Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	6038480	6038480	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6038480G>C	uc001alq.1	-						NPHP4_uc001als.1_Intron|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCCTAGGAGACAACGGGGA	0.552													3	22	---	---	---	---	PASS
PRAMEF6	440561	broad.mit.edu	37	1	13001318	13001318	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13001318C>A	uc001auq.2	-	3	451	c.365G>T	c.(364-366)CGT>CTT	p.R122L	PRAMEF5_uc001aur.2_Intron	NM_001010889	NP_001010889	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	122											0	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGCACCCACGGGCCATAGC	0.502													68	355	---	---	---	---	PASS
KLHDC7A	127707	broad.mit.edu	37	1	18808058	18808058	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18808058G>A	uc001bax.2	+	1	635	c.583G>A	c.(583-585)GAG>AAG	p.E195K	KLHDC7A_uc009vpg.2_5'UTR	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	195						integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TAAACCCCGTGAGCATCCAGG	0.612													14	29	---	---	---	---	PASS
NBPF3	84224	broad.mit.edu	37	1	21798050	21798050	+	Intron	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21798050A>G	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTTCTCTACTATCTCACCTTA	0.443													5	137	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22211643	22211643	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22211643G>A	uc001bfj.2	-	11	1258	c.1218C>T	c.(1216-1218)CCC>CCT	p.P406P	HSPG2_uc009vqd.2_Silent_p.P406P	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	406	Ig-like C2-type 1.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TCACCACCTGGGGGGGCACTG	0.667													11	14	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27874402	27874402	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27874402T>G	uc009vsy.2	-	6	5194	c.4225A>C	c.(4225-4227)AAG>CAG	p.K1409Q	AHDC1_uc009vsz.1_Missense_Mutation_p.K1409Q	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1409							DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		AGCTCTTCCTTGAAGCCCAGT	0.672													58	42	---	---	---	---	PASS
C1orf216	127703	broad.mit.edu	37	1	36181836	36181836	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36181836T>A	uc001bzh.1	-	2	575	c.87A>T	c.(85-87)CCA>CCT	p.P29P		NM_152374	NP_689587	Q8TAB5	CA216_HUMAN	hypothetical protein LOC127703	29										skin(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				AGTTGCTGTCTGGTTGGAGCT	0.572											OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	41	35	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39910348	39910348	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39910348G>A	uc010oiu.1	+	45	14906	c.14775G>A	c.(14773-14775)CAG>CAA	p.Q4925Q	MACF1_uc010ois.1_Silent_p.Q4423Q	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCTATTCCCAGCTGAAAGCCA	0.443													3	47	---	---	---	---	PASS
PABPC4	8761	broad.mit.edu	37	1	40029580	40029580	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40029580C>A	uc010oiv.1	-	11	2318	c.1420G>T	c.(1420-1422)GAC>TAC	p.D474Y	PABPC4_uc001cdl.2_Missense_Mutation_p.D490Y|PABPC4_uc001cdm.2_Intron	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	474					blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCCAAGCGGTCCGGGCACTCA	0.582													7	35	---	---	---	---	PASS
PABPC4	8761	broad.mit.edu	37	1	40029581	40029581	+	Silent	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40029581C>G	uc010oiv.1	-	11	2317	c.1419G>C	c.(1417-1419)CCG>CCC	p.P473P	PABPC4_uc001cdl.2_Silent_p.P489P|PABPC4_uc001cdm.2_Intron	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	473					blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCAAGCGGTCCGGGCACTCAG	0.582													8	35	---	---	---	---	PASS
PABPC4	8761	broad.mit.edu	37	1	40029582	40029582	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40029582G>A	uc010oiv.1	-	11	2316	c.1418C>T	c.(1417-1419)CCG>CTG	p.P473L	PABPC4_uc001cdl.2_Missense_Mutation_p.P489L|PABPC4_uc001cdm.2_Intron	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	473					blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CAAGCGGTCCGGGCACTCAGA	0.577													8	35	---	---	---	---	PASS
FAM159A	348378	broad.mit.edu	37	1	53122665	53122665	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53122665G>T	uc001cuf.2	+	3	626	c.526G>T	c.(526-528)GAG>TAG	p.E176*	FAM159A_uc001cug.1_Intron|FAM159A_uc001cuh.2_Intron	NM_001042693	NP_001036158	Q6UWV7	F159A_HUMAN	hypothetical protein LOC348378	176						integral to membrane					0						AGGCAGCCCTGAGGAAGCCTC	0.527													129	142	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54606960	54606960	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54606960C>A	uc001cwv.1	-	3	1422	c.574G>T	c.(574-576)GTG>TTG	p.V192L		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	192	CUB 2.					extracellular region				ovary(1)	1						TTGCCCTCCACCTGGAAGTCC	0.637													34	37	---	---	---	---	PASS
PDE4B	5142	broad.mit.edu	37	1	66384311	66384311	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66384311G>T	uc001dcn.2	+	3	265	c.74G>T	c.(73-75)AGT>ATT	p.S25I	PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Missense_Mutation_p.S25I	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1	25					signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	TGTAGCTTGAGTAAATCCTAC	0.383													30	29	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507364	74507364	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507364G>T	uc001dfy.3	-	7	1443	c.1251C>A	c.(1249-1251)CTC>CTA	p.L417L	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	417										ovary(2)	2						TAAATGTTCGGAGTTTCATAC	0.368													45	47	---	---	---	---	PASS
LHX8	431707	broad.mit.edu	37	1	75606778	75606778	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75606778C>A	uc001dgo.2	+	5	1040	c.376C>A	c.(376-378)CTT>ATT	p.L126I	LHX8_uc001dgq.2_Missense_Mutation_p.L65I	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8	126	LIM zinc-binding 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TTTCTGCAAACTTGATTATTT	0.378													44	51	---	---	---	---	PASS
LHX8	431707	broad.mit.edu	37	1	75606780	75606780	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75606780T>A	uc001dgo.2	+	5	1042	c.378T>A	c.(376-378)CTT>CTA	p.L126L	LHX8_uc001dgq.2_Silent_p.L65L	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8	126	LIM zinc-binding 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TCTGCAAACTTGATTATTTCA	0.368													43	52	---	---	---	---	PASS
LPPR4	9890	broad.mit.edu	37	1	99772006	99772006	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99772006C>A	uc001dse.2	+	7	1838	c.1732C>A	c.(1732-1734)CAA>AAA	p.Q578K	LPPR4_uc010oue.1_Missense_Mutation_p.Q520K	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	578							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CCGAATCATGCAAGTCATAGC	0.547													37	23	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103412503	103412503	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103412503C>A	uc001dul.2	-	42	3496	c.3178G>T	c.(3178-3180)GGA>TGA	p.G1060*	COL11A1_uc001duk.2_Nonsense_Mutation_p.G256*|COL11A1_uc001dum.2_Nonsense_Mutation_p.G1072*|COL11A1_uc001dun.2_Nonsense_Mutation_p.G1021*|COL11A1_uc009weh.2_Nonsense_Mutation_p.G944*	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1060	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCACGTTCTCCTGGTGAGCCC	0.468													14	13	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109795276	109795276	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109795276G>C	uc001dxa.3	+	1	2636	c.2575G>C	c.(2575-2577)GAT>CAT	p.D859H		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	859	Extracellular (Potential).|Cadherin 7.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AGGAGGCGACGATGGAGACGG	0.547													27	30	---	---	---	---	PASS
CHI3L2	1117	broad.mit.edu	37	1	111784000	111784000	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111784000G>T	uc001eam.2	+	9	1041	c.970G>T	c.(970-972)GTT>TTT	p.V324F	CHI3L2_uc001ean.2_Missense_Mutation_p.V314F|CHI3L2_uc001eao.2_Missense_Mutation_p.V245F|CHI3L2_uc009wga.2_Intron	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a	324					chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		GGATCAACAGGTTCCCTACGC	0.532													28	30	---	---	---	---	PASS
HFE2	148738	broad.mit.edu	37	1	145415810	145415810	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145415810T>C	uc001eni.2	+	3	954	c.629T>C	c.(628-630)TTG>TCG	p.L210S	NBPF10_uc001emp.3_Intron|HFE2_uc001enj.2_Intron|HFE2_uc001enk.2_Missense_Mutation_p.L97S|HFE2_uc001enl.2_Intron	NM_213653	NP_998818	Q6ZVN8	RGMC_HUMAN	hemojuvelin isoform a precursor	210					axon guidance	anchored to membrane				ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCATGGCGTTGGGGGCCAAC	0.572													126	142	---	---	---	---	PASS
C1orf43	25912	broad.mit.edu	37	1	154187017	154187017	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154187017T>A	uc001fei.2	-	3	592	c.202A>T	c.(202-204)AGG>TGG	p.R68W	C1orf43_uc001fef.1_5'Flank|C1orf43_uc001feg.2_Missense_Mutation_p.R34W|C1orf43_uc001feh.2_Missense_Mutation_p.R34W|C1orf43_uc001fej.2_Missense_Mutation_p.R68W|C1orf43_uc009wos.1_Missense_Mutation_p.R68W|C1orf43_uc001fek.2_Missense_Mutation_p.R68W|C1orf43_uc001fel.2_Missense_Mutation_p.R34W	NM_001098616	NP_001092086	Q9BWL3	CA043_HUMAN	hypothetical protein LOC25912 isoform 3	68						integral to membrane	coenzyme binding|oxidoreductase activity				0	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					TCCTGAACCCTGGAGAGTCGA	0.423													98	81	---	---	---	---	PASS
PKLR	5313	broad.mit.edu	37	1	155265282	155265282	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155265282C>A	uc001fkb.3	-	4	492	c.453G>T	c.(451-453)GTG>GTT	p.V151V	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Silent_p.V120V|PKLR_uc010pga.1_Silent_p.V87V	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	151					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GGGCGATGGCCACGGGCCGGT	0.692													21	13	---	---	---	---	PASS
ROBLD3	28956	broad.mit.edu	37	1	156027821	156027821	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156027821C>A	uc001fnb.3	+	3	448	c.284C>A	c.(283-285)GCC>GAC	p.A95D	ROBLD3_uc010pgy.1_Intron	NM_014017	NP_054736	Q9Y2Q5	LTOR2_HUMAN	roadblock domain-containing protein 3 isoform 1	95					cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	lysosomal membrane|Ragulator complex					0						TGTATGTATGCCAAGGAGACC	0.562													90	90	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156843688	156843688	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156843688G>T	uc001fqh.1	+	8	1170	c.1114G>T	c.(1114-1116)GCC>TCC	p.A372S	NTRK1_uc001fqf.1_Missense_Mutation_p.A342S|NTRK1_uc009wsi.1_Missense_Mutation_p.A77S|NTRK1_uc001fqi.1_Missense_Mutation_p.A372S|NTRK1_uc009wsk.1_Missense_Mutation_p.A372S	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	372	Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CCAGGCCTCCGCCTCCATCAT	0.652			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			9	9	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156845871	156845871	+	Splice_Site	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156845871G>T	uc001fqh.1	+	13	1558	c.1502_splice	c.e13-1	p.C501_splice	NTRK1_uc001fqf.1_Splice_Site_p.C465_splice|NTRK1_uc009wsi.1_Splice_Site_p.C200_splice|NTRK1_uc001fqi.1_Splice_Site_p.C495_splice|NTRK1_uc009wsk.1_Missense_Mutation_p.G498C	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1						activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	AGCCCCCTCAGGTGTTCACCA	0.557			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			53	208	---	---	---	---	PASS
