7386	224
INPPL1	3636	broad.mit.edu	37	11	71942586	71942586	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71942586delC	uc001osf.2	+	13	1689	c.1542delC	c.(1540-1542)GTCfs	p.V514fs	INPPL1_uc001osg.2_Frame_Shift_Del_p.V272fs	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	514					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						CAGTGCTGGTCAAGCCAGAGC	0.567																0.59			58	40		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	71942586	71942586	INPPL1	11	C	-	-	-	1	0	1	0	1	0	0	0	0	366	29	5	5	7684	224
SESN3	143686	broad.mit.edu	37	11	94924753	94924756	+	Frame_Shift_Del	DEL	TTGC	-	-			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94924753_94924756delTTGC	uc001pfk.1	-	3	376_379	c.154_157delGCAA	c.(154-159)GCAAACfs	p.A52fs	SESN3_uc010rug.1_5'UTR|SESN3_uc001pfl.2_Frame_Shift_Del_p.A52fs	NM_144665	NP_653266	P58005	SESN3_HUMAN	sestrin 3	52_53					cell cycle arrest	nucleus					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		TCCACTGTGTTTGCTTGGACAACC	0.368																0.55			65	54		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	94924753	94924756	SESN3	11	TTGC	-	-	-	1	0	1	0	1	0	0	0	0	832	64	5	5	14019	224
MRPS34	65993	broad.mit.edu	37	16	1823074	1823075	+	Frame_Shift_Ins	INS	-	G	G			TCGA-28-5218-01	TCGA-28-5218-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1823074_1823075insG	uc002cmo.2	-	1	66_67	c.46_47insC	c.(46-48)CGCfs	p.R16fs	NME3_uc002cmm.2_5'Flank|NME3_uc010brv.2_5'Flank|MRPS34_uc002cmn.2_5'Flank|MRPS34_uc002cmp.1_Frame_Shift_Ins_p.R16fs|EME2_uc002cmq.1_5'Flank|EME2_uc010brw.1_5'Flank	NM_023936	NP_076425	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	16						mitochondrion|ribosome	protein binding			skin(2)	2						GCGCACGCGGCGGGCCAGCTCC	0.723																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	1823074	1823075	MRPS34	16	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	9753	224
