Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SCNN1D	6339	broad.mit.edu	37	1	1226037	1226037	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1226037C>A	uc001adu.1	+	14	2012	c.1388C>A	c.(1387-1389)TCC>TAC	p.S463Y	SCNN1D_uc001adt.1_Missense_Mutation_p.S627Y|SCNN1D_uc001adw.2_Missense_Mutation_p.S529Y|SCNN1D_uc001adx.2_Missense_Mutation_p.S252Y|SCNN1D_uc001adv.2_Missense_Mutation_p.S463Y	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		TTCAAGCTCTCCACTGGGACC	0.647													41	106	---	---	---	---	PASS
AGTRAP	57085	broad.mit.edu	37	1	11808673	11808673	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11808673G>A	uc001asv.2	+						AGTRAP_uc001ast.2_Intron|AGTRAP_uc001asu.2_Intron|AGTRAP_uc001asw.2_Intron|AGTRAP_uc001asx.2_Intron	NM_020350	NP_065083	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein							cytoplasmic vesicle membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein binding		AGTRAP/BRAF(2)	stomach(2)	2	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CACTGGTGAGGCCACCACCTC	0.662													18	44	---	---	---	---	PASS
IGSF21	84966	broad.mit.edu	37	1	18703336	18703336	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18703336G>A	uc001bau.1	+	8	1527	c.1144G>A	c.(1144-1146)GGG>AGG	p.G382R	IGSF21_uc001bav.1_Missense_Mutation_p.G203R	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	382	Ig-like 2.					extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GACGCGGGTTGGGAGCCGCCT	0.647													35	85	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21133912	21133912	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21133912T>C	uc001bec.2	-	32	4914	c.4658A>G	c.(4657-4659)AAG>AGG	p.K1553R	EIF4G3_uc010odi.1_Missense_Mutation_p.K1157R|EIF4G3_uc010odj.1_Missense_Mutation_p.K1552R|EIF4G3_uc009vpz.2_Missense_Mutation_p.K1273R|EIF4G3_uc001bed.2_Missense_Mutation_p.K1553R|EIF4G3_uc001bef.2_Missense_Mutation_p.K1589R|EIF4G3_uc001bee.2_Missense_Mutation_p.K1559R	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	1553	EIF4A-binding (By similarity).|W2.				interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TGCAGGGTCCTTGCTGCTCTC	0.498													144	228	---	---	---	---	PASS
TMEM57	55219	broad.mit.edu	37	1	25783156	25783156	+	Silent	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25783156T>A	uc001bkk.2	+	5	688	c.486T>A	c.(484-486)CCT>CCA	p.P162P	TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron|TMEM57_uc009vrt.2_RNA	NM_018202	NP_060672	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	162	Helical; (Potential).					axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGGTACCCTGTGGTAACTT	0.383													23	38	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29587268	29587268	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29587268G>A	uc001bru.2	+	7	1107	c.997G>A	c.(997-999)GAG>AAG	p.E333K	PTPRU_uc001brv.2_Missense_Mutation_p.E333K|PTPRU_uc001brw.2_Missense_Mutation_p.E333K|PTPRU_uc009vtq.2_Missense_Mutation_p.E333K|PTPRU_uc009vtr.2_Missense_Mutation_p.E333K	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	333	Fibronectin type-III 1.|Extracellular (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GCCCTGGGCTGAGGTGCACGC	0.637													65	89	---	---	---	---	PASS
LAPTM5	7805	broad.mit.edu	37	1	31214487	31214487	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31214487C>G	uc001bsc.2	-	3	349	c.258G>C	c.(256-258)AAG>AAC	p.K86N		NM_006762	NP_006753	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	86					transport	integral to plasma membrane|lysosomal membrane					0		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCCCTCACCTTGACTACGC	0.607													6	15	---	---	---	---	PASS
SDC3	9672	broad.mit.edu	37	1	31349607	31349607	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31349607G>T	uc001bse.2	-	3	709	c.662C>A	c.(661-663)ACG>AAG	p.T221K	SDC3_uc001bsd.2_Missense_Mutation_p.T163K	NM_014654	NP_055469	O75056	SDC3_HUMAN	syndecan 3	221	Extracellular (Potential).|Ser/Thr-rich (mucin-like).					integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		GGCCCGTGCCGTAGCCACTGT	0.672													6	34	---	---	---	---	PASS
TEKT2	27285	broad.mit.edu	37	1	36552339	36552339	+	Missense_Mutation	SNP	G	A	A	rs141019195		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36552339G>A	uc001bzr.2	+	5	650	c.523G>A	c.(523-525)GAC>AAC	p.D175N	TEKT2_uc001bzs.2_Missense_Mutation_p.D81N|ADPRHL2_uc001bzt.2_5'Flank|ADPRHL2_uc001bzu.2_5'Flank	NM_014466	NP_055281	Q9UIF3	TEKT2_HUMAN	tektin 2	175					cell projection organization|microtubule cytoskeleton organization	actin cytoskeleton|cilium axoneme|flagellar axoneme|focal adhesion|microtubule|nucleolus					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCTCAACTCCGACCATCGGGG	0.562													117	204	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37346264	37346264	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37346264G>T	uc001caz.2	-	3	656	c.521C>A	c.(520-522)TCA>TAA	p.S174*	GRIK3_uc001cba.1_Nonsense_Mutation_p.S174*	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	174	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CACGGTGGCTGACCGCCACTT	0.622													249	248	---	---	---	---	PASS
SNIP1	79753	broad.mit.edu	37	1	38005899	38005899	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38005899T>C	uc001cbi.2	-	3	858	c.785A>G	c.(784-786)TAC>TGC	p.Y262C	SNIP1_uc010oid.1_RNA	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein	262					production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding			upper_aerodigestive_tract(1)|lung(1)	2		Myeloproliferative disorder(586;0.0393)				TTTAAATGGGTAGAGACGCCA	0.488													79	99	---	---	---	---	PASS
PPIE	10450	broad.mit.edu	37	1	40207597	40207597	+	Intron	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40207597T>C	uc001cds.1	+						PPIE_uc001cdt.1_Intron|PPIE_uc010oiy.1_Intron|PPIE_uc001cdu.1_RNA|PPIE_uc001cdv.2_Intron|PPIE_uc001cdw.2_Intron|PPIE_uc001cdx.1_5'Flank	NM_006112	NP_006103	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E isoform 1						protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CAACATGGTATGGCTGGGAAT	0.418													42	49	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43898205	43898205	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43898205C>T	uc001cjk.1	+	23	3225	c.2763C>T	c.(2761-2763)CCC>CCT	p.P921P		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	1820						peroxisome		p.P921P(1)			0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGCCAGCCCCCAAGCACCTG	0.632													113	295	---	---	---	---	PASS
LRRC41	10489	broad.mit.edu	37	1	46763301	46763301	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46763301G>A	uc001cpn.2	-	3	335	c.291C>T	c.(289-291)CTC>CTT	p.L97L	LRRC41_uc010omb.1_Silent_p.L97L|LRRC41_uc001cpo.1_Silent_p.L97L	NM_006369	NP_006360	Q15345	LRC41_HUMAN	MUF1 protein	97										ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)					CCTGAGTTGAGAGGCCTGTAA	0.463													30	76	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47755241	47755241	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47755241C>A	uc001crc.1	-	9	1044	c.889G>T	c.(889-891)GGA>TGA	p.G297*	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Nonsense_Mutation_p.G250*|STIL_uc010omo.1_Nonsense_Mutation_p.G297*|STIL_uc001crd.1_Nonsense_Mutation_p.G297*|STIL_uc001cre.1_Nonsense_Mutation_p.G297*|STIL_uc001crg.1_Nonsense_Mutation_p.G250*	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	297					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				ATGAAATTTCCAGATTCTGAA	0.338													25	43	---	---	---	---	PASS
ELAVL4	1996	broad.mit.edu	37	1	50661265	50661265	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50661265G>A	uc001csb.2	+	5	809	c.541G>A	c.(541-543)GAT>AAT	p.D181N	ELAVL4_uc001cry.3_Missense_Mutation_p.D184N|ELAVL4_uc001crz.3_Missense_Mutation_p.D181N|ELAVL4_uc001csa.3_Missense_Mutation_p.D198N|ELAVL4_uc001csc.3_Missense_Mutation_p.D181N|ELAVL4_uc009vyu.2_Missense_Mutation_p.D186N|ELAVL4_uc010omz.1_Missense_Mutation_p.D186N	NM_021952	NP_068771	P26378	ELAV4_HUMAN	ELAV-like 4 isoform 1	181	RRM 2.				mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2						CATCCGCTTTGATAAGAGGAT	0.498													79	129	---	---	---	---	PASS
CPT2	1376	broad.mit.edu	37	1	53676551	53676551	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53676551A>C	uc001cvb.3	+	4	1720	c.1205A>C	c.(1204-1206)CAG>CCG	p.Q402P		NM_000098	NP_000089	P23786	CPT2_HUMAN	carnitine O-palmitoyltransferase precursor	402	Mitochondrial matrix (By similarity).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	mitochondrial inner membrane	carnitine O-palmitoyltransferase activity				0					L-Carnitine(DB00583)|Perhexiline(DB01074)	CCACAGAGCCAGCCAGCTACC	0.483													19	26	---	---	---	---	PASS
JUN	3725	broad.mit.edu	37	1	59248539	59248539	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59248539C>A	uc001cze.2	-	1	1247	c.204G>T	c.(202-204)CTG>CTT	p.L68L	uc001czf.2_5'Flank|uc010oop.1_5'Flank	NM_002228	NP_002219	P05412	JUN_HUMAN	jun oncogene	68					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding				0	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)	CCAGCTTGAGCAGCCCCACGT	0.662			A		sarcoma								124	273	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62330263	62330263	+	Nonsense_Mutation	SNP	T	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62330263T>G	uc001dab.2	+	20	2907	c.2793T>G	c.(2791-2793)TAT>TAG	p.Y931*	INADL_uc009waf.1_Nonsense_Mutation_p.Y931*|INADL_uc001daa.2_Nonsense_Mutation_p.Y931*|INADL_uc001dad.3_Nonsense_Mutation_p.Y628*|INADL_uc001dac.2_RNA	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	931					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GGACTGTCTATTCCCAGGAGG	0.502													83	122	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507031	74507031	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507031C>A	uc001dfy.3	-	7	1776	c.1584G>T	c.(1582-1584)TTG>TTT	p.L528F	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	528										ovary(2)	2						GTCCTCTGGTCAAAAGAGTGC	0.343													39	74	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86939149	86939149	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86939149G>C	uc001dlt.2	+	2	341	c.212G>C	c.(211-213)CGA>CCA	p.R71P	CLCA1_uc001dls.1_Intron	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	71					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		ACAGGAAAGCGATTTTATTTC	0.358													42	144	---	---	---	---	PASS
TBX15	6913	broad.mit.edu	37	1	119467405	119467405	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119467405C>A	uc001ehl.1	-	4	554	c.239G>T	c.(238-240)GGC>GTC	p.G80V		NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15	186	T-box.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		ATCAGCATTGCCAGCCACCAT	0.373													169	152	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151497266	151497266	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151497266G>C	uc009wmw.2	+	8	1662	c.1518G>C	c.(1516-1518)GAG>GAC	p.E506D		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	500	Glu-rich.|Potential.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CCCTGAAAGAGGAGGTAGCCT	0.612													48	28	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152191644	152191644	+	Nonsense_Mutation	SNP	C	A	A	rs141963410		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152191644C>A	uc001ezt.1	-	3	2537	c.2461G>T	c.(2461-2463)GAG>TAG	p.E821*		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	821	8.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGCCAGACTCGTGTTGCCCA	0.567													4	246	---	---	---	---	PASS
LCE2D	353141	broad.mit.edu	37	1	152636633	152636633	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152636633C>A	uc001fag.2	+	2	107	c.52C>A	c.(52-54)CCC>ACC	p.P18T		NM_178430	NP_848517	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	18	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAAATGTCCTCCCAAGTGTAC	0.517													311	218	---	---	---	---	PASS
LCE2D	353141	broad.mit.edu	37	1	152636634	152636634	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152636634C>A	uc001fag.2	+	2	108	c.53C>A	c.(52-54)CCC>CAC	p.P18H		NM_178430	NP_848517	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	18	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAATGTCCTCCCAAGTGTACC	0.522													307	221	---	---	---	---	PASS
IVL	3713	broad.mit.edu	37	1	152882692	152882692	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152882692A>G	uc001fau.2	+	2	465	c.419A>G	c.(418-420)AAG>AGG	p.K140R		NM_005547	NP_005538	P07476	INVO_HUMAN	involucrin	140					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(3)	3	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGCTAGTCAAGAGAGATGAG	0.348													21	70	---	---	---	---	PASS
PYGO2	90780	broad.mit.edu	37	1	154932143	154932143	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154932143C>T	uc001fft.2	-	3	539	c.333G>A	c.(331-333)GCG>GCA	p.A111A		NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	pygopus homolog 2	111	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding			skin(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GTACCTGGCCCGCCATGCCCC	0.662													24	40	---	---	---	---	PASS
RXFP4	339403	broad.mit.edu	37	1	155911494	155911494	+	5'UTR	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155911494C>T	uc010pgs.1	+	1						NM_181885	NP_871001	Q8TDU9	RL3R2_HUMAN	relaxin 3 receptor 2							integral to membrane|plasma membrane	angiotensin type II receptor activity				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATCTCTGATGCCCTGCGATGC	0.557													280	233	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156514248	156514248	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156514248T>C	uc001fpf.2	-	20	2396	c.2321A>G	c.(2320-2322)TAT>TGT	p.Y774C		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	774	IQ 2.				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCGCTGCCTATAACCCCGCCA	0.483													51	28	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157494125	157494125	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157494125T>A	uc001fqu.2	-	10	2341	c.2183A>T	c.(2182-2184)GAG>GTG	p.E728V	FCRL5_uc009wsm.2_Missense_Mutation_p.E728V|FCRL5_uc010phv.1_Missense_Mutation_p.E728V|FCRL5_uc010phw.1_Missense_Mutation_p.E643V	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	728	Extracellular (Potential).|Ig-like C2-type 7.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ATTGTCTGCCTCACAGGAGTA	0.557													46	157	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214813603	214813603	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214813603A>G	uc001hkm.2	+	12	2096	c.1922A>G	c.(1921-1923)CAG>CGG	p.Q641R		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	641	Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAAAACTTGCAGAGTAAAATT	0.338													25	56	---	---	---	---	PASS
RHOU	58480	broad.mit.edu	37	1	228873420	228873420	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228873420C>A	uc001htf.2	+	2	884	c.263C>A	c.(262-264)GCG>GAG	p.A88E		NM_021205	NP_067028	Q7L0Q8	RHOU_HUMAN	ras homolog gene family, member U	88					regulation of small GTPase mediated signal transduction	cell projection|cytosol|focal adhesion|Golgi membrane|podosome	GTP binding|metal ion binding|protein binding				0	Breast(184;0.162)	Prostate(94;0.183)				TGTTTTTAAGCGGTGGTGTCT	0.473													33	201	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232619559	232619559	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232619559G>A	uc001hvg.2	-	4	2118	c.1960C>T	c.(1960-1962)CGA>TGA	p.R654*		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	654	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				AGCTGAGCTCGATATTTACTA	0.398													85	55	---	---	---	---	PASS
GGPS1	9453	broad.mit.edu	37	1	235506071	235506071	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235506071A>T	uc001hwv.2	+	4	971	c.887A>T	c.(886-888)AAA>ATA	p.K296I	GGPS1_uc001hww.2_Missense_Mutation_p.K296I|GGPS1_uc001hwx.2_Missense_Mutation_p.K242I|GGPS1_uc001hwy.2_Missense_Mutation_p.K296I	NM_001037277	NP_001032354	O95749	GGPPS_HUMAN	geranylgeranyl diphosphate synthase 1 isoform A	296					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	dimethylallyltranstransferase activity|farnesyltranstransferase activity|geranyltranstransferase activity|metal ion binding			central_nervous_system(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)			AAGATGTTCAAAGAAGAAAAT	0.338													52	35	---	---	---	---	PASS
CHML	1122	broad.mit.edu	37	1	241798732	241798732	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241798732C>A	uc001hzd.2	-	1	501	c.337G>T	c.(337-339)GTT>TTT	p.V113F	OPN3_uc001hza.2_Intron|OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron	NM_001821	NP_001812	P26374	RAE2_HUMAN	choroideremia-like Rab escort protein 2	113					intracellular protein transport|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(4)|skin(2)	6	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			ATCTCTTCAACGTTGTCCTCC	0.433													164	496	---	---	---	---	PASS
ZNF238	10472	broad.mit.edu	37	1	244218085	244218085	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244218085C>T	uc001iae.2	+	1	1504	c.982C>T	c.(982-984)CGG>TGG	p.R328W	ZNF238_uc001iad.3_Missense_Mutation_p.R337W|ZNF238_uc001iaf.1_3'UTR	NM_006352	NP_006343	Q99592	ZN238_HUMAN	zinc finger protein 238 isoform 2	328	Interaction with DNMT3A.				negative regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|pancreas(2)	5	all_cancers(71;6.42e-05)|all_epithelial(71;7e-05)|Breast(184;0.0333)|Ovarian(71;0.0619)|all_lung(81;0.089)|all_neural(11;0.101)|Lung NSC(105;0.123)		all cancers(7;1.35e-08)|GBM - Glioblastoma multiforme(7;1e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00223)			GGAGCTGGACCGGGAGGACAA	0.572													65	172	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343633	248343633	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343633G>C	uc010pzf.1	+	1	346	c.346G>C	c.(346-348)GCT>CCT	p.A116P		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTTTCTTTTGGCTGTTATGGC	0.403													407	235	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685250	248685250	+	Silent	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685250C>G	uc001ien.1	+	1	303	c.303C>G	c.(301-303)CTC>CTG	p.L101L		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGCCCAGCTCTATGTGGCCA	0.542													145	125	---	---	---	---	PASS
OR2T29	343563	broad.mit.edu	37	1	248722772	248722772	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248722772C>A	uc001ieo.1	-	1	3	c.3G>T	c.(1-3)ATG>ATT	p.M1I		NM_001004694	NP_001004694	Q8NH02	O2T29_HUMAN	olfactory receptor, family 2, subfamily T,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTGGTTGGCCATCCTGGTGA	0.473													22	123	---	---	---	---	PASS
PGBD2	267002	broad.mit.edu	37	1	249210959	249210959	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249210959C>T	uc001ifh.2	+	3	323	c.176C>T	c.(175-177)TCA>TTA	p.S59L	PGBD2_uc001ifg.2_Intron|PGBD2_uc009xhd.2_Missense_Mutation_p.S56L	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	59										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GATGAGGACTCAGGGGATGAA	0.542													27	106	---	---	---	---	PASS
IFT172	26160	broad.mit.edu	37	2	27670407	27670407	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27670407G>A	uc002rku.2	-	42	4685	c.4634C>T	c.(4633-4635)TCT>TTT	p.S1545F	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1545					cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					CTGGGCTGCAGAGCGCGTGGC	0.502													80	504	---	---	---	---	PASS
GALNT14	79623	broad.mit.edu	37	2	31152291	31152291	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31152291C>T	uc002rnr.2	-	11	1740	c.1121G>A	c.(1120-1122)CGG>CAG	p.R374Q	GALNT14_uc002rnq.2_Missense_Mutation_p.R354Q|GALNT14_uc002rns.2_Missense_Mutation_p.R379Q|GALNT14_uc010ymr.1_Missense_Mutation_p.R339Q|GALNT14_uc010ezo.1_Missense_Mutation_p.R341Q	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14	374	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GGCGAATGGCCGGGCAGCGTA	0.542													4	170	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33752408	33752408	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33752408A>T	uc002rox.2	+	11	1639	c.1012A>T	c.(1012-1014)AGT>TGT	p.S338C	RASGRP3_uc010ync.1_Missense_Mutation_p.S338C|RASGRP3_uc002roy.2_Missense_Mutation_p.S338C	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	338	Ras-GEF.				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					CGTTACCCTGAGTGAACTAGT	0.478													14	72	---	---	---	---	PASS
PNPT1	87178	broad.mit.edu	37	2	55870350	55870350	+	Splice_Site	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55870350T>A	uc002rzf.2	-	25	2067	c.2014_splice	c.e25-1	p.Q672_splice	PNPT1_uc002rzg.2_Splice_Site	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTGCTCCTGCTGTAAGTGCAA	0.284													65	62	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56420530	56420530	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56420530G>A	uc002rzn.2	+	2	1697	c.1195G>A	c.(1195-1197)GAG>AAG	p.E399K		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	399										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCAGGCACAGGAGGACGGGTC	0.612													18	16	---	---	---	---	PASS
ATP6V1B1	525	broad.mit.edu	37	2	71190703	71190703	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71190703T>A	uc002shj.2	+	11	1149	c.1062T>A	c.(1060-1062)GAT>GAA	p.D354E	ATP6V1B1_uc010fdv.2_Missense_Mutation_p.D337E|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_Missense_Mutation_p.D312E	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1	354					ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						TTCTTGTAGATATCACCCACC	0.562													73	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90044444	90044444	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90044444C>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TTTCCTCACACAGTGGTACAG	0.512													118	128	---	---	---	---	PASS
ZAP70	7535	broad.mit.edu	37	2	98351161	98351161	+	Silent	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98351161G>C	uc002syd.1	+	9	1275	c.1068G>C	c.(1066-1068)GTG>GTC	p.V356V	ZAP70_uc010yvf.1_3'UTR|ZAP70_uc002sye.1_Silent_p.V246V|ZAP70_uc002syf.1_Silent_p.V49V	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	356	Protein kinase.				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						GCCAGGGCGTGTACCGCATGC	0.637													101	90	---	---	---	---	PASS
C2orf29	55571	broad.mit.edu	37	2	101869911	101869911	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101869911G>T	uc002taw.3	+	1	567	c.485G>T	c.(484-486)GGC>GTC	p.G162V		NM_017546	NP_060016	Q9UKZ1	CB029_HUMAN	hypothetical protein LOC55571	162	Pro-rich.				cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						gcccgcggcggccAGGAACCC	0.562													7	16	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112755045	112755045	+	Silent	SNP	A	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112755045A>C	uc002thk.1	+	10	1718	c.1596A>C	c.(1594-1596)ACA>ACC	p.T532T	MERTK_uc002thl.1_Silent_p.T356T	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	532	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TCCAGGAGACAAAGTTTGGGT	0.423													21	88	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	115200385	115200385	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115200385C>T	uc002tla.1	+	1	487	c.30C>T	c.(28-30)CAC>CAT	p.H10H		NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	10	Mediates effects on KCND2.|Cytoplasmic (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGTCCCATCACATCAAGTGTC	0.468													7	62	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136590717	136590717	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136590717C>A	uc002tuu.1	-	2	695	c.684G>T	c.(682-684)GAG>GAT	p.E228D		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	228	Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		CTAGCAGGAGCTCCGGGATAT	0.488													72	494	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141004694	141004694	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141004694G>T	uc002tvj.1	-	87	14257	c.13285C>A	c.(13285-13287)CCA>ACA	p.P4429T		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4429	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTGGGGCTGGCCTTTCACAC	0.388										TSP Lung(27;0.18)			14	45	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141115593	141115593	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141115593G>C	uc002tvj.1	-	74	12322	c.11350C>G	c.(11350-11352)CTT>GTT	p.L3784V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3784	Extracellular (Potential).|LDL-receptor class A 32.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGTCATCAAGTCGATCACAC	0.418										TSP Lung(27;0.18)			17	86	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141259330	141259330	+	Missense_Mutation	SNP	G	T	T	rs146247369		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141259330G>T	uc002tvj.1	-	55	9748	c.8776C>A	c.(8776-8778)CAT>AAT	p.H2926N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2926	Extracellular (Potential).|LDL-receptor class A 20.|EGF-like 6.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCATTTATATGGCAGTTTCTC	0.408										TSP Lung(27;0.18)			36	18	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155295176	155295176	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155295176C>T	uc002tyr.3	+	12	2035	c.1468C>T	c.(1468-1470)CCT>TCT	p.P490S	GALNT13_uc002tyt.3_Missense_Mutation_p.P490S|GALNT13_uc010fod.2_Missense_Mutation_p.T222I|uc002tyu.1_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	490	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						ACTCAATGGACCTGTAATCAT	0.323													25	88	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163144789	163144789	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163144789C>G	uc002uce.2	-	5	1173	c.951G>C	c.(949-951)CAG>CAC	p.Q317H		NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	317	Helicase ATP-binding.				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						CCAAGGCTGGCTGGGCAACTT	0.478													56	53	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106960	168106960	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106960G>A	uc002udx.2	+	8	9076	c.9058G>A	c.(9058-9060)GAA>AAA	p.E3020K	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2845K|XIRP2_uc010fpq.2_Missense_Mutation_p.E2798K|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2845	Potential.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AACTCAAGCGGAAGATATGCT	0.348													25	99	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179395577	179395577	+	Silent	SNP	A	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179395577A>C	uc010zfg.1	-	307	98285	c.98061T>G	c.(98059-98061)TCT>TCG	p.S32687S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.S26382S|TTN_uc010zfi.1_Silent_p.S26315S|TTN_uc010zfj.1_Silent_p.S26190S|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33614							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGGTTCTGGAGATTTCACTC	0.498													30	104	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179538385	179538385	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179538385T>A	uc010zfg.1	-	147	31082	c.30858A>T	c.(30856-30858)AAA>AAT	p.K10286N	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.K6947N|TTN_uc010fre.1_Missense_Mutation_p.K794N|TTN_uc010zfk.1_5'Flank|TTN_uc002una.1_RNA|TTN_uc010frf.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11213							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTCCACTTTTTTAGGAACAG	0.328													11	31	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179602984	179602984	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179602984C>T	uc010zfg.1	-	46	10688	c.10464G>A	c.(10462-10464)CAG>CAA	p.Q3488Q	TTN_uc010zfh.1_Silent_p.Q4561Q|TTN_uc010zfi.1_Silent_p.Q4494Q|TTN_uc010zfj.1_Silent_p.Q4369Q|TTN_uc002umz.1_Silent_p.Q149Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4415							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTAAACCACTGGAACCGGA	0.478													14	14	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179666959	179666959	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179666959G>C	uc002und.2	-	3	426	c.201C>G	c.(199-201)ATC>ATG	p.I67M	TTN_uc010zfg.1_Missense_Mutation_p.I67M|TTN_uc010zfh.1_Missense_Mutation_p.I67M|TTN_uc010zfi.1_Missense_Mutation_p.I67M|TTN_uc010zfj.1_Missense_Mutation_p.I67M|TTN_uc002unb.2_Missense_Mutation_p.I67M			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	67							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACGGCGGGGATCGTCAGTT	0.547													81	89	---	---	---	---	PASS