OR10X1	128367	broad.mit.edu	37	1	158549355	158549355	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158549355C>T	uc010pin.1	-	1	335	c.335G>A	c.(334-336)GGT>GAT	p.G112D		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	112	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					TAAGCTACAACCTGTGACTGA	0.488													22	75	---	---	---	---	PASS
OR6K3	391114	broad.mit.edu	37	1	158687440	158687440	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687440G>C	uc010pip.1	-	1	514	c.514C>G	c.(514-516)CTG>GTG	p.L172V		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	172	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					TCGGGAAGCAGGATAAGGAAA	0.522													39	130	---	---	---	---	PASS
IFI16	3428	broad.mit.edu	37	1	158988388	158988388	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158988388C>G	uc001ftf.1	+	6	1526	c.919C>G	c.(919-921)CTT>GTT	p.L307V	IFI16_uc001ftg.2_Missense_Mutation_p.L307V|IFI16_uc010pis.1_Missense_Mutation_p.L251V	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	307	HIN-200 1.				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					GATTGATATTCTTCACAAACA	0.353													44	146	---	---	---	---	PASS
SLAMF1	6504	broad.mit.edu	37	1	160607207	160607207	+	Silent	SNP	G	T	T	rs35824111		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160607207G>T	uc001fwl.3	-	2	535	c.189C>A	c.(187-189)GTC>GTA	p.V63V	SLAMF1_uc010pjk.1_RNA|SLAMF1_uc010pjl.1_RNA|SLAMF1_uc010pjm.1_RNA|SLAMF1_uc001fwm.2_Silent_p.V63V	NM_003037	NP_003028	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family	63	Extracellular (Potential).				interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity			ovary(1)|breast(1)	2	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CCATTGTGACGACAATGTGGA	0.463													33	119	---	---	---	---	PASS
OLFML2B	25903	broad.mit.edu	37	1	161967994	161967994	+	Silent	SNP	G	A	A	rs34123330	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161967994G>A	uc001gbu.2	-	6	1519	c.1095C>T	c.(1093-1095)AAC>AAT	p.N365N	OLFML2B_uc010pkq.1_Silent_p.N366N	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	365										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CGGTCCGAGCGTTCAGGTCGC	0.612													74	305	---	---	---	---	PASS
C1orf226	400793	broad.mit.edu	37	1	162351745	162351745	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162351745C>T	uc001gby.2	+	1	226	c.54C>T	c.(52-54)TCC>TCT	p.S18S	C1orf226_uc010pkt.1_Silent_p.S61S	NM_001085375	NP_001078844	A1L170	CA226_HUMAN	hypothetical protein LOC400793 isoform 2	18										ovary(1)	1						CCAGCCGCTCCTTCCCCCACT	0.622													16	48	---	---	---	---	PASS
NUF2	83540	broad.mit.edu	37	1	163297351	163297351	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163297351T>A	uc001gcq.1	+	3	497	c.197T>A	c.(196-198)ATG>AAG	p.M66K	NUF2_uc001gcp.2_Missense_Mutation_p.M66K|NUF2_uc001gcr.1_Missense_Mutation_p.M66K|NUF2_uc009wvc.1_Missense_Mutation_p.M66K	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	66	Interaction with the N-terminus of NDC80.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					CATTTTTACATGGTGAGTTTA	0.348													29	150	---	---	---	---	PASS
RCSD1	92241	broad.mit.edu	37	1	167654655	167654655	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167654655C>T	uc001gem.2	+						RCSD1_uc010pli.1_Intron	NM_052862	NP_443094	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1											ovary(2)|central_nervous_system(2)|skin(1)	5	all_hematologic(923;0.215)					GCCCTCCCTCCAGACACCAGC	0.552													72	54	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173493188	173493188	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173493188T>C	uc001giz.2	-	21	2983	c.2560A>G	c.(2560-2562)ATC>GTC	p.I854V	SLC9A11_uc009wwe.2_Missense_Mutation_p.I412V	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	854					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						GGGGGTGGGATTGCCTTTGGA	0.289													71	66	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175335165	175335165	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175335165G>T	uc001gkp.1	-	9	2244	c.2163C>A	c.(2161-2163)ACC>ACA	p.T721T	TNR_uc009wwu.1_Silent_p.T721T	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	721	Fibronectin type-III 5.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CAGAGGATGGGGTAAAGGTAA	0.552													28	141	---	---	---	---	PASS
SEC16B	89866	broad.mit.edu	37	1	177933402	177933402	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177933402C>T	uc001gli.1	-	5	636	c.546G>A	c.(544-546)AGG>AGA	p.R182R	SEC16B_uc001glk.1_5'UTR|SEC16B_uc009wwz.1_5'UTR|SEC16B_uc001glj.1_Silent_p.R182R|SEC16B_uc001gll.3_Silent_p.R182R	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	182	Required for endoplasmic reticulum localization.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						TACAAGGGTTCCTACTGTTAG	0.572													27	38	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181726098	181726098	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181726098C>T	uc001gow.2	+	30	4330	c.4165C>T	c.(4165-4167)CGA>TGA	p.R1389*	CACNA1E_uc009wxs.2_Nonsense_Mutation_p.R1277*|CACNA1E_uc001gox.1_Nonsense_Mutation_p.R615*|CACNA1E_uc009wxt.2_Nonsense_Mutation_p.R615*	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1389	Extracellular (Potential).|III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AGAGGAAGACCGAGGCCCAAG	0.478													8	222	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181767480	181767480	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181767480C>A	uc001gow.2	+	47	6488	c.6323C>A	c.(6322-6324)ACC>AAC	p.T2108N	CACNA1E_uc009wxs.2_Missense_Mutation_p.T1996N|CACNA1E_uc009wxt.2_Missense_Mutation_p.T1377N	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2151	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GACACCAGCACCCCAAGAAGA	0.592													104	121	---	---	---	---	PASS
C1orf26	54823	broad.mit.edu	37	1	185144061	185144061	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185144061A>T	uc001grg.3	+	5	896	c.782A>T	c.(781-783)AAG>ATG	p.K261M	C1orf26_uc001grh.3_Missense_Mutation_p.K261M	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	261											0						AATAATTCGAAGACTAAGCAG	0.353													110	108	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197070783	197070783	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197070783G>A	uc001gtu.2	-	18	7855	c.7598C>T	c.(7597-7599)TCT>TTT	p.S2533F	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Missense_Mutation_p.S381F	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2533	IQ 27.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						AACCACAGCAGAATGCCATTG	0.343													56	202	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197072005	197072005	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072005T>A	uc001gtu.2	-	18	6633	c.6376A>T	c.(6376-6378)ATG>TTG	p.M2126L	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2126	IQ 17.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						ATTTTAAACATGGCTTTAATA	0.323													57	244	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198704280	198704280	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198704280T>A	uc001gur.1	+	23	2476	c.2296T>A	c.(2296-2298)TCA>ACA	p.S766T	PTPRC_uc001gus.1_Missense_Mutation_p.S718T|PTPRC_uc001gut.1_Missense_Mutation_p.S605T|PTPRC_uc010ppg.1_Missense_Mutation_p.S702T	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	766	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						ATACTGGCCGTCAATGGAAGA	0.308													28	67	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204985583	204985583	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204985583G>T	uc001hbj.2	+	30	3967	c.3639G>T	c.(3637-3639)ACG>ACT	p.T1213T	NFASC_uc010pra.1_Silent_p.T1147T|NFASC_uc001hbi.2_Silent_p.T1142T|NFASC_uc010prb.1_Silent_p.T1162T|NFASC_uc010prc.1_Silent_p.T713T|NFASC_uc001hbl.1_Silent_p.T289T|NFASC_uc001hbm.1_Silent_p.T236T|NFASC_uc009xbh.1_Missense_Mutation_p.R68L|NFASC_uc001hbo.1_Missense_Mutation_p.R89L	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	1320	Cytoplasmic (Potential).				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCCAGTACACGGTCAAAAAGG	0.572													32	126	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207658901	207658901	+	3'UTR	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207658901C>G	uc001hfw.2	+	18					CR2_uc001hfv.2_3'UTR|CR2_uc009xch.2_3'UTR	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)						complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						GCCAGCTGATCAGAAGACAAA	0.333													51	36	---	---	---	---	PASS
CD34	947	broad.mit.edu	37	1	208084408	208084408	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208084408G>A	uc001hgw.1	-	1	276	c.18C>T	c.(16-18)GGC>GGT	p.G6G	CD34_uc001hgx.1_Silent_p.G6G|CD34_uc010psj.1_5'UTR	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a	6					cell-cell adhesion|leukocyte migration|regulation of immune response	integral to membrane	carbohydrate binding			ovary(1)	1						CTGCGCGCGCGCCCCTGCGGA	0.617													6	8	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211192446	211192446	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211192446A>T	uc001hib.2	-	6	881	c.711T>A	c.(709-711)TAT>TAA	p.Y237*	KCNH1_uc001hic.2_Nonsense_Mutation_p.Y237*	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	237	Helical; Name=Segment S1; (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AGGAGACATTATAAGGGACCA	0.413													37	128	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211276913	211276913	+	Missense_Mutation	SNP	T	A	A	rs148218711	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211276913T>A	uc001hib.2	-	3	405	c.235A>T	c.(235-237)ACG>TCG	p.T79S	KCNH1_uc001hic.2_Missense_Mutation_p.T79S	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	79	Cytoplasmic (Potential).|PAS.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TTTTCAATCGTGTCTTTATCA	0.308													60	68	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214817978	214817978	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214817978G>T	uc001hkm.2	+	13	5239	c.5065G>T	c.(5065-5067)GAT>TAT	p.D1689Y		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	1785					cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ACCAAAGCATGATGTTCATCA	0.388													40	117	---	---	---	---	PASS
