Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0562	9731	broad.mit.edu	37	1	3732029	3732029	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3732029G>C	uc001aky.2	-	22	3074	c.2715C>G	c.(2713-2715)AGC>AGG	p.S905R	KIAA0562_uc010nzm.1_RNA	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,	905						centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		TGGGGATCTTGCTTCCGGCCT	0.642																0.345455	63.12051	64.274816	19	36	KEEP	---	---	---	---	11	11	27	16	-1	capture	Missense_Mutation	SNP	3732029	3732029	KIAA0562	1	G	C	C	C	1	0	0	0	0	1	0	0	0	594	46	4	4	8106	228
TNFRSF8	943	broad.mit.edu	37	1	12164492	12164492	+	Nonsense_Mutation	SNP	C	T	T	rs148756853		TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12164492C>T	uc001atq.2	+	4	547	c.325C>T	c.(325-327)CGA>TGA	p.R109*	TNFRSF8_uc010obc.1_5'UTR	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	109	TNFR-Cys 3.|Extracellular (Potential).				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCGAATGTCGACCCGGCAT	0.577					756											0.482759	127.865708	127.886807	42	45	KEEP	---	---	---	---	27	16	21	26	-1	capture	Nonsense_Mutation	SNP	12164492	12164492	TNFRSF8	1	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	16182	228
DPH2	1802	broad.mit.edu	37	1	44437537	44437537	+	Silent	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44437537G>T	uc001ckz.2	+	4	1158	c.963G>T	c.(961-963)CGG>CGT	p.R321R	DPH2_uc001cla.2_Intron|DPH2_uc010okk.1_Silent_p.R186R|DPH2_uc001clb.2_Silent_p.R245R	NM_001384	NP_001375	Q9BQC3	DPH2_HUMAN	diphthamide biosynthesis protein 2 isoform a	321					peptidyl-diphthamide biosynthetic process from peptidyl-histidine	cytoplasm				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				CCCTGGGGCGGCCCACCCCTG	0.607																0.282051	100.133398	106.736168	44	112	KEEP	---	---	---	---	23	24	62	70	0.489361702128	capture	Silent	SNP	44437537	44437537	DPH2	1	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	4675	228
PTGFR	5737	broad.mit.edu	37	1	79002163	79002163	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79002163C>T	uc001din.2	+	3	1137	c.871C>T	c.(871-873)CGA>TGA	p.R291*	PTGFR_uc001dim.2_3'UTR	NM_000959	NP_000950	P43088	PF2R_HUMAN	prostaglandin F receptor isoform a precursor	291	Helical; Name=7; (Potential).				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity			ovary(3)|breast(2)|skin(1)	6				Colorectal(170;0.248)	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)	TTTTGCTCTCCGAATGGCAAC	0.388																0.498039	424.62969	424.630502	127	128	KEEP	---	---	---	---	61	74	65	68	-1	capture	Nonsense_Mutation	SNP	79002163	79002163	PTGFR	1	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	12644	228
HRNR	388697	broad.mit.edu	37	1	152193260	152193260	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152193260C>G	uc001ezt.1	-	3	921	c.845G>C	c.(844-846)AGC>ACC	p.S282T		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	282	3.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGACCATAGCTGGAAGACGA	0.587																0.288194	229.289404	240.887481	83	205	KEEP	---	---	---	---	95	94	100	123	-1	capture	Missense_Mutation	SNP	152193260	152193260	HRNR	1	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	7284	228
IQGAP3	128239	broad.mit.edu	37	1	156518190	156518190	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156518190G>C	uc001fpf.2	-	18	2158	c.2083C>G	c.(2083-2085)CCT>GCT	p.P695A		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	695					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGCCAGGAGGTTGCTCCCAG	0.557																0.022222	-27.649553	6.68767	3	132	KEEP	---	---	---	---	3	1	70	75	-1	capture	Missense_Mutation	SNP	156518190	156518190	IQGAP3	1	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	7739	228
ASPM	259266	broad.mit.edu	37	1	197061071	197061071	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197061071G>T	uc001gtu.2	-	22	9667	c.9410C>A	c.(9409-9411)GCT>GAT	p.A3137D	ASPM_uc001gtv.2_Missense_Mutation_p.A1552D|ASPM_uc001gtw.3_Missense_Mutation_p.A985D	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3137					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CTGCTTGTTAGCATTCTTCAC	0.338																0.4	172.928366	174.193989	58	87	KEEP	---	---	---	---	24	39	49	45	0.380952380952	capture	Missense_Mutation	SNP	197061071	197061071	ASPM	1	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	1047	228
OR2W5	441932	broad.mit.edu	37	1	247654810	247654810	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247654810C>T	uc001icz.1	+	1	381	c.381C>T	c.(379-381)TGC>TGT	p.C127C		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	127					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGGCCGTCTGCCGGTCCCTGC	0.587																0.035398	-19.655471	6.815068	4	109	KEEP	---	---	---	---	3	1	80	68	-1	capture	Silent	SNP	247654810	247654810	OR2W5	1	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	10938	228
TRIM58	25893	broad.mit.edu	37	1	248039235	248039235	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248039235C>T	uc001ido.2	+	6	953	c.905C>T	c.(904-906)CCG>CTG	p.P302L	OR2W3_uc001idp.1_5'UTR	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	302	B30.2/SPRY.					intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACGGCGCACCCGAGTCTGCTC	0.557																0.333333	90.923565	93.135839	30	60	KEEP	---	---	---	---	27	15	40	26	-1	capture	Missense_Mutation	SNP	248039235	248039235	TRIM58	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16414	228
OR2L3	391192	broad.mit.edu	37	1	248224640	248224640	+	Silent	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248224640G>T	uc001idx.1	+	1	657	c.657G>T	c.(655-657)CGG>CGT	p.R219R	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	219	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCTATGGCCGGGTTCTCCTTG	0.498																0.264706	129.149847	139.366441	54	150	KEEP	---	---	---	---	32	43	71	109	0.426666666667	capture	Silent	SNP	248224640	248224640	OR2L3	1	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	10912	228
OR2G6	391211	broad.mit.edu	37	1	248685400	248685400	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248685400C>T	uc001ien.1	+	1	453	c.453C>T	c.(451-453)AGC>AGT	p.S151S		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATGGCTCAGCGGCCTCATCA	0.577																0.506494	115.320198	115.322955	39	38	KEEP	---	---	---	---	20	25	25	19	-1	capture	Silent	SNP	248685400	248685400	OR2G6	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	10904	228
ITIH5	80760	broad.mit.edu	37	10	7605143	7605143	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7605143G>A	uc001ijq.2	-	14	2811	c.2732C>T	c.(2731-2733)GCC>GTC	p.A911V	ITIH5_uc001ijp.2_Missense_Mutation_p.A697V	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	911					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CAGTTTGGCGGCATTGTTCCT	0.522																0.027972	-28.716973	6.408244	4	139	KEEP	---	---	---	---	2	2	69	85	-1	capture	Missense_Mutation	SNP	7605143	7605143	ITIH5	10	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7830	228
ITIH5	80760	broad.mit.edu	37	10	7659109	7659109	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7659109G>T	uc001ijq.2	-	6	868	c.789C>A	c.(787-789)GAC>GAA	p.D263E	ITIH5_uc001ijp.2_Missense_Mutation_p.D49E|ITIH5_uc001ijr.1_Missense_Mutation_p.D263E	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	263					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CTCTATTGACGTCATATCTAA	0.388																0.772414	408.680885	418.557406	112	33	KEEP	---	---	---	---	64	66	21	18	0.492307692308	capture	Missense_Mutation	SNP	7659109	7659109	ITIH5	10	G	T	T	T	1	0	0	0	0	1	0	0	0	516	40	4	4	7830	228