NEUROD1	4760	broad.mit.edu	37	2	182542874	182542874	+	Silent	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182542874A>G	uc002uof.2	-	2	950	c.714T>C	c.(712-714)CAT>CAC	p.H238H	CERKL_uc002uod.1_Intron	NM_002500	NP_002491	Q13562	NDF1_HUMAN	neurogenic differentiation 1	238					amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CGTGGAAGACATGGGAGCTGT	0.622													104	108	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185803623	185803623	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803623C>T	uc002uph.2	+	4	4094	c.3500C>T	c.(3499-3501)CCT>CTT	p.P1167L		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1167						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GTTGCTCCTCCTCAGATGCCA	0.517													183	179	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189868763	189868763	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189868763G>T	uc002uqj.1	+	39	2834	c.2717G>T	c.(2716-2718)GGT>GTT	p.G906V		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	906	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	GGGCCCCCAGGTCCTGCGGGT	0.547													10	52	---	---	---	---	PASS
SLC40A1	30061	broad.mit.edu	37	2	190430288	190430288	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190430288G>A	uc002uqp.3	-	6	903	c.552C>T	c.(550-552)ACC>ACT	p.T184T		NM_014585	NP_055400	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated	184					anatomical structure morphogenesis|cellular iron ion homeostasis	cytoplasm|integral to plasma membrane	iron ion transmembrane transporter activity|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CTAAGATGTTGGTTAACTGGT	0.483													22	107	---	---	---	---	PASS
PGAP1	80055	broad.mit.edu	37	2	197781209	197781209	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197781209C>A	uc002utw.2	-	3	524	c.410G>T	c.(409-411)GGT>GTT	p.G137V	PGAP1_uc002utx.2_5'UTR|PGAP1_uc002uty.1_Missense_Mutation_p.G137V|PGAP1_uc010zgv.1_RNA|PGAP1_uc010fsj.2_5'UTR	NM_024989	NP_079265	Q75T13	PGAP1_HUMAN	GPI deacylase	137	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|intracellular protein transport|myo-inositol transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	nuclease activity|phosphoric ester hydrolase activity			ovary(3)|central_nervous_system(1)	4						AAGACTTCCACCATACAAAGC	0.378													12	60	---	---	---	---	PASS
PGAP1	80055	broad.mit.edu	37	2	197781210	197781210	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197781210C>A	uc002utw.2	-	3	523	c.409G>T	c.(409-411)GGT>TGT	p.G137C	PGAP1_uc002utx.2_5'UTR|PGAP1_uc002uty.1_Missense_Mutation_p.G137C|PGAP1_uc010zgv.1_RNA|PGAP1_uc010fsj.2_5'UTR	NM_024989	NP_079265	Q75T13	PGAP1_HUMAN	GPI deacylase	137	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|intracellular protein transport|myo-inositol transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	nuclease activity|phosphoric ester hydrolase activity			ovary(3)|central_nervous_system(1)	4						AGACTTCCACCATACAAAGCC	0.373													12	59	---	---	---	---	PASS
WDR12	55759	broad.mit.edu	37	2	203748393	203748393	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203748393G>A	uc002uzl.2	-	11	1810	c.1060C>T	c.(1060-1062)CAT>TAT	p.H354Y	WDR12_uc010ftt.2_Missense_Mutation_p.H354Y	NM_018256	NP_060726	Q9GZL7	WDR12_HUMAN	WD repeat domain 12 protein	354	WD 6.|Sufficient for nucleolar localization.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						TGCTGTTCATGGGTAGGAGAC	0.383													16	63	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204078285	204078285	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204078285A>G	uc002uzt.3	+	54	8225	c.7892A>G	c.(7891-7893)CAT>CGT	p.H2631R	NBEAL1_uc002uzs.3_Missense_Mutation_p.H1272R|NBEAL1_uc002uzu.2_Missense_Mutation_p.H126R	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2631							binding			ovary(1)|skin(1)	2						CTGCCTATCCATTGTGTTTGT	0.363													84	79	---	---	---	---	PASS
IDH1	3417	broad.mit.edu	37	2	209108187	209108187	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209108187C>A	uc002vcs.2	-	6	908	c.662G>T	c.(661-663)GGG>GTG	p.G221V	IDH1_uc002vct.2_Missense_Mutation_p.G221V|IDH1_uc002vcu.2_Missense_Mutation_p.G221V	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	221					2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity			central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TTTAAAACGCCCATCATATTT	0.343			Mis		gliobastoma 								19	163	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225721669	225721669	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225721669C>T	uc010fwz.1	-	15	1955	c.1716G>A	c.(1714-1716)GTG>GTA	p.V572V	DOCK10_uc002vob.2_Silent_p.V566V	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	572							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGTCTCTGTCCACATTTCCCT	0.318													10	21	---	---	---	---	PASS
ATG16L1	55054	broad.mit.edu	37	2	234178666	234178666	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234178666G>T	uc002vty.2	+	6	917	c.660G>T	c.(658-660)CTG>CTT	p.L220L	ATG16L1_uc002vtx.1_Silent_p.L76L|ATG16L1_uc002vua.2_Silent_p.L220L|ATG16L1_uc002vub.2_Silent_p.L97L|ATG16L1_uc002vtz.2_Silent_p.L76L|ATG16L1_uc002vud.3_Silent_p.L136L	NM_030803	NP_110430	Q676U5	A16L1_HUMAN	APG16 autophagy 16-like isoform 1	220	Potential.				autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding				0		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		AAGCCCGGCTGCAGAAAGAGC	0.443													19	159	---	---	---	---	PASS
DNAJB3	414061	broad.mit.edu	37	2	234652404	234652404	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234652404G>A	uc002vuz.2	-	1	258	c.159C>T	c.(157-159)TAC>TAT	p.Y53Y	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	NM_001001394	NP_001001394	Q8WWF6	DNJB3_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 3	53	J.				protein folding		heat shock protein binding|unfolded protein binding				0						ACAACACCTCGTAGGCCTCGG	0.632													111	455	---	---	---	---	PASS
TRPM8	79054	broad.mit.edu	37	2	234835254	234835254	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234835254G>T	uc002vvh.2	+	2	112	c.72G>T	c.(70-72)CTG>CTT	p.L24L	TRPM8_uc010fyj.2_5'UTR	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	24	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CCCGGACCCTGTACTCCAGCG	0.517													40	48	---	---	---	---	PASS
TSEN2	80746	broad.mit.edu	37	3	12531401	12531401	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12531401G>T	uc003bxc.2	+	2	489	c.102G>T	c.(100-102)CTG>CTT	p.L34L	TSEN2_uc003bwy.2_Silent_p.L34L|TSEN2_uc003bwz.2_Silent_p.L34L|TSEN2_uc003bxa.2_Silent_p.L34L|TSEN2_uc011auq.1_Silent_p.L34L|TSEN2_uc003bxb.2_Silent_p.L34L|TSEN2_uc011aur.1_5'UTR	NM_025265	NP_079541	Q8NCE0	SEN2_HUMAN	tRNA-intron nuclease 2 isoform 1	34					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity			central_nervous_system(1)	1						ATGGTCCTCTGAAAGAATTCA	0.448													4	171	---	---	---	---	PASS
NEK10	152110	broad.mit.edu	37	3	27243972	27243972	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27243972C>T	uc010hfk.2	-	3	332	c.103G>A	c.(103-105)GCG>ACG	p.A35T	NEK10_uc003cds.1_Missense_Mutation_p.A120T|NEK10_uc010hfj.2_Missense_Mutation_p.A35T			Q6ZWH5	NEK10_HUMAN	RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;	723							ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						CTCAAAGTCGCCATCTGATAA	0.488													35	59	---	---	---	---	PASS
OSBPL10	114884	broad.mit.edu	37	3	31871615	31871615	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31871615C>A	uc003cev.2	-	5	1027	c.646G>T	c.(646-648)GTC>TTC	p.V216F	OSBPL10_uc003ceu.1_5'UTR|OSBPL10_uc011axf.1_Intron	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	216					lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		GTGATTGTGACAACACCGGGG	0.577													35	51	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38945400	38945400	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38945400T>A	uc011ays.1	-	12	1997	c.1798A>T	c.(1798-1800)AAG>TAG	p.K600*		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	600	II.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	GCCTCCATCTTGTGATGCTCC	0.373													4	157	---	---	---	---	PASS
SCAP	22937	broad.mit.edu	37	3	47467063	47467063	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47467063G>C	uc003crh.1	-	8	1204	c.949C>G	c.(949-951)CTG>GTG	p.L317V	SCAP_uc011baz.1_Missense_Mutation_p.L62V|SCAP_uc003crg.2_Intron	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	317	SSD.|Helical; Name=3; (Potential).				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		ACGGCAGCCAGGGCCAGCCCC	0.672													48	48	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48697982	48697982	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48697982C>G	uc003cul.2	-	1	2367	c.2086G>C	c.(2086-2088)GAT>CAT	p.D696H	CELSR3_uc003cuf.1_Missense_Mutation_p.D766H	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	696	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AAAGGAGTATCAGGTGCCACA	0.537													50	21	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48698817	48698817	+	Silent	SNP	C	T	T	rs111946927		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48698817C>T	uc003cul.2	-	1	1532	c.1251G>A	c.(1249-1251)ACG>ACA	p.T417T	CELSR3_uc003cuf.1_Silent_p.T487T	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	417	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGGCCACCATCGTGGTGGCCG	0.657													36	33	---	---	---	---	PASS
GRM2	2912	broad.mit.edu	37	3	51749765	51749765	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51749765G>A	uc010hlv.2	+	4	2215	c.1976G>A	c.(1975-1977)CGC>CAC	p.R659H	GRM2_uc003dbo.3_Missense_Mutation_p.R41H|GRM2_uc010hlu.2_RNA	NM_000839	NP_000830	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2 isoform a	659	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)	CGCATTGCACGCATCTTCGGT	0.622													51	36	---	---	---	---	PASS
FOXP1	27086	broad.mit.edu	37	3	71102787	71102787	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71102787C>A	uc003dol.2	-	4	743	c.420G>T	c.(418-420)CAG>CAT	p.Q140H	FOXP1_uc003dom.2_Intron|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Missense_Mutation_p.Q140H|FOXP1_uc003dop.2_Missense_Mutation_p.Q140H|FOXP1_uc003doq.1_Missense_Mutation_p.Q140H|FOXP1_uc003doi.2_Missense_Mutation_p.Q40H|FOXP1_uc003doj.2_Missense_Mutation_p.Q40H|FOXP1_uc003dok.2_Intron	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	140	Gln-rich.				cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GGACAATTACCTGTTGAAGCA	0.592			T	PAX5	ALL								56	36	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	85961556	85961556	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85961556G>T	uc003dqj.2	+	5	1162	c.536G>T	c.(535-537)CGC>CTC	p.R179L	CADM2_uc003dqk.2_Missense_Mutation_p.R188L|CADM2_uc003dql.2_Missense_Mutation_p.R181L	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	179	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GATGCAAATCGCAAGACATTC	0.393													28	50	---	---	---	---	PASS
DCBLD2	131566	broad.mit.edu	37	3	98531173	98531173	+	Intron	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98531173T>C	uc003dtd.2	-						DCBLD2_uc003dte.2_Intron	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2						cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						ACTGTCTCTTTACCTTTAGGA	0.363													52	32	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122287797	122287797	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122287797G>A	uc003efk.2	+	3	950	c.861G>A	c.(859-861)CTG>CTA	p.L287L	DTX3L_uc010hrj.2_Intron	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	287					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		CAGGTGACCTGGAAGCAGCTC	0.398													65	32	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122399772	122399772	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122399772C>T	uc003efq.3	+	1	101	c.42C>T	c.(40-42)TCC>TCT	p.S14S		NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	14					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		TCGAGGGCTCCTGGGGCCCCG	0.672													19	17	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739139	138739139	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739139A>T	uc003esy.1	-	1	630	c.365T>A	c.(364-366)CTG>CAG	p.L122Q		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	122										breast(1)	1						GTCCACTTCCAGCCCGGCAGA	0.632													65	329	---	---	---	---	PASS
MBNL1	4154	broad.mit.edu	37	3	152165568	152165568	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152165568G>A	uc003ezm.2	+						MBNL1_uc003ezh.2_Intron|MBNL1_uc003ezi.2_Intron|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Intron|MBNL1_uc003ezp.2_Intron|MBNL1_uc003ezn.2_Intron|MBNL1_uc003ezo.2_Intron|MBNL1_uc010hvp.2_Intron	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c						embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ACCAGGTAAGGGGTGGGGTTT	0.433													51	152	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	156009808	156009808	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156009808G>A	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Missense_Mutation_p.A38T|KCNAB1_uc010hvt.1_Missense_Mutation_p.A38T	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CGCAGCCCGGGCCAAATTCCG	0.577													5	315	---	---	---	---	PASS
TERC	7012	broad.mit.edu	37	3	169482713	169482713	+	RNA	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169482713C>A	uc003ffr.1	-	1		c.136G>T				NR_001566				Homo sapiens cDNA clone IMAGE:40002477.												0						AGGCGGCAGGCCGAGGCTTTT	0.612									Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				14	170	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169540309	169540309	+	Silent	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169540309A>T	uc003fgb.2	+	1	600	c.600A>T	c.(598-600)ATA>ATT	p.I200I		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	200	LRR 8.										0						AGAACAAAATAGGTGCCATCC	0.512													128	761	---	---	---	---	PASS
SAMD7	344658	broad.mit.edu	37	3	169644948	169644948	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169644948G>T	uc003fgd.2	+	6	1165	c.898G>T	c.(898-900)GTT>TTT	p.V300F	SAMD7_uc003fge.2_Missense_Mutation_p.V300F|SAMD7_uc011bpo.1_Missense_Mutation_p.V201F	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	300										skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TTGCCCTCCAGTTCCTCGACC	0.507													468	163	---	---	---	---	PASS
ZNF639	51193	broad.mit.edu	37	3	179052178	179052178	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179052178A>T	uc003fjq.1	+	6	1769	c.1426A>T	c.(1426-1428)ATA>TTA	p.I476L	ZNF639_uc003fjr.1_Missense_Mutation_p.I476L	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639	476	C2H2-type 8.				initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AAGGGAATTAATAAGTCACCT	0.308													119	50	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47643929	47643929	+	Intron	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47643929G>T	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						ACAAACTACTGACCTTACCCT	0.468													78	43	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69796922	69796922	+	Silent	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69796922T>C	uc003hef.2	-	4	1066	c.1035A>G	c.(1033-1035)TTA>TTG	p.L345L	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	345	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						TATTGGCTCCTAATGTGGATG	0.378													32	13	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69798458	69798458	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69798458T>C	uc003hef.2	-	3	915	c.884A>G	c.(883-885)CAG>CGG	p.Q295R	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	295	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CCCTGAACTCTGGACAAAATT	0.338													64	36	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90169135	90169135	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90169135G>T	uc003hsm.1	-	2	2646	c.2127C>A	c.(2125-2127)ATC>ATA	p.I709I		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	709										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		AATGGTTCTGGATCGCGATTC	0.473													71	26	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177138064	177138064	+	Missense_Mutation	SNP	C	A	A	rs144451873		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177138064C>A	uc003iuq.1	-	6	783	c.767G>T	c.(766-768)GGA>GTA	p.G256V	ASB5_uc003iup.1_Missense_Mutation_p.G203V	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	256	ANK 6.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		GATATCTGCTCCAAATTCTAG	0.413													98	57	---	---	---	---	PASS
CCDC111	201973	broad.mit.edu	37	4	185606641	185606641	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185606641G>T	uc003iwk.2	+	10	1608	c.1175G>T	c.(1174-1176)GGC>GTC	p.G392V	CCDC111_uc003iwj.2_Missense_Mutation_p.G391V|CCDC111_uc003iwl.2_Missense_Mutation_p.G392V|CCDC111_uc003iwm.2_Missense_Mutation_p.G263V|CCDC111_uc003iwn.2_Missense_Mutation_p.G132V	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111	392					DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		AATAAAGATGGCATTAAAGGA	0.338													54	39	---	---	---	---	PASS
TARS	6897	broad.mit.edu	37	5	33461126	33461126	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33461126G>A	uc003jhy.2	+	12	1665	c.1370G>A	c.(1369-1371)AGA>AAA	p.R457K	TARS_uc011cob.1_Missense_Mutation_p.R445K|TARS_uc010iup.1_Missense_Mutation_p.R398K|TARS_uc011coc.1_Missense_Mutation_p.R478K|TARS_uc003jhz.2_Missense_Mutation_p.R353K|TARS_uc011cod.1_Missense_Mutation_p.R336K	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	457					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	CGGGTACGAAGATTCCAACAG	0.488													213	109	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45461983	45461983	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45461983G>A	uc003jok.2	-	3	1001	c.976C>T	c.(976-978)CCA>TCA	p.P326S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	326	Extracellular (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CAATCTGGTGGGAAGTCCTGC	0.408													38	26	---	---	---	---	PASS
TNPO1	3842	broad.mit.edu	37	5	72144337	72144337	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72144337G>A	uc003kck.3	+						TNPO1_uc011csi.1_Intron|TNPO1_uc011csj.1_Intron|TNPO1_uc003kch.2_Intron|TNPO1_uc003kci.3_Intron|TNPO1_uc003kcg.3_Intron	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1						interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TATCCTTTCCGAGGCCTGGCC	0.512													40	31	---	---	---	---	PASS
TNPO1	3842	broad.mit.edu	37	5	72192363	72192363	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72192363G>A	uc003kck.3	+	19	2369	c.2222G>A	c.(2221-2223)GGA>GAA	p.G741E	TNPO1_uc011csj.1_Missense_Mutation_p.G691E|TNPO1_uc003kch.2_Missense_Mutation_p.G733E|TNPO1_uc003kci.3_Missense_Mutation_p.G733E|TNPO1_uc003kcg.3_Missense_Mutation_p.G733E	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1	741					interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TGGGCAATTGGAGAAATCTCC	0.254													53	21	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80503102	80503102	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80503102C>T	uc003kha.1	+	21	3005	c.3005C>T	c.(3004-3006)TCG>TTG	p.S1002L	RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	1002	Ras-GEF.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GAGTCCTTGTCGGCCATGGAG	0.572													79	35	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90074835	90074835	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90074835G>T	uc003kju.2	+	64	13099	c.13003G>T	c.(13003-13005)GTT>TTT	p.V4335F	GPR98_uc003kjt.2_Missense_Mutation_p.V2041F|GPR98_uc003kjw.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4335	Extracellular (Potential).|Calx-beta 29.				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAGTCTGCATGTTGAAATCCT	0.478													68	33	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90101179	90101179	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90101179A>T	uc003kju.2	+	72	14836	c.14740A>T	c.(14740-14742)ACA>TCA	p.T4914S	GPR98_uc003kjt.2_Missense_Mutation_p.T2620S|GPR98_uc003kjw.2_Missense_Mutation_p.T575S	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4914	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAGGAGAGGCACATATGGAGC	0.468													49	22	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118485124	118485124	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118485124G>T	uc003ksd.2	+	18	3783	c.3602G>T	c.(3601-3603)CGA>CTA	p.R1201L	DMXL1_uc010jcl.1_Missense_Mutation_p.R1201L	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1201										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GTACTATTACGAAGTGTGGAC	0.478													155	68	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127674728	127674728	+	Silent	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127674728A>T	uc003kuu.2	-	26	3808	c.3369T>A	c.(3367-3369)CCT>CCA	p.P1123P	FBN2_uc003kuv.2_Silent_p.P1090P	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1123	EGF-like 16; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CACAGAGGTCAGGAGAAATCC	0.458													97	36	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128326129	128326129	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128326129T>G	uc003kuy.2	+	5	1337	c.941T>G	c.(940-942)CTT>CGT	p.L314R	SLC27A6_uc003kuz.2_Missense_Mutation_p.L314R	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	314					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		ATTGGAGAACTTTGTCGCTAC	0.338													62	16	---	---	---	---	PASS
PCDHA2	56146	broad.mit.edu	37	5	140175437	140175437	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140175437T>A	uc003lhd.2	+	1	994	c.888T>A	c.(886-888)GAT>GAA	p.D296E	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.D296E|PCDHA2_uc011czy.1_Missense_Mutation_p.D296E	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	296	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTACCATAGATCCCATCTCAG	0.428													193	59	---	---	---	---	PASS
FBLL1	345630	broad.mit.edu	37	5	167957133	167957133	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167957133C>T	uc011dep.1	+	1	552	c.339C>T	c.(337-339)GCC>GCT	p.A113A		NR_024356				RecName: Full=rRNA/tRNA 2'-O-methyltransferase fibrillarin-like protein 1;          EC=2.1.1.-;												0						CCCACCGCGCCGGCCGCGATC	0.662													3	38	---	---	---	---	PASS
CDHR2	54825	broad.mit.edu	37	5	176005554	176005554	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176005554G>C	uc003mem.1	+	16	1829	c.1763G>C	c.(1762-1764)GGC>GCC	p.G588A	CDHR2_uc003men.1_Missense_Mutation_p.G588A	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	588	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						GTGGTTAGCGGCTCCTACAAC	0.617													83	26	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180377501	180377501	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180377501C>A	uc003mmp.2	+	8	1694	c.1460C>A	c.(1459-1461)TCC>TAC	p.S487Y	BTNL8_uc003mmq.2_3'UTR|BTNL8_uc011dhg.1_Missense_Mutation_p.S362Y|BTNL8_uc010jll.2_3'UTR|BTNL8_uc010jlm.2_Missense_Mutation_p.S371Y|BTNL8_uc011dhh.1_Missense_Mutation_p.S303Y	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor	487	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTGAGTCCTCCTCACAGGCA	0.522													88	25	---	---	---	---	PASS
SNRNP48	154007	broad.mit.edu	37	6	7602899	7602899	+	Silent	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7602899A>G	uc003mxr.2	+	6	698	c.639A>G	c.(637-639)GCA>GCG	p.A213A	SNRNP48_uc003mxs.2_RNA|SNRNP48_uc003mxt.1_5'UTR	NM_152551	NP_689764	Q6IEG0	SNR48_HUMAN	U11/U12 snRNP 48K	213					mRNA processing	cytoplasm|U12-type spliceosomal complex	metal ion binding				0						AAATCCTGGCAGAAGTACGAG	0.308													7	27	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25862035	25862035	+	Intron	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25862035C>T	uc003nfi.3	-						SLC17A3_uc003nfk.3_Missense_Mutation_p.G176S|SLC17A3_uc011djz.1_Missense_Mutation_p.G176S|SLC17A3_uc011dka.1_Intron	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),						glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						TGGCTTAGGCCCTGGACTATT	0.393													20	31	---	---	---	---	PASS