SNAP47	116841	broad.mit.edu	37	1	227954784	227954784	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227954784G>T	uc001hrf.2	+	4	1662	c.1248G>T	c.(1246-1248)CAG>CAT	p.Q416H	SNAP47_uc001hqz.2_Missense_Mutation_p.Q371H|SNAP47_uc001hra.2_Missense_Mutation_p.Q174H|SNAP47_uc001hrd.2_Missense_Mutation_p.Q416H|SNAP47_uc001hre.2_Missense_Mutation_p.Q174H	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	416	t-SNARE coiled-coil homology 2.					endomembrane system|membrane|perinuclear region of cytoplasm				ovary(1)	1						AACTAACCCAGGTAAGATGTC	0.602													13	50	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228431117	228431117	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228431117G>A	uc009xez.1	+	10	3207	c.3163G>A	c.(3163-3165)GAG>AAG	p.E1055K	OBSCN_uc001hsn.2_Missense_Mutation_p.E1055K	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1055	Ig-like 10.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CTACAGCTGCGAGGCCAGGGG	0.552													29	25	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235331886	235331886	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235331886G>C	uc001hwq.2	-	24	4391	c.3893C>G	c.(3892-3894)TCA>TGA	p.S1298*	ARID4B_uc001hwr.2_Nonsense_Mutation_p.S1212*|ARID4B_uc001hwp.2_RNA	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	1298	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GCTGGACATTGACGGTTCAGC	0.463													50	64	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235973326	235973326	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235973326T>G	uc001hxj.2	-	5	967	c.792A>C	c.(790-792)TTA>TTC	p.L264F	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.L264F	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	264					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTTTTTCTAATAAAGATAACA	0.388									Chediak-Higashi_syndrome				60	56	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237617769	237617769	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237617769G>T	uc001hyl.1	+	15	1491	c.1371G>T	c.(1369-1371)CAG>CAT	p.Q457H		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	457	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAAGTCTGCAGGATCTCATTG	0.463													53	63	---	---	---	---	PASS
MAP1LC3C	440738	broad.mit.edu	37	1	242161836	242161836	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242161836G>T	uc001hzk.2	-	3	276	c.201C>A	c.(199-201)ACC>ACA	p.T67T		NM_001004343	NP_001004343	Q9BXW4	MLP3C_HUMAN	microtubule-associated protein 1 light chain 3	67					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGAGGAACTGGGTCATGGTCA	0.622											OREG0014354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	85	75	---	---	---	---	PASS
ZNF695	57116	broad.mit.edu	37	1	247150705	247150705	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247150705C>A	uc009xgu.2	-	4	1257	c.1112G>T	c.(1111-1113)AGG>ATG	p.R371M	ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron|ZNF695_uc009xgt.1_Intron|ZNF695_uc001ibx.2_Intron|ZNF695_uc001iby.2_Intron	NM_020394	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein SBZF3	371	C2H2-type 8.				regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATGAATTCTCCTATGTTCAGT	0.393													7	68	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247587425	247587425	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587425C>A	uc001icr.2	+	5	818	c.680C>A	c.(679-681)GCG>GAG	p.A227E	NLRP3_uc001ics.2_Missense_Mutation_p.A227E|NLRP3_uc001icu.2_Missense_Mutation_p.A227E|NLRP3_uc001icw.2_Missense_Mutation_p.A227E|NLRP3_uc001icv.2_Missense_Mutation_p.A227E|NLRP3_uc010pyw.1_Missense_Mutation_p.A225E|NLRP3_uc001ict.1_Missense_Mutation_p.A225E	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	227	ATP (Potential).|NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TTCCAGGGGGCGGCAGGGATT	0.537													56	49	---	---	---	---	PASS
OR6F1	343169	broad.mit.edu	37	1	247875890	247875890	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875890A>G	uc001idj.1	-	1	168	c.168T>C	c.(166-168)CAT>CAC	p.H56H		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	56	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			ACATGGGGGTATGCAACTGAT	0.483													104	102	---	---	---	---	PASS
OR1C1	26188	broad.mit.edu	37	1	247921036	247921036	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247921036C>G	uc010pza.1	-	1	673	c.673G>C	c.(673-675)GTT>CTT	p.V225L		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			ATCTTCAGAACAGTGGAGAAG	0.498													36	39	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248524899	248524899	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248524899G>A	uc001ieh.1	+	1	17	c.17G>A	c.(16-18)TGG>TAG	p.W6*		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	6	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AACATCACCTGGATGGCCAGC	0.473													28	87	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685150	248685150	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685150G>T	uc001ien.1	+	1	203	c.203G>T	c.(202-204)TGT>TTT	p.C68F		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AACCTCTCGTGTGTGGACATC	0.507													95	75	---	---	---	---	PASS
TRIB2	28951	broad.mit.edu	37	2	12863631	12863631	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12863631G>T	uc002rbv.3	+	2	1952	c.516G>T	c.(514-516)GTG>GTT	p.V172V	TRIB2_uc010yjp.1_Silent_p.V36V	NM_021643	NP_067675	Q92519	TRIB2_HUMAN	tribbles homolog 2	172	Protein kinase.				negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			stomach(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GGGGGCTGGTGCTGCGGGACC	0.577													55	73	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21256232	21256232	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21256232G>A	uc002red.2	-	9	1191	c.1063C>T	c.(1063-1065)CTG>TTG	p.L355L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	355	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AGGCCTCTCAGCTCAGTAACC	0.428													63	67	---	---	---	---	PASS
ATAD2B	54454	broad.mit.edu	37	2	24046409	24046409	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24046409C>T	uc002rek.3	-	16	2144	c.1850G>A	c.(1849-1851)TGC>TAC	p.C617Y	ATAD2B_uc010yki.1_RNA|ATAD2B_uc002rej.3_5'UTR	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	617							ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTTCAGTGCACAGGGCCTT	0.463													13	74	---	---	---	---	PASS
ADCY3	109	broad.mit.edu	37	2	25043721	25043721	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25043721G>A	uc002rfs.3	-						ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TTCATGCCTAGGGTAGAGGCA	0.537													5	121	---	---	---	---	PASS
TCF23	150921	broad.mit.edu	37	2	27373020	27373020	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27373020G>T	uc010ylg.1	+	2	252	c.252G>T	c.(250-252)CGG>CGT	p.R84R		NM_175769	NP_786951	Q7RTU1	TCF23_HUMAN	transcription factor 23	84	Basic motif (By similarity).				cell differentiation|muscle organ development|regulation of transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGCCGCGCGGGAGCGGAGCC	0.657													40	60	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27460931	27460931	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27460931A>T	uc002rji.2	+	30	4898	c.4736A>T	c.(4735-4737)GAG>GTG	p.E1579V	CAD_uc010eyw.2_Missense_Mutation_p.E1516V	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1579	DHOase (dihydroorotase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CAGCATTTCGAGACATGGCCC	0.572													38	38	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27801261	27801261	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27801261C>A	uc002rkz.3	+	1	1873	c.1822C>A	c.(1822-1824)CCA>ACA	p.P608T		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	608										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					GGAGTTAGCACCAGGACCAAT	0.413													7	48	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32961770	32961770	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32961770G>A	uc002rom.2	+	12	1570	c.1339G>A	c.(1339-1341)GCA>ACA	p.A447T	TTC27_uc010ymx.1_Missense_Mutation_p.A397T|TTC27_uc002ron.2_RNA	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	447	TPR 1.						protein binding			central_nervous_system(1)	1						GCGCCAACTTGCAAGTTTGCT	0.378													47	61	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48872229	48872229	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48872229G>A	uc010yol.1	+						STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.A825T|GTF2A1L_uc002rws.1_Missense_Mutation_p.A121T|GTF2A1L_uc010yom.1_Missense_Mutation_p.A87T|GTF2A1L_uc002rwt.2_Missense_Mutation_p.A121T	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1						endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCATGTACCAGCAGGTGTGAC	0.338													12	89	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	51255264	51255264	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51255264A>T	uc010fbq.2	-	2	1625	c.148T>A	c.(148-150)TGC>AGC	p.C50S	NRXN1_uc002rxe.3_Missense_Mutation_p.C50S|NRXN1_uc002rxd.1_Missense_Mutation_p.C50S	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCGCTCTCGCAGCAGGCGTTC	0.667													5	7	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56599485	56599485	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56599485C>A	uc002rzn.2	+	4	1826	c.1324C>A	c.(1324-1326)CAG>AAG	p.Q442K		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	442	Potential.									breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TAAGGCCAGCCAGAATAGAAG	0.468													5	4	---	---	---	---	PASS
LOXL3	84695	broad.mit.edu	37	2	74761091	74761091	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74761091T>A	uc002smp.1	-	13	2178	c.2106A>T	c.(2104-2106)GCA>GCT	p.A702A	LOXL3_uc002smo.1_Silent_p.A341A|LOXL3_uc010ffm.1_Silent_p.A646A|LOXL3_uc002smq.1_Silent_p.A557A|LOXL3_uc010ffn.1_Silent_p.A557A	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	702	Lysyl-oxidase like.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						AGTCACTCTCTGCTACTTCAA	0.438													29	125	---	---	---	---	PASS
MRPL19	9801	broad.mit.edu	37	2	75874310	75874310	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75874310C>T	uc002snl.2	+	2	211	c.186C>T	c.(184-186)ATC>ATT	p.I62I	MRPL19_uc002snm.1_Silent_p.I62I	NM_014763	NP_055578	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19 precursor	62					translation	mitochondrion|nuclear membrane|ribosome	structural constituent of ribosome				0						AACCGGTCATCGTGGACAAGC	0.721													6	5	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80808823	80808823	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80808823G>T	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ATATCTTTTTGTCTTTAGACC	0.423													5	49	---	---	---	---	PASS
ADRA2B	151	broad.mit.edu	37	2	96781414	96781414	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96781414G>A	uc002svi.2	-	1	475	c.475C>T	c.(475-477)CGC>TGC	p.R159C		NM_000682	NP_000673	P18089	ADA2B_HUMAN	alpha-2B-adrenergic receptor	159	Extracellular (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding			ovary(2)|lung(1)	3					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	GGGCGCCCGCGCGGCTGGGGG	0.632													26	37	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100170906	100170906	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100170906C>A	uc002tag.2	-	23	3662	c.3426G>T	c.(3424-3426)CTG>CTT	p.L1142L	AFF3_uc002taf.2_Silent_p.L1167L	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	1142					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						TCGACGGGGACAGGGCGCTGG	0.652													71	38	---	---	---	---	PASS