CYP2C18	1562	broad.mit.edu	37	10	96447617	96447617	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96447617C>T	uc001kjv.3	+	2	585	c.259C>T	c.(259-261)CTG>TTG	p.L87L	CYP2C18_uc001kjw.3_Silent_p.L87L|CYP2C19_uc009xus.1_5'Flank|CYP2C19_uc010qny.1_5'Flank	NM_000772	NP_000763	P33260	CP2CI_HUMAN	cytochrome P450 family 2 subfamily C polypeptide	87					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(3)|lung(1)|skin(1)	5		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)		GAAGGAGGCCCTGATTGATCA	0.433																0.745665	463.455696	472.926943	129	44	KEEP	---	---	---	---	72	66	23	21	-1	capture	Silent	SNP	96447617	96447617	CYP2C18	10	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	4125	228
SOX6	55553	broad.mit.edu	37	11	16007846	16007846	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:16007846C>T	uc001mme.2	-	15	2159	c.2126G>A	c.(2125-2127)CGC>CAC	p.R709H	SOX6_uc001mmd.2_Missense_Mutation_p.R672H|SOX6_uc001mmf.2_Missense_Mutation_p.R669H|SOX6_uc001mmg.2_Missense_Mutation_p.R676H	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	696					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						AATGCAGGTGCGTTTCGGTCG	0.473																0.198454	168.085554	200.905154	77	311	KEEP	---	---	---	---	49	34	182	152	-1	capture	Missense_Mutation	SNP	16007846	16007846	SOX6	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14847	228
MRGPRX3	117195	broad.mit.edu	37	11	18158842	18158842	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18158842G>A	uc001mnu.2	+	3	454	c.93G>A	c.(91-93)ACG>ACA	p.T31T		NM_054031	NP_473372	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	31	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2						TGAGCTTCACGGGGCTGACGT	0.567																0.419672	402.056902	403.772181	128	177	KEEP	---	---	---	---	79	64	87	115	-1	capture	Silent	SNP	18158842	18158842	MRGPRX3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9678	228
MYBPC3	4607	broad.mit.edu	37	11	47360181	47360181	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47360181C>T	uc001nfa.3	-	22	2253	c.2198G>A	c.(2197-2199)CGC>CAC	p.R733H	MYBPC3_uc010rhl.1_RNA	NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	732	Ig-like C2-type 5.		R -> C (in CMH4).		cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		GAAGATGCTGCGGTCCTTGGT	0.632																0.442308	68.520008	68.670327	23	29	KEEP	---	---	---	---	14	12	10	19	-1	capture	Missense_Mutation	SNP	47360181	47360181	MYBPC3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9923	228
OR4B1	119765	broad.mit.edu	37	11	48238965	48238965	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48238965G>A	uc010rhs.1	+	1	604	c.604G>A	c.(604-606)GGA>AGA	p.G202R		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	202	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|pancreas(1)	4						GGCCAACAGTGGATTATTCTC	0.473																0.432927	227.392807	228.037375	71	93	KEEP	---	---	---	---	32	45	53	44	-1	capture	Missense_Mutation	SNP	48238965	48238965	OR4B1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	10948	228
RTN4RL2	349667	broad.mit.edu	37	11	57235097	57235097	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57235097G>C	uc010rjt.1	+	2	47	c.47G>C	c.(46-48)TGC>TCC	p.C16S		NM_178570	NP_848665	Q86UN3	R4RL2_HUMAN	reticulon 4 receptor-like 2 precursor	16					axon regeneration	anchored to plasma membrane	receptor activity				0						GCCTCGGCCTGCCTCCTGCTG	0.682																0.022727	-27.084038	6.41675	3	129	KEEP	---	---	---	---	1	3	96	86	-1	capture	Missense_Mutation	SNP	57235097	57235097	RTN4RL2	11	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	13624	228
OR1S1	219959	broad.mit.edu	37	11	57982381	57982381	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57982381C>T	uc010rkc.1	+	1	165	c.165C>T	c.(163-165)AAC>AAT	p.N55N		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	55	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				TGATTGGGAACGGGCTCATCA	0.443																0.356757	380.59278	387.281993	132	238	KEEP	---	---	---	---	80	70	114	158	-1	capture	Silent	SNP	57982381	57982381	OR1S1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10876	228
MS4A3	932	broad.mit.edu	37	11	59837091	59837091	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59837091C>T	uc001nom.2	+	6	686	c.558C>T	c.(556-558)TGC>TGT	p.C186C	MS4A3_uc001non.2_Silent_p.C140C|MS4A3_uc001noo.2_Silent_p.C63C	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	186	Helical; (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TGGAATTATGCGTAACCATCT	0.413																0.358639	392.373821	399.093441	137	245	KEEP	---	---	---	---	68	97	141	152	-1	capture	Silent	SNP	59837091	59837091	MS4A3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	9771	228
POLD4	57804	broad.mit.edu	37	11	67120265	67120265	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67120265G>A	uc001okm.2	-	3	343	c.196C>T	c.(196-198)CGG>TGG	p.R66W	LOC100130987_uc010rpo.1_Intron|POLD4_uc001okn.2_RNA|POLD4_uc001oko.2_RNA|POLD4_uc001okp.1_3'UTR	NM_021173	NP_066996	Q9HCU8	DPOD4_HUMAN	DNA-directed DNA polymerase delta 4	66					base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA-directed DNA polymerase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(15;3.08e-06)			CGCTGCAGCCGTGTGATCCCT	0.637																0.193548	22.363976	27.802227	12	50	KEEP	---	---	---	---	8	8	42	28	-1	capture	Missense_Mutation	SNP	67120265	67120265	POLD4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	12096	228
MTNR1B	4544	broad.mit.edu	37	11	92714860	92714860	+	Silent	SNP	C	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92714860C>A	uc001pdk.1	+	2	574	c.471C>A	c.(469-471)ACC>ACA	p.T157T		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	157	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	GCTGGCACACCCCTCTGCACA	0.572																0.310811	59.289069	61.653309	23	51	KEEP	---	---	---	---	16	16	34	26	0.5	capture	Silent	SNP	92714860	92714860	MTNR1B	11	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	9862	228
CWF19L2	143884	broad.mit.edu	37	11	107200691	107200691	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:107200691C>T	uc010rvp.1	-	17	2524	c.2494G>A	c.(2494-2496)GCC>ACC	p.A832T	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	832							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		ATGACATGGGCAAACCCTCCG	0.383																0.388889	19.01967	19.214735	7	11	KEEP	---	---	---	---	5	3	2	10	-1	capture	Missense_Mutation	SNP	107200691	107200691	CWF19L2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	4032	228
PRPF40B	25766	broad.mit.edu	37	12	50030600	50030600	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50030600C>T	uc001rur.1	+	15	1526	c.1462C>T	c.(1462-1464)CGC>TGC	p.R488C	PRPF40B_uc001rup.1_Missense_Mutation_p.R510C|PRPF40B_uc001ruq.1_Missense_Mutation_p.R482C|PRPF40B_uc001rus.1_Missense_Mutation_p.R431C	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	488					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						TCGGGAGCGACGCCAACAACG	0.562														OREG0021797	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.351562	128.849833	131.331419	45	83	KEEP	---	---	---	---	24	30	48	49	-1	capture	Missense_Mutation	SNP	50030600	50030600	PRPF40B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12468	228
CELA1	1990	broad.mit.edu	37	12	51723540	51723540	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51723540G>A	uc001ryi.1	-	7	728	c.687C>T	c.(685-687)AGC>AGT	p.S229S		NM_001971	NP_001962	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	229	Peptidase S1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			breast(1)	1						TACAGCCCCGGCTGGACACAA	0.512																0.027778	-28.720218	6.684499	4	140	KEEP	---	---	---	---	2	3	69	87	-1	capture	Silent	SNP	51723540	51723540	CELA1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	3178	228
STAT2	6773	broad.mit.edu	37	12	56748251	56748251	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56748251A>G	uc001slc.2	-	8	859	c.781T>C	c.(781-783)TGG>CGG	p.W261R	STAT2_uc001sld.2_Missense_Mutation_p.W257R|STAT2_uc010sqn.1_Missense_Mutation_p.W257R	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription	261					interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						ACCTCTCACCATGTCTCCAGC	0.527																0.022222	-27.795598	6.586664	3	132	KEEP	---	---	---	---	2	1	81	74	-1	capture	Missense_Mutation	SNP	56748251	56748251	STAT2	12	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	15155	228