GTF2H4	2968	broad.mit.edu	37	6	30881678	30881678	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30881678C>A	uc003nsa.1	+	14	1514	c.1307C>A	c.(1306-1308)TCG>TAG	p.S436*	GTF2H4_uc003nsb.1_Nonsense_Mutation_p.S274*|VARS2_uc003nsc.1_5'Flank|VARS2_uc003nsd.2_5'Flank|VARS2_uc011dmx.1_5'Flank|VARS2_uc011dmy.1_5'Flank|VARS2_uc011dmz.1_5'Flank|VARS2_uc011dna.1_5'Flank|VARS2_uc011dnb.1_5'Flank|VARS2_uc011dnc.1_5'Flank	NM_001517	NP_001508	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4,	436					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3						TTCGAGAACTCGGCCAAGCGG	0.632								NER					20	48	---	---	---	---	PASS
ANKS1A	23294	broad.mit.edu	37	6	34951166	34951166	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34951166A>G	uc003ojx.3	+	7	1118	c.976A>G	c.(976-978)ATC>GTC	p.I326V	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_5'UTR|ANKS1A_uc010jvp.1_5'UTR	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	326						cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						GCCACCTCTCATCTCCAGTAT	0.413													127	179	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38704871	38704871	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38704871C>A	uc003ooe.1	+	4	740	c.140C>A	c.(139-141)TCG>TAG	p.S47*		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CTGGATGCGTCGAAAGGACTC	0.388													57	107	---	---	---	---	PASS
C6orf138	442213	broad.mit.edu	37	6	48036181	48036181	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48036181C>T	uc011dwm.1	-	1	245	c.160G>A	c.(160-162)GAG>AAG	p.E54K	C6orf138_uc011dwn.1_Intron|C6orf138_uc003ozf.2_Missense_Mutation_p.E71K	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	71						integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						ACCAGGCGCTCCAGGTCGCCC	0.657													66	86	---	---	---	---	PASS
HCRTR2	3062	broad.mit.edu	37	6	55142175	55142175	+	Intron	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55142175C>T	uc003pcl.2	+						HCRTR2_uc010jzv.2_Intron	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2						feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CTTCTCCTTTCAGATCCCTGG	0.488													32	61	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69666693	69666693	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69666693G>A	uc003pev.3	+	8	1965	c.1517G>A	c.(1516-1518)CGA>CAA	p.R506Q	BAI3_uc010kak.2_Missense_Mutation_p.R506Q	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	506	TSP type-1 4.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	p.R506R(1)		lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				AATGAGCAGCGATGCCCTGGT	0.428													53	62	---	---	---	---	PASS
SNX14	57231	broad.mit.edu	37	6	86227605	86227605	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86227605G>A	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TGTGGTGATAGATTATTGTAA	0.279													26	40	---	---	---	---	PASS
C6orf204	387119	broad.mit.edu	37	6	118887133	118887133	+	Silent	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118887133T>C	uc003pxz.1	-	3	1167	c.579A>G	c.(577-579)ACA>ACG	p.T193T	C6orf204_uc003pya.1_Silent_p.T196T|C6orf204_uc003pyb.2_Silent_p.T193T|C6orf204_uc011ebj.1_Silent_p.T91T|C6orf204_uc003pyc.2_Silent_p.T196T|C6orf204_uc011ebl.1_Silent_p.T91T	NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a	193						centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		TCAGTTGTGATGTTAAAGCCT	0.453													93	131	---	---	---	---	PASS
RNF146	81847	broad.mit.edu	37	6	127608771	127608771	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127608771G>A	uc003qav.2	+	3	1172	c.1013G>A	c.(1012-1014)GGT>GAT	p.G338D	RNF146_uc003qat.2_Missense_Mutation_p.G337D|RNF146_uc003qau.2_Missense_Mutation_p.G337D|RNF146_uc003qaw.2_Missense_Mutation_p.G337D	NM_030963	NP_112225	Q9NTX7	RN146_HUMAN	ring finger protein 146	338					positive regulation of canonical Wnt receptor signaling pathway|protein autoubiquitination|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol	poly-ADP-D-ribose binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(1)	1				GBM - Glioblastoma multiforme(226;0.0407)|all cancers(137;0.2)		GTAGCAGGGGGTGGAACAGTG	0.468													39	98	---	---	---	---	PASS
ECHDC1	55862	broad.mit.edu	37	6	127636051	127636051	+	Intron	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127636051G>C	uc003qax.2	-						ECHDC1_uc003qaz.3_Intron|ECHDC1_uc010key.2_Intron|ECHDC1_uc003qay.3_Intron|ECHDC1_uc010kez.2_Intron|ECHDC1_uc010kex.2_Intron	NM_001139510	NP_001132982	Q9NTX5	ECHD1_HUMAN	enoyl Coenzyme A hydratase domain containing 1								catalytic activity				0				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TCTGTATATTGAAGAAAAAAC	0.313													38	51	---	---	---	---	PASS
TAAR5	9038	broad.mit.edu	37	6	132910270	132910270	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132910270T>A	uc003qdk.2	-	1	608	c.556A>T	c.(556-558)ATG>TTG	p.M186L		NM_003967	NP_003958	O14804	TAAR5_HUMAN	trace amine associated receptor 5	186	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		ACACAAGGCATCTCTTCCAGC	0.512													34	47	---	---	---	---	PASS
REPS1	85021	broad.mit.edu	37	6	139247564	139247564	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139247564C>A	uc003qii.2	-	10	1891	c.1312G>T	c.(1312-1314)GAT>TAT	p.D438Y	REPS1_uc003qig.3_Intron|REPS1_uc011edr.1_Missense_Mutation_p.D438Y|REPS1_uc003qij.2_Intron|REPS1_uc003qik.2_Intron	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	438						coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		ATGTTAGAATCAAATTGGGTC	0.388													6	23	---	---	---	---	PASS
AIG1	51390	broad.mit.edu	37	6	143382212	143382212	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143382212G>A	uc003qjh.2	+						AIG1_uc003qjf.2_Intron|AIG1_uc003qji.2_Intron|AIG1_uc011edw.1_Intron|AIG1_uc003qjg.2_Intron	NM_016108	NP_057192	Q9NVV5	AIG1_HUMAN	androgen-induced 1							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		TGGTAAGGCCGTCCCCTCCCC	0.473													51	90	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	145124203	145124203	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145124203G>A	uc003qkt.2	+	64	9369	c.9277G>A	c.(9277-9279)GTC>ATC	p.V3093I		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	3093	Interaction with SYNM.|ZZ-type.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TAACTATGATGTCTGCCAGAG	0.343													20	34	---	---	---	---	PASS
LRP11	84918	broad.mit.edu	37	6	150141797	150141797	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150141797A>G	uc003qng.2	-	7	1715	c.1391T>C	c.(1390-1392)CTG>CCG	p.L464P		NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein	464	Helical; (Potential).					integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GAGAAGCAGCAGAGCAGTGAT	0.498													21	15	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151914353	151914353	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151914353G>T	uc003qol.2	+	8	1494	c.1405G>T	c.(1405-1407)GTT>TTT	p.V469F		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	469											0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		AGAGCAGCTGGTTCGTCTTGA	0.458													47	85	---	---	---	---	PASS
UNC93A	54346	broad.mit.edu	37	6	167728850	167728850	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167728850G>T	uc003qvq.2	+	8	1459	c.1284G>T	c.(1282-1284)GTG>GTT	p.V428V	UNC93A_uc003qvr.2_Silent_p.V386V	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	428						integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		ATGGGCTTGTGGAGTGCGTGG	0.537													240	619	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167753874	167753874	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167753874C>A	uc003qvs.1	+	3	574	c.486C>A	c.(484-486)CAC>CAA	p.H162Q	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	162	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGGCCAAACACCTGAAGCACA	0.502													51	71	---	---	---	---	PASS
TBP	6908	broad.mit.edu	37	6	170871073	170871073	+	Silent	SNP	G	A	A	rs71010673		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170871073G>A	uc003qxt.2	+	3	481	c.249G>A	c.(247-249)CAG>CAA	p.Q83Q	TBP_uc003qxu.2_Silent_p.Q83Q|TBP_uc011ehf.1_Silent_p.Q63Q|TBP_uc011ehg.1_Silent_p.Q83Q	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein	83	Poly-Gln.				cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.184													2	1	---	---	---	---	PASS
TTYH3	80727	broad.mit.edu	37	7	2692645	2692645	+	Splice_Site	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2692645G>T	uc003smp.2	+	9	1207	c.1020_splice	c.e9+1	p.K340_splice	TTYH3_uc010ksn.2_Splice_Site_p.K60_splice|TTYH3_uc003smq.2_Splice_Site_p.K169_splice	NM_025250	NP_079526	Q9C0H2	TTYH3_HUMAN	tweety 3							chloride channel complex|plasma membrane	chloride channel activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		GGCCACTAAGGTGAGGGGCTG	0.597													7	11	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11486857	11486857	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11486857C>A	uc003ssf.3	-	12	3052	c.2800G>T	c.(2800-2802)GGA>TGA	p.G934*		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	934	TSP type-1 9.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTATTCTTACCAACAAGAGTG	0.428										HNSCC(18;0.044)			35	33	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11509548	11509548	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11509548G>A	uc003ssf.3	-	9	2578	c.2326C>T	c.(2326-2328)CCA>TCA	p.P776S		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	776	TSP type-1 8.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCACTATATGGGGTCACAATA	0.463										HNSCC(18;0.044)			5	8	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11521576	11521576	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11521576G>A	uc003ssf.3	-	7	2108	c.1856C>T	c.(1855-1857)GCC>GTC	p.A619V		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	619	Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GGGGAAGATGGCATCTCTGCA	0.493										HNSCC(18;0.044)			4	122	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18705957	18705957	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18705957C>T	uc003suh.2	+	11	1621	c.1580C>T	c.(1579-1581)ACT>ATT	p.T527I	HDAC9_uc003sue.2_Missense_Mutation_p.T527I|HDAC9_uc011jyd.1_Missense_Mutation_p.T527I|HDAC9_uc003sui.2_Missense_Mutation_p.T530I|HDAC9_uc003suj.2_Missense_Mutation_p.T486I|HDAC9_uc011jya.1_Missense_Mutation_p.T524I|HDAC9_uc003sua.1_Missense_Mutation_p.T505I|HDAC9_uc011jyb.1_Missense_Mutation_p.T483I|HDAC9_uc003sud.1_Missense_Mutation_p.T527I|HDAC9_uc011jyc.1_Missense_Mutation_p.T486I|HDAC9_uc003suf.1_Missense_Mutation_p.T558I|HDAC9_uc010kud.1_Missense_Mutation_p.T530I|HDAC9_uc011jye.1_Missense_Mutation_p.T499I|HDAC9_uc011jyf.1_Missense_Mutation_p.T450I|HDAC9_uc010kue.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	527					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	GGCAACAGCACTAGGAGCGAC	0.557											OREG0017877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	126	95	---	---	---	---	PASS
SCRN1	9805	broad.mit.edu	37	7	29980442	29980442	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29980442C>A	uc010kvp.2	-	4	799	c.595G>T	c.(595-597)GCA>TCA	p.A199S	SCRN1_uc011jzy.1_Missense_Mutation_p.A131S|SCRN1_uc003tak.2_Missense_Mutation_p.A199S|SCRN1_uc011jzz.1_Missense_Mutation_p.A199S|SCRN1_uc011kaa.1_Missense_Mutation_p.A219S|SCRN1_uc011jzw.1_Intron|SCRN1_uc011jzx.1_Missense_Mutation_p.A22S	NM_001145515	NP_001138987	Q12765	SCRN1_HUMAN	secernin 1 isoform c	199					exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2						GGATGCTCTGCATCCATCTTA	0.473													6	454	---	---	---	---	PASS
ADCYAP1R1	117	broad.mit.edu	37	7	31132311	31132311	+	Missense_Mutation	SNP	G	T	T	rs139752068		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31132311G>T	uc003tca.1	+	13	1231	c.1008G>T	c.(1006-1008)CAG>CAT	p.Q336H	ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.Q315H|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.Q336H|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.Q336H|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.Q336H|ADCYAP1R1_uc003tcf.1_Missense_Mutation_p.Q38H	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	336	Cytoplasmic (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						AGAAACTTCAGTCTCCAGACA	0.458													100	86	---	---	---	---	PASS
GRB10	2887	broad.mit.edu	37	7	50686990	50686990	+	Intron	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50686990G>T	uc003tpi.2	-						GRB10_uc003tph.3_Intron|GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					TCTCTGCAGGGGCAAAGCATC	0.428									Russell-Silver_syndrome				95	86	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92760803	92760803	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92760803C>A	uc003umh.1	-	5	5698	c.4482G>T	c.(4480-4482)GAG>GAT	p.E1494D	SAMD9L_uc003umj.1_Missense_Mutation_p.E1494D|SAMD9L_uc003umi.1_Missense_Mutation_p.E1494D|SAMD9L_uc010lfb.1_Missense_Mutation_p.E1494D|SAMD9L_uc003umk.1_Missense_Mutation_p.E1494D|SAMD9L_uc010lfc.1_Missense_Mutation_p.E1494D|SAMD9L_uc010lfd.1_Missense_Mutation_p.E1494D|SAMD9L_uc011khx.1_3'UTR	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1494										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CAAAGTACTGCTCTATTTTGG	0.448													16	314	---	---	---	---	PASS
PON1	5444	broad.mit.edu	37	7	94937448	94937448	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94937448T>A	uc003uns.2	-	6	670	c.573A>T	c.(571-573)TTA>TTT	p.L191F	PON1_uc011kih.1_Missense_Mutation_p.L191F	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	191					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	CCCAGGATTGTAAGTAGGGGT	0.393													112	80	---	---	---	---	PASS
LMTK2	22853	broad.mit.edu	37	7	97834767	97834767	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97834767C>A	uc003upd.1	+							NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor						early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CTTCCTCTCTCCTCAACAGGA	0.607													40	90	---	---	---	---	PASS
ARPC1A	10552	broad.mit.edu	37	7	98955993	98955993	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98955993G>T	uc003upx.1	+	7	891	c.744G>T	c.(742-744)CCG>CCT	p.P248P	ARPC1A_uc010lfu.1_RNA|ARPC1A_uc003upy.1_Silent_p.P234P|ARPC1A_uc011kit.1_RNA	NM_006409	NP_006400	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex subunit 1A	248	WD 5.				actin cytoskeleton organization|regulation of actin filament polymerization	actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			AGTTCCTGCCGCTCCTAAGTG	0.468													166	147	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99795708	99795708	+	Splice_Site	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99795708A>G	uc003utx.1	+	12	1320	c.1165_splice	c.e12-2	p.D389_splice	STAG3_uc010lgs.1_Splice_Site_p.D177_splice|STAG3_uc011kjk.1_Splice_Site_p.D331_splice|STAG3_uc003uub.1_5'Flank	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCTTTCTGCAGGACCGGATG	0.458													46	178	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100350489	100350489	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100350489A>G	uc003uwj.2	+	14	2926	c.2761A>G	c.(2761-2763)ACC>GCC	p.T921A	ZAN_uc003uwk.2_Missense_Mutation_p.T921A|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	921	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGAAAAACCCACCATCCCCAC	0.502													94	248	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102614210	102614210	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102614210C>A	uc003vaq.2	-						FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|FBXL13_uc003vav.2_Intron	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform												0						tcactgatctcacctactggt	0.000													32	19	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126173378	126173378	+	Silent	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126173378C>G	uc003vlr.2	-	8	2369	c.2058G>C	c.(2056-2058)GCG>GCC	p.A686A	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.A686A|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	686	Cytoplasmic (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TGAACTTGGGCGCTGTGACAG	0.507										HNSCC(24;0.065)			49	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142013440	142013440	+	Intron	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013440G>T	uc011kro.1	+						uc011krp.1_Intron|uc003vxg.2_Missense_Mutation_p.A99S|uc003vxh.1_Missense_Mutation_p.A96S					SubName: Full=V_segment translation product; Flags: Fragment;																		TCACCTACACGCCCTGCAGCC	0.527													102	81	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701539	143701539	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701539C>A	uc003wdt.1	+	1	450	c.450C>A	c.(448-450)GCC>GCA	p.A150A		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					GTTCCTGGGCCATTGGCTTTG	0.552													53	24	---	---	---	---	PASS
TMEM176B	28959	broad.mit.edu	37	7	150489160	150489160	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150489160T>C	uc003wht.3	-	6	870	c.704A>G	c.(703-705)CAG>CGG	p.Q235R	TMEM176B_uc003whu.3_Missense_Mutation_p.Q235R|TMEM176B_uc003whv.3_Missense_Mutation_p.Q198R|TMEM176B_uc003whw.3_Missense_Mutation_p.Q235R	NM_001101313	NP_001094783	Q3YBM2	T176B_HUMAN	transmembrane protein 176B isoform a	235					cell differentiation|organ morphogenesis	integral to membrane|nuclear membrane				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGGGAGCTCTGGCCACACAA	0.597													99	95	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154379476	154379476	+	Intron	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154379476C>T	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Silent_p.I248I|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ttcattacatcaccatgtctc	0.234													13	41	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	157041102	157041102	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157041102G>T	uc010lqs.2	+	19	2834	c.2522G>T	c.(2521-2523)GGC>GTC	p.G841V	UBE3C_uc003wni.3_Missense_Mutation_p.G204V	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	841	HECT.				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CCCTTTGCAGGCTTCTTTCTT	0.468													149	356	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52323825	52323825	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52323825C>A	uc003xqu.3	-	16	2148	c.2047G>T	c.(2047-2049)GAC>TAC	p.D683Y	PXDNL_uc003xqt.3_5'Flank	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	683					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCTTCCAAGTCCACAGTGAGC	0.507													13	4	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69012004	69012004	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69012004C>T	uc003xxv.1	+	23	2668	c.2641C>T	c.(2641-2643)CTT>TTT	p.L881F	PREX2_uc003xxu.1_Missense_Mutation_p.L881F|PREX2_uc011lez.1_Missense_Mutation_p.L816F	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	881					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TCCTACTGACCTTCAGAGTAA	0.353													4	187	---	---	---	---	PASS
PRDM14	63978	broad.mit.edu	37	8	70980718	70980718	+	Silent	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70980718T>C	uc003xym.2	-	3	952	c.750A>G	c.(748-750)CCA>CCG	p.P250P		NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14	250					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GCCTACCTTCTGGAAGTTGAA	0.413													148	37	---	---	---	---	PASS
IMPA1	3612	broad.mit.edu	37	8	82572769	82572769	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82572769C>T	uc003ych.2	-	8	827	c.700G>A	c.(700-702)GTG>ATG	p.V234M	IMPA1_uc011lfq.1_Missense_Mutation_p.V293M|IMPA1_uc011lfr.1_Silent_p.A197A	NM_005536	NP_005527	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1 isoform	234					inositol phosphate dephosphorylation|phosphatidylinositol biosynthetic process|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(1)	1					Lithium(DB01356)	TCCATTAGCACGCCACCAGCT	0.418													86	31	---	---	---	---	PASS
NBN	4683	broad.mit.edu	37	8	90996768	90996768	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90996768C>T	uc003yej.1	-	1	132	c.22G>A	c.(22-24)GCG>ACG	p.A8T	NBN_uc003yei.1_5'UTR|NBN_uc011lgb.1_Missense_Mutation_p.A8T	NM_002485	NP_002476	O60934	NBN_HUMAN	nibrin	8					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding			central_nervous_system(3)|kidney(3)|lung(1)	7			BRCA - Breast invasive adenocarcinoma(11;0.0344)			GCCGGGCCCGCGGCGGGCAGC	0.706								Direct_reversal_of_damage|Homologous_recombination	Nijmegen_Breakage_syndrome		OREG0018856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	36	---	---	---	---	PASS
RRM2B	50484	broad.mit.edu	37	8	103226340	103226340	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103226340T>C	uc003ykn.2	-	7	975	c.731A>G	c.(730-732)AAT>AGT	p.N244S	RRM2B_uc003yko.2_RNA|RRM2B_uc010mbv.1_Missense_Mutation_p.N192S|RRM2B_uc010mbw.1_Missense_Mutation_p.N32S|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	NM_015713	NP_056528	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)	244					deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)			TGAAGGCTTATTTACTAAGTA	0.378								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					98	21	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110476887	110476887	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110476887G>A	uc003yne.2	+	49	7930	c.7826G>A	c.(7825-7827)GGC>GAC	p.G2609D		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2609	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTTCCCCTTGGCGAATTTTTT	0.438										HNSCC(38;0.096)			186	53	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110477141	110477141	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110477141G>A	uc003yne.2	+	49	8184	c.8080G>A	c.(8080-8082)GGA>AGA	p.G2694R		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2694	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCCTTATGTTGGAGGGTGGGG	0.463										HNSCC(38;0.096)			144	57	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113308161	113308161	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113308161C>A	uc003ynu.2	-	54	8674	c.8515G>T	c.(8515-8517)GTT>TTT	p.V2839F	CSMD3_uc003yns.2_Missense_Mutation_p.V2041F|CSMD3_uc003ynt.2_Missense_Mutation_p.V2799F|CSMD3_uc011lhx.1_Missense_Mutation_p.V2670F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2839	Extracellular (Potential).|Sushi 18.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGATATACAACTGTGTCTCTA	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			59	14	---	---	---	---	PASS
TNFRSF11B	4982	broad.mit.edu	37	8	119938863	119938863	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119938863G>T	uc003yon.3	-	4	1010	c.687C>A	c.(685-687)GGC>GGA	p.G229G	TNFRSF11B_uc010mdc.1_RNA	NM_002546	NP_002537	O00300	TR11B_HUMAN	osteoprotegerin precursor	229	Death 1.				apoptosis|skeletal system development		cytokine activity|receptor activity			central_nervous_system(2)	2	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TTACTTTGGTGCCAGGCAAAT	0.438													145	42	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8465650	8465650	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8465650C>A	uc003zkk.2	-	31	4241	c.3530G>T	c.(3529-3531)CGC>CTC	p.R1177L	PTPRD_uc003zkp.2_Missense_Mutation_p.R766L|PTPRD_uc003zkq.2_Missense_Mutation_p.R766L|PTPRD_uc003zkr.2_Missense_Mutation_p.R761L|PTPRD_uc003zks.2_Missense_Mutation_p.R756L|PTPRD_uc003zkl.2_Missense_Mutation_p.R1168L|PTPRD_uc003zkm.2_Missense_Mutation_p.R1164L|PTPRD_uc003zkn.2_Missense_Mutation_p.R766L|PTPRD_uc003zko.2_Missense_Mutation_p.R763L	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1177	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GATGCTTCTGCGCTTCCTAGA	0.393										TSP Lung(15;0.13)			24	62	---	---	---	---	PASS
SLC24A2	25769	broad.mit.edu	37	9	19550241	19550241	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19550241G>A	uc003zoa.1	-	7	1435	c.1373C>T	c.(1372-1374)CCT>CTT	p.P458L	SLC24A2_uc003zob.1_Missense_Mutation_p.P441L	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24	458	Cytoplasmic (Potential).				visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		AAGGCTGAGAGGCTGGTCCTC	0.458													78	134	---	---	---	---	PASS
IFNA10	3446	broad.mit.edu	37	9	21206861	21206861	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21206861A>G	uc003zoq.1	-	1	282	c.236T>C	c.(235-237)GTC>GCC	p.V79A	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	79					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		CTCATGGAGGACAGAGATGGC	0.488													3	120	---	---	---	---	PASS
LRRC19	64922	broad.mit.edu	37	9	26997838	26997838	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26997838A>T	uc003zqh.2	-	3	594	c.483T>A	c.(481-483)GAT>GAA	p.D161E	IFT74_uc010mja.2_Intron|IFT74_uc010mjb.2_Intron|IFT74_uc003zqf.3_Intron|IFT74_uc003zqg.3_Intron	NM_022901	NP_075052	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19 precursor	161	LRR 5.|Extracellular (Potential).					integral to membrane					0		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)		GTGGTGGTACATCCAAATAGC	0.353													47	88	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34506780	34506780	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34506780A>C	uc003zum.2	+	13	1412	c.1219A>C	c.(1219-1221)AAC>CAC	p.N407H		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	407	WD 1.				cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CTATGACGGCAACGTGGCCAT	0.582									Kartagener_syndrome				35	93	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35313984	35313984	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35313984G>A	uc003zwq.2	+	10	1457	c.1165G>A	c.(1165-1167)GAG>AAG	p.E389K	UNC13B_uc010mkl.1_Missense_Mutation_p.E389K|UNC13B_uc003zwr.2_Missense_Mutation_p.E389K	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	389					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CCAGCTGCAGGAGGTAGGAAA	0.443													49	74	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35385807	35385807	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35385807G>A	uc003zwq.2	+	22	3007	c.2715G>A	c.(2713-2715)ATG>ATA	p.M905I	UNC13B_uc003zwr.2_Missense_Mutation_p.M905I	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	905					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TCTTCAGAATGAAGGTAAGAA	0.483													35	79	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35397239	35397239	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35397239G>C	uc003zwq.2	+	28	3653	c.3361G>C	c.(3361-3363)GAG>CAG	p.E1121Q	UNC13B_uc003zwr.2_Missense_Mutation_p.E1121Q	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	1121	MHD1.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TCAGAGCTTTGAGATCATCCG	0.512													100	170	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73442860	73442860	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73442860G>T	uc004aid.2	-	6	1120	c.876C>A	c.(874-876)TTC>TTA	p.F292L	TRPM3_uc004ahu.2_Missense_Mutation_p.F122L|TRPM3_uc004ahv.2_Missense_Mutation_p.F122L|TRPM3_uc004ahw.2_Missense_Mutation_p.F139L|TRPM3_uc004ahx.2_Missense_Mutation_p.F139L|TRPM3_uc004ahy.2_Missense_Mutation_p.F139L|TRPM3_uc004ahz.2_Missense_Mutation_p.F139L|TRPM3_uc004aia.2_Missense_Mutation_p.F139L|TRPM3_uc004aib.2_Missense_Mutation_p.F139L|TRPM3_uc004aic.2_Missense_Mutation_p.F292L|TRPM3_uc010mor.2_Missense_Mutation_p.F292L|TRPM3_uc004aie.2_Missense_Mutation_p.F139L|TRPM3_uc004aif.2_Missense_Mutation_p.F139L|TRPM3_uc004aig.2_Missense_Mutation_p.F139L|TRPM3_uc004aii.2_Missense_Mutation_p.F294L	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	292	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						CAGCCAGAATGAAGTGGGAAT	0.468													84	180	---	---	---	---	PASS