C2orf29	55571	broad.mit.edu	37	2	101881431	101881431	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101881431G>T	uc002taw.3	+	4	1039	c.957G>T	c.(955-957)AAG>AAT	p.K319N		NM_017546	NP_060016	Q9UKZ1	CB029_HUMAN	hypothetical protein LOC55571	319					cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						TGTGTGTTAAGAATAGCACTG	0.483													4	127	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112604762	112604762	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112604762C>T	uc002thi.2	-	16	2052	c.1805G>A	c.(1804-1806)GGC>GAC	p.G602D		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	602					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						AACCATGGAGCCATTACTCAG	0.348													59	26	---	---	---	---	PASS
IL1B	3553	broad.mit.edu	37	2	113591131	113591131	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113591131G>T	uc002tii.1	-	4	208	c.121C>A	c.(121-123)CTC>ATC	p.L41I	IL1B_uc002tih.1_Missense_Mutation_p.L10I	NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein	41					activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	AGAGGGCAGAGGTCCAGGTCC	0.597													43	108	---	---	---	---	PASS
TMEM37	140738	broad.mit.edu	37	2	120194773	120194773	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120194773G>T	uc002tly.2	+	2	364	c.330G>T	c.(328-330)ATG>ATT	p.M110I		NM_183240	NP_899063	Q8WXS4	CCGL_HUMAN	transmembrane protein 37	110	Helical; (Potential).					integral to membrane	calcium channel activity|voltage-gated ion channel activity			breast(1)	1						AGTTCCTCATGGTGTCCCAGT	0.652													144	60	---	---	---	---	PASS
BIN1	274	broad.mit.edu	37	2	127818201	127818201	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127818201C>T	uc002tns.1	-						BIN1_uc010yzf.1_Intron|BIN1_uc010yzg.1_Intron|BIN1_uc002tnu.1_Silent_p.L260L|BIN1_uc002toa.1_Intron|BIN1_uc002tnt.1_Intron|BIN1_uc002tnv.1_Intron|BIN1_uc002tnw.1_Silent_p.L260L|BIN1_uc002tnx.1_Silent_p.L260L|BIN1_uc002tny.1_Intron|BIN1_uc002tnz.1_Intron|BIN1_uc002tob.1_Intron|BIN1_uc002toc.1_Intron	NM_139343	NP_647593	O00499	BIN1_HUMAN	bridging integrator 1 isoform 1						cell proliferation|endocytosis|interspecies interaction between organisms|multicellular organismal development	actin cytoskeleton|nucleus				ovary(2)|central_nervous_system(2)|skin(2)|lung(1)	7	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		GCCGCGAAAACAGTTTACTTT	0.617													54	31	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128324316	128324316	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128324316C>T	uc002top.2	+	5	437	c.384C>T	c.(382-384)GGC>GGT	p.G128G		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	128	Myosin head-like.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCCATATGGGCGAGCTGCCCC	0.587													27	14	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128775365	128775365	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128775365C>A	uc002tpp.2	-	3	447	c.315G>T	c.(313-315)CAG>CAT	p.Q105H	SAP130_uc002tpo.2_5'Flank|SAP130_uc010fmd.2_Missense_Mutation_p.Q105H|SAP130_uc002tpq.1_Missense_Mutation_p.Q79H	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	105					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TCGACAACATCTGCACCTGTG	0.587													130	48	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141202228	141202228	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141202228C>A	uc002tvj.1	-	64	11050	c.10078G>T	c.(10078-10080)GGC>TGC	p.G3360C		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3360	Extracellular (Potential).|LDL-receptor class A 22.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAAATCGGCCTGGCTGACAT	0.423										TSP Lung(27;0.18)			73	32	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141986915	141986915	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141986915T>A	uc002tvj.1	-	6	1659	c.687A>T	c.(685-687)TCA>TCT	p.S229S	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	229	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTCCATTGACTGAGCTTAGAG	0.303										TSP Lung(27;0.18)			39	36	---	---	---	---	PASS
KYNU	8942	broad.mit.edu	37	2	143787241	143787241	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143787241G>A	uc002tvl.2	+	11	1078	c.948G>A	c.(946-948)ATG>ATA	p.M316I	KYNU_uc010fnm.2_Missense_Mutation_p.M316I	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a	316					anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	GATTTAAGATGGATAACAGTA	0.279													40	88	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157325	145157325	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157325C>A	uc002tvu.2	-	8	1909	c.1429G>T	c.(1429-1431)GAC>TAC	p.D477Y	ZEB2_uc002tvv.2_Missense_Mutation_p.D471Y|ZEB2_uc010zbm.1_Missense_Mutation_p.D448Y|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.D506Y	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	477	SMAD-MH2 binding domain (By similarity).					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GCCTTGCAGTCCATTTTTTGC	0.413													80	69	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166740350	166740350	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166740350T>A	uc002udk.2	-	26	3771	c.3638A>T	c.(3637-3639)TAT>TTT	p.Y1213F	TTC21B_uc002udj.1_RNA	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1213	TPR 17.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TGCCATGTCATATTTTGCTGA	0.373													69	34	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167279930	167279930	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167279930T>C	uc002udu.1	-	18	2993	c.2866A>G	c.(2866-2868)ATA>GTA	p.I956V	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	956	Helical; Name=S1 of repeat III; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TCCATATATATATCTTCAAAA	0.284													14	9	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168107333	168107333	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107333C>A	uc002udx.2	+	8	9449	c.9431C>A	c.(9430-9432)TCC>TAC	p.S3144Y	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S2969Y|XIRP2_uc010fpq.2_Missense_Mutation_p.S2922Y|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2969					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CTTTCTCAGTCCCCTAAAAAG	0.468													101	55	---	---	---	---	PASS
NOSTRIN	115677	broad.mit.edu	37	2	169707637	169707637	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169707637A>G	uc002ueg.2	+	9	678	c.674A>G	c.(673-675)AAT>AGT	p.N225S	NOSTRIN_uc002uef.2_Missense_Mutation_p.N282S|NOSTRIN_uc002uei.2_Missense_Mutation_p.N108S|NOSTRIN_uc010fpu.2_Missense_Mutation_p.N197S|NOSTRIN_uc002ueh.2_Missense_Mutation_p.N147S|NOSTRIN_uc002uej.2_Missense_Mutation_p.N108S	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2	225					endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						CTTTTATGCAATAACTTAAAC	0.398													73	52	---	---	---	---	PASS
DFNB59	494513	broad.mit.edu	37	2	179325139	179325139	+	Silent	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179325139G>C	uc002umi.3	+	6	1088	c.732G>C	c.(730-732)CTG>CTC	p.L244L	DFNB59_uc002umj.3_Silent_p.L244L	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	244					sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CATTTGCACTGCTGTACAGGT	0.338													52	23	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179411946	179411946	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179411946C>T	uc010zfg.1	-	289	86826	c.86602G>A	c.(86602-86604)GGT>AGT	p.G28868S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G22563S|TTN_uc010zfi.1_Missense_Mutation_p.G22496S|TTN_uc010zfj.1_Missense_Mutation_p.G22371S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29795							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACTGCCACCATCGTGGTAG	0.438													105	76	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179413505	179413505	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179413505G>T	uc010zfg.1	-	288	85368	c.85144C>A	c.(85144-85146)CAA>AAA	p.Q28382K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q22077K|TTN_uc010zfi.1_Missense_Mutation_p.Q22010K|TTN_uc010zfj.1_Missense_Mutation_p.Q21885K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29309							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTCTACCTTGGTAGGCAATG	0.478													68	34	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179429564	179429564	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179429564C>T	uc010zfg.1	-	275	73815	c.73591G>A	c.(73591-73593)GAT>AAT	p.D24531N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D18226N|TTN_uc010zfi.1_Missense_Mutation_p.D18159N|TTN_uc010zfj.1_Missense_Mutation_p.D18034N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	25458							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGCCTCCATCATTCACTGGC	0.393													18	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179442567	179442567	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179442567C>G	uc010zfg.1	-	272	61106	c.60882G>C	c.(60880-60882)TGG>TGC	p.W20294C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.W13989C|TTN_uc010zfi.1_Missense_Mutation_p.W13922C|TTN_uc010zfj.1_Missense_Mutation_p.W13797C|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21221							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGGTTCAGTCCAAATGAGAG	0.373													48	32	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179466840	179466840	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179466840G>T	uc010zfg.1	-	233	47678	c.47454C>A	c.(47452-47454)GAC>GAA	p.D15818E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D9513E|TTN_uc010zfi.1_Missense_Mutation_p.D9446E|TTN_uc010zfj.1_Missense_Mutation_p.D9321E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16745							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAACCAGACAGTCCTGTGCTC	0.393													71	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186673790	186673790	+	Intron	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186673790T>A	uc002upm.2	+						uc010zfu.1_Nonsense_Mutation_p.L1084*					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		TCACCTGATTTAGAAAAGAGA	0.393													52	30	---	---	---	---	PASS
COQ10B	80219	broad.mit.edu	37	2	198327404	198327404	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198327404G>T	uc002uuh.1	+	3	450	c.396G>T	c.(394-396)GTG>GTT	p.V132V	COQ10B_uc010fsl.1_Silent_p.V104V	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor	132						mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTCCACCTGTGTTGGAGCGAT	0.308													101	47	---	---	---	---	PASS
STRADB	55437	broad.mit.edu	37	2	202337718	202337718	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202337718G>A	uc002uyd.3	+	5	599	c.234G>A	c.(232-234)CGG>CGA	p.R78R		NM_018571	NP_061041	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	78	Protein kinase.				activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|protein binding|protein kinase activity			skin(2)|stomach(1)|lung(1)	4						ATCTTGCACGGCATACTCCCA	0.323													124	68	---	---	---	---	PASS
RAPH1	65059	broad.mit.edu	37	2	204324756	204324756	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204324756C>T	uc002vad.2	-						RAPH1_uc002vae.2_Intron|RAPH1_uc002vaf.2_Intron	NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains						cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						TTCTCTCTGTCCCAAAATAAA	0.323													26	57	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	206023449	206023449	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206023449G>A	uc002var.1	+	11	1645	c.1438G>A	c.(1438-1440)GGA>AGA	p.G480R	PARD3B_uc010fub.1_Missense_Mutation_p.G480R|PARD3B_uc002vao.1_Missense_Mutation_p.G480R|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Missense_Mutation_p.G480R	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	480					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CTAACAGAAAGGAGAACCTGA	0.478													129	105	---	---	---	---	PASS