UTP20	27340	broad.mit.edu	37	12	101750729	101750729	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101750729C>A	uc001tia.1	+	43	5716	c.5560C>A	c.(5560-5562)CTC>ATC	p.L1854I		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1854	HEAT 2.				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						GTGTGCCCTACTCAAGAACAG	0.363																0.026316	-21.882357	6.409844	3	111	KEEP	---	---	---	---	3	1	64	58	0.25	capture	Missense_Mutation	SNP	101750729	101750729	UTP20	12	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	16981	228
TMEM132B	114795	broad.mit.edu	37	12	125834519	125834519	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125834519G>A	uc001uhe.1	+	2	582	c.574G>A	c.(574-576)GAG>AAG	p.E192K		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	192	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GCTGCTGCCCGAGTGGTTCAG	0.632																0.333333	97.388948	99.97254	35	70	KEEP	---	---	---	---	14	23	47	29	-1	capture	Missense_Mutation	SNP	125834519	125834519	TMEM132B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15930	228
RB1	5925	broad.mit.edu	37	13	49039351	49039351	+	Nonsense_Mutation	SNP	T	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49039351T>A	uc001vcb.2	+	23	2502	c.2336T>A	c.(2335-2337)TTG>TAG	p.L779*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	779	Interaction with LIMD1.|Domain C; mediates interaction with E4F1.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCCCCTACCTTGTCACCAATA	0.398			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.737374	486.024505	496.112167	146	52	KEEP	---	---	---	---	66	108	31	26	-1	capture	Nonsense_Mutation	SNP	49039351	49039351	RB1	13	T	A	A	A	1	0	0	0	0	0	1	0	0	819	63	5	4	12993	228
FGF14	2259	broad.mit.edu	37	13	102375254	102375254	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:102375254G>A	uc001vpe.2	-	5	671	c.671C>T	c.(670-672)ACG>ATG	p.T224M	FGF14_uc001vpf.2_Missense_Mutation_p.T229M|FGF14_uc001vpd.1_5'Flank	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A	224					cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTACTTGGCGTCACCCCAGG	0.473																0.443548	167.227409	167.567804	55	69	KEEP	---	---	---	---	31	28	44	30	-1	capture	Missense_Mutation	SNP	102375254	102375254	FGF14	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5789	228
RNF31	55072	broad.mit.edu	37	14	24627141	24627141	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24627141C>A	uc001wmn.1	+	17	3011	c.2762C>A	c.(2761-2763)TCC>TAC	p.S921Y	RNF31_uc001wml.1_Missense_Mutation_p.S770Y|RNF31_uc010alg.1_Missense_Mutation_p.S680Y|RNF31_uc001wmo.1_Missense_Mutation_p.S388Y|RNF31_uc001wmp.2_RNA|RNF31_uc010alh.1_Missense_Mutation_p.S105Y	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	921	IBR-type 2.				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		GTGAAAAAGTCCCTGCACGGC	0.587																0.082474	-4.484761	12.77303	8	89	KEEP	---	---	---	---	6	2	52	45	0.25	capture	Missense_Mutation	SNP	24627141	24627141	RNF31	14	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	13379	228
C14orf145	145508	broad.mit.edu	37	14	81329142	81329142	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:81329142G>A	uc001xux.2	-	8	892	c.721C>T	c.(721-723)CGC>TGC	p.R241C	C14orf145_uc001xuz.2_Missense_Mutation_p.R241C|C14orf145_uc001xuy.1_Missense_Mutation_p.R99C	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	241	Potential.					centriole|spindle pole		p.R241C(1)			0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGATCCTGGCGTCTTTCCACC	0.463					1											0.379518	176.392954	178.503384	63	103	KEEP	---	---	---	---	32	39	57	62	-1	capture	Missense_Mutation	SNP	81329142	81329142	C14orf145	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1735	228
FLRT2	23768	broad.mit.edu	37	14	86088466	86088466	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:86088466T>C	uc001xvr.2	+	2	1375	c.608T>C	c.(607-609)CTC>CCC	p.L203P	FLRT2_uc010atd.2_Missense_Mutation_p.L203P	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	203	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TTCCAGAATCTCACGAGCTTG	0.522																0.33913	131.095404	133.72394	39	76	KEEP	---	---	---	---	19	23	44	38	-1	capture	Missense_Mutation	SNP	86088466	86088466	FLRT2	14	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	5883	228
GATM	2628	broad.mit.edu	37	15	45668979	45668979	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45668979G>T	uc001zvc.2	-	2	437	c.108C>A	c.(106-108)TTC>TTA	p.F36L	GATM_uc001zvb.2_5'UTR|GATM_uc010uev.1_Missense_Mutation_p.F89L	NM_001482	NP_001473	P50440	GATM_HUMAN	L-arginine:glycine amidinotransferase precursor	36					creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)	GGGTGCTCTGGAAAGTTCGCT	0.512																0.484375	89.214683	89.228536	31	33	KEEP	---	---	---	---	25	15	16	24	0.625	capture	Missense_Mutation	SNP	45668979	45668979	GATM	15	G	T	T	T	1	0	0	0	0	1	0	0	0	529	41	4	4	6203	228
MEGF11	84465	broad.mit.edu	37	15	66191203	66191203	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:66191203G>T	uc002apm.2	-	22	2978	c.2837C>A	c.(2836-2838)ACA>AAA	p.T946K	MEGF11_uc002apl.2_Missense_Mutation_p.T871K|MEGF11_uc002apn.1_Missense_Mutation_p.T946K	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor	946						basolateral plasma membrane|integral to membrane				pancreas(1)	1						GTCCTTAATTGTGGCGTAAGG	0.468																0.46875	194.290585	194.399397	60	68	KEEP	---	---	---	---	33	31	34	39	0.515625	capture	Missense_Mutation	SNP	66191203	66191203	MEGF11	15	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	9374	228
PGPEP1L	145814	broad.mit.edu	37	15	99512679	99512679	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99512679C>T	uc002bum.2	-	4	552	c.346G>A	c.(346-348)GTG>ATG	p.V116M	PGPEP1L_uc010bop.2_Missense_Mutation_p.V62M|PGPEP1L_uc002bun.2_RNA	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein	116					proteolysis		cysteine-type peptidase activity				0						GAAAAGATCACGTCGACACCC	0.627																0.441718	209.675728	210.158246	72	91	KEEP	---	---	---	---	33	44	56	43	-1	capture	Missense_Mutation	SNP	99512679	99512679	PGPEP1L	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11707	228
TMEM219	124446	broad.mit.edu	37	16	29979390	29979390	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29979390A>G	uc002duw.2	+	4	567	c.400A>G	c.(400-402)ACA>GCA	p.T134A	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TMEM219_uc002duy.2_Missense_Mutation_p.T134A|TMEM219_uc010bzk.1_Missense_Mutation_p.T134A|TMEM219_uc002duz.2_Missense_Mutation_p.T134A|TMEM219_uc010bzl.1_RNA	NM_194280	NP_919256	Q86XT9	TM219_HUMAN	transmembrane protein 219	134						integral to membrane					0						CAGGGTGACCACAGAAAGGAC	0.527																0.182143	93.763173	120.493891	51	229	KEEP	---	---	---	---	33	22	128	117	-1	capture	Missense_Mutation	SNP	29979390	29979390	TMEM219	16	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	16025	228
SNX20	124460	broad.mit.edu	37	16	50707501	50707501	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50707501C>T	uc002egk.2	-	4	940	c.767G>A	c.(766-768)CGC>CAC	p.R256H	SNX20_uc010vgp.1_Intron|SNX20_uc002egi.3_Intron	NM_182854	NP_878274	Q7Z614	SNX20_HUMAN	sorting nexin 20 isoform 1	256					cell communication|protein transport	endosome membrane|nucleus|plasma membrane	phosphatidylinositol binding|protein binding			ovary(1)	1						GGCCTGCAGGCGCTGCAGGGC	0.741																0.411765	40.735344	40.968122	14	20	KEEP	---	---	---	---	12	9	10	11	-1	capture	Missense_Mutation	SNP	50707501	50707501	SNX20	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14784	228