SLC28A3	64078	broad.mit.edu	37	9	86900906	86900906	+	Silent	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86900906G>C	uc010mpz.2	-	13	1526	c.1401C>G	c.(1399-1401)GCC>GCG	p.A467A	SLC28A3_uc011lsy.1_Silent_p.A398A|SLC28A3_uc004anu.1_Silent_p.A467A	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter	467	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						ACCAGGACAGGGCTGAATTCA	0.493													19	31	---	---	---	---	PASS
NOL8	55035	broad.mit.edu	37	9	95078179	95078179	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95078179A>G	uc004arv.2	-	7	1065	c.728T>C	c.(727-729)ATA>ACA	p.I243T	NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Intron|NOL8_uc011ltw.1_Missense_Mutation_p.I175T	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN	nucleolar protein 8	243					DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding			ovary(1)	1						TGGTCTCTCTATTACCCTCCT	0.453													28	55	---	---	---	---	PASS
C9orf3	84909	broad.mit.edu	37	9	97522859	97522859	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97522859G>T	uc004ava.2	+	1	929	c.794G>T	c.(793-795)GGC>GTC	p.G265V	C9orf3_uc011lui.1_RNA|C9orf3_uc004aux.1_Missense_Mutation_p.G265V|C9orf3_uc004auy.2_Missense_Mutation_p.G265V|C9orf3_uc004auz.1_Missense_Mutation_p.G265V	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O	265					leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		GACCAGAGTGGCAGGTAGGTT	0.507													18	42	---	---	---	---	PASS
C9orf102	375748	broad.mit.edu	37	9	98735335	98735335	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98735335A>T	uc010mry.1	+	15	3529	c.2441A>T	c.(2440-2442)CAA>CTA	p.Q814L	C9orf102_uc004avu.2_Missense_Mutation_p.Q392L|uc010msa.1_Missense_Mutation_p.Q82L|uc011lun.1_Missense_Mutation_p.Q82L			Q5T890	RAD26_HUMAN	RecName: Full=Putative DNA repair and recombination protein RAD26-like;          EC=3.6.1.-;	Error:Variant_position_missing_in_Q5T890_after_alignment					DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				GTTGTTAATCAAGAGCAGTCG	0.274													4	6	---	---	---	---	PASS
ANKS6	203286	broad.mit.edu	37	9	101552494	101552494	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101552494C>T	uc004ayu.2	-	2	775	c.754G>A	c.(754-756)GAC>AAC	p.D252N	ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	252	ANK 6.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				CTGAGGTGGTCAGGGTTGGCG	0.672													79	172	---	---	---	---	PASS
DFNB31	25861	broad.mit.edu	37	9	117186785	117186785	+	Silent	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117186785C>G	uc004biz.3	-	6	1894	c.1245G>C	c.(1243-1245)CTG>CTC	p.L415L	DFNB31_uc004bix.2_Silent_p.L64L|DFNB31_uc004biy.3_Silent_p.L32L|DFNB31_uc004bja.3_Silent_p.L415L	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	415					inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CCAGGCTGCTCAGGGTCACCT	0.587													41	58	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135772642	135772642	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135772642C>A	uc004cca.2	-	22	3138	c.2904G>T	c.(2902-2904)AGG>AGT	p.R968S	TSC1_uc004ccb.3_Missense_Mutation_p.R967S|TSC1_uc011mcq.1_Missense_Mutation_p.R917S|TSC1_uc011mcr.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	968	Potential.				activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTTTCTCCAACCTGCCATATA	0.438			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				193	276	---	---	---	---	PASS
QSOX2	169714	broad.mit.edu	37	9	139137450	139137450	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139137450T>G	uc010nbi.2	-	1	238	c.200A>C	c.(199-201)GAC>GCC	p.D67A		NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor	67	Thioredoxin.				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		GCTGCCGCTGTCCAGCACCCA	0.557													4	20	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7659226	7659226	+	Silent	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7659226T>A	uc001ijq.2	-	6	751	c.672A>T	c.(670-672)CCA>CCT	p.P224P	ITIH5_uc001ijp.2_Silent_p.P10P|ITIH5_uc001ijr.1_Silent_p.P224P	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	224					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						TGACAGTAGATGGGGGAGGCC	0.338													58	12	---	---	---	---	PASS
C1QL3	389941	broad.mit.edu	37	10	16563058	16563058	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16563058G>T	uc001ioj.1	-	1	947	c.7C>A	c.(7-9)CTG>ATG	p.L3M		NM_001010908	NP_001010908	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	3						collagen				ovary(1)	1						ACCAGCAGCAGCACCATCACC	0.692													18	2	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17369080	17369080	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17369080C>T	uc001ipd.2	-	6	568	c.568G>A	c.(568-570)GGA>AGA	p.G190R	ST8SIA6_uc010qce.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	190	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						CCCCCATTTCCGACCACTGCA	0.393													51	22	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25701176	25701176	+	Intron	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25701176C>G	uc001isj.2	+							NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						TTGGAACTTTCAGGAAGGGGT	0.458													124	66	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30317316	30317316	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30317316C>T	uc001iux.2	-	2	1820	c.1761G>A	c.(1759-1761)GTG>GTA	p.V587V	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Silent_p.V449V|KIAA1462_uc009xle.1_Silent_p.V587V	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	587										ovary(4)	4						ATTCTGATTTCACTGGGATAG	0.413													199	213	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50818900	50818900	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50818900C>G	uc001jhw.2	+	1	554	c.114C>G	c.(112-114)ATC>ATG	p.I38M	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	38	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						TGCTTGTTATCGTGTGCGTGG	0.697													26	50	---	---	---	---	PASS
UBE2D1	7321	broad.mit.edu	37	10	60124635	60124635	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60124635A>T	uc001jke.1	+	5	526	c.303A>T	c.(301-303)AAA>AAT	p.K101N		NM_003338	NP_003329	P51668	UB2D1_HUMAN	ubiquitin-conjugating enzyme E2D 1	101					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|BMP signaling pathway|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K48-linked ubiquitination|transforming growth factor beta receptor signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|ubiquitin-protein ligase activity			skin(2)	2						CTGTATCAAAAGGTAATTTCA	0.338													40	113	---	---	---	---	PASS
SUPV3L1	6832	broad.mit.edu	37	10	70960234	70960234	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70960234G>A	uc001jpe.1	+	11	1552	c.1497G>A	c.(1495-1497)AAG>AAA	p.K499K	SUPV3L1_uc010qjd.1_Silent_p.K368K	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	499	Helicase C-terminal.				DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						AAATTTTGAAGAGGCCTGTGG	0.438													14	158	---	---	---	---	PASS
CHST3	9469	broad.mit.edu	37	10	73767080	73767080	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73767080C>A	uc001jsn.2	+	3	731	c.291C>A	c.(289-291)CTC>CTA	p.L97L		NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3	97	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0						TCCGCAACCTCAGCTTGCAGC	0.647													12	69	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87966225	87966225	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87966225T>C	uc001kdl.1	-	3	517	c.416A>G	c.(415-417)TAC>TGC	p.Y139C	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	139	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	AGCCAGTGTGTAGGCCTCACC	0.622										Multiple Myeloma(13;0.14)			111	41	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98412549	98412549	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98412549C>T	uc001kmq.2	-	4	746	c.618G>A	c.(616-618)GTG>GTA	p.V206V	PIK3AP1_uc001kmp.2_Silent_p.V28V	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	206	DBB.					cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CTTCTGTCGCCACCCTGTCAT	0.507													183	96	---	---	---	---	PASS
DHDPSL	112817	broad.mit.edu	37	10	99359443	99359443	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99359443G>C	uc001kny.2	+	4	834	c.475G>C	c.(475-477)GAT>CAT	p.D159H	DHDPSL_uc001knx.2_3'UTR|DHDPSL_uc001knz.2_Intron|PI4K2A_uc010qoy.1_Intron	NM_138413	NP_612422	Q86XE5	HOGA1_HUMAN	DHDPS-like protein isoform 1	159					glyoxylate catabolic process	mitochondrion	4-hydroxy-2-oxoglutarate aldolase activity				0						CCAGGTTGCTGATCTCTCTCC	0.622													103	333	---	---	---	---	PASS
HPS6	79803	broad.mit.edu	37	10	103826716	103826716	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103826716G>T	uc001kuj.2	+	1	1570	c.1485G>T	c.(1483-1485)AGG>AGT	p.R495S		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	495						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		GCCTGCTGAGGACTGAGTTGA	0.622									Hermansky-Pudlak_syndrome				109	42	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105932195	105932195	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105932195A>T	uc001kxw.2	-	20	2675	c.2559T>A	c.(2557-2559)CAT>CAA	p.H853Q	C10orf79_uc009xxq.2_Missense_Mutation_p.H161Q|C10orf79_uc001kxx.3_Missense_Mutation_p.H854Q	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	853	Potential.										0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		GACTTTCATCATGAAGCCTTT	0.323													66	24	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	128019004	128019004	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128019004G>T	uc001ljk.2	-	2	576	c.163C>A	c.(163-165)CCA>ACA	p.P55T	ADAM12_uc010qul.1_Missense_Mutation_p.P55T|ADAM12_uc001ljm.2_Missense_Mutation_p.P55T|ADAM12_uc001ljn.2_Missense_Mutation_p.P55T|ADAM12_uc001ljl.3_Missense_Mutation_p.P55T	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	55					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CTCTTCACTGGGATCCAGAGG	0.473													185	51	---	---	---	---	PASS
GLRX3	10539	broad.mit.edu	37	10	131958274	131958274	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131958274G>T	uc001lkm.1	+	3	239	c.217G>T	c.(217-219)GTT>TTT	p.V73F	GLRX3_uc001lkn.1_Missense_Mutation_p.V73F|GLRX3_uc001lko.2_RNA	NM_006541	NP_006532	O76003	GLRX3_HUMAN	glutaredoxin 3	73	Thioredoxin.				cell redox homeostasis|negative regulation of cardiac muscle hypertrophy|regulation of the force of heart contraction	cell cortex	electron carrier activity|iron-sulfur cluster binding|metal ion binding|protein disulfide oxidoreductase activity				0		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		AGCTGAAGGTGTTCCTGAAGT	0.323													64	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134648195	134648195	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134648195G>T	uc010qux.1	-	40	6007	c.6007C>A	c.(6007-6009)CAG>AAG	p.Q2003K		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		AATAGCGGCTGCAGAAGCTCC	0.622													32	21	---	---	---	---	PASS
OR51G2	81282	broad.mit.edu	37	11	4936530	4936530	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4936530A>G	uc001lzr.1	-	1	364	c.364T>C	c.(364-366)TCT>CCT	p.S122P		NM_001005238	NP_001005238	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G,	122	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAGGCCATAGACAGTAGCACA	0.502													39	16	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048462	6048462	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048462C>T	uc010qzw.1	-	1	473	c.473G>A	c.(472-474)CGG>CAG	p.R158Q		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGCGCATTCCGCACCACAAT	0.493													91	41	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861369	55861369	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861369A>T	uc010rix.1	+	1	586	c.586A>T	c.(586-588)ATG>TTG	p.M196L		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					CGGCACAGAAATGGTGAGCTT	0.428													6	185	---	---	---	---	PASS
OR9Q1	219956	broad.mit.edu	37	11	57947664	57947664	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57947664T>C	uc001nmj.2	+	3	1064	c.748T>C	c.(748-750)TTC>CTC	p.F250L		NM_001005212	NP_001005212	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q,	250	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)				TGTGTCACTCTTCTTTGGTAC	0.517													205	90	---	---	---	---	PASS
MS4A12	54860	broad.mit.edu	37	11	60264962	60264962	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60264962G>A	uc001npr.2	+	2	228	c.171G>A	c.(169-171)CCG>CCA	p.P57P	MS4A12_uc009ynb.2_Silent_p.P57P	NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	57	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						TCACATCTCCGGGAATCTTTG	0.463													4	126	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66483365	66483365	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66483365T>C	uc001ojd.2	-	3	317	c.245A>G	c.(244-246)TAC>TGC	p.Y82C		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	82	CH 1.|Actin-binding.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GAGGTCGCTGTACAGGTCCCC	0.612													99	34	---	---	---	---	PASS
UCP3	7352	broad.mit.edu	37	11	73717342	73717342	+	Missense_Mutation	SNP	C	T	T	rs58614015	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73717342C>T	uc001our.2	-	3	564	c.209G>A	c.(208-210)CGG>CAG	p.R70Q	UCP3_uc001ous.2_Missense_Mutation_p.R70Q	NM_003356	NP_003347	P55916	UCP3_HUMAN	uncoupling protein 3 isoform UCP3L	70	Solcar 1.				mitochondrial transport|respiratory electron transport chain|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	binding			pancreas(1)	1	Breast(11;2.08e-05)					ACCCTCAGTCCGCACCATGGT	0.657													32	12	---	---	---	---	PASS
ZNF202	7753	broad.mit.edu	37	11	123598980	123598980	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123598980C>A	uc001pzd.1	-						ZNF202_uc001pzc.1_Intron|ZNF202_uc001pze.1_Intron|ZNF202_uc001pzf.1_Intron	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202						lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		CCTGAAACCACATAAGGATTT	0.468													122	29	---	---	---	---	PASS
OR10G4	390264	broad.mit.edu	37	11	123886786	123886786	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123886786G>T	uc010sac.1	+	1	505	c.505G>T	c.(505-507)GGA>TGA	p.G169*		NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GCCCTACTGTGGACCCAACCA	0.567													213	118	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124253171	124253171	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124253171G>T	uc010sai.1	-	1	69	c.69C>A	c.(67-69)TTC>TTA	p.F23L	OR8B2_uc001qab.3_RNA	NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	23	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GGGGTTGCCGGAACTCTGGAT	0.413													59	242	---	---	---	---	PASS
TAS2R31	259290	broad.mit.edu	37	12	11183530	11183530	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11183530C>A	uc001qzo.1	-	1	477	c.405G>T	c.(403-405)GGG>GGT	p.G135G	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176885	NP_795366	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	135	Helical; Name=4; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity				0						ATAGTAAAGGCCCCAACAGCA	0.348													54	44	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20876065	20876065	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20876065T>G	uc001rej.3	+	10	1418	c.1063T>G	c.(1063-1065)TAC>GAC	p.Y355D	SLCO1C1_uc010sii.1_Missense_Mutation_p.Y355D|SLCO1C1_uc010sij.1_Missense_Mutation_p.Y306D|SLCO1C1_uc009zip.2_Missense_Mutation_p.Y189D|SLCO1C1_uc001rei.2_Missense_Mutation_p.Y355D|SLCO1C1_uc010sik.1_Missense_Mutation_p.Y237D	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	355	Helical; Name=7; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					AAACCCAGTATACTTCCTATA	0.368													72	25	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30783889	30783889	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30783889C>T	uc001rjd.2	-	25	3189	c.3019G>A	c.(3019-3021)GCA>ACA	p.A1007T	IPO8_uc001rje.1_3'UTR|IPO8_uc010sjt.1_Missense_Mutation_p.A802T	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	1007					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TTCTTCTTTGCCTCTAGCATT	0.398													40	17	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40745484	40745484	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40745484C>A	uc001rmg.3	+	44	6646	c.6525C>A	c.(6523-6525)GAC>GAA	p.D2175E	LRRK2_uc009zjw.2_Missense_Mutation_p.D1013E|LRRK2_uc001rmi.2_Missense_Mutation_p.D1008E	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2175					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGCACACCGACAGAGGACAGC	0.388													61	25	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41337799	41337799	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41337799C>T	uc001rmm.1	+	14	1623	c.1510C>T	c.(1510-1512)CCT>TCT	p.P504S	CNTN1_uc009zjy.1_Missense_Mutation_p.P504S|CNTN1_uc001rmn.1_Missense_Mutation_p.P493S|CNTN1_uc001rmo.2_Missense_Mutation_p.P504S	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	504	Ig-like C2-type 6.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ATATATAGATCCTACGCGAAT	0.343													36	12	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54905761	54905761	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54905761C>T	uc001sgc.3	+	9	892	c.813C>T	c.(811-813)CTC>CTT	p.L271L	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Silent_p.L221L	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	271					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						ATGGGTGCCTCAACTCCAATA	0.483													61	104	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62785030	62785030	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62785030G>A	uc001src.1	+	16	2063	c.2054G>A	c.(2053-2055)GGA>GAA	p.G685E	USP15_uc001srb.1_Missense_Mutation_p.G656E	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	685					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		GATTCAGTTGGAGGAGATAAT	0.393													38	44	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86374004	86374004	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86374004C>T	uc001tai.3	-	8	1750	c.500G>A	c.(499-501)GGA>GAA	p.G167E	MGAT4C_uc001tal.3_Missense_Mutation_p.G167E|MGAT4C_uc001taj.3_Missense_Mutation_p.G167E|MGAT4C_uc001tak.3_Missense_Mutation_p.G167E|MGAT4C_uc010sum.1_Missense_Mutation_p.G191E|MGAT4C_uc001tah.3_Missense_Mutation_p.G167E	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	167	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						CATTAATCTTCCTGCAATAAT	0.398													45	81	---	---	---	---	PASS
NTN4	59277	broad.mit.edu	37	12	96104392	96104392	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96104392C>G	uc001tei.2	-	5	1456	c.1007G>C	c.(1006-1008)GGG>GCG	p.G336A	NTN4_uc009ztf.2_Missense_Mutation_p.G336A|NTN4_uc009ztg.2_Missense_Mutation_p.G299A	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	336	Laminin EGF-like 2.				axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						ATCAGCATGCCCATTACACTT	0.423													60	17	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101520783	101520783	+	Missense_Mutation	SNP	C	A	A	rs139827573		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101520783C>A	uc010svm.1	+	27	3375	c.2803C>A	c.(2803-2805)CGT>AGT	p.R935S	ANO4_uc001thw.2_Missense_Mutation_p.R900S|ANO4_uc001thx.2_Missense_Mutation_p.R935S|ANO4_uc001thy.2_Missense_Mutation_p.R455S	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	935	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						AGAACTGGAACGTCTCCAGAA	0.483										HNSCC(74;0.22)			39	22	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114793441	114793441	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114793441G>A	uc001tvo.2	-	9	1948	c.1453C>T	c.(1453-1455)CCT>TCT	p.P485S	TBX5_uc001tvp.2_Missense_Mutation_p.P485S|TBX5_uc001tvq.2_Missense_Mutation_p.P435S	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	485					cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		AGGAACTCAGGGGGCTGAAGG	0.607													101	52	---	---	---	---	PASS
GATC	283459	broad.mit.edu	37	12	120884640	120884640	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120884640C>A	uc010szi.1	+						TRIAP1_uc001tyg.2_5'Flank	NM_176818	NP_789788	O43716	GATCL_HUMAN	glutamyl-tRNA(Gln) amidotransferase, subunit C						regulation of translational fidelity						0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGGTAAACTCGCGGCTGCAG	0.532													68	25	---	---	---	---	PASS
RB1	5925	broad.mit.edu	37	13	48916733	48916733	+	Splice_Site	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48916733A>G	uc001vcb.2	+	3	431	c.265_splice	c.e3-2	p.G89_splice	RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding			lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTTGTTCCCAGGGAGGTTAT	0.318		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			45	11	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67800906	67800906	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67800906G>T	uc001vik.2	-	2	2359	c.1667C>A	c.(1666-1668)GCG>GAG	p.A556E	PCDH9_uc001vil.2_Missense_Mutation_p.A556E|PCDH9_uc010thl.1_Missense_Mutation_p.A556E|PCDH9_uc001vin.3_Missense_Mutation_p.A556E	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	556	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AATCACAGCCGCTTGGCTTTG	0.418													168	57	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109777485	109777485	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109777485G>A	uc001vqt.1	+	30	3621	c.3495G>A	c.(3493-3495)CAG>CAA	p.Q1165Q	MYO16_uc010agk.1_Silent_p.Q1187Q|MYO16_uc010tjh.1_Silent_p.Q677Q	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1165	IQ.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TAGCACGCCAGCACCTGCTTC	0.408													3	65	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20248790	20248790	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20248790C>T	uc010tku.1	+	1	309	c.309C>T	c.(307-309)TTC>TTT	p.F103F		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGCTCTTCTTCTTACACTTTG	0.458													215	442	---	---	---	---	PASS
OR4N2	390429	broad.mit.edu	37	14	20295820	20295820	+	Silent	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20295820A>G	uc010tkv.1	+	1	213	c.213A>G	c.(211-213)GCA>GCG	p.A71A		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCCTGGATGCATCCTACTCCT	0.493													54	537	---	---	---	---	PASS
OR11G2	390439	broad.mit.edu	37	14	20666364	20666364	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20666364C>A	uc010tlb.1	+	1	870	c.870C>A	c.(868-870)TAC>TAA	p.Y290*		NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G,	290	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CACTGTTCTACGGCTCAGTAC	0.348													151	408	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20854783	20854783	+	Splice_Site	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20854783C>G	uc001vxe.2	-	19	2725	c.2685_splice	c.e19-1	p.G895_splice	TEP1_uc010ahk.2_Splice_Site_p.G245_splice|TEP1_uc010tlf.1_Splice_Site|TEP1_uc010tlg.1_Splice_Site_p.G787_splice	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCTGCGCCATCTGGGGATAAG	0.577													20	49	---	---	---	---	PASS
OR5AU1	390445	broad.mit.edu	37	14	21623814	21623814	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21623814T>A	uc010tlp.1	-	1	371	c.371A>T	c.(370-372)TAC>TTC	p.Y124F		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	124	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		CGTGGAGGAGTAGCAGAAATC	0.527													75	78	---	---	---	---	PASS