DYTN	391475	broad.mit.edu	37	2	207583001	207583001	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207583001C>T	uc002vbr.1	-	1	120	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN	dystrotelin	1						plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TATCTGGATCCATTTCACAAA	0.373													17	13	---	---	---	---	PASS
CCNYL1	151195	broad.mit.edu	37	2	208615672	208615672	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208615672C>T	uc002vci.2	+						CCNYL1_uc002vch.2_Intron	NM_001142300	NP_001135772	Q8N7R7	CCYL1_HUMAN	cyclin Y-like 1 isoform 1						regulation of cyclin-dependent protein kinase activity		protein kinase binding				0				LUSC - Lung squamous cell carcinoma(261;0.0731)|Epithelial(149;0.139)|Lung(261;0.14)		TGTGTTCTTCCTCCTCCAGGA	0.383													28	45	---	---	---	---	PASS
CXCR1	3577	broad.mit.edu	37	2	219029167	219029167	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219029167C>A	uc002vhc.2	-	2	887	c.768G>T	c.(766-768)CTG>CTT	p.L256L		NM_000634	NP_000625	P25024	CXCR1_HUMAN	interleukin 8 receptor alpha	256	Helical; Name=6; (Potential).				dendritic cell chemotaxis|inflammatory response	integral to membrane|plasma membrane	interleukin-8 receptor activity			lung(2)	2						GGTTGTAGGGCAGCCAGCAAA	0.597													13	196	---	---	---	---	PASS
MRPL44	65080	broad.mit.edu	37	2	224822335	224822335	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224822335G>T	uc002vnr.3	+	1	215	c.146G>T	c.(145-147)CGC>CTC	p.R49L		NM_022915	NP_075066	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44 precursor	49					RNA processing	mitochondrion|ribosome	double-stranded RNA binding|protein binding|ribonuclease III activity			central_nervous_system(1)	1		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		GAGCGGCAGCGCCTTCTGCGG	0.697													13	8	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225653789	225653789	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225653789A>G	uc010fwz.1	-	48	5649	c.5410T>C	c.(5410-5412)TAC>CAC	p.Y1804H	DOCK10_uc002vob.2_Missense_Mutation_p.Y1798H|DOCK10_uc002voa.2_Missense_Mutation_p.Y460H|DOCK10_uc002voc.2_Missense_Mutation_p.Y625H	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1804	DHR-2.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ACCTCATTGTATGGTGTATCT	0.403													14	23	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228884816	228884816	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228884816C>G	uc002vpq.2	-	7	801	c.754G>C	c.(754-756)GCC>CCC	p.A252P	SPHKAP_uc002vpp.2_Missense_Mutation_p.A252P|SPHKAP_uc010zlx.1_Missense_Mutation_p.A252P	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	252						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ACCTGGGTGGCTCCCTTTAGC	0.378													226	110	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39230709	39230709	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39230709A>T	uc003cjk.1	-	2	449	c.228T>A	c.(226-228)GAT>GAA	p.D76E	XIRP1_uc003cji.2_Missense_Mutation_p.D76E|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	76							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CCTCAGCCAGATCCTCGGCCA	0.597													15	27	---	---	---	---	PASS
TGM4	7047	broad.mit.edu	37	3	44932107	44932107	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44932107G>T	uc003coc.3	+	4	386	c.313G>T	c.(313-315)GTC>TTC	p.V105F	TGM4_uc003cob.2_RNA	NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	105					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	CACAGTGGCTGTCACCAGTTC	0.473													52	39	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49160961	49160961	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49160961C>A	uc003cwe.2	-	25	4200	c.3901G>T	c.(3901-3903)GAG>TAG	p.E1301*	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1301	Domain II.|Potential.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTATCTCGCTCCAGACCACTT	0.502													51	35	---	---	---	---	PASS
CCDC36	339834	broad.mit.edu	37	3	49293826	49293826	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49293826C>A	uc003cwk.2	+	10	1283	c.896C>A	c.(895-897)GCC>GAC	p.A299D	CCDC36_uc011bck.1_Missense_Mutation_p.A299D	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	299										ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		TTATGGCAGGCCCAGGCCCTC	0.522													16	16	---	---	---	---	PASS
IQCF1	132141	broad.mit.edu	37	3	51937094	51937094	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51937094C>A	uc003dbv.2	-	2	113	c.15G>T	c.(13-15)CAG>CAT	p.Q5H	IQCF1_uc003dbq.3_RNA	NM_152397	NP_689610	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	5										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TCTTTTGGGGCTGCTTCTCCT	0.537													144	120	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62253411	62253411	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62253411A>G	uc003dlb.2	+	19	3510	c.2791A>G	c.(2791-2793)ACA>GCA	p.T931A	PTPRG_uc003dlc.2_Missense_Mutation_p.T902A|PTPRG_uc011bfi.1_Missense_Mutation_p.T177A|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	931	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TTTGAAGTCTACATTTGAAGA	0.398													63	84	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108690217	108690217	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108690217T>A	uc003dxl.2	-	25	2597	c.2510A>T	c.(2509-2511)CAG>CTG	p.Q837L	MORC1_uc011bhn.1_Missense_Mutation_p.Q816L	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	837					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TGATGGTAGCTGATGCTCAGG	0.403													39	35	---	---	---	---	PASS
DRD3	1814	broad.mit.edu	37	3	113890804	113890804	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113890804G>A	uc003ebd.2	-	3	459	c.36C>T	c.(34-36)AAC>AAT	p.N12N	DRD3_uc010hqn.1_Silent_p.N12N|DRD3_uc003ebb.1_Silent_p.N12N|DRD3_uc003ebc.1_Silent_p.N12N	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	12	Extracellular (Probable).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	CACAGGTGTAGTTCAGGTGGC	0.577													8	5	---	---	---	---	PASS
CD80	941	broad.mit.edu	37	3	119276494	119276494	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119276494G>C	uc003ecq.2	-	2	477	c.82C>G	c.(82-84)CTT>GTT	p.L28V	CD80_uc010hqt.1_Missense_Mutation_p.L28V|CD80_uc010hqu.1_Missense_Mutation_p.L28V|CD80_uc003ecr.1_Missense_Mutation_p.L28V	NM_005191	NP_005182	P33681	CD80_HUMAN	CD80 antigen precursor	28					interspecies interaction between organisms|intracellular signal transduction|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of signal transduction|positive regulation of T-helper 1 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	intracellular	coreceptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2					Abatacept(DB01281)	AAGTGAGAAAGACCAGCCAGC	0.493													11	33	---	---	---	---	PASS
CD80	941	broad.mit.edu	37	3	119276533	119276533	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119276533G>A	uc003ecq.2	-	2	438	c.43C>T	c.(43-45)CCA>TCA	p.P15S	CD80_uc010hqt.1_Missense_Mutation_p.P15S|CD80_uc010hqu.1_Missense_Mutation_p.P15S|CD80_uc003ecr.1_Missense_Mutation_p.P15S	NM_005191	NP_005182	P33681	CD80_HUMAN	CD80 antigen precursor	15					interspecies interaction between organisms|intracellular signal transduction|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of signal transduction|positive regulation of T-helper 1 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	intracellular	coreceptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2					Abatacept(DB01281)	TTGAGGTATGGACACTTGGAT	0.478													12	35	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124720847	124720847	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124720847G>A	uc003ehs.3	-	11	3434	c.3366C>T	c.(3364-3366)AAC>AAT	p.N1122N	HEG1_uc003ehr.3_Translation_Start_Site|HEG1_uc011bke.1_Silent_p.N1222N	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	1122	Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						TCACCACCGCGTTGGACTCCC	0.483													7	25	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126726697	126726697	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126726697G>A	uc003ejg.2	+	8	1988	c.1984G>A	c.(1984-1986)GTG>ATG	p.V662M		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	685	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		ATACCGCCACGTGTGCACACA	0.627													27	52	---	---	---	---	PASS
TMEM108	66000	broad.mit.edu	37	3	133099697	133099697	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133099697C>T	uc003eph.2	+	4	1416	c.1142C>T	c.(1141-1143)ACA>ATA	p.T381I	TMEM108_uc003epi.2_Missense_Mutation_p.T381I|TMEM108_uc003epj.1_Missense_Mutation_p.T381I|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_Missense_Mutation_p.T332I	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	381	Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)	4						GGAGCATCCACAACCCCACAA	0.622													51	89	---	---	---	---	PASS
FAIM	55179	broad.mit.edu	37	3	138338595	138338595	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138338595C>A	uc003esr.2	+						FAIM_uc003eso.1_Intron|FAIM_uc003esp.2_Intron|FAIM_uc003esq.2_Silent_p.I9I|FAIM_uc003ess.2_Intron	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0						ACAGTCCTATCTTTGAAGATG	0.348													56	73	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739091	138739091	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739091T>A	uc003esy.1	-	1	678	c.413A>T	c.(412-414)GAG>GTG	p.E138V		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	138										breast(1)	1						GAATTCCAGCTCGACGACGAC	0.657													53	80	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140281055	140281055	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140281055T>A	uc003etn.2	+	13	2307	c.2117T>A	c.(2116-2118)TTG>TAG	p.L706*		NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	706	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GGAGGGGACTTGGACCCAAGG	0.483										HNSCC(16;0.037)			45	90	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140397113	140397113	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140397113G>A	uc003eto.1	+	1	233	c.42G>A	c.(40-42)TGG>TGA	p.W14*		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	14	Cys-rich.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						GTTGTACATGGCAGAGATGTT	0.512													134	194	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142455367	142455367	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142455367G>A	uc003evc.2	+	2	455	c.319G>A	c.(319-321)GGT>AGT	p.G107S	TRPC1_uc003evb.2_Missense_Mutation_p.G107S	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	107	ANK 2.|Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						TTTGGACTACGGTTGTCAGGT	0.308													21	250	---	---	---	---	PASS