CPNE2	221184	broad.mit.edu	37	16	57153520	57153520	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57153520C>T	uc002eks.1	+	7	868	c.639C>T	c.(637-639)CCC>CCT	p.P213P	CPNE2_uc010cct.1_Silent_p.P239P|CPNE2_uc010ccu.1_Silent_p.P213P	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II	213	C2 2.									central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				TCACAGTGCCCTTGGTGTCCC	0.617																0.409091	28.970721	29.129658	9	13	KEEP	---	---	---	---	6	6	8	7	-1	capture	Silent	SNP	57153520	57153520	CPNE2	16	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	3777	228
PKD1L2	114780	broad.mit.edu	37	16	81181065	81181065	+	Missense_Mutation	SNP	C	T	T	rs113696594		TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81181065C>T	uc002fgh.1	-	30	5026	c.5026G>A	c.(5026-5028)GCC>ACC	p.A1676T	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1676	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CAGCCCAAGGCGGGGGATGGC	0.512																0.473054	242.901489	243.007118	79	88	KEEP	---	---	---	---	43	42	49	42	-1	capture	Missense_Mutation	SNP	81181065	81181065	PKD1L2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11868	228
NEURL4	84461	broad.mit.edu	37	17	7220634	7220634	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7220634G>A	uc002gga.1	-	28	4381	c.4374C>T	c.(4372-4374)TTC>TTT	p.F1458F	GPS2_uc002gfv.1_5'Flank|GPS2_uc002gfw.1_5'Flank|GPS2_uc002gfx.1_5'Flank|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_5'UTR|NEURL4_uc002ggb.1_Silent_p.F1456F	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	1458							protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						CAGGCTCCTCGAACCCTACCC	0.607																0.876404	266.51436	278.871914	78	11	KEEP	---	---	---	---	48	46	6	6	-1	capture	Silent	SNP	7220634	7220634	NEURL4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	10254	228
TP53	7157	broad.mit.edu	37	17	7577138	7577138	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577138C>G	uc002gim.2	-	8	994	c.800G>C	c.(799-801)CGG>CCG	p.R267P	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R267P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R135P|TP53_uc010cng.1_Missense_Mutation_p.R135P|TP53_uc002gii.1_Missense_Mutation_p.R135P|TP53_uc010cnh.1_Missense_Mutation_p.R267P|TP53_uc010cni.1_Missense_Mutation_p.R267P|TP53_uc002gij.2_Missense_Mutation_p.R267P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	267	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> H (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R267W(20)|p.R267P(13)|p.0?(7)|p.R267Q(7)|p.R267R(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.R267fs*78(1)|p.N268fs*77(1)|p.L265_K305del41(1)|p.R267G(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.R267L(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AAAGCTGTTCCGTCCCAGTAG	0.527	Pancreas(47;798 1329 9957 10801)		111	p.R267P(NCIH1437-Tumor)|p.R267P(JHH7-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.862069	95.096725	98.775485	25	4	KEEP	---	---	---	---	13	14	3	1	-1	capture	Missense_Mutation	SNP	7577138	7577138	TP53	17	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	16264	228
SLC47A2	146802	broad.mit.edu	37	17	19618087	19618087	+	Missense_Mutation	SNP	C	T	T	rs148775490	byFrequency	TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19618087C>T	uc002gwe.3	-	3	416	c.241G>A	c.(241-243)GGA>AGA	p.G81R	SLC47A2_uc002gwg.3_Missense_Mutation_p.G81R|SLC47A2_uc002gwf.3_Missense_Mutation_p.G81R|SLC47A2_uc002gwh.3_RNA|SLC47A2_uc002gwi.2_RNA|SLC47A2_uc010cqs.1_RNA|SLC47A2_uc010cqt.1_RNA	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1	81	Helical; (Potential).					integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					ACAGAAACTCCGCAGACATTG	0.587																0.414938	299.465308	300.984689	100	141	KEEP	---	---	---	---	54	57	66	89	-1	capture	Missense_Mutation	SNP	19618087	19618087	SLC47A2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14540	228
DHRS13	147015	broad.mit.edu	37	17	27228288	27228288	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27228288C>T	uc002hde.3	-	4	529	c.402G>A	c.(400-402)GCG>GCA	p.A134A	DHRS13_uc002hdd.3_Silent_p.A84A|DHRS13_uc010wba.1_Silent_p.A53A	NM_144683	NP_653284	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	134						extracellular region	binding|oxidoreductase activity				0	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GCAGGTTAAACGCCTCACGGG	0.592																0.370787	86.331647	87.642877	33	56	KEEP	---	---	---	---	21	15	35	29	-1	capture	Silent	SNP	27228288	27228288	DHRS13	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4447	228
MTMR4	9110	broad.mit.edu	37	17	56582201	56582201	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56582201C>T	uc002iwj.2	-	12	1348	c.1238G>A	c.(1237-1239)CGC>CAC	p.R413H		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	413	Myotubularin phosphatase.|Substrate binding (By similarity).					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGCGGTGTGCGGTCCCAGCC	0.532																0.026596	-37.761081	8.78155	5	183	KEEP	---	---	---	---	4	3	93	103	-1	capture	Missense_Mutation	SNP	56582201	56582201	MTMR4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9856	228
AXIN2	8313	broad.mit.edu	37	17	63553948	63553948	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:63553948G>A	uc002jfi.2	-	2	1080	c.791C>T	c.(790-792)ACG>ATG	p.T264M	AXIN2_uc010den.1_Missense_Mutation_p.T264M|AXIN2_uc002jfh.2_Missense_Mutation_p.T264M|AXIN2_uc002jfj.1_Missense_Mutation_p.T264M	NM_004655	NP_004646	Q9Y2T1	AXIN2_HUMAN	axin 2	264					cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2						AACAGTTTCCGTGGACCTCAC	0.537					240							Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				0.46729	155.777165	155.872518	50	57	KEEP	---	---	---	---	28	26	35	31	-1	capture	Missense_Mutation	SNP	63553948	63553948	AXIN2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1227	228
EMR3	84658	broad.mit.edu	37	19	14785604	14785604	+	Translation_Start_Site	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14785604C>T	uc002mzi.3	-	1	127	c.-21G>A	c.(-23--19)GCGTG>GCATG		EMR3_uc010dzp.2_Translation_Start_Site|EMR3_uc010xnv.1_Translation_Start_Site	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						GGGTATCCCACGCCAGCCAGC	0.507																0.287129	75.177901	79.257074	29	72	KEEP	---	---	---	---	13	17	43	38	-1	capture	Translation_Start_Site	SNP	14785604	14785604	EMR3	19	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	5061	228
F2RL3	9002	broad.mit.edu	37	19	17000950	17000950	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17000950G>A	uc002nfa.2	+	2	851	c.676G>A	c.(676-678)GTG>ATG	p.V226M		NM_003950	NP_003941	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	226	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation|positive regulation of release of sequestered calcium ion into cytosol	extracellular region|integral to plasma membrane	thrombin receptor activity				0						CTCCGATCGCGTGCTCTGCCA	0.701																0.266667	8.792603	9.531238	4	11	KEEP	---	---	---	---	1	3	6	8	-1	capture	Missense_Mutation	SNP	17000950	17000950	F2RL3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5300	228
FFAR3	2865	broad.mit.edu	37	19	35849928	35849928	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35849928C>T	uc002nzd.2	+	2	211	c.136C>T	c.(136-138)CGC>TGC	p.R46C	FFAR3_uc010xsu.1_RNA	NM_005304	NP_005295	O14843	FFAR3_HUMAN	free fatty acid receptor 3	46	Cytoplasmic.					integral to plasma membrane	G-protein coupled receptor activity|lipid binding				0	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GCTGCAGCGCCGCCCGGTGGC	0.637	Esophageal Squamous(185;1742 2042 21963 24215 27871)															0.136659	95.745633	154.661112	63	398	KEEP	---	---	---	---	43	28	252	234	-1	capture	Missense_Mutation	SNP	35849928	35849928	FFAR3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5775	228