CDH24	64403	broad.mit.edu	37	14	23521275	23521275	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23521275C>T	uc001wil.2	-	9	1641	c.1381G>A	c.(1381-1383)GAA>AAA	p.E461K	CDH24_uc001wik.3_5'Flank|CDH24_uc010akf.2_Intron	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	461	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		CAGCCCCTTTCTGGCCCCCAG	0.592													8	14	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26949180	26949180	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26949180C>A	uc001wpy.2	-						NOVA1_uc001wpz.2_Intron|NOVA1_uc001wqa.2_Intron|NOVA1_uc001wqb.2_Intron	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		ACTAAACACTCACTTGTTTGA	0.373													48	147	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356796	42356796	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356796C>G	uc001wvm.2	+	3	2166	c.968C>G	c.(967-969)CCT>CGT	p.P323R	LRFN5_uc010ana.2_Missense_Mutation_p.P323R	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	323	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGGATTTCTCCTGAAGGGAAG	0.458										HNSCC(30;0.082)			98	209	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44975893	44975893	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44975893C>T	uc001wvn.2	-	1	607	c.298G>A	c.(298-300)GAT>AAT	p.D100N		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	100						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TCTCTAACATCAGCTGACTTT	0.403													246	262	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52735279	52735279	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52735279C>A	uc001wzq.2	+	1	849	c.747C>A	c.(745-747)GAC>GAA	p.D249E		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	249	Cytoplasmic (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CGCGCGCGGACGGGAGGGAAG	0.667													120	295	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53619162	53619162	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53619162T>A	uc001xai.2	-	1	885	c.655A>T	c.(655-657)ACG>TCG	p.T219S	DDHD1_uc001xaj.2_Missense_Mutation_p.T219S|DDHD1_uc001xah.2_Missense_Mutation_p.T219S	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	219					lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					GCTGGGCCCGTGGGGGAGCAC	0.701													23	52	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65263341	65263341	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65263341C>A	uc001xht.2	-	10	1329	c.1275G>T	c.(1273-1275)CGG>CGT	p.R425R	SPTB_uc001xhr.2_Silent_p.R425R|SPTB_uc001xhs.2_Silent_p.R425R|SPTB_uc001xhu.2_Silent_p.R425R	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	425	Spectrin 2.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GGTCAAAGCGCCGGGCCAGTT	0.597													44	144	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76906013	76906013	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76906013G>A	uc001xsq.1	+	2	384	c.317G>A	c.(316-318)TGC>TAC	p.C106Y	ESRRB_uc001xsr.2_Missense_Mutation_p.C106Y|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	106						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TGCCTCGTGTGCGGGGACATT	0.617													37	98	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96777896	96777896	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96777896C>T	uc001yfi.2	-	27	4338	c.3973G>A	c.(3973-3975)GAT>AAT	p.D1325N		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1325										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CCATCAGAATCAGACTTCACT	0.289													5	51	---	---	---	---	PASS
MARK3	4140	broad.mit.edu	37	14	103933533	103933533	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103933533G>A	uc001ymz.3	+						MARK3_uc001ymx.3_Intron|MARK3_uc001ymw.3_Intron|MARK3_uc001yna.3_Intron|MARK3_uc001ymy.3_Intron|MARK3_uc010awp.2_Intron|MARK3_uc010tyb.1_Intron	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3								ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			TCAGAGGTAAGAGTAATCAGA	0.279													27	120	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369109	22369109	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369109C>T	uc010tzu.1	+	1	534	c.534C>T	c.(532-534)TTC>TTT	p.F178F	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ACAGTTACTTCTGTGACATCA	0.493													26	352	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369110	22369110	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369110T>G	uc010tzu.1	+	1	535	c.535T>G	c.(535-537)TGT>GGT	p.C179G	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CAGTTACTTCTGTGACATCAC	0.493													23	354	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369111	22369111	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369111G>T	uc010tzu.1	+	1	536	c.536G>T	c.(535-537)TGT>TTT	p.C179F	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AGTTACTTCTGTGACATCACA	0.488													22	352	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28356897	28356897	+	3'UTR	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28356897C>T	uc001zbj.2	-	93					HERC2_uc001zbi.2_3'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTCACGAGGACGTTTCCCCAT	0.552													77	31	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28544607	28544607	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28544607C>A	uc001zbj.2	-	3	234	c.128G>T	c.(127-129)GGA>GTA	p.G43V	HERC2_uc001zbl.1_5'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	43	WD 1.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TACAATTTCTCCATCTTTAAC	0.423													100	31	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28544608	28544608	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28544608C>T	uc001zbj.2	-	3	233	c.127G>A	c.(127-129)GGA>AGA	p.G43R	HERC2_uc001zbl.1_5'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	43	WD 1.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACAATTTCTCCATCTTTAACC	0.423													98	33	---	---	---	---	PASS
MTMR15	22909	broad.mit.edu	37	15	31196869	31196869	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31196869G>A	uc001zff.2	+	2	294	c.3G>A	c.(1-3)ATG>ATA	p.M1I	MTMR15_uc001zfc.3_Missense_Mutation_p.M1I|MTMR15_uc010azw.2_Missense_Mutation_p.M1I|MTMR15_uc001zfd.3_Missense_Mutation_p.M1I|MTMR15_uc001zfe.2_5'UTR	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	1					double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)		TAATACTCATGATGTCAGAAG	0.328								Direct_reversal_of_damage|Editing_and_processing_nucleases					219	75	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40954333	40954333	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40954333G>T	uc010bbs.1	+	27	7137	c.6976G>T	c.(6976-6978)GTA>TTA	p.V2326L	CASC5_uc010bbt.1_Missense_Mutation_p.V2300L	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	2326					acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		CCTGAAGAATGTAGTCAAGCA	0.368													342	99	---	---	---	---	PASS
SLC24A5	283652	broad.mit.edu	37	15	48414135	48414135	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48414135G>T	uc001zwe.2	+	2	276	c.203G>T	c.(202-204)GGC>GTC	p.G68V	SLC24A5_uc001zwd.2_Missense_Mutation_p.G68V|SLC24A5_uc010bel.2_Intron	NM_205850	NP_995322	Q71RS6	NCKX5_HUMAN	solute carrier family 24, member 5 precursor	68	Helical; Name=1; (Potential).				response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity				0		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		AGAGATGGAGGCATCATAATC	0.418													140	51	---	---	---	---	PASS
SIN3A	25942	broad.mit.edu	37	15	75684663	75684663	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75684663C>G	uc002bai.2	-	15	3030	c.2771G>C	c.(2770-2772)AGA>ACA	p.R924T	SIN3A_uc002baj.2_Missense_Mutation_p.R924T|SIN3A_uc010uml.1_Missense_Mutation_p.R924T	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	924					blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TTCCCATTCTCTCTCTCGGTT	0.498													88	208	---	---	---	---	PASS
SNRNP25	79622	broad.mit.edu	37	16	107122	107122	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:107122C>T	uc002cfj.3	+	5	539	c.378C>T	c.(376-378)ATC>ATT	p.I126I	SNRNP25_uc002cfk.3_RNA	NM_024571	NP_078847	Q9BV90	SNR25_HUMAN	U11/U12 snRNP 25K protein	126	Ubiquitin-like.				mRNA processing	U12-type spliceosomal complex					0						TTTCCTTCATCAAAAAGCTGA	0.512													66	384	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2153488	2153488	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2153488G>T	uc002cos.1	-	23	8779	c.8570C>A	c.(8569-8571)GCC>GAC	p.A2857D	PKD1_uc002cot.1_Missense_Mutation_p.A2857D|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2857	Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CTGGGCGCCGGCCTGTGTCTG	0.627													22	138	---	---	---	---	PASS
IL32	9235	broad.mit.edu	37	16	3119009	3119009	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3119009G>C	uc002cto.2	+	6	569	c.358G>C	c.(358-360)GAA>CAA	p.E120Q	IL32_uc002ctk.2_Missense_Mutation_p.E74Q|IL32_uc010uwp.1_Missense_Mutation_p.E54Q|IL32_uc010btb.2_Missense_Mutation_p.E64Q|IL32_uc002ctl.2_Missense_Mutation_p.E74Q|IL32_uc002ctm.2_Missense_Mutation_p.E74Q|IL32_uc002ctn.2_Missense_Mutation_p.E74Q|IL32_uc002cts.3_Missense_Mutation_p.E74Q|IL32_uc002ctp.2_Missense_Mutation_p.E54Q|IL32_uc002ctq.2_Missense_Mutation_p.E120Q|IL32_uc002ctr.2_Missense_Mutation_p.E54Q|IL32_uc002ctt.2_Missense_Mutation_p.E74Q|IL32_uc010uwr.1_Missense_Mutation_p.E34Q|IL32_uc002ctu.2_Missense_Mutation_p.E65Q	NM_004221	NP_004212	P24001	IL32_HUMAN	interleukin 32 isoform B	120					cell adhesion|defense response|immune response	extracellular space	cytokine activity			pancreas(1)	1						TCCTCTACTTGAAAAAGAAAG	0.582													20	32	---	---	---	---	PASS
C16orf71	146562	broad.mit.edu	37	16	4790471	4790471	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4790471C>T	uc002cxn.2	+	4	1056	c.594C>T	c.(592-594)GCC>GCT	p.A198A		NM_139170	NP_631909	Q8IYS4	CP071_HUMAN	hypothetical protein LOC146562	198										central_nervous_system(1)	1						ACCGCCGGGCCCTCCGACAGG	0.612													82	39	---	---	---	---	PASS
GLYR1	84656	broad.mit.edu	37	16	4882911	4882911	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4882911G>A	uc002cxx.3	-	4	195	c.158C>T	c.(157-159)GCC>GTC	p.A53V	GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_5'UTR|GLYR1_uc002cya.2_Missense_Mutation_p.A53V|GLYR1_uc010uxv.1_Missense_Mutation_p.A53V	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN	cytokine-like nuclear factor n-pac	53	PWWP.				pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0						TTTGATCCAGGCACTAGCAGA	0.403													95	37	---	---	---	---	PASS
EARS2	124454	broad.mit.edu	37	16	23546569	23546569	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23546569C>T	uc002dlt.3	-	4	630	c.598G>A	c.(598-600)GAC>AAC	p.D200N	EARS2_uc002dlr.3_RNA|EARS2_uc002dls.3_RNA|EARS2_uc002dlu.2_Missense_Mutation_p.D200N	NM_001083614	NP_001077083	Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2 precursor	200					glutamyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|glutamate-tRNA ligase activity|RNA binding				0				GBM - Glioblastoma multiforme(48;0.0353)	L-Glutamic Acid(DB00142)	TAGACCAGGTCCTGGAAGGCT	0.627													23	157	---	---	---	---	PASS
CD19	930	broad.mit.edu	37	16	28944824	28944824	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28944824C>A	uc002drs.2	+	4	891	c.829C>A	c.(829-831)CGG>AGG	p.R277R	uc010vct.1_Intron|CD19_uc010byo.1_Silent_p.R277R	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor	277	Extracellular (Potential).|Ig-like C2-type 2.				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						GATCACTGCTCGGCCAGGTAG	0.552													4	117	---	---	---	---	PASS
ZNF668	79759	broad.mit.edu	37	16	31075787	31075787	+	5'UTR	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31075787G>A	uc010caf.2	-	2					ZNF668_uc002eao.2_5'UTR|ZNF668_uc010cag.1_5'UTR	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4						CCATGGCCTTGGTGAACGGGG	0.567													4	124	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31087665	31087665	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31087665C>T	uc002eap.2	+	2	309	c.20C>T	c.(19-21)TCA>TTA	p.S7L	ZNF668_uc002eao.2_5'Flank	NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						ACACCCCCCTCACTCAGCTGC	0.617													28	187	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31090223	31090223	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31090223C>T	uc002eap.2	+	2	2867	c.2578C>T	c.(2578-2580)CTG>TTG	p.L860L		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	860	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						GTTTGACTCTCTGCCTGCCCT	0.627													38	176	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31090538	31090538	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31090538C>T	uc002eap.2	+	2	3182	c.2893C>T	c.(2893-2895)CAG>TAG	p.Q965*		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	965	C2H2-type 17; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CTGCTGTGGTCAGACCTACGA	0.607													15	192	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31091162	31091162	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31091162G>A	uc002eap.2	+	2	3806	c.3517G>A	c.(3517-3519)GAG>AAG	p.E1173K		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1173					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						AGAGGTGTGGGAGGAGACCAC	0.617													11	56	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52472835	52472835	+	3'UTR	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52472835C>T	uc002egw.2	-	7					TOX3_uc010vgt.1_3'UTR|TOX3_uc010vgu.1_Missense_Mutation_p.G587E	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3						apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						TCAGTATGTCCCAGGATTCAT	0.363													24	13	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66949990	66949990	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66949990C>T	uc002eql.2	-	5	475	c.402G>A	c.(400-402)CGG>CGA	p.R134R	CDH16_uc010cdy.2_Silent_p.R134R|CDH16_uc002eqm.2_Intron	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	134	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		CCCGGCTCAGCCGAGCTCTGT	0.567													60	24	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577046	7577046	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577046C>A	uc002gim.2	-	8	1086	c.892G>T	c.(892-894)GAG>TAG	p.E298*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.E298*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E166*|TP53_uc010cng.1_Nonsense_Mutation_p.E166*|TP53_uc002gii.1_Nonsense_Mutation_p.E166*|TP53_uc010cnh.1_Nonsense_Mutation_p.E298*|TP53_uc010cni.1_Nonsense_Mutation_p.E298*|TP53_uc002gij.2_Nonsense_Mutation_p.E298*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	298	Interaction with HIPK1 (By similarity).		E -> V (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E298*(35)|p.0?(7)|p.E298K(2)|p.?(2)|p.E298V(2)|p.L299fs*2(1)|p.L265_K305del41(1)|p.E298A(1)|p.E298fs*53(1)|p.G293fs*1(1)|p.E298fs*47(1)|p.E298E(1)|p.E298Q(1)|p.E298_P301delELPP(1)|p.H296_S303delHHELPPGS(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGGGGCAGCTCGTGGTGAGGC	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			164	63	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10348590	10348590	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10348590G>A	uc002gmn.2	-	36	5370	c.5259C>T	c.(5257-5259)CGC>CGT	p.R1753R	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1753	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CCTCTGCATTGCGGGCTTCCT	0.468													307	89	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10427947	10427947	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10427947C>A	uc010coi.2	-	35	5139	c.5011G>T	c.(5011-5013)GAG>TAG	p.E1671*	uc002gml.1_Intron|MYH2_uc002gmp.3_Nonsense_Mutation_p.E1671*|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1671	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTCAGGTCCTCCTGGCTCCGG	0.572													100	50	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10427948	10427948	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10427948C>A	uc010coi.2	-	35	5138	c.5010G>T	c.(5008-5010)CAG>CAT	p.Q1670H	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.Q1670H|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1670	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TCAGGTCCTCCTGGCTCCGGA	0.567													100	49	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21319284	21319284	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319284C>T	uc002gyv.1	+	3	1335	c.630C>T	c.(628-630)TGC>TGT	p.C210C		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	210	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	GCAAGCTCTGCCTCATGTGGC	0.637										Prostate(3;0.18)			45	84	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29664885	29664885	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29664885G>T	uc002hgg.2	+	44	7024	c.6691G>T	c.(6691-6693)GAA>TAA	p.E2231*	NF1_uc002hgh.2_Nonsense_Mutation_p.E2210*|NF1_uc010cso.2_Nonsense_Mutation_p.E419*|NF1_uc010wbt.1_5'UTR|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2231					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCAGTGGACAGAACTAGCTCA	0.313			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			38	15	---	---	---	---	PASS
SUZ12	23512	broad.mit.edu	37	17	30315405	30315405	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30315405G>T	uc002hgs.2	+	10	1312	c.1090G>T	c.(1090-1092)GAG>TAG	p.E364*	SUZ12_uc002hgt.2_Nonsense_Mutation_p.E341*	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	364					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TTGGACAGGAGAGACCAATGA	0.433			T	JAZF1	endometrial stromal tumours								158	49	---	---	---	---	PASS
CANT1	124583	broad.mit.edu	37	17	76993183	76993183	+	Silent	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76993183A>G	uc002jwn.2	-	4	961	c.522T>C	c.(520-522)AAT>AAC	p.N174N	CANT1_uc002jwk.2_Silent_p.N174N|CANT1_uc002jwj.2_Silent_p.N174N|CANT1_uc002jwl.2_RNA|CANT1_uc002jwm.1_5'Flank	NM_001159772	NP_001153244	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	174	Lumenal (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity				0			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGAGTTTCCCATTGAAAACAA	0.602			T	ETV4	prostate								461	153	---	---	---	---	PASS
CETN1	1068	broad.mit.edu	37	18	580811	580811	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580811G>A	uc002kko.1	+	1	445	c.403G>A	c.(403-405)GAG>AAG	p.E135K		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	135	EF-hand 3.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2						CGAGCTGGGGGAGAACCTCAC	0.537													45	146	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5395670	5395670	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5395670T>A	uc002kmt.1	-	20	3096	c.3010A>T	c.(3010-3012)ATG>TTG	p.M1004L	EPB41L3_uc010wzh.1_Missense_Mutation_p.M835L|EPB41L3_uc002kmu.1_Missense_Mutation_p.M782L|EPB41L3_uc010dkq.1_Missense_Mutation_p.M673L|EPB41L3_uc002kms.1_Missense_Mutation_p.M239L|EPB41L3_uc010wze.1_Missense_Mutation_p.M309L|EPB41L3_uc010wzf.1_Missense_Mutation_p.M301L|EPB41L3_uc010wzg.1_Missense_Mutation_p.M276L|EPB41L3_uc010dkr.2_Missense_Mutation_p.M396L	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1004	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TGTGCACTCATCAGCACGCCT	0.522													124	279	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5434020	5434020	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5434020C>A	uc002kmt.1	-	7	792	c.706G>T	c.(706-708)GAG>TAG	p.E236*	EPB41L3_uc010wzh.1_Nonsense_Mutation_p.E236*|EPB41L3_uc002kmu.1_Nonsense_Mutation_p.E236*|EPB41L3_uc010dkq.1_Nonsense_Mutation_p.E127*|EPB41L3_uc010dks.1_Nonsense_Mutation_p.E258*|EPB41L3_uc002kmv.1_Nonsense_Mutation_p.E127*	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	236	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity	p.E236V(1)		ovary(5)	5						TCTCCGAGCTCTGACTGGACA	0.517													129	182	---	---	---	---	PASS
CIDEA	1149	broad.mit.edu	37	18	12274250	12274250	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12274250C>T	uc002kqt.3	+	4	554	c.489C>T	c.(487-489)TGC>TGT	p.C163C	CIDEA_uc002kqu.3_Silent_p.C197C|CIDEA_uc010dlc.2_RNA	NM_001279	NP_001270	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a isoform	163					DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|lipid metabolic process|lipid storage|negative regulation of apoptosis|negative regulation of cytokine secretion|negative regulation of lipid catabolic process|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of sequestering of triglyceride|temperature homeostasis	mitochondrial envelope|nucleus	protein homodimerization activity			ovary(1)|central_nervous_system(1)	2						ACATCCGGTGCACGGGACTCA	0.597													81	110	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32409029	32409029	+	Intron	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32409029C>A	uc010dmn.1	+						DTNA_uc002kxu.2_Nonsense_Mutation_p.C373*|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Nonsense_Mutation_p.C370*|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_RNA|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron|DTNA_uc010dmm.2_Intron|DTNA_uc010xby.1_Intron|DTNA_uc010dmo.2_Intron|DTNA_uc002kyd.3_Intron|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						TTGGTGGATGCGTCTAGATGG	0.428													43	108	---	---	---	---	PASS
MOCOS	55034	broad.mit.edu	37	18	33779713	33779713	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33779713G>T	uc002kzq.3	+	4	390	c.367G>T	c.(367-369)GCT>TCT	p.A123S		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	123					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	GAGCACGGCTGCTCTCAAACT	0.607													57	73	---	---	---	---	PASS
KATNAL2	83473	broad.mit.edu	37	18	44586020	44586020	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44586020C>T	uc002lco.2	+	5	522	c.328C>T	c.(328-330)CGA>TGA	p.R110*	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Nonsense_Mutation_p.R70*	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2	182						cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						TGCCCACCCACGAAGAGTAAG	0.383													76	148	---	---	---	---	PASS
MBD1	4152	broad.mit.edu	37	18	47800013	47800013	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47800013A>C	uc010dow.1	-	12	1804	c.1367T>G	c.(1366-1368)CTT>CGT	p.L456R	MBD1_uc002lef.2_Missense_Mutation_p.L207R|MBD1_uc002leg.2_Missense_Mutation_p.L406R|MBD1_uc010xdi.1_Missense_Mutation_p.L507R|MBD1_uc002leh.3_Missense_Mutation_p.L400R|MBD1_uc002len.2_Missense_Mutation_p.L456R|MBD1_uc002lei.3_Missense_Mutation_p.L456R|MBD1_uc002lej.3_Missense_Mutation_p.L400R|MBD1_uc002lek.3_Missense_Mutation_p.L407R|MBD1_uc002lel.3_Missense_Mutation_p.L433R|MBD1_uc002lem.3_Missense_Mutation_p.L456R|MBD1_uc010xdj.1_Missense_Mutation_p.L400R|MBD1_uc010xdk.1_Missense_Mutation_p.L481R|MBD1_uc010dox.1_Missense_Mutation_p.L433R|MBD1_uc002leo.2_Missense_Mutation_p.L456R	NM_015846	NP_056671	Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1 isoform 1	456					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TAAAAACACAAGGTCAGTGCC	0.627													68	108	---	---	---	---	PASS
MEX3C	51320	broad.mit.edu	37	18	48703429	48703429	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48703429C>A	uc002lfc.3	-	2	1272	c.1272G>T	c.(1270-1272)GCG>GCT	p.A424A		NM_016626	NP_057710	Q5U5Q3	MEX3C_HUMAN	ring finger and KH domain containing 2	424						cytoplasm|nucleus	RNA binding|zinc ion binding	p.A424D(1)		lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		AGGAGAGCCACGCAGAGCCAA	0.448													23	75	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67855446	67855446	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67855446C>T	uc002lkp.2	-	10	1271	c.1203G>A	c.(1201-1203)GTG>GTA	p.V401V	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_5'UTR|RTTN_uc002lkq.1_Silent_p.V401V	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	401							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				CTCTTATTATCACTTGTCTGC	0.328													16	23	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76752199	76752199	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76752199C>T	uc002lmt.2	+	2	208	c.208C>T	c.(208-210)CAG>TAG	p.Q70*	SALL3_uc010dra.2_5'Flank	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	70					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCTGGAGCACCAGCGGAGCTG	0.721													13	21	---	---	---	---	PASS
THOP1	7064	broad.mit.edu	37	19	2807757	2807757	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2807757G>A	uc002lwj.2	+	8	1359	c.1204G>A	c.(1204-1206)GCG>ACG	p.A402T	THOP1_uc010xgz.1_Missense_Mutation_p.A281T|THOP1_uc002lwk.2_5'Flank	NM_003249	NP_003240	P52888	THOP1_HUMAN	thimet oligopeptidase 1	402					proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGAGGGACGCGGCCTCGGG	0.726													9	63	---	---	---	---	PASS
PIP5K1C	23396	broad.mit.edu	37	19	3641803	3641803	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3641803G>A	uc002lyj.1	-	15	1744	c.1687C>T	c.(1687-1689)CAG>TAG	p.Q563*	PIP5K1C_uc010xhq.1_Nonsense_Mutation_p.Q563*|PIP5K1C_uc010xhr.1_Nonsense_Mutation_p.Q563*	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	563					axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GGCTCCTCCTGCGGCCTGCAG	0.637													44	62	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10561335	10561335	+	Intron	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10561335A>T	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron|PDE4A_uc002mom.2_5'Flank|PDE4A_uc002mon.2_5'Flank	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	TCAGGTAGCTAAGCCCAGAGG	0.672													12	16	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15349185	15349185	+	3'UTR	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15349185C>G	uc002nar.2	-	20						NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long						interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CACCTAGGTGCGCTCAGAAAA	0.483			T	NUT|C15orf55	lethal midline carcinoma of young people								42	114	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15538134	15538134	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15538134C>A	uc002nbc.2	-	4	1285	c.1262G>T	c.(1261-1263)GGG>GTG	p.G421V	WIZ_uc002nba.3_Missense_Mutation_p.G288V|WIZ_uc002nbb.3_Missense_Mutation_p.G247V	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1104	Pro-rich.					nucleus	zinc ion binding				0						TGGGCTTGGCCCTGGTGGGTT	0.652													62	90	---	---	---	---	PASS
C19orf50	79036	broad.mit.edu	37	19	18677931	18677931	+	Intron	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18677931C>G	uc002njo.2	+						C19orf50_uc002njp.2_Intron|C19orf50_uc002njq.2_Intron	NM_024069	NP_076974	Q9BQD3	CS050_HUMAN	hypothetical protein LOC79036								protein binding				0						TGTGCCTTCTCTCCCCTGCAG	0.642													43	57	---	---	---	---	PASS