SLC9A9	285195	broad.mit.edu	37	3	143297493	143297493	+	Silent	SNP	C	A	A	rs141404629	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143297493C>A	uc003evn.2	-	7	1010	c.828G>T	c.(826-828)GGG>GGT	p.G276G	SLC9A9_uc011bnk.1_Silent_p.G150G	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	276					regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						CCAGGAAATTCCCCACAGACT	0.468													35	84	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151094642	151094642	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151094642A>G	uc003eyp.2	+	27	4041	c.4003A>G	c.(4003-4005)AAA>GAA	p.K1335E	MED12L_uc011bnz.1_Missense_Mutation_p.K1195E|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Missense_Mutation_p.K498E	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1335					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCTAATGATCAAACAGTGCTT	0.353													32	86	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155203429	155203429	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203429G>T	uc011bok.1	-	22	2991	c.2714C>A	c.(2713-2715)TCC>TAC	p.S905Y	PLCH1_uc011boj.1_Missense_Mutation_p.S905Y|PLCH1_uc011bol.1_Missense_Mutation_p.S867Y	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	905					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TACATAATGGGAATTGTTTTC	0.458													24	72	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155311743	155311743	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155311743T>A	uc011bok.1	-	3	698	c.421A>T	c.(421-423)AGG>TGG	p.R141W	PLCH1_uc011boj.1_Missense_Mutation_p.R141W|PLCH1_uc011bol.1_Missense_Mutation_p.R123W	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	141					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCATGGGTCCTCTGCCTTTTG	0.493													41	38	---	---	---	---	PASS
SMC4	10051	broad.mit.edu	37	3	160137340	160137340	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160137340G>A	uc003fdh.2	+						IFT80_uc003fda.2_Intron|SMC4_uc010hwc.1_Intron|SMC4_uc003fdi.2_Intron|SMC4_uc003fdj.2_Intron|SMC4_uc010hwd.2_Intron|SMC4_uc003fdl.2_Intron	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGGTAAAGTAGATTTTTGGGG	0.328													20	72	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169540420	169540420	+	Silent	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169540420G>C	uc003fgb.2	+	1	711	c.711G>C	c.(709-711)TCG>TCC	p.S237S		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	237	LRR 10.										0						GCCAACTGTCGGTGCTCGATT	0.572													46	76	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			24	62	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179458136	179458136	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179458136C>G	uc003fkh.2	+	11	1437	c.1356C>G	c.(1354-1356)TTC>TTG	p.F452L	USP13_uc003fkf.2_Missense_Mutation_p.F452L	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	452					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			AGGAATTCTTCTTGCACCTGG	0.542													48	103	---	---	---	---	PASS
DVL3	1857	broad.mit.edu	37	3	183882396	183882396	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183882396C>T	uc003fms.2	+						DVL3_uc011bqw.1_Intron|DVL3_uc003fmt.2_Intron|DVL3_uc003fmu.2_Intron	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3						canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CATGGTATATCTTCCTGAACA	0.602													4	92	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8613819	8613819	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8613819T>C	uc003glm.2	+	8	1419	c.1293T>C	c.(1291-1293)AAT>AAC	p.N431N	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Silent_p.N294N|CPZ_uc003glo.2_Silent_p.N420N|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	431					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						GGTCGGAGAATAGGTGTGGAG	0.502													20	18	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20598065	20598065	+	Silent	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20598065C>G	uc003gpr.1	+	32	3552	c.3348C>G	c.(3346-3348)CCC>CCG	p.P1116P	SLIT2_uc003gps.1_Silent_p.P1108P	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1116					apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						TTTCTCCACCCATGGTCCTCC	0.393													31	35	---	---	---	---	PASS
LGI2	55203	broad.mit.edu	37	4	25019790	25019790	+	Intron	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25019790A>T	uc003grf.2	-							NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2							extracellular region					0		Breast(46;0.173)				TCTAAAAATCAAAATAAAACA	0.333													34	30	---	---	---	---	PASS
SHISA3	152573	broad.mit.edu	37	4	42403061	42403061	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42403061T>A	uc003gwp.2	+	2	528	c.310T>A	c.(310-312)TCC>ACC	p.S104T		NM_001080505	NP_001073974	A0PJX4	SHSA3_HUMAN	shisa homolog 3 precursor	104	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|skin(1)	2						CATCGTCGGCTCCATCTTCAT	0.498													84	75	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49040053	49040053	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49040053A>T	uc003gyv.2	+	13	1841	c.1659A>T	c.(1657-1659)GAA>GAT	p.E553D	CWH43_uc011bzl.1_Missense_Mutation_p.E526D	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	553					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						CATTTTTTAGAGATGACCTCG	0.348													97	79	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72338609	72338609	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72338609G>C	uc003hfy.2	+	14	1942	c.1825G>C	c.(1825-1827)GAT>CAT	p.D609H	SLC4A4_uc010iic.2_Missense_Mutation_p.D609H|SLC4A4_uc010iib.2_Missense_Mutation_p.D609H|SLC4A4_uc003hfz.2_Missense_Mutation_p.D609H|SLC4A4_uc003hgc.3_Missense_Mutation_p.D565H|SLC4A4_uc010iid.2_Intron|SLC4A4_uc003hga.2_Missense_Mutation_p.D487H|SLC4A4_uc003hgb.3_Missense_Mutation_p.D565H	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	609	Extracellular (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CAAGCTTGCAGATTACTACCC	0.453													67	70	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83778278	83778278	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83778278C>T	uc003hnf.2	-	16	1872	c.1708G>A	c.(1708-1710)GAT>AAT	p.D570N	SEC31A_uc003hne.2_Missense_Mutation_p.D303N|SEC31A_uc011ccl.1_Missense_Mutation_p.D531N|SEC31A_uc003hnl.2_Missense_Mutation_p.D531N|SEC31A_uc003hng.2_Missense_Mutation_p.D570N|SEC31A_uc003hnh.2_Missense_Mutation_p.D570N|SEC31A_uc003hni.2_Missense_Mutation_p.D570N|SEC31A_uc003hnj.2_Missense_Mutation_p.D531N|SEC31A_uc011ccm.1_Missense_Mutation_p.D565N|SEC31A_uc011ccn.1_Missense_Mutation_p.D570N|SEC31A_uc003hnk.2_Missense_Mutation_p.D531N|SEC31A_uc003hnm.2_Missense_Mutation_p.D570N|SEC31A_uc003hnn.1_Missense_Mutation_p.D570N	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	570					COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				ATTAAACCATCAATGTCTGCA	0.343													20	19	---	---	---	---	PASS
PKD2	5311	broad.mit.edu	37	4	88973290	88973290	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88973290G>T	uc003hre.2	+	7	1762	c.1696G>T	c.(1696-1698)GTA>TTA	p.V566L	PKD2_uc011cdf.1_5'UTR|PKD2_uc011cdg.1_5'UTR|PKD2_uc011cdh.1_5'UTR	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2	566	Helical; (Potential).					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGCTGTCACAGTATTTTTTGT	0.308													47	45	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96761453	96761453	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761453C>A	uc003htr.3	+	1	215	c.152C>A	c.(151-153)ACT>AAT	p.T51N		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	51					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	CCCCCTGTCACTACAGTGCTC	0.478													17	22	---	---	---	---	PASS
DAPP1	27071	broad.mit.edu	37	4	100784938	100784938	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100784938A>G	uc003hvf.3	+	7	702	c.612A>G	c.(610-612)CCA>CCG	p.P204P	DAPP1_uc011cek.1_3'UTR|DAPP1_uc010ilh.2_Silent_p.P204P	NM_014395	NP_055210	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and	204	PH.				signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		CACCAGAACCAATTCGGATCC	0.323													9	6	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153244198	153244198	+	Silent	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153244198C>G	uc003ims.2	-	12	2108	c.1959G>C	c.(1957-1959)ACG>ACC	p.T653T	FBXW7_uc011cii.1_Silent_p.T653T|FBXW7_uc003imt.2_Silent_p.T653T|FBXW7_uc011cih.1_Silent_p.T477T|FBXW7_uc003imq.2_Silent_p.T573T|FBXW7_uc003imr.2_Silent_p.T535T	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	653	WD 7.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.T653fs*8(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TAAATTCACCCGTTTTCAAGT	0.463			Mis|N|D|F		colorectal|endometrial|T-ALL								53	67	---	---	---	---	PASS
FGG	2266	broad.mit.edu	37	4	155530895	155530895	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155530895T>A	uc003ioj.2	-	6	694	c.553A>T	c.(553-555)AAG>TAG	p.K185*	FGG_uc003iog.2_Nonsense_Mutation_p.K185*|FGG_uc003ioh.2_Nonsense_Mutation_p.K193*|FGG_uc010ipx.2_Nonsense_Mutation_p.K13*|FGG_uc010ipy.2_5'UTR|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Nonsense_Mutation_p.K193*	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	185	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTAGCTCCCTTATTGGCAATG	0.403													42	43	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162376272	162376272	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162376272G>T	uc003iqh.2	-	15	2161	c.1725C>A	c.(1723-1725)ACC>ACA	p.T575T	FSTL5_uc003iqi.2_Silent_p.T574T|FSTL5_uc010iqv.2_Silent_p.T565T	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	575						extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CACTGGCCAGGGTAATTACCT	0.408													24	20	---	---	---	---	PASS
SPOCK3	50859	broad.mit.edu	37	4	167833857	167833857	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167833857C>A	uc003iri.1	-	6	538	c.397G>T	c.(397-399)GGT>TGT	p.G133C	SPOCK3_uc011cjp.1_Missense_Mutation_p.G130C|SPOCK3_uc011cjq.1_Missense_Mutation_p.G142C|SPOCK3_uc011cjr.1_Missense_Mutation_p.G13C|SPOCK3_uc003irj.1_Missense_Mutation_p.G130C|SPOCK3_uc011cjs.1_Missense_Mutation_p.G82C|SPOCK3_uc011cjt.1_Missense_Mutation_p.G41C|SPOCK3_uc011cju.1_Missense_Mutation_p.G26C|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Missense_Mutation_p.G130C|SPOCK3_uc011cjw.1_Intron	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	133	Kazal-like.				signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AATATGGGACCCCTCCACTGC	0.398													23	38	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189012776	189012776	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189012776G>C	uc003izl.2	-	7	951	c.915C>G	c.(913-915)TTC>TTG	p.F305L	TRIML2_uc003izj.1_Missense_Mutation_p.F133L|TRIML2_uc003izk.1_Missense_Mutation_p.F113L|TRIML2_uc011cle.1_Missense_Mutation_p.F380L	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	305	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TCAGAGGGGGGAAGACCCAGA	0.562													94	102	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189012862	189012862	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189012862C>T	uc003izl.2	-	7	865	c.829G>A	c.(829-831)GCG>ACG	p.A277T	TRIML2_uc003izj.1_Missense_Mutation_p.A105T|TRIML2_uc003izk.1_Missense_Mutation_p.A85T|TRIML2_uc011cle.1_Missense_Mutation_p.A352T	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	277	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CTGCCCTTCGCGTCTGCAGAG	0.617													89	118	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	231090	231090	+	Silent	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:231090A>C	uc003jao.3	+	7	985	c.870A>C	c.(868-870)CTA>CTC	p.L290L	SDHA_uc003jan.2_Silent_p.L290L|SDHA_uc011clv.1_Silent_p.L290L|SDHA_uc011clw.1_Silent_p.L242L|SDHA_uc003jap.3_Silent_p.L290L|SDHA_uc003jaq.3_Silent_p.L65L|SDHA_uc003jar.3_5'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	290					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GCCAGGACCTAGAGTTTGTTC	0.592									Familial_Paragangliomas				3	81	---	---	---	---	PASS