ZNF229	7772	broad.mit.edu	37	19	44932920	44932920	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44932920G>A	uc002oze.1	-	6	2470	c.2036C>T	c.(2035-2037)ACG>ATG	p.T679M	ZNF229_uc010ejk.1_Missense_Mutation_p.T333M|ZNF229_uc010ejl.1_Missense_Mutation_p.T673M	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	679					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				CTTTTTTCCCGTGTGGACTCG	0.512																0.44206	307.990458	308.67215	103	130	KEEP	---	---	---	---	56	54	73	73	-1	capture	Missense_Mutation	SNP	44932920	44932920	ZNF229	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17662	228
ZNF534	147658	broad.mit.edu	37	19	52942354	52942354	+	Silent	SNP	A	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52942354A>G	uc002pzk.2	+	4	1741	c.1680A>G	c.(1678-1680)GAA>GAG	p.E560E	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Silent_p.E547E	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	560					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATACTGGAGAAAAGCCTTACA	0.433																0.111111	4.504822	8.541566	3	24	KEEP	---	---	---	---	1	2	11	14	-1	capture	Silent	SNP	52942354	52942354	ZNF534	19	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	17852	228
EHD3	30845	broad.mit.edu	37	2	31484475	31484475	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31484475A>T	uc002rnu.2	+	5	1584	c.976A>T	c.(976-978)AAC>TAC	p.N326Y	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	326					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CGGGAAGGACAACAAGAAGAA	0.552																0.068966	-11.989823	32.57978	16	216	KEEP	---	---	---	---	9	8	106	130	-1	capture	Missense_Mutation	SNP	31484475	31484475	EHD3	2	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	4934	228
DPP10	57628	broad.mit.edu	37	2	116497460	116497460	+	Silent	SNP	G	A	A	rs146251151		TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116497460G>A	uc002tla.1	+	9	1300	c.843G>A	c.(841-843)CCG>CCA	p.P281P	DPP10_uc002tlb.1_Silent_p.P231P|DPP10_uc002tlc.1_Silent_p.P277P|DPP10_uc002tle.2_Silent_p.P285P|DPP10_uc002tlf.1_Silent_p.P274P	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	281	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AGCAGTATCCGTATCCTAAGG	0.423																0.381643	233.473479	236.017545	79	128	KEEP	---	---	---	---	50	66	90	87	-1	capture	Silent	SNP	116497460	116497460	DPP10	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4682	228
UGGT1	56886	broad.mit.edu	37	2	128939777	128939777	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128939777G>T	uc002tps.2	+	37	4335	c.4157G>T	c.(4156-4158)TGT>TTT	p.C1386F	UGGT1_uc002tpr.2_Missense_Mutation_p.C1362F	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	1386	Glucosyltransferase (By similarity).				'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						ACTCCTTTCTGTGACAGCCGA	0.418																0.431472	262.760637	263.563031	85	112	KEEP	---	---	---	---	48	44	63	64	0.521739130435	capture	Missense_Mutation	SNP	128939777	128939777	UGGT1	2	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	16823	228
GCA	25801	broad.mit.edu	37	2	163204170	163204170	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163204170G>C	uc002ucg.2	+	2	286	c.110G>C	c.(109-111)GGA>GCA	p.G37A	GCA_uc010zcu.1_Missense_Mutation_p.G18A	NM_012198	NP_036330	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	37					cellular membrane fusion	cytoplasm|plasma membrane	calcium ion binding|protein homodimerization activity				0						CTCCTCGATGGATACTCTGGG	0.463																0.443478	181.814741	182.134166	51	64	KEEP	---	---	---	---	21	34	31	37	-1	capture	Missense_Mutation	SNP	163204170	163204170	GCA	2	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	6223	228
TTN	7273	broad.mit.edu	37	2	179598493	179598493	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179598493A>G	uc010zfg.1	-	50	12115	c.11891T>C	c.(11890-11892)ATC>ACC	p.I3964T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.I625T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4891							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTTCTCTGATGACCTCTTG	0.448					8722											0.020619	-62.896463	11.991201	6	285	KEEP	---	---	---	---	5	2	152	173	-1	capture	Missense_Mutation	SNP	179598493	179598493	TTN	2	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	16617	228
GLS	2744	broad.mit.edu	37	2	191765419	191765419	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:191765419G>A	uc002usf.2	+	4	999	c.735G>A	c.(733-735)AAG>AAA	p.K245K	GLS_uc002use.2_Silent_p.K245K	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor	245					cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CTGGAGGAAAGGTAATGCTTT	0.323																0.181818	39.87052	48.22051	16	72	KEEP	---	---	---	---	10	7	48	35	-1	capture	Silent	SNP	191765419	191765419	GLS	2	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	6399	228
ZNFX1	57169	broad.mit.edu	37	20	47887010	47887010	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47887010G>A	uc002xui.2	-	3	1586	c.1339C>T	c.(1339-1341)CGA>TGA	p.R447*		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	447							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TAGAGCAATCGTTTGGAATTC	0.468																0.2	139.197233	165.128472	62	248	KEEP	---	---	---	---	33	31	118	150	-1	capture	Nonsense_Mutation	SNP	47887010	47887010	ZNFX1	20	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	18081	228
PRIC285	85441	broad.mit.edu	37	20	62200284	62200284	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62200284G>A	uc002yfm.2	-	6	2049	c.1157C>T	c.(1156-1158)GCG>GTG	p.A386V	PRIC285_uc002yfl.1_5'Flank	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	386					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			TCCCGGAGGCGCGAAGAGCAT	0.677																0.345679	75.982292	77.682339	28	53	KEEP	---	---	---	---	14	17	26	34	-1	capture	Missense_Mutation	SNP	62200284	62200284	PRIC285	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12381	228
CYTSA	23384	broad.mit.edu	37	22	24807598	24807598	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24807598C>T	uc002zzw.2	+	15	3437	c.3130C>T	c.(3130-3132)CTG>TTG	p.L1044L	CYTSA_uc002zzv.3_Silent_p.L1044L|CYTSA_uc011ajq.1_Intron	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	1044	CH.				cell cycle|cell division						0						GAATGATGGGCTGGCCTTCTG	0.493																0.611111	312.831024	314.577686	99	63	KEEP	---	---	---	---	48	52	32	37	-1	capture	Silent	SNP	24807598	24807598	CYTSA	22	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	4168	228
RBMS3	27303	broad.mit.edu	37	3	30032601	30032601	+	Missense_Mutation	SNP	C	G	G	rs143165101		TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:30032601C>G	uc003cel.2	+	14	1438	c.1208C>G	c.(1207-1209)ACA>AGA	p.T403R	RBMS3_uc003cek.2_Missense_Mutation_p.T387R|RBMS3_uc010hfq.2_Missense_Mutation_p.T400R|RBMS3_uc003cem.2_Missense_Mutation_p.T385R|RBMS3_uc010hfr.2_Missense_Mutation_p.T387R	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting	403						cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				TCTCCCCAGACAGTGGCACCT	0.483																0.422018	166.835228	167.413155	46	63	KEEP	---	---	---	---	23	28	42	29	-1	capture	Missense_Mutation	SNP	30032601	30032601	RBMS3	3	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	13045	228
CCR9	10803	broad.mit.edu	37	3	45942421	45942421	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45942421G>A	uc003coz.1	+	3	298	c.141G>A	c.(139-141)GCG>GCA	p.A47A	LZTFL1_uc003coy.1_Intron|LZTFL1_uc011bak.1_Intron|CCR9_uc010hiv.1_Silent_p.A35A|CCR9_uc003cpa.1_Silent_p.A35A	NM_031200	NP_112477	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9 isoform A	47	Extracellular (Potential).				cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane				ovary(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		GGCAGTTTGCGAGCCATTTCC	0.468																0.477011	259.053841	259.130474	83	91	KEEP	---	---	---	---	71	49	73	90	-1	capture	Silent	SNP	45942421	45942421	CCR9	3	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	2919	228