ZNF85	7639	broad.mit.edu	37	19	21133024	21133024	+	Silent	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21133024T>C	uc002npg.3	+	4	1831	c.1704T>C	c.(1702-1704)TGT>TGC	p.C568C	ZNF85_uc010ecn.2_Silent_p.C503C|ZNF85_uc010eco.2_Silent_p.C516C|ZNF85_uc002npi.2_Silent_p.C509C	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	568	C2H2-type 16.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						CTTACAAATGTGAAGAATGTG	0.338													25	35	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21240490	21240490	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21240490G>T	uc002npj.2	+	5	1486	c.1376G>T	c.(1375-1377)TGT>TTT	p.C459F	ZNF430_uc002npk.2_Missense_Mutation_p.C458F	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	459	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						CCCTACAAATGTGAAGAATGT	0.393													40	113	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22939415	22939415	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22939415T>A	uc010xrh.1	-	7	2756	c.2756A>T	c.(2755-2757)GAA>GTA	p.E919V		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GCCACATTCTTCACATTTGTA	0.368													34	5	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22939499	22939499	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22939499T>A	uc010xrh.1	-	7	2672	c.2672A>T	c.(2671-2673)GAA>GTA	p.E891V		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GCCACATTCTTCACATTTGTA	0.363													8	5	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22939797	22939797	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22939797A>T	uc010xrh.1	-	6	2534	c.2534T>A	c.(2533-2535)CTT>CAT	p.L845H		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ATGTTTCCTAAGGGCTGAGAA	0.348													45	57	---	---	---	---	PASS
ZNF675	171392	broad.mit.edu	37	19	23836845	23836845	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23836845G>A	uc002nri.2	-	4	1072	c.890C>T	c.(889-891)TCA>TTA	p.S297L		NM_138330	NP_612203	Q8TD23	ZN675_HUMAN	zinc finger protein 675	297	C2H2-type 6.				bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AGTAAGATTTGAGAACTGGTT	0.388													39	117	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36042008	36042008	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36042008T>G	uc002oal.1	-	20	2920	c.2891A>C	c.(2890-2892)AAG>ACG	p.K964T	ATP4A_uc010eee.1_Missense_Mutation_p.K122T	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	964	Helical; (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	CACCAGGATCTTATTCCTGGG	0.542													14	25	---	---	---	---	PASS
ZNF566	84924	broad.mit.edu	37	19	36940084	36940084	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36940084C>A	uc002oea.3	-	5	1134	c.1052G>T	c.(1051-1053)GGC>GTC	p.G351V	ZNF566_uc010xte.1_Missense_Mutation_p.G351V|ZNF566_uc010xtf.1_Missense_Mutation_p.G352V|ZNF566_uc002oeb.3_Missense_Mutation_p.G351V|ZNF566_uc002oec.3_Missense_Mutation_p.G247V|ZNF566_uc010xtg.1_Missense_Mutation_p.G247V	NM_032838	NP_116227	Q969W8	ZN566_HUMAN	zinc finger protein 566 isoform 1	351	C2H2-type 5.|C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					AAGGTCTGAGCCAGAACGAAA	0.388													38	59	---	---	---	---	PASS
PLEKHG2	64857	broad.mit.edu	37	19	39913469	39913469	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39913469C>T	uc010xuz.1	+	18	2100	c.1775C>T	c.(1774-1776)TCA>TTA	p.S592L	PLEKHG2_uc010xuy.1_Missense_Mutation_p.S533L|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.S370L	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	592					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGGGACTCTTCAGAAGAGGAG	0.602													46	97	---	---	---	---	PASS
PRR19	284338	broad.mit.edu	37	19	42813770	42813770	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42813770C>G	uc002oti.2	+	2	412	c.34C>G	c.(34-36)CAG>GAG	p.Q12E	PRR19_uc002oth.1_Missense_Mutation_p.Q12E|PRR19_uc002otj.2_Missense_Mutation_p.Q12E	NM_199285	NP_954979	A6NJB7	PRR19_HUMAN	proline rich 19	12											0		Prostate(69;0.00682)				CCAGCCTTTTCAGCAGCCTGA	0.572													68	346	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45856082	45856082	+	Intron	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45856082G>C	uc002pbj.2	-						ERCC2_uc002pbh.2_Intron|ERCC2_uc002pbi.2_Intron|ERCC2_uc010ejz.2_Intron|ERCC2_uc002pbk.2_Intron	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GCACTGGTGGGCAGAGGAGAG	0.627			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				73	109	---	---	---	---	PASS
PNMAL1	55228	broad.mit.edu	37	19	46974186	46974186	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46974186T>A	uc002peq.3	-	2	413	c.107A>T	c.(106-108)CAG>CTG	p.Q36L	PNMAL1_uc002per.3_Missense_Mutation_p.Q36L	NM_018215	NP_060685	Q86V59	PNML1_HUMAN	PNMA-like 1 isoform a	36											0		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		aatttctgcctgcccacagtc	0.000													62	131	---	---	---	---	PASS
ELSPBP1	64100	broad.mit.edu	37	19	48517489	48517489	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48517489C>A	uc002pht.2	+	3	287	c.132C>A	c.(130-132)ACC>ACA	p.T44T		NM_022142	NP_071425	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1 precursor	44	Fibronectin type-II 1.				single fertilization	extracellular region					0		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		TCACTTGCACCCATATTCATA	0.498													155	213	---	---	---	---	PASS
KCNJ14	3770	broad.mit.edu	37	19	48967528	48967528	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48967528G>A	uc002pje.1	+	3	1210	c.805G>A	c.(805-807)GTG>ATG	p.V269M	KCNJ14_uc002pjf.1_Missense_Mutation_p.V269M	NM_013348	NP_037480	Q9UNX9	IRK14_HUMAN	potassium inwardly-rectifying channel J14	269	Cytoplasmic (By similarity).					voltage-gated potassium channel complex	inward rectifier potassium channel activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)		TATCTTCCTCGTGTCCCCCAT	0.597													53	76	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50099158	50099158	+	Silent	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50099158G>A	uc002poo.3	+	4	1566	c.1566G>A	c.(1564-1566)CAG>CAA	p.Q522Q		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCCACTCCCAGGGGCTGCCCA	0.711													19	23	---	---	---	---	PASS
TSKS	60385	broad.mit.edu	37	19	50248526	50248526	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50248526G>C	uc002ppm.2	-	7	1131	c.1120C>G	c.(1120-1122)CGC>GGC	p.R374G		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	374							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GCCTGTTCGCGCTGTGCCCGC	0.701													27	50	---	---	---	---	PASS
AKT1S1	84335	broad.mit.edu	37	19	50373310	50373310	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50373310G>A	uc002pql.3	-	5	1361	c.635C>T	c.(634-636)TCG>TTG	p.S212L	PNKP_uc002pqh.2_5'Flank|PNKP_uc002pqi.2_5'Flank|PNKP_uc002pqj.2_5'Flank|PNKP_uc010enm.2_5'Flank|PNKP_uc002pqk.2_5'Flank|AKT1S1_uc002pqn.3_Missense_Mutation_p.S212L|AKT1S1_uc002pqm.3_Missense_Mutation_p.S212L	NM_032375	NP_115751	Q96B36	AKTS1_HUMAN	AKT1 substrate 1 (proline-rich)	212					negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|nerve growth factor receptor signaling pathway|neuroprotection|phosphatidylinositol-mediated signaling|regulation of survival gene product expression	cytosolic part	protein binding				0		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CAGGTCGGGCGAAGAGGGCTG	0.741													5	14	---	---	---	---	PASS
KCNC3	3748	broad.mit.edu	37	19	50831691	50831691	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50831691C>A	uc002pru.1	-	1	944	c.649G>T	c.(649-651)GCA>TCA	p.A217S	NR1H2_uc002prv.3_5'Flank	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel	217	Cytoplasmic (Potential).				cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		TGGGCGCCTGCGGCGTTGGCG	0.637													5	9	---	---	---	---	PASS
IGLON5	402665	broad.mit.edu	37	19	51826948	51826948	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51826948C>A	uc002pwc.2	+	3	191	c.191C>A	c.(190-192)GCC>GAC	p.A64D		NM_001101372	NP_001094842	A6NGN9	IGLO5_HUMAN	IgLON family member 5 precursor	64	Ig-like C2-type 1.					extracellular region					0						ACCCGCGTGGCCTGGCTGAAC	0.642													28	65	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51918657	51918657	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51918657C>G	uc002pwo.2	-	7	1724	c.1108G>C	c.(1108-1110)GTA>CTA	p.V370L	SIGLEC10_uc002pwp.2_Missense_Mutation_p.V312L|SIGLEC10_uc002pwq.2_Missense_Mutation_p.V312L|SIGLEC10_uc002pwr.2_Missense_Mutation_p.V370L|SIGLEC10_uc010ycy.1_Missense_Mutation_p.V280L|SIGLEC10_uc010ycz.1_Missense_Mutation_p.V322L|SIGLEC10_uc010eow.2_Missense_Mutation_p.V182L|SIGLEC10_uc002pws.1_Missense_Mutation_p.V206L	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	370	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CCCTCCAGTACTGGGAGAGAC	0.632													52	135	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	52004682	52004682	+	Silent	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52004682C>T	uc002pwx.1	-	1	362	c.306G>A	c.(304-306)AAG>AAA	p.K102K	SIGLEC12_uc002pww.1_5'Flank|SIGLEC12_uc010eoy.1_5'UTR	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like	102	Ig-like V-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGGTACAATCCTTGTTCTGTG	0.493													7	561	---	---	---	---	PASS
ZNF83	55769	broad.mit.edu	37	19	53117505	53117505	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53117505C>T	uc002pzu.3	-	2	1557	c.313G>A	c.(313-315)GGC>AGC	p.G105S	ZNF83_uc002pzv.3_Missense_Mutation_p.G105S|ZNF83_uc010eps.2_Missense_Mutation_p.G105S|ZNF83_uc010ept.2_Missense_Mutation_p.G105S|ZNF83_uc010epu.2_Missense_Mutation_p.G105S|ZNF83_uc010epv.2_Missense_Mutation_p.G105S|ZNF83_uc010epw.2_Missense_Mutation_p.G105S|ZNF83_uc010epx.2_Missense_Mutation_p.G105S|ZNF83_uc010epy.2_Missense_Mutation_p.G105S|ZNF83_uc010epz.2_Missense_Mutation_p.G105S|ZNF83_uc010eqb.1_Missense_Mutation_p.G105S	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a	105	C2H2-type 1; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		AAATGTAAGCCTTGATGAAAG	0.328													23	94	---	---	---	---	PASS
TTYH1	57348	broad.mit.edu	37	19	54932556	54932556	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54932556C>A	uc002qfq.2	+	3	503	c.411C>A	c.(409-411)GAC>GAA	p.D137E	TTYH1_uc010yey.1_Missense_Mutation_p.D186E|TTYH1_uc002qfr.2_Missense_Mutation_p.D137E|TTYH1_uc002qft.2_Missense_Mutation_p.D137E|TTYH1_uc002qfu.1_Missense_Mutation_p.D52E	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	137	Extracellular (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GCACCATTGACCACCTGGTGA	0.602													42	127	---	---	---	---	PASS
TTYH1	57348	broad.mit.edu	37	19	54932557	54932557	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54932557C>T	uc002qfq.2	+	3	504	c.412C>T	c.(412-414)CAC>TAC	p.H138Y	TTYH1_uc010yey.1_Missense_Mutation_p.H187Y|TTYH1_uc002qfr.2_Missense_Mutation_p.H138Y|TTYH1_uc002qft.2_Missense_Mutation_p.H138Y|TTYH1_uc002qfu.1_Missense_Mutation_p.H53Y	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	138	Extracellular (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CACCATTGACCACCTGGTGAG	0.602													42	124	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56539873	56539873	+	Silent	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539873A>G	uc002qmj.2	+	7	2274	c.2274A>G	c.(2272-2274)CTA>CTG	p.L758L	NLRP5_uc002qmi.2_Silent_p.L739L	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	758						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGGTCCCTCTATGGTGAGTAC	0.527													261	429	---	---	---	---	PASS
ESF1	51575	broad.mit.edu	37	20	13698128	13698128	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13698128C>T	uc002woj.2	-	13	2257	c.2149G>A	c.(2149-2151)GAG>AAG	p.E717K		NM_016649	NP_057733	Q9H501	ESF1_HUMAN	ABT1-associated protein	717	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1						TTACTGTCCTCGTCCTCATCC	0.373													82	123	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51870229	51870229	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51870229G>A	uc002xwo.2	+	2	1188	c.232G>A	c.(232-234)GAT>AAT	p.D78N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	78					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			GTCCAATCAGGATGCCGAGAA	0.537													52	115	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51870575	51870575	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51870575G>A	uc002xwo.2	+	2	1534	c.578G>A	c.(577-579)AGC>AAC	p.S193N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	193					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			AGCCTGTTCAGCTCGGTGCAG	0.572													58	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10863033	10863033	+	IGR	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10863033C>A								None (None upstream) : TPTE (43710 downstream)																							TCTGAGGACACGGCCATGTAT	0.502													232	459	---	---	---	---	PASS
DYRK1A	1859	broad.mit.edu	37	21	38858871	38858871	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38858871C>G	uc002ywk.2	+	5	694	c.619C>G	c.(619-621)CTT>GTT	p.L207V	DYRK1A_uc002ywh.1_Missense_Mutation_p.L169V|DYRK1A_uc002ywi.2_Missense_Mutation_p.L207V|DYRK1A_uc002ywj.2_Missense_Mutation_p.L198V|DYRK1A_uc002ywl.2_Missense_Mutation_p.L207V|DYRK1A_uc002ywm.2_Missense_Mutation_p.L207V|DYRK1A_uc011aei.1_5'Flank	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	207	Protein kinase.				nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						AGTGCGACTTCTTGAGCTCAT	0.403													11	35	---	---	---	---	PASS
KRTAP10-8	386681	broad.mit.edu	37	21	46032670	46032670	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46032670G>A	uc002zfo.1	+	1	675	c.653G>A	c.(652-654)CGG>CAG	p.R218Q	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	218	19 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)|breast(1)	2						cctgtgtgccggcctgcctgc	0.264													5	320	---	---	---	---	PASS
SLC19A1	6573	broad.mit.edu	37	21	46935569	46935569	+	3'UTR	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46935569G>A	uc002zhl.1	-	6					SLC19A1_uc010gpy.1_Intron|SLC19A1_uc011aft.1_3'UTR|SLC19A1_uc002zhm.1_Intron|SLC19A1_uc010gpz.1_3'UTR	NM_194255	NP_919231	P41440	S19A1_HUMAN	solute carrier family 19 member 1						folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity				0				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)		GGGCGCCCGAGAGTCACTGGT	0.612													79	215	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23264871	23264871	+	RNA	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23264871G>A	uc011aim.1	+	379		c.16692G>A								Parts of antibodies, mostly variable regions.												0						TTCTACCCGGGAGCCGTGACA	0.597													29	65	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31859726	31859726	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31859726C>A	uc003akz.1	-	5	690	c.526G>T	c.(526-528)GAC>TAC	p.D176Y	EIF4ENIF1_uc003ala.1_Missense_Mutation_p.D176Y|EIF4ENIF1_uc003alb.1_Intron	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	176	Arg-rich.					nucleus	protein binding|protein transporter activity			ovary(1)	1						TCCCGCAGGTCCTTATCGCTA	0.433													81	116	---	---	---	---	PASS
CSF2RB	1439	broad.mit.edu	37	22	37325795	37325795	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37325795C>A	uc003aqa.3	+	6	881	c.664C>A	c.(664-666)CTC>ATC	p.L222I	CSF2RB_uc003aqc.3_Missense_Mutation_p.L222I	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	222	Fibronectin type-III 1.|Extracellular (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	AGGTTCTCGGCTCTCAGGACG	0.667													40	64	---	---	---	---	PASS
SSTR3	6753	broad.mit.edu	37	22	37603375	37603375	+	Silent	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37603375T>A	uc003ara.2	-	2	530	c.468A>T	c.(466-468)ACA>ACT	p.T156T	SSTR3_uc003arb.2_Silent_p.T156T	NM_001051	NP_001042	P32745	SSR3_HUMAN	somatostatin receptor 3	156	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity			lung(1)	1						CCACCGGAGCTGTGCGCCAGC	0.672													94	132	---	---	---	---	PASS
SCUBE1	80274	broad.mit.edu	37	22	43600112	43600112	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43600112G>A	uc003bdt.1	-	22	2946	c.2858C>T	c.(2857-2859)CCC>CTC	p.P953L		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	953					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				GTAGTTCTGGGGATGCGCCAG	0.582													103	195	---	---	---	---	PASS
KAL1	3730	broad.mit.edu	37	X	8501094	8501094	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8501094C>A	uc004csf.2	-	14	2135	c.1985G>T	c.(1984-1986)AGA>ATA	p.R662I		NM_000216	NP_000207	P23352	KALM_HUMAN	Kallmann syndrome 1 protein precursor	662					axon guidance|cell adhesion|cellular component movement	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|serine-type endopeptidase inhibitor activity			ovary(3)|pancreas(1)	4						AAGATGAGATCCTAAAAAGTG	0.338													20	53	---	---	---	---	PASS
FAM48B1	100130302	broad.mit.edu	37	X	24381382	24381382	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24381382C>G	uc011mjx.1	+	1	505	c.505C>G	c.(505-507)CCA>GCA	p.P169A		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1						TCTTCTACGTCCAACGATGCA	0.458													24	787	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29973391	29973391	+	Silent	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29973391G>T	uc004dby.2	+	11	2053	c.1545G>T	c.(1543-1545)CTG>CTT	p.L515L		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	515	Cytoplasmic (Potential).|TIR.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						GCAGTGAACTGAGAGGAATTA	0.438													7	171	---	---	---	---	PASS
NR0B1	190	broad.mit.edu	37	X	30327185	30327185	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30327185G>T	uc004dcf.3	-	1	311	c.296C>A	c.(295-297)GCG>GAG	p.A99E		NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	99	4 X 67 AA tandem repeats.|2.				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	ACCCAGCGTCGCCTCGGGCGC	0.682											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	167	---	---	---	---	PASS
GK	2710	broad.mit.edu	37	X	30739016	30739016	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30739016G>A	uc004dch.3	+	18	1584	c.1405G>A	c.(1405-1407)GCA>ACA	p.A469T	GK_uc010ngj.2_Missense_Mutation_p.A463T|GK_uc004dci.3_Missense_Mutation_p.A463T|GK_uc011mjz.1_Missense_Mutation_p.A264T|GK_uc011mka.1_Missense_Mutation_p.A306T|GK_uc010ngk.2_Missense_Mutation_p.A258T	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	469					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						GGCTATGGCGGCAGGGGCTGC	0.542													4	66	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32383289	32383289	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32383289T>C	uc004dda.1	-	35	5117	c.4873A>G	c.(4873-4875)AAG>GAG	p.K1625E	DMD_uc004dcw.2_Missense_Mutation_p.K281E|DMD_uc004dcx.2_Missense_Mutation_p.K284E|DMD_uc004dcz.2_Missense_Mutation_p.K1502E|DMD_uc004dcy.1_Missense_Mutation_p.K1621E|DMD_uc004ddb.1_Missense_Mutation_p.K1617E|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1625	Spectrin 11.|Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGGTGCACCTTCTGTTTCTCA	0.408													5	118	---	---	---	---	PASS
CXorf22	170063	broad.mit.edu	37	X	35993797	35993797	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35993797C>A	uc004ddj.2	+	15	2539	c.2480C>A	c.(2479-2481)ACC>AAC	p.T827N	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	827										large_intestine(1)|lung(1)|ovary(1)	3						AGGTCTTTCACCTTTACAGTG	0.383													4	214	---	---	---	---	PASS
SRPX	8406	broad.mit.edu	37	X	38020265	38020265	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38020265T>A	uc004ddy.1	-	6	782	c.696A>T	c.(694-696)GAA>GAT	p.E232D	SRPX_uc004ddz.1_Missense_Mutation_p.E212D|SRPX_uc011mkh.1_Missense_Mutation_p.E173D|SRPX_uc011mki.1_Missense_Mutation_p.E232D	NM_006307	NP_006298	P78539	SRPX_HUMAN	sushi-repeat-containing protein, X-linked	232	HYR.				cell adhesion	cell surface|membrane					0						TGTGGTCTCCTTCTGGAAAGT	0.423													10	237	---	---	---	---	PASS
SSX7	280658	broad.mit.edu	37	X	52681327	52681327	+	Silent	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52681327A>G	uc004dqx.1	-	4	414	c.255T>C	c.(253-255)GAT>GAC	p.D85D		NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	85					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					TACGGTCATTATCAAAATCAT	0.488													184	105	---	---	---	---	PASS
XAGE5	170627	broad.mit.edu	37	X	52841664	52841664	+	Splice_Site	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52841664T>C	uc004drd.1	+	2	137	c.72_splice	c.e2+2	p.L24_splice		NM_130775	NP_570131	Q8WWM1	GAGD5_HUMAN	X antigen family, member 5											ovary(1)	1						CCTATGCTTGTGAGTGACTTC	0.383													14	270	---	---	---	---	PASS
SMC1A	8243	broad.mit.edu	37	X	53439033	53439033	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53439033G>A	uc004dsg.2	-	6	1094	c.1025C>T	c.(1024-1026)TCA>TTA	p.S342L	SMC1A_uc011moe.1_Missense_Mutation_p.S320L|SMC1A_uc011mof.1_Intron	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	342	Potential.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						CTTCTCCACTGACAGCATCTC	0.498													12	52	---	---	---	---	PASS
USP51	158880	broad.mit.edu	37	X	55513249	55513249	+	Silent	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55513249T>C	uc004dun.1	-	2	2203	c.2124A>G	c.(2122-2124)CTA>CTG	p.L708L	USP51_uc011moo.1_Silent_p.L412L	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	708					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						AGTCTTTCTCTAGACCCTGTT	0.413													70	33	---	---	---	---	PASS
NLGN3	54413	broad.mit.edu	37	X	70389333	70389333	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70389333A>G	uc004dzb.2	+	7	2177	c.1873A>G	c.(1873-1875)ACC>GCC	p.T625A	NLGN3_uc004dzc.2_Missense_Mutation_p.T508A|NLGN3_uc011mps.1_Missense_Mutation_p.T605A|NLGN3_uc004dze.2_Missense_Mutation_p.T443A	NM_018977	NP_061850	Q9NZ94	NLGN3_HUMAN	neuroligin 3	645	Extracellular (Potential).				neuron cell-cell adhesion|positive regulation of synaptogenesis|receptor-mediated endocytosis|social behavior|synapse assembly	cell surface|endocytic vesicle|integral to plasma membrane|synapse	neurexin binding|receptor activity			ovary(1)	1	Renal(35;0.156)					GTCCACCACCACCAAAGTGCC	0.582													42	36	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433380	72433380	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433380G>C	uc004ebi.2	-	1	1305	c.949C>G	c.(949-951)CCC>GCC	p.P317A	NAP1L2_uc011mqj.1_Missense_Mutation_p.P175A	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	317					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					TAGGGATGGGGATCATAATAT	0.378													12	286	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73042994	73042994	+	RNA	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73042994A>T	uc004ebn.2	+	1		c.30955A>T			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						TAATAAAAGCAGAATGTTTAG	0.358													11	2	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73043403	73043403	+	RNA	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73043403T>C	uc004ebn.2	+	1		c.31364T>C			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						CTGAGGCATTTATTTTTACTC	0.289													41	18	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76854945	76854945	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76854945C>G	uc004ecp.3	-	25	6123	c.5891G>C	c.(5890-5892)GGA>GCA	p.G1964A	ATRX_uc004ecq.3_Missense_Mutation_p.G1926A|ATRX_uc004eco.3_Missense_Mutation_p.G1749A	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1964					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTCACCACCTCCCCGAGATCT	0.388			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						20	372	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78427277	78427277	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78427277C>A	uc004edg.1	+	1	809	c.773C>A	c.(772-774)TCC>TAC	p.S258Y		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	258	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						CTGGTGAAGTCCAATGAAATT	0.388										HNSCC(63;0.18)			6	116	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78427278	78427278	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78427278C>A	uc004edg.1	+	1	810	c.774C>A	c.(772-774)TCC>TCA	p.S258S		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	258	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						TGGTGAAGTCCAATGAAATTA	0.388										HNSCC(63;0.18)			7	116	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91066265	91066265	+	5'UTR	SNP	G	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91066265G>C	uc004efh.1	+	3						NM_032967	NP_116749	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform b precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						AGGACTGAACGACAGTGGGTT	0.388													29	18	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100505427	100505427	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100505427T>C	uc004egz.2	+	15	1925	c.1556T>C	c.(1555-1557)GTG>GCG	p.V519A	DRP2_uc011mrh.1_Missense_Mutation_p.V441A	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	519					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						TTCAGCCAAGTGGCCAACTCA	0.587													154	65	---	---	---	---	PASS
ARMCX5	64860	broad.mit.edu	37	X	101857704	101857704	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101857704A>T	uc004ejg.2	+	6	1516	c.635A>T	c.(634-636)AAA>ATA	p.K212I	ARMCX5_uc004ejh.2_Missense_Mutation_p.K212I	NM_022838	NP_073749	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	212							binding			ovary(1)	1						CCCACACACAAACCCACACTT	0.478													10	215	---	---	---	---	PASS
GLRA4	441509	broad.mit.edu	37	X	102974010	102974010	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102974010G>T	uc011mse.1	-	7	1329	c.908C>A	c.(907-909)TCT>TAT	p.S303Y	GLRA4_uc010nou.2_Missense_Mutation_p.S303Y	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	303	Cytoplasmic (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0						CCGGGAGCCAGAGCTCTGGGT	0.582													18	296	---	---	---	---	PASS
PLP1	5354	broad.mit.edu	37	X	103043405	103043405	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103043405G>T	uc010nov.2	+	6	942	c.662G>T	c.(661-663)GGC>GTC	p.G221V	RAB9B_uc004eli.1_Intron|PLP1_uc004elk.2_Missense_Mutation_p.G221V|PLP1_uc004elj.2_Missense_Mutation_p.G186V|PLP1_uc011msf.1_Missense_Mutation_p.G166V|PLP1_uc010nox.2_Missense_Mutation_p.G175V	NM_001128834	NP_001122306	P60201	MYPR_HUMAN	proteolipid protein 1 isoform 1	221	Extracellular (Probable).		G -> C (in HLD1).		cell death|synaptic transmission	integral to membrane				ovary(1)	1						AAGGTTTGTGGCTCCAACCTT	0.463													390	210	---	---	---	---	PASS
MORC4	79710	broad.mit.edu	37	X	106185171	106185171	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106185171T>A	uc004emu.3	-	16	2900	c.2657A>T	c.(2656-2658)GAA>GTA	p.E886V	MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Intron|MORC4_uc004emw.3_Intron	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN	zinc finger, CW type with coiled-coil domain 2	886							ATP binding|zinc ion binding			ovary(1)	1						AATTAACCTTTCTAGGTCATC	0.478													12	169	---	---	---	---	PASS