EXOC3	11336	broad.mit.edu	37	5	453949	453949	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:453949C>T	uc003jba.2	+	4	957	c.829C>T	c.(829-831)CGC>TGC	p.R277C		NM_007277	NP_009208	O60645	EXOC3_HUMAN	Sec6 protein	288					exocytosis|protein transport						0		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GTGGCTTGTCCGCCACCTGGA	0.473													5	41	---	---	---	---	PASS
SLC12A7	10723	broad.mit.edu	37	5	1084028	1084028	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1084028C>G	uc003jbu.2	-	8	1027	c.961G>C	c.(961-963)GAT>CAT	p.D321H		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	321					potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	ACGCAGGCATCGAAGCTGCGC	0.672													17	52	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5462757	5462757	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5462757G>T	uc003jdm.3	+	13	3532	c.3310G>T	c.(3310-3312)GGA>TGA	p.G1104*		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1104										ovary(1)|central_nervous_system(1)	2						TCGAGAGGGGGGAGACGACAC	0.478													20	54	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10405769	10405769	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10405769C>T	uc003jet.1	+	16	1615	c.1432C>T	c.(1432-1434)CGA>TGA	p.R478*	MARCH6_uc011cmu.1_Nonsense_Mutation_p.R430*|MARCH6_uc003jeu.1_Nonsense_Mutation_p.R176*|MARCH6_uc011cmv.1_Nonsense_Mutation_p.R373*	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	478	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						TAGGCATCTCCGAAGATTTAT	0.338													46	84	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24492935	24492935	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24492935C>A	uc003jgr.1	-	10	1947	c.1615G>T	c.(1615-1617)GAT>TAT	p.D539Y	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	539	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		CCTTCATTATCCTGTACTGTG	0.338										HNSCC(23;0.051)			56	149	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24593447	24593447	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24593447A>G	uc003jgr.1	-	2	485	c.153T>C	c.(151-153)CGT>CGC	p.R51R	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	51					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		CACGTTTTTGACGATGGAGAA	0.393										HNSCC(23;0.051)			60	135	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31317884	31317884	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31317884A>T	uc003jhe.1	+	11	2061	c.1735A>T	c.(1735-1737)AGC>TGC	p.S579C	CDH6_uc003jhd.1_Missense_Mutation_p.S579C	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	579	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CCCAGTTCAAAGCAGCACTGG	0.542													20	51	---	---	---	---	PASS
ZFR	51663	broad.mit.edu	37	5	32390512	32390512	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32390512T>C	uc003jhr.1	-	12	2091	c.2011A>G	c.(2011-2013)ATG>GTG	p.M671V	ZFR_uc011cny.1_5'Flank	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	671					multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		TCTTCCTCCATTCTCCTCCAG	0.463													40	73	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33624345	33624345	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33624345C>G	uc003jia.1	-	14	2297	c.2134G>C	c.(2134-2136)GAA>CAA	p.E712Q	ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	712	Spacer 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CCAGATCCTTCCTTCTGCTTA	0.448										HNSCC(64;0.19)			35	81	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33637810	33637810	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33637810C>A	uc003jia.1	-	12	1923	c.1760G>T	c.(1759-1761)CGC>CTC	p.R587L	ADAMTS12_uc010iuq.1_Missense_Mutation_p.R587L	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	587	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CAAGCGATAGCGTTTTCTTTC	0.458										HNSCC(64;0.19)			25	62	---	---	---	---	PASS
AMACR	23600	broad.mit.edu	37	5	34005954	34005954	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34005954G>T	uc003jig.2	-	2	380	c.298C>A	c.(298-300)CCA>ACA	p.P100T	AMACR_uc003jih.2_Missense_Mutation_p.P100T|AMACR_uc003jii.2_Missense_Mutation_p.P100T|AMACR_uc003jij.2_Missense_Mutation_p.P100T|AMACR_uc003jil.1_Missense_Mutation_p.P100T|AMACR_uc003jik.1_Missense_Mutation_p.P100T	NM_014324	NP_055139	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase isoform 1	100					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	mitochondrion|peroxisomal matrix	alpha-methylacyl-CoA racemase activity				0						ATAAGCCTTGGATTTTCCCGC	0.463													17	97	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41004890	41004890	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41004890C>G	uc003jmj.3	-	36	4487	c.3997G>C	c.(3997-3999)GGG>CGG	p.G1333R	HEATR7B2_uc003jmi.3_Missense_Mutation_p.G888R	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1333							binding			ovary(6)|central_nervous_system(2)	8						TGAGGAGCCCCGGATGCTGTG	0.473													24	56	---	---	---	---	PASS
IL31RA	133396	broad.mit.edu	37	5	55185892	55185892	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55185892G>T	uc003jql.2	+	6	766	c.701G>T	c.(700-702)CGA>CTA	p.R234L	IL31RA_uc003jqk.2_Missense_Mutation_p.R234L|IL31RA_uc011cqj.1_Missense_Mutation_p.R92L|IL31RA_uc003jqm.2_Missense_Mutation_p.R202L|IL31RA_uc003jqn.2_Missense_Mutation_p.R234L|IL31RA_uc010iwa.1_Missense_Mutation_p.R202L|IL31RA_uc003jqo.2_Missense_Mutation_p.R92L	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	202	Extracellular (Potential).|Fibronectin type-III 2.				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				ATAGCTCTGCGATGTGCGGTC	0.478													33	75	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75594629	75594629	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75594629G>T	uc003kei.1	+	10	1647	c.1513G>T	c.(1513-1515)GTC>TTC	p.V505F		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	505	Extracellular (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		ATTCATAGGGGTCAAGTTCAA	0.368													48	137	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90087132	90087132	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90087132A>G	uc003kju.2	+	70	14582	c.14486A>G	c.(14485-14487)TAT>TGT	p.Y4829C	GPR98_uc003kjt.2_Missense_Mutation_p.Y2535C|GPR98_uc003kjw.2_Missense_Mutation_p.Y490C	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4829	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGTGCCACATATAAAGTGGAC	0.453													8	12	---	---	---	---	PASS
ANKRD32	84250	broad.mit.edu	37	5	94024292	94024292	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94024292C>T	uc003kkr.3	+	17	2283	c.2203C>T	c.(2203-2205)CGG>TGG	p.R735W	ANKRD32_uc003kks.2_Missense_Mutation_p.R99W	NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	735										ovary(2)	2		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		AATAGGACAGCGGCCTTGTTT	0.408													51	99	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109103254	109103254	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109103254G>T	uc003kou.1	+	6	1817	c.854G>T	c.(853-855)GGC>GTC	p.G285V		NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	285	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		CCTCGGTCCGGCTGGGCTATT	0.383													60	110	---	---	---	---	PASS
ALDH7A1	501	broad.mit.edu	37	5	125894941	125894941	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125894941C>T	uc003ktx.2	-	11	1191	c.999G>A	c.(997-999)GCG>GCA	p.A333A	ALDH7A1_uc003ktv.2_5'UTR|ALDH7A1_uc003kty.2_RNA|ALDH7A1_uc011cxa.1_Silent_p.A360A	NM_001182	NP_001173	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	333					cellular aldehyde metabolic process|lysine catabolic process|sensory perception of sound	cytosol|mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity|betaine-aldehyde dehydrogenase activity|L-aminoadipate-semialdehyde dehydrogenase activity			kidney(2)|ovary(1)	3		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)	NADH(DB00157)|Pyridoxine(DB00165)	CCAGTCGCCTCGCAGTGGTAC	0.478													23	63	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127713574	127713574	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127713574G>A	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCAATATCTAGGAAGATTGAG	0.353													66	139	---	---	---	---	PASS
ISOC1	51015	broad.mit.edu	37	5	128442721	128442721	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128442721C>G	uc003kva.2	+	4	734	c.716C>G	c.(715-717)TCA>TGA	p.S239*		NM_016048	NP_057132	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	239						peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		GCCACCTCATCAAGAAGCATG	0.448													30	80	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128844853	128844853	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128844853T>A	uc003kvb.1	+	3	813	c.813T>A	c.(811-813)CGT>CGA	p.R271R	ADAMTS19_uc003kvc.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	271					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ACCCACACCGTGTATATAGGC	0.413													43	60	---	---	---	---	PASS
CHSY3	337876	broad.mit.edu	37	5	129243813	129243813	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129243813G>T	uc003kvd.2	+	2	846	c.846G>T	c.(844-846)AAG>AAT	p.K282N		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	282	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ACAGCAGTAAGCCTCTCTACC	0.433													29	68	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131915105	131915105	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131915105C>T	uc003kxi.2	+	4	849	c.462C>T	c.(460-462)GTC>GTT	p.V154V	RAD50_uc003kxg.1_Silent_p.V55V|RAD50_uc003kxh.2_Silent_p.V15V	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	154					DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAAATAATGTCATTTTCTGTC	0.398								Homologous_recombination					38	86	---	---	---	---	PASS
TXNDC15	79770	broad.mit.edu	37	5	134232099	134232099	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134232099A>T	uc003lac.1	+	4	1529	c.871A>T	c.(871-873)ATT>TTT	p.I291F	TXNDC15_uc010jdy.1_RNA|TXNDC15_uc011cxv.1_RNA	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor	291	Extracellular (Potential).|Thioredoxin.				cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAAAATCTTCATTTTTAATCA	0.393													64	144	---	---	---	---	PASS
TRPC7	57113	broad.mit.edu	37	5	135583364	135583364	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135583364C>A	uc003lbn.1	-	6	1639	c.1636G>T	c.(1636-1638)GCC>TCC	p.A546S	TRPC7_uc010jef.1_Missense_Mutation_p.A483S|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.A477S|TRPC7_uc010jei.1_Missense_Mutation_p.A422S|TRPC7_uc010jej.1_Missense_Mutation_p.A98S	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	547	Helical; (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGCACGACGGCTATCGCGTAG	0.517													51	98	---	---	---	---	PASS