STAB1	23166	broad.mit.edu	37	3	52540233	52540233	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52540233G>A	uc003dej.2	+	17	1871	c.1797G>A	c.(1795-1797)GCG>GCA	p.A599A	STAB1_uc003dei.1_Silent_p.A599A	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	599	Extracellular (Potential).|FAS1 2.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TCACCATGGCGAACCAGGTCC	0.622																0.307692	21.990413	22.84749	8	18	KEEP	---	---	---	---	7	3	11	10	-1	capture	Silent	SNP	52540233	52540233	STAB1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	15127	228
GCET2	257144	broad.mit.edu	37	3	111852081	111852081	+	Translation_Start_Site	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111852081G>A	uc003dys.1	-	1	37	c.-113C>T	c.(-115--111)CACGG>CATGG		GCET2_uc003dyt.1_Translation_Start_Site	NM_152785	NP_689998	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform							mitochondrion					0						CTGGCCACCCGTGCAGAGACA	0.557																0.478873	100.442042	100.469824	34	37	KEEP	---	---	---	---	15	19	18	19	-1	capture	Translation_Start_Site	SNP	111852081	111852081	GCET2	3	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	6228	228
STXBP5L	9515	broad.mit.edu	37	3	120764376	120764376	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120764376G>A	uc003eec.3	+	5	604	c.464G>A	c.(463-465)CGG>CAG	p.R155Q	STXBP5L_uc011bji.1_Missense_Mutation_p.R155Q	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	155					exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		AAATTTAACCGGGAACGGTAA	0.358																0.374332	228.209875	230.800736	70	117	KEEP	---	---	---	---	39	68	74	85	-1	capture	Missense_Mutation	SNP	120764376	120764376	STXBP5L	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15247	228
MECOM	2122	broad.mit.edu	37	3	168833869	168833869	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168833869C>T	uc003ffi.3	-	7	1496	c.1227G>A	c.(1225-1227)TCG>TCA	p.S409S	MECOM_uc010hwk.1_Silent_p.S432S|MECOM_uc003ffj.3_Silent_p.S474S|MECOM_uc011bpi.1_Silent_p.S410S|MECOM_uc003ffn.3_Silent_p.S409S|MECOM_uc003ffk.2_Silent_p.S409S|MECOM_uc003ffl.2_Silent_p.S569S|MECOM_uc011bpj.1_Silent_p.S597S|MECOM_uc011bpk.1_Silent_p.S399S|MECOM_uc010hwn.2_Silent_p.S597S	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	409					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						GATCAGAGCCCGAGGTTGTTT	0.423				p.S409S(ZR7530-Tumor)	646											0.518293	283.674335	283.721919	85	79	KEEP	---	---	---	---	49	45	49	38	-1	capture	Silent	SNP	168833869	168833869	MECOM	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9335	228
ACAP2	23527	broad.mit.edu	37	3	195102729	195102729	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195102729A>G	uc003fun.3	-	3	375	c.134T>C	c.(133-135)ATG>ACG	p.M45T	ACAP2_uc003fuo.2_Missense_Mutation_p.M45T	NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	45	BAR.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						AGTATCAATCATTGCAATACA	0.343																0.453333	112.345875	112.487382	34	41	KEEP	---	---	---	---	16	18	20	24	-1	capture	Missense_Mutation	SNP	195102729	195102729	ACAP2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	119	228
GPR78	27201	broad.mit.edu	37	4	8583361	8583361	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8583361G>A	uc003glk.2	+	1	1071	c.652G>A	c.(652-654)GCC>ACC	p.A218T	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	218	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						CGCGCTGCTCGCCGACCTGCA	0.687																0.5	11.398565	11.398565	4	4	KEEP	---	---	---	---	1	3	2	2	-1	capture	Missense_Mutation	SNP	8583361	8583361	GPR78	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6643	228
FGB	2244	broad.mit.edu	37	4	155487823	155487823	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155487823A>T	uc003ioa.3	+	3	528	c.489A>T	c.(487-489)AAA>AAT	p.K163N	FGB_uc010ipu.1_RNA|FGB_uc003iob.3_Missense_Mutation_p.K160N|FGB_uc010ipv.2_Missense_Mutation_p.K101N|FGB_uc010ipw.2_Missense_Mutation_p.K160N|FGB_uc003ioc.3_Intron	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein	163	Potential.	Cleavage; by plasmin; to break down fibrin clots.			platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AGCAAGTAAAAGGTAGATATC	0.403	NSCLC(106;1133 1613 21870 46110 52656)															0.050955	-16.939473	16.599624	8	149	KEEP	---	---	---	---	7	3	73	91	-1	capture	Missense_Mutation	SNP	155487823	155487823	FGB	4	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	5777	228
C5orf42	65250	broad.mit.edu	37	5	37167302	37167302	+	Missense_Mutation	SNP	T	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37167302T>A	uc011cpa.1	-	35	7478	c.7247A>T	c.(7246-7248)CAA>CTA	p.Q2416L	C5orf42_uc011coy.1_Missense_Mutation_p.Q916L|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.Q1491L	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2416										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TGGGATAAGTTGTGTTTTTTT	0.313																0.041237	-13.585774	8.374226	4	93	KEEP	---	---	---	---	3	1	51	56	-1	capture	Missense_Mutation	SNP	37167302	37167302	C5orf42	5	T	A	A	A	1	0	0	0	0	1	0	0	0	819	63	4	4	2278	228
C7	730	broad.mit.edu	37	5	40976859	40976859	+	Silent	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40976859G>A	uc003jmh.2	+	16	2196	c.2082G>A	c.(2080-2082)CCG>CCA	p.P694P	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	694					complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TAGAAAATCCGTTAACACAGG	0.433																0.5	25.800126	25.800126	8	8	KEEP	---	---	---	---	4	5	6	3	-1	capture	Silent	SNP	40976859	40976859	C7	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	2352	228
ACTBL2	345651	broad.mit.edu	37	5	56778318	56778318	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56778318C>T	uc003jrm.2	-	1	319	c.217G>A	c.(217-219)GAG>AAG	p.E73K		NM_001017992	NP_001017992	Q562R1	ACTBL_HUMAN	actin, beta-like 2	73						cytoplasm|cytoskeleton	ATP binding			ovary(3)	3		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		ACTCCATGCTCGATAGGATAC	0.542																0.368421	62.172385	63.034749	21	36	KEEP	---	---	---	---	14	11	20	20	-1	capture	Missense_Mutation	SNP	56778318	56778318	ACTBL2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	194	228
GPR98	84059	broad.mit.edu	37	5	89990447	89990447	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89990447G>A	uc003kju.2	+	33	7970	c.7874G>A	c.(7873-7875)CGT>CAT	p.R2625H	GPR98_uc003kjt.2_Missense_Mutation_p.R331H|GPR98_uc003kjv.2_Missense_Mutation_p.R225H	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2625	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTCGAATGGCGTGTTGTTGGT	0.473																0.092486	5.461841	34.390444	16	157	KEEP	---	---	---	---	5	11	80	87	-1	capture	Missense_Mutation	SNP	89990447	89990447	GPR98	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6654	228
PCDHA2	56146	broad.mit.edu	37	5	140176747	140176747	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140176747C>T	uc003lhd.2	+	1	2304	c.2198C>T	c.(2197-2199)GCG>GTG	p.A733V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A733V|PCDHA2_uc011czy.1_Missense_Mutation_p.A733V	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	733	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGCGCGCGCGCCAGGAAAG	0.682																0.419355	114.410718	114.937961	39	54	KEEP	---	---	---	---	17	24	35	24	-1	capture	Missense_Mutation	SNP	140176747	140176747	PCDHA2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11427	228
PCDHGB1	56104	broad.mit.edu	37	5	140730079	140730079	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140730079C>T	uc003ljo.1	+	1	252	c.252C>T	c.(250-252)AAC>AAT	p.N84N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Silent_p.N84N	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	84	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTTAGTGAACGGTAGGATAG	0.473														OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.304348	78.865728	82.007659	28	64	KEEP	---	---	---	---	18	18	35	36	-1	capture	Silent	SNP	140730079	140730079	PCDHGB1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11465	228