MID2	11043	broad.mit.edu	37	X	107169340	107169340	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107169340G>T	uc004enl.2	+	9	2187	c.1614G>T	c.(1612-1614)TTG>TTT	p.L538F	MID2_uc004enk.2_Missense_Mutation_p.L508F	NM_012216	NP_036348	Q9UJV3	TRIM1_HUMAN	midline 2 isoform 1	538	B30.2/SPRY.					centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1						CCTTTAAATTGGATCCCAAAA	0.383													9	177	---	---	---	---	PASS
HTR2C	3358	broad.mit.edu	37	X	113961348	113961348	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113961348G>T	uc004epu.1	+	3	731	c.3G>T	c.(1-3)ATG>ATT	p.M1I	HTR2C_uc010nqc.1_Missense_Mutation_p.M1I|HTR2C_uc004epv.1_Missense_Mutation_p.M1I	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C	1	Extracellular (By similarity).				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	AAGCAATCATGGTGAACCTGA	0.368													13	7	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117742109	117742109	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117742109G>A	uc004eqp.2	+						DOCK11_uc004eqq.2_Intron	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						ATAAAGGTTTGTGGAGTAAAG	0.338													12	136	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117773511	117773511	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117773511G>T	uc004eqp.2	+	38	4178	c.4115G>T	c.(4114-4116)AGC>ATC	p.S1372I	DOCK11_uc004eqq.2_Missense_Mutation_p.S1151I	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1372					blood coagulation	cytosol	GTP binding			ovary(3)	3						CATCTTAGTAGCCTAGAAAGT	0.393													68	32	---	---	---	---	PASS
RHOXF1	158800	broad.mit.edu	37	X	119249579	119249579	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119249579C>T	uc004esk.1	-	1	269	c.194G>A	c.(193-195)GGC>GAC	p.G65D	uc004esi.1_Intron	NM_139282	NP_644811	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	65					gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGGGATCATGCCGCCATCGCG	0.687													5	161	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123870869	123870869	+	Silent	SNP	C	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123870869C>A	uc004euj.2	-	4	778	c.714G>T	c.(712-714)ACG>ACT	p.T238T	ODZ1_uc011muj.1_Silent_p.T238T|ODZ1_uc010nqy.2_Silent_p.T238T	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	238	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CTGAATCCTGCGTGCTGGTTG	0.542													19	540	---	---	---	---	PASS
SMARCA1	6594	broad.mit.edu	37	X	128623054	128623054	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128623054T>A	uc004eun.3	-	16	2070	c.1957A>T	c.(1957-1959)ATT>TTT	p.I653F	SMARCA1_uc004eup.3_Missense_Mutation_p.I641F|SMARCA1_uc011muk.1_Missense_Mutation_p.I653F|SMARCA1_uc011mul.1_Missense_Mutation_p.I641F	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	653	Helicase C-terminal.				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						TGTTGGTCAATGAGTCTTCCT	0.348													3	59	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128674717	128674717	+	Intron	SNP	G	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128674717G>A	uc004euq.2	+						OCRL_uc004eur.2_Intron	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						ACTAGCGCCCGCATACTGTCG	0.547													6	270	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151870167	151870167	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151870167T>A	uc004ffq.1	+	3	1051	c.857T>A	c.(856-858)GTC>GAC	p.V286D	MAGEA6_uc004ffr.1_Missense_Mutation_p.V286D|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	286	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					TATGTGAAAGTCCTGCACCAT	0.542													320	146	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35332385	35332386	+	Intron	INS	-	C	C	rs138792284	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35332385_35332386insC	uc001byc.2	-							NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated						cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				AGCCGCCGCCACCCCCCCAACC	0.653											OREG0013353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	63822103	63822104	+	IGR	INS	-	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63822103_63822104insA								FOXD3 (31306 upstream) : ALG6 (11157 downstream)																							aggaaggaaggaaggaaggaag	0.005													4	3	---	---	---	---	
ATP1A1	476	broad.mit.edu	37	1	116946259	116946260	+	Intron	INS	-	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116946259_116946260insT	uc001ege.2	+						ATP1A1_uc010owv.1_Intron|ATP1A1_uc010oww.1_Intron|ATP1A1_uc010owx.1_Intron|C1orf203_uc009whb.2_Intron|C1orf203_uc001egg.3_Intron|ATP1A1_uc001egh.2_Intron	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a						ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	CTGAAGATGAGTAGGGATTCCA	0.391													2	4	---	---	---	---	
NBPF7	343505	broad.mit.edu	37	1	120379730	120379731	+	Intron	INS	-	A	A	rs142246355	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120379730_120379731insA	uc010oxk.1	-							NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN	hypothetical protein LOC343505							cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)		gactccatctcaaaaaagaaaa	0.124													5	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145024589	145024590	+	Intron	DEL	AT	-	-	rs72375630		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024589_145024590delAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		acacacacacatacacacacac	0.267			T	PDGFRB	MPD								4	2	---	---	---	---	
ETNK2	55224	broad.mit.edu	37	1	204117698	204117701	+	Intron	DEL	ACAC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204117698_204117701delACAC	uc001hao.3	-						ETNK2_uc010pqr.1_5'Flank|ETNK2_uc001han.3_Intron|ETNK2_uc010pqs.1_Intron|ETNK2_uc010pqt.1_Intron	NM_018208	NP_060678	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2								ATP binding|choline kinase activity|ethanolamine kinase activity			ovary(1)|central_nervous_system(1)	2	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CACCCTCAAGacacacacacacac	0.407													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205520054	205520061	+	IGR	DEL	GAAGGAAG	-	-	rs10527971		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205520054_205520061delGAAGGAAG								CDK18 (18139 upstream) : LOC284578 (3340 downstream)																							CCAAAAAaaagaaggaaggaaggaagga	0.067													6	3	---	---	---	---	
NUCKS1	64710	broad.mit.edu	37	1	205687214	205687214	+	3'UTR	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205687214delA	uc001hdb.2	-	7						NM_022731	NP_073568	Q9H1E3	NUCKS_HUMAN	nuclear casein kinase and cyclin-dependent							nucleus					0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GGTTTGCTTTaaaaaaaaaaa	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224137788	224137790	+	IGR	DEL	TGG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224137788_224137790delTGG								TP53BP2 (104114 upstream) : FBXO28 (164001 downstream)																							AAACGGATGCTGGTGGTGGGTGC	0.631													10	7	---	---	---	---	
RNASEH1	246243	broad.mit.edu	37	2	3608128	3608131	+	5'Flank	DEL	TTCT	-	-	rs4849995		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3608128_3608131delTTCT	uc002qxs.2	-						RNASEH1_uc002qxt.2_5'Flank|uc002qxu.2_Intron|uc002qxv.2_Intron			O60930	RNH1_HUMAN	SubName: Full=cDNA FLJ39594 fis, clone SKNSH2001875, highly similar to Ribonuclease H1 (EC 3.1.26.4);						RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		ccttccttccttcttctttccttc	0.118													7	4	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001225	7001236	+	Intron	DEL	ACACACACACGC	-	-	rs149134084		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001225_7001236delACACACACACGC	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGTACGTATacacacacacgcacacacacac	0.189													32	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11253718	11253721	+	Intron	DEL	TCCT	-	-	rs147237347	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11253718_11253721delTCCT	uc002raz.1	-						uc002rba.1_Intron					Homo sapiens cDNA FLJ33534 fis, clone BRAMY2007411.																		cttccctccctccttccttccttc	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293377	12293378	+	Intron	INS	-	TCCT	TCCT	rs67700339		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293377_12293378insTCCT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		ccttccttccctccttccttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801335	91801336	+	IGR	INS	-	CAATG	CAATG	rs56326147		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801335_91801336insCAATG								None (None upstream) : LOC654342 (3856 downstream)																							tcatgactaccattagctccca	0.000													9	4	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179466988	179466988	+	Intron	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179466988delA	uc010zfg.1	-						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGAATACATAAACTGAGTAA	0.333													31	38	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5782682	5782683	+	IGR	INS	-	CACT	CACT	rs12636222		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5782682_5782683insCACT								EDEM1 (521033 upstream) : None (None downstream)																							acacacacacacTTATATGTAA	0.307													2	6	---	---	---	---	
SCN5A	6331	broad.mit.edu	37	3	38627658	38627659	+	Intron	INS	-	C	C	rs144923222	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38627658_38627659insC	uc003cio.2	-						SCN5A_uc003cin.2_Intron|SCN5A_uc003cil.3_Intron|SCN5A_uc010hhi.2_Intron|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Intron|SCN5A_uc010hhj.1_Intron	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha						blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	TGACACCTATTCCCCCCCCGCC	0.609													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75703977	75703978	+	IGR	INS	-	T	T			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75703977_75703978insT								MIR1324 (23968 upstream) : ZNF717 (54816 downstream)																							TCTTTTCTGAATTTTTTATTTT	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	122242444	122242444	+	IGR	DEL	T	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122242444delT								KPNA1 (8658 upstream) : PARP9 (4318 downstream)																							cttttctttcttttttttttt	0.000													6	3	---	---	---	---	
MAGEF1	64110	broad.mit.edu	37	3	184429674	184429674	+	5'UTR	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184429674delC	uc003fpa.2	-	1						NM_022149	NP_071432	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1											ovary(1)	1	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			GCCGCGCAAGCCCCGGGGGAG	0.687													7	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186544793	186544794	+	IGR	DEL	CC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186544793_186544794delCC								RFC4 (20309 upstream) : ADIPOQ (15669 downstream)																							GTGCACCCGTCCCCCCCCCCGC	0.644													38	28	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13234603	13234618	+	IGR	DEL	GAAAGAAAGAAAAAGG	-	-	rs71167697	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13234603_13234618delGAAAGAAAGAAAAAGG								None (None upstream) : HSP90AB2P (100419 downstream)																							aagaaagaaagaaagaaagaaaaaggaaggaaggaa	0.000													4	3	---	---	---	---	
MANBA	4126	broad.mit.edu	37	4	103630548	103630560	+	Intron	DEL	AAAGAAAGAAAAA	-	-	rs28782317		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103630548_103630560delAAAGAAAGAAAAA	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		aggaagaaagaaagaaagaaaaaaaagaaagaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	767062	767062	+	IGR	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:767062delC								TPPP (73552 upstream) : ZDHHC11 (28658 downstream)																							GGAGGACCTGCGCCATCAGCT	0.652													109	69	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29457446	29457467	+	IGR	DEL	GCGCGCGCGCGCGCACGTGTGT	-	-	rs80272001	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29457446_29457467delGCGCGCGCGCGCGCACGTGTGT								None (None upstream) : None (None downstream)																							gtgtgtgtgcgcgcgcgcgcgcgcacgtgtgtgcgtgCGCGC	0.180													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	32704476	32704477	+	IGR	INS	-	TG	TG	rs147397887	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32704476_32704477insTG								SUB1 (100291 upstream) : NPR3 (6283 downstream)																							ttttggctctttgtgtgtgtgt	0.000													5	4	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	39002501	39002504	+	Intron	DEL	TGTA	-	-	rs1239251	byFrequency	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39002501_39002504delTGTA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron|RICTOR_uc003jlq.1_Intron|RICTOR_uc011cpk.1_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					tgtgtgtgtgtgtatatatatata	0.059													25	17	---	---	---	---	
HEATR7B2	133558	broad.mit.edu	37	5	41033416	41033416	+	Intron	DEL	G	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41033416delG	uc003jmj.3	-						HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2								binding			ovary(6)|central_nervous_system(2)	8						CTAAGTTGCAGGGAAAGTGAG	0.358													3	6	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134106778	134106781	+	Intron	DEL	TCTC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134106778_134106781delTCTC	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			tttctttctttctctttctttctt	0.044													1	7	---	---	---	---	
SPINK6	404203	broad.mit.edu	37	5	147585796	147585803	+	Intron	DEL	ACCTAACC	-	-	rs62388546		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147585796_147585803delACCTAACC	uc003lpa.2	+							NM_205841	NP_995313	Q6UWN8	ISK6_HUMAN	serine protease inhibitor, Kazal type 6							extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTAAAAGAACCTAACCACACATTCTC	0.216													6	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171978716	171978716	+	IGR	DEL	T	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171978716delT								SH3PXD2B (97189 upstream) : NEURL1B (89560 downstream)																							ccttccttcctttccttcctt	0.000													3	4	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177676716	177676719	+	Intron	DEL	CACT	-	-	rs34904323		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177676716_177676719delCACT	uc003mje.2	-						COL23A1_uc010jkt.2_Intron	NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		cacacacacacactctctctctct	0.255													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14383214	14383221	+	IGR	DEL	TCCTTCCT	-	-	rs58552935		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14383214_14383221delTCCTTCCT								CD83 (246068 upstream) : JARID2 (862513 downstream)																							ccttccttcctccttccttccttccttc	0.159													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	17748003	17748004	+	IGR	DEL	AC	-	-	rs111554813		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17748003_17748004delAC								NUP153 (41185 upstream) : KIF13A (12581 downstream)																							AACTCATTTAacacacacacac	0.104													4	2	---	---	---	---	
RUNX2	860	broad.mit.edu	37	6	45367926	45367927	+	Intron	INS	-	GGAA	GGAA	rs149457722		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45367926_45367927insGGAA	uc011dvx.1	+						RUNX2_uc011dvy.1_Intron	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						gagggaatgagggaaggaagga	0.144													4	3	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	66027668	66027671	+	Intron	DEL	TCTC	-	-	rs149352333		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66027668_66027671delTCTC	uc011dxu.1	-							NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						ggctacattttctcttccttcctt	0.000													1	5	---	---	---	---	
KLHL32	114792	broad.mit.edu	37	6	97512545	97512545	+	Frame_Shift_Del	DEL	G	-	-	rs138548618		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97512545delG	uc010kcm.1	+	5	826	c.354delG	c.(352-354)GCGfs	p.A118fs	KLHL32_uc003poy.2_Frame_Shift_Del_p.A118fs|KLHL32_uc011ead.1_Frame_Shift_Del_p.A82fs|KLHL32_uc003poz.2_5'UTR|KLHL32_uc011eae.1_Intron|KLHL32_uc003ppa.2_RNA	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32	118										ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TGCTAGCAGCGGGCAGTCACC	0.423													62	31	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109818566	109818573	+	Intron	DEL	CTCTCTCT	-	-	rs60173259		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109818566_109818573delCTCTCTCT	uc003ptn.2	-						AKD1_uc011eas.1_Intron	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						cacacacacactctctctctctctctct	0.029													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148930104	148930113	+	IGR	DEL	TGTGTGTGTG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148930104_148930113delTGTGTGTGTG								SASH1 (56920 upstream) : UST (138158 downstream)																							CTTGCAGATTtgtgtgtgtgtgtgtgtgtg	0.300													3	3	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	946108	946108	+	Intron	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:946108delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aggagaaaggagaaaggagaa	0.000													4	2	---	---	---	---	
RADIL	55698	broad.mit.edu	37	7	4845037	4845040	+	Intron	DEL	GGGC	-	-	rs148730991	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4845037_4845040delGGGC	uc003snj.1	-						RADIL_uc003sng.1_Intron|RADIL_uc003sni.1_Intron|RADIL_uc011jwc.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snh.1_5'Flank	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor						cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GGATGGGGCGGGGCGGGGGGGTCC	0.672													13	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	48199773	48199774	+	IGR	DEL	AG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48199773_48199774delAG								UPP1 (51444 upstream) : ABCA13 (11283 downstream)																							acagagagacagagagagagag	0.406													3	3	---	---	---	---	
HIP1	3092	broad.mit.edu	37	7	75224569	75224570	+	Intron	INS	-	CTTCCTTC	CTTCCTTC	rs4730992		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75224569_75224570insCTTCCTTC	uc003uds.1	-						HIP1_uc011kfz.1_5'Flank	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						tttctttctttcttccttcctt	0.084			T	PDGFRB	CMML								3	3	---	---	---	---	
DPY19L2P4	442523	broad.mit.edu	37	7	89748927	89748928	+	RNA	INS	-	C	C	rs148487888	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89748927_89748928insC	uc003ujw.1	+	1		c.214_215insC				NR_003551				Homo sapiens dpy-19-like 2 pseudogene 4 (C. elegans), mRNA (cDNA clone IMAGE:5295327).												0						GGTGCGGGCCTCCCCCTTCCCC	0.639													7	7	---	---	---	---	
ORC5L	5001	broad.mit.edu	37	7	103767525	103767526	+	Intron	DEL	TT	-	-	rs74901297		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103767525_103767526delTT	uc003vcb.2	-						ORC5L_uc011klp.1_Intron	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						aatattttaatttttttttttt	0.287													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147678879	147678880	+	Intron	DEL	GT	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147678879_147678880delGT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTCCTTACAGgtgtgtgtgtgt	0.292										HNSCC(39;0.1)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	151632946	151632947	+	IGR	INS	-	TGTT	TGTT	rs12669759		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151632946_151632947insTGTT								PRKAG2 (58630 upstream) : GALNTL5 (20564 downstream)																							gtgtgtgtgtgtgtttgtttgt	0.134													2	4	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158178847	158178848	+	Intron	DEL	CC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158178847_158178848delCC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TCCTCCCATGCCCTGAGTCCCT	0.569													7	4	---	---	---	---	
XKR6	286046	broad.mit.edu	37	8	11058893	11058893	+	5'Flank	DEL	G	-	-	rs79111379		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11058893delG	uc003wtk.1	-							NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		gagggacggcggggggggggg	0.244													9	4	---	---	---	---	
PNMA2	10687	broad.mit.edu	37	8	26365632	26365632	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26365632delC	uc003xez.2	-	3	1410	c.640delG	c.(640-642)GCCfs	p.A214fs		NM_007257	NP_009188	Q9UL42	PNMA2_HUMAN	paraneoplastic antigen MA2	214					apoptosis	nucleolus	protein binding				0		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		aggtccagggcagggccccgc	0.000													109	128	---	---	---	---	
TMEM55A	55529	broad.mit.edu	37	8	92052622	92052623	+	Intron	INS	-	CACCAC	CACCAC			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92052622_92052623insCACCAC	uc003yes.2	-							NM_018710	NP_061180	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A							integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(11;0.033)			ACACAcaccatcaccaccacca	0.332													6	3	---	---	---	---	
TMEM55A	55529	broad.mit.edu	37	8	92052646	92052647	+	Intron	INS	-	CAC	CAC	rs139914574	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92052646_92052647insCAC	uc003yes.2	-							NM_018710	NP_061180	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A							integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(11;0.033)			accaccaccatcaccaccacca	0.347													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101900106	101900107	+	IGR	INS	-	AAAG	AAAG	rs149864597	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101900106_101900107insAAAG								PABPC1 (165791 upstream) : YWHAZ (30697 downstream)																							gaaagaaagaaaaagaaagaaa	0.010													5	5	---	---	---	---	
NDRG1	10397	broad.mit.edu	37	8	134260868	134260868	+	Intron	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134260868delC	uc003yuh.2	-						NDRG1_uc003yuf.1_Intron|NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CAATGTCCTGCCACACTCAGA	0.562													46	141	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135331910	135331935	+	IGR	DEL	CCAGGGAGAGGGTGTGAGGGGTCAAT	-	-	rs13271339		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135331910_135331935delCCAGGGAGAGGGTGTGAGGGGTCAAT								ST3GAL1 (747727 upstream) : ZFAT (158098 downstream)																							CCACAGCAGCCCAGGGAGAGGGTGTGAGGGGTCAATCCAGGGAGAG	0.345													3	3	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400831	400833	+	Intron	DEL	CAT	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400831_400833delCAT	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ccaccatcaccatcaccaccacc	0.000													4	2	---	---	---	---	
FLJ44082	389762	broad.mit.edu	37	9	84563776	84563776	+	3'UTR	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84563776delC	uc010mpt.2	+	4					uc004ami.1_Intron|uc004amm.1_5'Flank	NM_207416	NP_997299	P0C874	YI039_HUMAN	hypothetical protein LOC389762							integral to membrane					0						CTGAAATTTTCCCACCAAGAA	0.398													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90432153	90432157	+	IGR	DEL	AGAGA	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90432153_90432157delAGAGA								CTSL3 (30354 upstream) : C9orf79 (65584 downstream)																							TCTCCAGAGCAGAGAAGAGTGTAGC	0.463													53	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138016448	138016451	+	IGR	DEL	AAGA	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138016448_138016451delAAGA								OLFM1 (3417 upstream) : KIAA0649 (355197 downstream)																							ggaaggaaggaagaaagaaagaaa	0.000													7	4	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138606581	138606582	+	Intron	INS	-	GG	GG	rs141291153	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138606581_138606582insGG	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGACCGGGCGCGGGGTGGGGGC	0.614													6	13	---	---	---	---	
MAN1B1	11253	broad.mit.edu	37	9	139996893	139996894	+	Intron	DEL	TG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139996893_139996894delTG	uc004cld.2	+						MAN1B1_uc011meo.1_Intron|MAN1B1_uc011mep.1_Intron|MAN1B1_uc010ncc.2_Intron|MAN1B1_uc004clf.1_5'Flank|MAN1B1_uc004clg.1_5'Flank	NM_016219	NP_057303	Q9UKM7	MA1B1_HUMAN	alpha 1,2-mannosidase						oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|endoplasmic reticulum quality control compartment|integral to membrane	alpha-mannosidase activity|calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(1)|central_nervous_system(1)	2	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACATTCACACTGTTGCAGGCGT	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2221205	2221205	+	IGR	DEL	A	-	-	rs112068462		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2221205delA								ADARB2 (441487 upstream) : PFKP (888547 downstream)																							aacacaaagcaaaacatgctt	0.000													3	3	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72288965	72288966	+	Intron	INS	-	A	A	rs72290492		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72288965_72288966insA	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						TTCCATTCTGCCCCCCCCCCCC	0.569													11	60	---	---	---	---	
CAMK2G	818	broad.mit.edu	37	10	75575127	75575128	+	Intron	INS	-	C	C	rs138806030	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75575127_75575128insC	uc001jvm.1	-						CAMK2G_uc001jvo.1_Intron|CAMK2G_uc001jvq.1_Intron|CAMK2G_uc001jvr.1_Intron|CAMK2G_uc001jvp.1_Intron|CAMK2G_uc001jvs.1_Intron|CAMK2G_uc001jvt.1_Intron|CAMK2G_uc001jvu.1_Intron|CAMK2G_uc009xrp.1_Intron	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II						insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					TCCAAGTACCGCCCCCCCCCAC	0.550													9	6	---	---	---	---	
CYP2C19	1557	broad.mit.edu	37	10	96612635	96612635	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96612635delC	uc010qnz.1	+	9	1437	c.1437delC	c.(1435-1437)GTCfs	p.V479fs	CYP2C19_uc010qny.1_Frame_Shift_Del_p.V457fs	NM_000769	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C,	479					exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)	TTGCTTCTGTCCCGCCCTTCT	0.463													61	114	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	109318062	109318063	+	IGR	DEL	AC	-	-	rs113563683		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109318062_109318063delAC								SORCS1 (393770 upstream) : None (None downstream)																							GGTacacacaacacacacacac	0.317													4	2	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135105966	135105967	+	Intron	INS	-	A	A	rs111433159	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135105966_135105967insA	uc001lmg.1	-						TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ccgtgtccccgtgtccctccgt	0.347													9	4	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2441272	2441286	+	Intron	DEL	CCCAGGCCCCCACGG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2441272_2441286delCCCAGGCCCCCACGG	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		AGCTCCTCCTCCCAGGCCCCCACGGCCCAGGCCCC	0.665													3	3	---	---	---	---	
SWAP70	23075	broad.mit.edu	37	11	9725916	9725916	+	Intron	DEL	T	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9725916delT	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		ATCTTCCCTCTTTTTTTTTTT	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49327166	49327167	+	IGR	INS	-	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49327166_49327167insA								FOLH1 (96944 upstream) : LOC440040 (252913 downstream)																							GTAAAGTTAGcaaaaaaaaaaa	0.208													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56249445	56249446	+	IGR	INS	-	A	A	rs79689882		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56249445_56249446insA								OR5M3 (11472 upstream) : OR5M8 (8465 downstream)																							aagaaagaaagaaagaaagaaa	0.000													4	2	---	---	---	---	
APLNR	187	broad.mit.edu	37	11	57004147	57004147	+	Frame_Shift_Del	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57004147delA	uc001njo.2	-	1	781	c.332delT	c.(331-333)GTCfs	p.V111fs	APLNR_uc001njn.3_RNA	NM_005161	NP_005152	P35414	APJ_HUMAN	apelin receptor	111	Helical; Name=3; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			lung(5)|ovary(1)	6						GTACATGTTGACGAAGATGAG	0.612													17	48	---	---	---	---	
PITPNM1	9600	broad.mit.edu	37	11	67267043	67267044	+	Intron	INS	-	CCAA	CCAA	rs150865355	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67267043_67267044insCCAA	uc001olx.2	-						PITPNM1_uc001olw.2_5'Flank|PITPNM1_uc001oly.2_Intron|PITPNM1_uc001olz.2_Intron	NM_004910	NP_004901	O00562	PITM1_HUMAN	phosphatidylinositol transfer protein,						brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity			lung(2)|central_nervous_system(1)	3						catccatccatccatccatcca	0.228													0	8	---	---	---	---	
ARRB1	408	broad.mit.edu	37	11	74980343	74980343	+	Intron	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74980343delC	uc001owe.1	-						ARRB1_uc001owf.1_Intron	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A						G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						TGCCCTGGGACCCCCCCCCAC	0.682													4	3	---	---	---	---	
TRIM49	57093	broad.mit.edu	37	11	89531247	89531247	+	3'UTR	DEL	G	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89531247delG	uc001pdb.2	-	8						NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18							intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AGGACTTCCTGGGATAAAGGG	0.403													15	7	---	---	---	---	
MAML2	84441	broad.mit.edu	37	11	95945273	95945278	+	Intron	DEL	GTGTGT	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95945273_95945278delGTGTGT	uc001pfw.1	-							NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				ggaagacaaagtgtgtgtgtgtgtgt	0.000			T	MECT1|CRTC3	salivary gland mucoepidermoid								4	2	---	---	---	---	
CASP12	120329	broad.mit.edu	37	11	104759817	104759818	+	Intron	INS	-	GAAG	GAAG			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104759817_104759818insGAAG	uc001pht.1	-						CASP12_uc001phs.2_5'Flank	NR_000035				RecName: Full=Inactive caspase-12;          Short=CASP-12;												0						TGTAaaagaaagaaggaaagaa	0.208													4	2	---	---	---	---	
CCDC84	338657	broad.mit.edu	37	11	118873890	118873891	+	Intron	INS	-	TG	TG	rs57737713		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118873890_118873891insTG	uc001pul.2	+						CCDC84_uc010ryk.1_Intron|CCDC84_uc010ryl.1_Intron|CCDC84_uc010rym.1_Intron|RPL23AP64_uc001pum.2_RNA	NM_198489	NP_940891	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84											ovary(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CACAAGTGCGTGTGTCTTCTGT	0.480													1	10	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199650	120199655	+	Intron	DEL	TGTGTT	-	-	rs72412112		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199650_120199655delTGTGTT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		tgtgtgtgtgtgtgtttgtgtatgtT	0.049													4	3	---	---	---	---	
GPRC5D	55507	broad.mit.edu	37	12	13097780	13097781	+	Intron	INS	-	T	T	rs138260461	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13097780_13097781insT	uc010shp.1	-							NM_018654	NP_061124	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, family C, group 5,							integral to membrane|plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		tccttccttccttccttctttc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	15956801	15956817	+	IGR	DEL	TACACCGTCTTCAACTA	-	-	rs11837575	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15956801_15956817delTACACCGTCTTCAACTA								EPS8 (14291 upstream) : STRAP (78471 downstream)																							actcctgCCCTACACCGTCTTCAACTAGGCAGTGAAA	0.286													20	49	---	---	---	---	
RHEBL1	121268	broad.mit.edu	37	12	49463357	49463374	+	Intron	DEL	CCAATCCTCCACTCTTCC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463357_49463374delCCAATCCTCCACTCTTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						ACCAACTCTTCCAATCCTCCACTCTTCCATTCCTCCAC	0.569													1	5	---	---	---	---	
GLS2	27165	broad.mit.edu	37	12	56884976	56884977	+	5'Flank	INS	-	TG	TG	rs112399691		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56884976_56884977insTG	uc001slj.2	-						GLS2_uc009zos.2_5'Flank|GLS2_uc001slk.2_5'Flank|GLS2_uc009zot.2_5'Flank|GLS2_uc001sll.2_5'Flank	NM_013267	NP_037399	Q9UI32	GLSL_HUMAN	glutaminase 2 precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding			ovary(1)|central_nervous_system(1)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CTACTCTATTTtgtgtgtgtgt	0.139													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881159	109881170	+	Intron	DEL	ATACACACACAC	-	-	rs10545297		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881159_109881170delATACACACACAC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						atgtgtgtatatacacacacacacacacacac	0.113													4	4	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110238216	110238217	+	Intron	INS	-	CAAGTT	CAAGTT	rs148721750	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110238216_110238217insCAAGTT	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						gtccatggtactcccCATGGCA	0.302													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119392844	119392845	+	IGR	INS	-	C	C			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119392844_119392845insC								SUDS3 (537005 upstream) : SRRM4 (26551 downstream)																							gcacttaggttccccgtgtggt	0.000													4	2	---	---	---	---	
FBRSL1	57666	broad.mit.edu	37	12	133161405	133161406	+	3'UTR	INS	-	AC	AC	rs7962882		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133161405_133161406insAC	uc001ukf.2	+	17						NM_001142641	NP_001136113	Q9HCM7	FBSL_HUMAN	fibrosin-like 1											central_nervous_system(2)	2						AGGCTGATTTTacacacacaca	0.436													4	2	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50299783	50299783	+	Intron	DEL	T	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299783delT	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		CCAACCCTACttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	45146753	45146754	+	IGR	DEL	AG	-	-	rs141958763	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45146753_45146754delAG								FSCB (170254 upstream) : C14orf28 (219753 downstream)																							gaaggaaggaaggaaagaaaga	0.000													6	3	---	---	---	---	
TSHR	7253	broad.mit.edu	37	14	81449259	81449259	+	Intron	DEL	G	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81449259delG	uc001xvd.1	+						TSHR_uc001xvb.1_Intron|TSHR_uc001xvc.2_Intron|TSHR_uc010tvs.1_Intron	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TAAGCCATTTGCTTACTCTTG	0.408			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						62	33	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123116	100123118	+	Intron	DEL	AAG	-	-	rs35577018		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123116_100123118delAAG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				tgtctgcaaaaagaaaagaaaag	0.000													59	47	---	---	---	---	
WARS	7453	broad.mit.edu	37	14	100819776	100819777	+	Intron	INS	-	G	G	rs147082280	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100819776_100819777insG	uc001yhf.1	-						WARS_uc001yhe.1_Intron|WARS_uc001yhg.1_Intron|WARS_uc001yhh.1_Intron|WARS_uc001yhi.1_Intron|WARS_uc001yhj.1_Intron|WARS_uc001yhk.1_Intron|WARS_uc001yhl.1_Intron	NM_173701	NP_776049	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase isoform a						angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	tcaatagagatgggtttcacca	0.000													3	3	---	---	---	---	
BEGAIN	57596	broad.mit.edu	37	14	101013101	101013102	+	Intron	DEL	GC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101013101_101013102delGC	uc010txa.1	-						BEGAIN_uc001yhp.2_5'UTR|BEGAIN_uc001yhq.2_Intron	NM_001159531	NP_001153003	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated							cytoplasm|membrane	protein binding				0		Melanoma(154;0.212)				GCGAGTACCGGCGCGCGCGCGC	0.470													6	6	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106714239	106714240	+	Intron	DEL	AC	-	-	rs112875057		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106714239_106714240delAC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						AGAAAGGAAAACCTTCTCCCGG	0.559													6	23	---	---	---	---	
SPRED1	161742	broad.mit.edu	37	15	38641776	38641777	+	Intron	INS	-	AATTAGT	AATTAGT	rs143316581	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38641776_38641777insAATTAGT	uc001zka.3	+							NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain						inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ATTAATAGATAGGTAAAGTTTT	0.317									Legius_syndrome				2	7	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40921686	40921688	+	Intron	DEL	GCC	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40921686_40921688delGCC	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ttttttttttgccttttcttttt	0.123													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45755466	45755466	+	Intron	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45755466delC	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																		atcaccaccaccatcaccacc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70670282	70670282	+	IGR	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70670282delA								TLE3 (280026 upstream) : UACA (276613 downstream)																							gtgtgtgtgtAGCTACTGGAG	0.338													4	2	---	---	---	---	
PSMA4	5685	broad.mit.edu	37	15	78838791	78838791	+	Intron	DEL	A	-	-	rs11350747		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78838791delA	uc002bdu.3	+						PSMA4_uc010blf.2_Intron|PSMA4_uc002bdv.3_Intron|PSMA4_uc002bdw.3_Intron|PSMA4_uc002bdx.3_Intron	NM_002789	NP_002780	P25789	PSA4_HUMAN	proteasome alpha 4 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	identical protein binding|threonine-type endopeptidase activity				0						cccctgtgtcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82584168	82584171	+	IGR	DEL	CCTT	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82584168_82584171delCCTT								FAM154B (6903 upstream) : GOLGA6L10 (48953 downstream)																							ttccccttccccttccttccttcc	0.000													5	3	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4959425	4959426	+	Intron	INS	-	TT	TT			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4959425_4959426insTT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						CTGGTCCCACCttttttttttt	0.332													4	2	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21142757	21142758	+	Intron	INS	-	AAGA	AAGA	rs147176563	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21142757_21142758insAAGA	uc010vbe.1	-						DNAH3_uc002die.2_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		gaaaagaaaggaagaaagaaag	0.035													4	6	---	---	---	---	
EEF2K	29904	broad.mit.edu	37	16	22260294	22260294	+	Intron	DEL	T	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22260294delT	uc002dki.2	+						EEF2K_uc002dkh.2_Intron	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase						insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		GTAGCCAGCAttttttttttt	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27150167	27150169	+	IGR	DEL	TGG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27150167_27150169delTGG								C16orf82 (69681 upstream) : JMJD5 (64638 downstream)																							gtggtggtgatggtggtggtggt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32177847	32177850	+	IGR	DEL	TTGA	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32177847_32177850delTTGA								HERC2P4 (13973 upstream) : TP53TG3B (506991 downstream)																							GATGCAATTGTTGACTCACCAAGC	0.368													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33939019	33939019	+	IGR	DEL	C	-	-	rs113683091		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33939019delC								None (None upstream) : MIR1826 (26489 downstream)																							GTTGCACAGGCCGCCTGCGTG	0.667													5	3	---	---	---	---	
DNAJA2	10294	broad.mit.edu	37	16	47005574	47005574	+	Intron	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47005574delA	uc002eeo.2	-						DNAJA2_uc002eep.2_Intron	NM_005880	NP_005871	O60884	DNJA2_HUMAN	DnaJ subfamily A member 2						positive regulation of cell proliferation|protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			lung(1)	1		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				ATTTAATTCTAAAAAAAAAAA	0.308													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255950	87255951	+	Intron	INS	-	CAT	CAT			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255950_87255951insCAT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		accaccatcaccaccaccacca	0.000													9	4	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424898	10424899	+	Intron	DEL	AT	-	-	rs147245930		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424898_10424899delAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TATTGATGTCATatatatatat	0.248													4	2	---	---	---	---	
USP22	23326	broad.mit.edu	37	17	20907656	20907657	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20907656_20907657delAG	uc002gym.3	-	12	1597_1598	c.1393_1394delCT	c.(1393-1395)CTGfs	p.L465fs	USP22_uc002gyn.3_Frame_Shift_Del_p.L453fs|USP22_uc002gyl.3_Frame_Shift_Del_p.L360fs	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	465					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						AACAGCAAACAGGGAATACCTA	0.545													50	180	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21217018	21217020	+	Intron	DEL	CCT	-	-	rs72412380		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21217018_21217020delCCT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TACCTGGCTCCCTCCTCCCTCCT	0.389													4	2	---	---	---	---	
GSDMA	284110	broad.mit.edu	37	17	38133530	38133534	+	3'UTR	DEL	CTTTA	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38133530_38133534delCTTTA	uc002htl.1	+	12					GSDMA_uc002htm.1_3'UTR	NM_178171	NP_835465	Q96QA5	GSDMA_HUMAN	gasdermin 1						apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0						CTTAAATTTTCTTTACttttctttt	0.259													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377702	45377703	+	Intron	INS	-	GCGT	GCGT	rs72300893		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377702_45377703insGCGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	GTCTTACAGGCGCGCGCGCGCg	0.525													7	4	---	---	---	---	
MARCH10	162333	broad.mit.edu	37	17	60871506	60871507	+	Intron	INS	-	CAC	CAC	rs148676242	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60871506_60871507insCAC	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190								ligase activity|zinc ion binding				0						accaaaacagtcaccaccacca	0.000													4	2	---	---	---	---	
ABCA9	10350	broad.mit.edu	37	17	67022584	67022585	+	Frame_Shift_Ins	INS	-	A	A			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67022584_67022585insA	uc002jhu.2	-	16	2217_2218	c.2074_2075insT	c.(2074-2076)GGGfs	p.G692fs	ABCA9_uc010dez.2_Frame_Shift_Ins_p.G692fs	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	692	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					CTTCAGCTTCCCATTGGATATG	0.381													107	284	---	---	---	---	
AZI1	22994	broad.mit.edu	37	17	79166473	79166473	+	Intron	DEL	C	-	-	rs3744149	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79166473delC	uc002jzp.1	-						AZI1_uc002jzm.1_Intron|AZI1_uc002jzn.1_Intron|AZI1_uc002jzo.1_Intron|AZI1_uc010wum.1_Intron|AZI1_uc002jzq.2_Intron	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGTGAGGGGGCGGGGGGGAGG	0.726													10	14	---	---	---	---	
C18orf16	147429	broad.mit.edu	37	18	24445878	24445880	+	Intron	DEL	TTT	-	-	rs68070007		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24445878_24445880delTTT	uc002kwb.2	+						C18orf16_uc010xbm.1_Intron|AQP4_uc002kwa.2_5'Flank	NR_026908				Homo sapiens cDNA FLJ30507 fis, clone BRAWH2000554.												0						ATTTACTTAATTTTTTTTTTTTT	0.300													2	4	---	---	---	---	
MBD1	4152	broad.mit.edu	37	18	47799999	47799999	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47799999delC	uc010dow.1	-	12	1818	c.1381delG	c.(1381-1383)GAAfs	p.E461fs	MBD1_uc002lef.2_Frame_Shift_Del_p.E212fs|MBD1_uc002leg.2_Frame_Shift_Del_p.E411fs|MBD1_uc010xdi.1_Frame_Shift_Del_p.E512fs|MBD1_uc002leh.3_Frame_Shift_Del_p.E405fs|MBD1_uc002len.2_Frame_Shift_Del_p.E461fs|MBD1_uc002lei.3_Frame_Shift_Del_p.E461fs|MBD1_uc002lej.3_Frame_Shift_Del_p.E405fs|MBD1_uc002lek.3_Frame_Shift_Del_p.E412fs|MBD1_uc002lel.3_Frame_Shift_Del_p.E438fs|MBD1_uc002lem.3_Frame_Shift_Del_p.E461fs|MBD1_uc010xdj.1_Frame_Shift_Del_p.E405fs|MBD1_uc010xdk.1_Frame_Shift_Del_p.E486fs|MBD1_uc010dox.1_Frame_Shift_Del_p.E438fs|MBD1_uc002leo.2_Frame_Shift_Del_p.E461fs	NM_015846	NP_056671	Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1 isoform 1	461					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CTTGCGCCTTCCCGTAAAAAC	0.632													112	69	---	---	---	---	
GALR1	2587	broad.mit.edu	37	18	74980742	74980742	+	Frame_Shift_Del	DEL	A	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74980742delA	uc002lms.3	+	3	1431	c.934delA	c.(934-936)AAGfs	p.K312fs		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	312	Cytoplasmic (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		AAATTTCAGGAAGGCCTATAA	0.443													131	76	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393498	77393518	+	IGR	DEL	TGATGGTGGTGGTGACGGTGA	-	-	rs78670059		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393498_77393518delTGATGGTGGTGGTGACGGTGA								NFATC1 (104176 upstream) : CTDP1 (46283 downstream)																							gtggtggtggtgatggtggtggtgacggtgatgatggtggt	0.000													3	3	---	---	---	---	
SPPL2B	56928	broad.mit.edu	37	19	2341094	2341102	+	Intron	DEL	CTCCCTGGA	-	-	rs76166147		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2341094_2341102delCTCCCTGGA	uc002lvs.2	+						SPPL2B_uc010dsw.1_In_Frame_Del_p.PPW318del|SPPL2B_uc010dsy.1_In_Frame_Del_p.PPW318del|SPPL2B_uc010dsz.1_In_Frame_Del_p.PPW346del|SPPL2B_uc002lvr.2_Intron|SPPL2B_uc010dta.1_In_Frame_Del_p.PPW198del|SPPL2B_uc002lvu.2_In_Frame_Del_p.PPW140del	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCCTGCCCTCCCTGGAGGCCGCCCCA	0.703													9	5	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4207083	4207083	+	Intron	DEL	T	-	-	rs67275884		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4207083delT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		taatgtttgcttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23031039	23031040	+	IGR	DEL	TG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23031039_23031040delTG								ZNF99 (78255 upstream) : ZNF91 (490379 downstream)																							TATGTGTGTATGTGTGTGTGTG	0.406													44	28	---	---	---	---	
COX7A1	1346	broad.mit.edu	37	19	36642561	36642562	+	Intron	INS	-	C	C	rs150771533	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36642561_36642562insC	uc002odm.1	-							NM_001864	NP_001855	P24310	CX7A1_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 1						generation of precursor metabolites and energy	integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CACCCCCCCCGACCCCCCACCT	0.698													21	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47803957	47803960	+	IGR	DEL	TCCT	-	-	rs34256769		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47803957_47803960delTCCT								PRR24 (24978 upstream) : C5AR1 (9144 downstream)																							TCTCTATTTCtccttccttccttc	0.069													3	3	---	---	---	---	
DHX34	9704	broad.mit.edu	37	19	47879705	47879705	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47879705delC	uc010xyn.1	+	12	2828	c.2487delC	c.(2485-2487)TTCfs	p.F829fs	DHX34_uc010xyo.1_5'Flank	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	829						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CGCAGATTTTCCACACGCAGG	0.547													47	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50997653	50997654	+	IGR	INS	-	GAG	GAG	rs57239148		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50997653_50997654insGAG								C19orf63 (11046 upstream) : JOSD2 (11605 downstream)																							gaggaggaagagaggaggagga	0.109													5	3	---	---	---	---	
ZCCHC3	85364	broad.mit.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	-	-	rs5839847		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:278688_278690delCGG	uc002wdf.2	+	1	485_487	c.461_463delCGG	c.(460-465)CCGGCG>CCG	p.A158del	ZCCHC3_uc002wdg.2_Intron	NM_033089	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	158	Poly-Ala.						nucleic acid binding|zinc ion binding				0		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.635													3	3	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60972983	60972984	+	Intron	INS	-	GGTGGTGGTGATGGC	GGTGGTGGTGATGGC	rs146308567	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60972983_60972984insGGTGGTGGTGATGGC	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			gtggtgatggtggtggtggtga	0.168													3	5	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60973128	60973133	+	Intron	DEL	GGTGGT	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973128_60973133delGGTGGT	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			tggtggtgacggtggtggtggtggtg	0.000													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18570225	18570226	+	IGR	INS	-	GAAGGAAG	GAAGGAAG			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18570225_18570226insGAAGGAAG								C21orf34 (588131 upstream) : CXADR (315104 downstream)																							aaggaaggaaggaaggaaagaa	0.099													6	3	---	---	---	---	
IL10RB	3588	broad.mit.edu	37	21	34660753	34660754	+	Intron	INS	-	AGGGAAGTCTG	AGGGAAGTCTG	rs138463621	by1000genomes	TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34660753_34660754insAGGGAAGTCTG	uc002yrk.1	+						IL10RB_uc002yrl.1_Intron	NM_000628	NP_000619	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta precursor						immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity				0						GTAACCATGTCAGGTGAAGGAA	0.436													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46161801	46161804	+	IGR	DEL	AAGG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46161801_46161804delAAGG								C21orf29 (30306 upstream) : UBE2G2 (27152 downstream)																							gaaagaaagaaaggaaggaaggaa	0.000													6	3	---	---	---	---	
C22orf13	83606	broad.mit.edu	37	22	24940243	24940244	+	Intron	DEL	GT	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24940243_24940244delGT	uc003aah.2	-						C22orf13_uc003aal.2_Intron|C22orf13_uc003aai.3_Intron|C22orf13_uc003aaj.3_Intron|C22orf13_uc003aak.3_Intron	NM_031444	NP_113632	Q96NT3	CV013_HUMAN	chromosome 22 open reading frame 13												0						GGTGGGGGGGGTGTGTGTGTGT	0.599													6	3	---	---	---	---	
C22orf30	253143	broad.mit.edu	37	22	32084030	32084031	+	Intron	DEL	AG	-	-	rs77978141		TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32084030_32084031delAG	uc003alp.3	-						C22orf30_uc003alo.1_Intron|C22orf30_uc010gwj.1_Intron	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143												0						aaaaaaaaaaaGACCCAATATT	0.178													5	4	---	---	---	---	
NLGN4X	57502	broad.mit.edu	37	X	5961175	5961176	+	Intron	INS	-	AC	AC			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5961175_5961176insAC	uc010ndh.2	-						NLGN4X_uc004crp.2_Intron|NLGN4X_uc004crq.2_Intron|NLGN4X_uc010ndi.2_Intron|NLGN4X_uc004crr.2_Intron|NLGN4X_uc010ndj.2_Intron	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor						brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						TGcacgcgcatacacacacaca	0.134													4	2	---	---	---	---	
CXorf22	170063	broad.mit.edu	37	X	36004131	36004131	+	Intron	DEL	C	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36004131delC	uc004ddj.2	+						CXorf22_uc010ngv.2_Intron	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063											large_intestine(1)|lung(1)|ovary(1)	3						aaggaaattgcccatggtctc	0.000													69	72	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128042237	128042238	+	IGR	INS	-	GGAA	GGAA			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128042237_128042238insGGAA								ACTRT1 (855855 upstream) : SMARCA1 (538242 downstream)																							aaaagaacaagggaagaaagga	0.010													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13310686	13310687	+	IGR	DEL	TG	-	-			TCGA-33-4533-01A-01D-1267-08	TCGA-33-4533-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13310686_13310687delTG								None (None upstream) : None (None downstream)																							GCCACCATGTTGTGTTCCTGAT	0.599													1	11	---	---	---	---	