FAM71B	153745	broad.mit.edu	37	5	156592869	156592869	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156592869C>T	uc003lwn.2	-	1	411	c.311G>A	c.(310-312)CGG>CAG	p.R104Q		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	104						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTTGGCAAACCGGCCCCATCT	0.542																0.314607	79.269583	81.990331	28	61	KEEP	---	---	---	---	11	17	31	32	-1	capture	Missense_Mutation	SNP	156592869	156592869	FAM71B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5556	228
RANBP17	64901	broad.mit.edu	37	5	170725815	170725815	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170725815C>T	uc003mba.2	+	28	3236	c.3220C>T	c.(3220-3222)CGC>TGC	p.R1074C	RANBP17_uc003mbb.2_Missense_Mutation_p.R399C|RANBP17_uc010jjs.2_RNA	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1074					mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGAGGCGTTGCGCAGTGATGG	0.502					661	T	TRD@	ALL								0.375	69.184087	70.061907	24	40	KEEP	---	---	---	---	18	17	29	19	-1	capture	Missense_Mutation	SNP	170725815	170725815	RANBP17	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12922	228
FBXW11	23291	broad.mit.edu	37	5	171299943	171299943	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:171299943G>A	uc003mbm.1	-	9	1581	c.1210C>T	c.(1210-1212)CGG>TGG	p.R404W	FBXW11_uc011dey.1_Missense_Mutation_p.R372W|FBXW11_uc003mbl.1_Missense_Mutation_p.R391W|FBXW11_uc003mbn.1_Missense_Mutation_p.R370W	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform	404	WD 5.				cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCAATGCCCCGCTTGTGCCCA	0.463																0.319672	104.785398	108.30872	39	83	KEEP	---	---	---	---	24	23	45	42	-1	capture	Missense_Mutation	SNP	171299943	171299943	FBXW11	5	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	5710	228
BCLAF1	9774	broad.mit.edu	37	6	136597406	136597406	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136597406C>A	uc003qgx.1	-	5	1510	c.1257G>T	c.(1255-1257)CAG>CAT	p.Q419H	BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Missense_Mutation_p.Q417H|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.Q417H	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	419					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AACTTTTACCCTGATCTGCGA	0.418	Colon(142;1534 1789 5427 7063 28491)															0.150138	192.914946	278.088431	109	617	KEEP	---	---	---	---	55	59	351	307	0.517543859649	capture	Missense_Mutation	SNP	136597406	136597406	BCLAF1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	1372	228
CDK13	8621	broad.mit.edu	37	7	40127783	40127783	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40127783C>T	uc003thh.3	+	12	3370	c.3088C>T	c.(3088-3090)CAG>TAG	p.Q1030*	CDK13_uc003thi.3_Nonsense_Mutation_p.Q1030*|CDK13_uc003thj.2_Nonsense_Mutation_p.Q81*	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1030					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						AAGACAGAAGCAGATGGGCAT	0.423					238											0.240964	91.406338	101.578134	40	126	KEEP	---	---	---	---	23	20	75	71	-1	capture	Nonsense_Mutation	SNP	40127783	40127783	CDK13	7	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	3099	228
ABCA13	154664	broad.mit.edu	37	7	48287917	48287917	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48287917C>G	uc003toq.2	+	14	1766	c.1741C>G	c.(1741-1743)CTT>GTT	p.L581V	ABCA13_uc010kyr.2_Missense_Mutation_p.L84V	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	581					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTGGCAGGAACTTGAGATGCA	0.428																0.019108	-71.467756	10.113571	6	308	KEEP	---	---	---	---	4	3	172	219	-1	capture	Missense_Mutation	SNP	48287917	48287917	ABCA13	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	31	228
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.522751	1520.814999	1521.247565	494	451	KEEP	---	---	---	---	232	303	194	270	-1	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	228
PSPH	5723	broad.mit.edu	37	7	56088826	56088826	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56088826C>G	uc003trg.2	-	3	443	c.80G>C	c.(79-81)AGA>ACA	p.R27T	PSPH_uc003trh.2_Missense_Mutation_p.R27T|PSPH_uc003tri.2_Missense_Mutation_p.R27T|PSPH_uc003trj.2_Missense_Mutation_p.R56T	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	27					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TCCTTCTTCTCTGATGACCGT	0.448																0.276549	754.134793	794.859931	250	654	KEEP	---	---	---	---	132	145	347	376	-1	capture	Missense_Mutation	SNP	56088826	56088826	PSPH	7	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	12612	228
ZNF735	730291	broad.mit.edu	37	7	63680236	63680236	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63680236C>T	uc011kdn.1	+	4	807	c.807C>T	c.(805-807)TAC>TAT	p.Y269Y		NM_001159524	NP_001152996	P0CB33	ZN735_HUMAN	zinc finger protein 735	269	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGAAACCCTACGCATGTGAAG	0.458																0.218182	55.339974	63.392896	24	86	KEEP	---	---	---	---	12	12	52	42	-1	capture	Silent	SNP	63680236	63680236	ZNF735	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	18001	228
ZNF107	51427	broad.mit.edu	37	7	64167281	64167281	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:64167281C>A	uc003ttd.2	+	7	1385	c.599C>A	c.(598-600)GCC>GAC	p.A200D	ZNF107_uc003tte.2_Missense_Mutation_p.A200D	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	200	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TTTAAACAGGCCTCACACCTT	0.373																0.259434	136.843441	147.945085	55	157	KEEP	---	---	---	---	26	32	76	89	0.551724137931	capture	Missense_Mutation	SNP	64167281	64167281	ZNF107	7	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	17595	228
MAGI2	9863	broad.mit.edu	37	7	77807399	77807399	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77807399C>T	uc003ugx.2	-	14	2586	c.2332G>A	c.(2332-2334)GAT>AAT	p.D778N	MAGI2_uc003ugy.2_Missense_Mutation_p.D764N|MAGI2_uc010ldx.1_Missense_Mutation_p.D371N	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	778	PDZ 4.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGATGAACATCCAATTCCTTA	0.453																0.222826	96.276493	109.278269	41	143	KEEP	---	---	---	---	22	24	74	91	-1	capture	Missense_Mutation	SNP	77807399	77807399	MAGI2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9105	228
PCLO	27445	broad.mit.edu	37	7	82582560	82582560	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82582560G>A	uc003uhx.2	-	5	7998	c.7709C>T	c.(7708-7710)CCA>CTA	p.P2570L	PCLO_uc003uhv.2_Missense_Mutation_p.P2570L|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2501					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGAAAATCTTGGTGAAGACTT	0.403																0.224299	240.086792	269.98983	96	332	KEEP	---	---	---	---	55	45	182	167	-1	capture	Missense_Mutation	SNP	82582560	82582560	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	11486	228
GRM3	2913	broad.mit.edu	37	7	86416220	86416220	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86416220G>A	uc003uid.2	+	3	2211	c.1112G>A	c.(1111-1113)CGC>CAC	p.R371H	GRM3_uc010lef.2_Missense_Mutation_p.R369H|GRM3_uc010leg.2_Missense_Mutation_p.R243H|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	371	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	AACCACAGGCGCGTCTGCGAC	0.567	GBM(52;969 1098 3139 52280)															0.213115	58.786181	68.062059	26	96	KEEP	---	---	---	---	16	13	60	52	-1	capture	Missense_Mutation	SNP	86416220	86416220	GRM3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6731	228
GRM3	2913	broad.mit.edu	37	7	86416334	86416334	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86416334G>A	uc003uid.2	+	3	2325	c.1226G>A	c.(1225-1227)CGC>CAC	p.R409H	GRM3_uc010lef.2_Missense_Mutation_p.R407H|GRM3_uc010leg.2_Missense_Mutation_p.R281H|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	409	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	AAAATGCAGCGCACCCTCTGT	0.498	GBM(52;969 1098 3139 52280)															0.25522	280.152906	303.580068	110	321	KEEP	---	---	---	---	59	64	152	195	-1	capture	Missense_Mutation	SNP	86416334	86416334	GRM3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6731	228
GRM3	2913	broad.mit.edu	37	7	86468918	86468918	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86468918C>T	uc003uid.2	+	4	3187	c.2088C>T	c.(2086-2088)ATC>ATT	p.I696I	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Silent_p.I568I|GRM3_uc010leh.2_Silent_p.I288I	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	696	Helical; Name=4; (Potential).				synaptic transmission	integral to plasma membrane		p.I696T(1)		lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TGGGTCTGATCCTGGTGCAAA	0.527	GBM(52;969 1098 3139 52280)															0.066327	-10.589304	27.644337	13	183	KEEP	---	---	---	---	4	9	94	100	-1	capture	Silent	SNP	86468918	86468918	GRM3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	382	30	2	2	6731	228
STEAP1	26872	broad.mit.edu	37	7	89791325	89791325	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:89791325T>C	uc003ujx.2	+	4	895	c.695T>C	c.(694-696)CTG>CCG	p.L232P	STEAP1_uc010lem.2_Missense_Mutation_p.L232P	NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the	232	Ferric oxidoreductase.|Helical; (Potential).				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)					ATACTGGCTCTGTTGGCTGTG	0.378																0.229282	198.029435	222.366794	83	279	KEEP	---	---	---	---	50	53	182	183	-1	capture	Missense_Mutation	SNP	89791325	89791325	STEAP1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	15167	228
TRPV5	56302	broad.mit.edu	37	7	142611855	142611855	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142611855G>A	uc003wby.1	-	12	1738	c.1474C>T	c.(1474-1476)CGT>TGT	p.R492C		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	492	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					CAGCAGAAACGCATTAGGTCT	0.463																0.05618	-8.001566	10.429831	5	84	KEEP	---	---	---	---	2	3	59	42	-1	capture	Missense_Mutation	SNP	142611855	142611855	TRPV5	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16482	228
GATA4	2626	broad.mit.edu	37	8	11607623	11607623	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11607623G>A	uc003wuc.2	+	4	1341	c.787G>A	c.(787-789)GCC>ACC	p.A263T	GATA4_uc003wub.1_Missense_Mutation_p.A57T|GATA4_uc011kxc.1_Missense_Mutation_p.A264T	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4	263					atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		CTTGCAGTCCGCCTCCCGCCG	0.637																0.041667	-13.542362	8.094489	4	92	KEEP	---	---	---	---	3	1	42	55	-1	capture	Missense_Mutation	SNP	11607623	11607623	GATA4	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6196	228
ENPP2	5168	broad.mit.edu	37	8	120629759	120629759	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120629759C>T	uc003yot.1	-	6	610	c.524G>A	c.(523-525)CGT>CAT	p.R175H	ENPP2_uc003yos.1_Missense_Mutation_p.R175H|ENPP2_uc010mdd.1_Missense_Mutation_p.R175H	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	175					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GTATGATGCACGGAAGCCATC	0.373	Melanoma(20;305 879 2501 4818 31020)															0.46	69.825222	69.894068	23	27	KEEP	---	---	---	---	19	9	23	11	-1	capture	Missense_Mutation	SNP	120629759	120629759	ENPP2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5085	228
BAI1	575	broad.mit.edu	37	8	143625027	143625027	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143625027C>T	uc003ywm.2	+	29	4698	c.4515C>T	c.(4513-4515)CAC>CAT	p.H1505H		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1505	Cytoplasmic (Potential).|Necessary for interaction with MAGI1.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGCTGCAGCACGCAGCGGAGA	0.662					829											0.666667	19.553053	19.774809	6	3	KEEP	---	---	---	---	3	3	2	1	-1	capture	Silent	SNP	143625027	143625027	BAI1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1287	228
OR13C9	286362	broad.mit.edu	37	9	107379553	107379553	+	Silent	SNP	C	T	T			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107379553C>T	uc011lvr.1	-	1	933	c.933G>A	c.(931-933)CCG>CCA	p.P311P		NM_001001956	NP_001001956	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C,	311	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACCTTCTGTTCGGTAGGTGTT	0.353																0.324873	362.958904	373.684892	128	266	KEEP	---	---	---	---	71	64	120	180	-1	capture	Silent	SNP	107379553	107379553	OR13C9	9	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	10843	228
BAT2L1	84726	broad.mit.edu	37	9	134350722	134350722	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:134350722G>A	uc004can.3	+	15	3261	c.3206G>A	c.(3205-3207)CGT>CAT	p.R1069H	BAT2L1_uc010mzj.1_Missense_Mutation_p.R652H|BAT2L1_uc004cao.3_Missense_Mutation_p.R427H	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1069							protein binding				0						GGCCGGGGCCGTGGTTTCAGA	0.612																0.238095	35.091213	39.040566	15	48	KEEP	---	---	---	---	14	3	19	36	-1	capture	Missense_Mutation	SNP	134350722	134350722	BAT2L1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1309	228
CEL	1056	broad.mit.edu	37	9	135945963	135945963	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135945963G>A	uc010naa.1	+	10	1427	c.1411G>A	c.(1411-1413)GCC>ACC	p.A471T		NM_001807	NP_001798	P19835	CEL_HUMAN	carboxyl ester lipase precursor	468					cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		GAAGCCCTTCGCCACCCCCAC	0.582																0.095238	11.977196	67.081203	32	304	KEEP	---	---	---	---	22	16	173	178	-1	capture	Missense_Mutation	SNP	135945963	135945963	CEL	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3177	228
EGFL6	25975	broad.mit.edu	37	X	13624543	13624543	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:13624543G>A	uc004cvi.2	+	6	806	c.566G>A	c.(565-567)CGA>CAA	p.R189Q	EGFL6_uc004cvj.2_Missense_Mutation_p.R189Q|EGFL6_uc011mik.1_Missense_Mutation_p.R90Q	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6	189	EGF-like 4; calcium-binding (Potential).				cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						CCCTACAATCGAAGATGTGTG	0.398																0.8875	488.55045	512.266665	142	18	KEEP	---	---	---	---	65	90	10	9	-1	capture	Missense_Mutation	SNP	13624543	13624543	EGFL6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4918	228
LCE4A	199834	broad.mit.edu	37	1	152681693	152681698	+	In_Frame_Del	DEL	TGTGGT	-	-	rs113617356;rs11269814;rs74871420;rs79268808		TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152681693_152681698delTGTGGT	uc001fak.2	+	1	171_176	c.142_147delTGTGGT	c.(142-147)TGTGGTdel	p.CG48del		NM_178356	NP_848133	Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	48_49	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			CTCTGGGGGCTGTGGTTGCTGCAGCT	0.578																0.03			7	202		---	---	---	---						capture_indel	In_Frame_Del	DEL	152681693	152681698	LCE4A	1	TGTGGT	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	8594	228
TNK2	10188	broad.mit.edu	37	3	195597005	195597006	+	Frame_Shift_Ins	INS	-	G	G			TCGA-32-1970-01	TCGA-32-1970-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195597005_195597006insG	uc003fvu.1	-	11	2065_2066	c.1522_1523insC	c.(1522-1524)CAGfs	p.Q508fs	TNK2_uc003fvq.1_5'Flank|TNK2_uc003fvr.1_Frame_Shift_Ins_p.Q18fs|TNK2_uc003fvs.1_Frame_Shift_Ins_p.Q540fs|TNK2_uc003fvt.1_Frame_Shift_Ins_p.Q571fs|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_Frame_Shift_Ins_p.Q338fs	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	508				Missing (in Ref. 4; AAH08884).	positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TCCTAGATGCTGGGGGGGCCGG	0.614					288											0.47			7	8		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	195597005	195597006	TNK2	3	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	16201	228