TRPC7	57113	broad.mit.edu	37	5	135651309	135651309	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135651309G>T	uc003lbn.1	-	2	939	c.936C>A	c.(934-936)CTC>CTA	p.L312L	TRPC7_uc010jef.1_Silent_p.L304L|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	313	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ATTTAATGGCGAGTTTGATCC	0.512													9	43	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137506041	137506041	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137506041T>C	uc003lcf.1	-	7	553	c.498A>G	c.(496-498)GCA>GCG	p.A166A	BRD8_uc003lcc.1_RNA|BRD8_uc003lcg.2_Silent_p.A166A|BRD8_uc003lci.2_Silent_p.A166A|BRD8_uc003lch.2_Silent_p.A26A|BRD8_uc011cym.1_Silent_p.A150A|BRD8_uc010jer.1_Silent_p.A135A|BRD8_uc011cyn.1_Silent_p.A125A|BRD8_uc010jes.1_Silent_p.A33A	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	166	Potential.				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TACCCTGGTATGCAGCATCTG	0.418													61	95	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140207706	140207706	+	Silent	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140207706A>T	uc003lho.2	+	1	57	c.30A>T	c.(28-30)GGA>GGT	p.G10G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Silent_p.G10G|PCDHA6_uc011dab.1_Silent_p.G10G	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	10					homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATAGATTGGGAAAGCAATGTC	0.512													68	136	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140308655	140308655	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140308655G>T	uc003lih.2	+	1	2354	c.2178G>T	c.(2176-2178)AGG>AGT	p.R726S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.R726S	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	726	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGATCTGAGGTATGGAAGTA	0.473													43	93	---	---	---	---	PASS
PCDHB1	29930	broad.mit.edu	37	5	140432759	140432759	+	Missense_Mutation	SNP	C	G	G	rs137984585	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140432759C>G	uc003lik.1	+	1	1781	c.1704C>G	c.(1702-1704)AAC>AAG	p.N568K		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	568	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACTGCAGAACGGCACCTTGC	0.522													69	127	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140474456	140474456	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140474456G>T	uc003lil.2	+	1	220	c.82G>T	c.(82-84)GCT>TCT	p.A28S	PCDHB2_uc003lim.1_Intron	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	28					calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATAGCTCAGGCTAGTTGCCA	0.527													21	93	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140501785	140501785	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140501785G>T	uc003lip.1	+	1	205	c.205G>T	c.(205-207)GAT>TAT	p.D69Y		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	69	Cadherin 1.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGTCTGACGATGACAAGCA	0.572													29	84	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140532060	140532060	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140532060G>T	uc003lir.2	+	1	2222	c.2222G>T	c.(2221-2223)GGG>GTG	p.G741V	PCDHB6_uc011dah.1_Missense_Mutation_p.G605V	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	741	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCGGCACCGGGACCCTATCC	0.612													89	182	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554197	140554197	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554197G>T	uc003lit.2	+	1	1955	c.1781G>T	c.(1780-1782)GGC>GTC	p.G594V		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	594	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGTGGACGGCGACTCGGGC	0.711													35	108	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559816	140559816	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559816C>T	uc011dai.1	+	1	2387	c.2201C>T	c.(2200-2202)CCA>CTA	p.P734L	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	734	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCCCTTTCCAGGGCATCTG	0.632													75	151	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140563670	140563670	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140563670C>T	uc003liv.2	+	1	2691	c.1536C>T	c.(1534-1536)CAC>CAT	p.H512H		NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	512	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAACGGCCACCTGTTCGCCC	0.692													5	104	---	---	---	---	PASS
PCDHB9	56127	broad.mit.edu	37	5	140568859	140568859	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140568859C>A	uc003liw.1	+	3	1968	c.1968C>A	c.(1966-1968)GCC>GCA	p.A656A		NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	protocadherin beta 9 precursor	656	Extracellular (Potential).|Cadherin 6.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGCCACCGCCACGCTGCACG	0.706													29	77	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140573661	140573661	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140573661C>T	uc003lix.2	+	1	1710	c.1536C>T	c.(1534-1536)CAC>CAT	p.H512H		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	512	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAACGGCCACCTGTTCGCCC	0.701													58	220	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140603986	140603986	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140603986G>C	uc003ljb.2	+	1	909	c.909G>C	c.(907-909)TTG>TTC	p.L303F	PCDHB14_uc011dal.1_Missense_Mutation_p.L150F	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	303	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGTTAATTTGAGATCACCCC	0.353													34	85	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140767870	140767870	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140767870T>A	uc003lkc.1	+	1	419	c.419T>A	c.(418-420)CTG>CAG	p.L140Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.L140Q	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	140	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTTTGAGCTGCAAATAAGT	0.438													38	51	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140768532	140768532	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140768532G>A	uc003lkc.1	+	1	1081	c.1081G>A	c.(1081-1083)GGA>AGA	p.G361R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.G361R	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	361	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCGAGCTGGGAACACATAT	0.428													35	78	---	---	---	---	PASS
CCDC69	26112	broad.mit.edu	37	5	150578600	150578600	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150578600G>A	uc003ltq.2	-	4	400	c.277C>T	c.(277-279)CAG>TAG	p.Q93*	CCDC69_uc010jhu.2_5'UTR|CCDC69_uc011dcq.1_RNA	NM_015621	NP_056436	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	93	Potential.									ovary(2)	2		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCCTTTGCTGCTCATCCAGT	0.577													73	152	---	---	---	---	PASS
HAVCR1	26762	broad.mit.edu	37	5	156479625	156479625	+	Silent	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156479625G>C	uc010jij.1	-	4	605	c.420C>G	c.(418-420)ACC>ACG	p.T140T	HAVCR1_uc011ddl.1_5'UTR|HAVCR1_uc003lwi.2_Silent_p.T140T|HAVCR1_uc011ddm.1_Silent_p.T140T	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	140	Extracellular (Potential).|11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.|1.				interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAGTCGTGACGGTTGGAACAG	0.468													103	269	---	---	---	---	PASS
KCNIP1	30820	broad.mit.edu	37	5	170148890	170148890	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170148890G>A	uc003mas.2	+	5	872	c.343G>A	c.(343-345)GGC>AGC	p.G115S	KCNIP1_uc003map.2_Missense_Mutation_p.G113S|KCNIP1_uc003mat.2_Missense_Mutation_p.G104S|KCNIP1_uc010jjp.2_Missense_Mutation_p.G76S|KCNIP1_uc010jjq.2_Missense_Mutation_p.G129S	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1	115	EF-hand 2.				detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACTCAGACAGGCTCCGTGAA	0.552													44	89	---	---	---	---	PASS
DOK3	79930	broad.mit.edu	37	5	176931438	176931438	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176931438C>A	uc003mhk.2	-	6	1042	c.1037G>T	c.(1036-1038)GGA>GTA	p.G346V	DOK3_uc003mhh.3_Intron|DOK3_uc003mhi.3_Intron|DOK3_uc003mhj.3_Intron|DOK3_uc003mhl.2_Missense_Mutation_p.G290V	NM_024872	NP_079148	Q7L591	DOK3_HUMAN	docking protein 3 isoform 1	346	Pro-rich.					cytoplasm|plasma membrane	insulin receptor binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TGGCTCAGGTCCTGGTGGCAT	0.711													18	28	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178413315	178413315	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178413315G>T	uc003mjr.2	-	8	2119	c.1940C>A	c.(1939-1941)GCC>GAC	p.A647D	GRM6_uc003mjq.2_5'Flank|GRM6_uc010jla.1_Missense_Mutation_p.A230D|GRM6_uc003mjs.1_Missense_Mutation_p.A267D	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	647	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		ACAGACCGCGGCCCCAGGCTC	0.647													13	25	---	---	---	---	PASS
SYCP2L	221711	broad.mit.edu	37	6	10961551	10961551	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10961551G>C	uc003mzo.2	+	27	2565	c.2269G>C	c.(2269-2271)GAG>CAG	p.E757Q	SYCP2L_uc010jow.2_Missense_Mutation_p.E377Q	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	757						nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CAATAAACTAGAGCGCTTTCA	0.378													22	37	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12124109	12124109	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12124109C>T	uc003nac.2	+	4	4260	c.4081C>T	c.(4081-4083)CGG>TGG	p.R1361W	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1361					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TGGATGTCACCGGGAAATGAG	0.433													15	54	---	---	---	---	PASS
PRSS16	10279	broad.mit.edu	37	6	27215751	27215751	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27215751C>A	uc003nja.2	+	2	173	c.161C>A	c.(160-162)GCA>GAA	p.A54E	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Missense_Mutation_p.A54E|PRSS16_uc010jqq.1_5'Flank|PRSS16_uc010jqr.1_5'Flank|PRSS16_uc003njc.1_5'Flank	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	54					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						CCAGGTGCTGCAGCCCTCCCA	0.642													38	46	---	---	---	---	PASS
HIST1H2AK	8330	broad.mit.edu	37	6	27805777	27805777	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27805777G>A	uc003njs.2	-	1	341	c.341C>T	c.(340-342)GCC>GTC	p.A114V	HIST1H2BN_uc003njt.1_5'Flank|HIST1H2BN_uc003nju.1_5'Flank|HIST1H2BN_uc003njv.2_5'Flank	NM_003510	NP_003501	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	114					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			upper_aerodigestive_tract(1)	1						CAGCAGCACGGCCTGGATATT	0.577													75	68	---	---	---	---	PASS
HIST1H4L	8368	broad.mit.edu	37	6	27841217	27841217	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27841217G>A	uc003njz.2	-	1	73	c.72C>T	c.(70-72)CGC>CGT	p.R24R	HIST1H3I_uc003njy.2_5'Flank	NM_003546	NP_003537	P62805	H4_HUMAN	histone cluster 1, H4l	24					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)|breast(1)	2						GAATGTTGTCGCGCAGAACTT	0.483													24	47	---	---	---	---	PASS
TRIM10	10107	broad.mit.edu	37	6	30121868	30121868	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30121868C>A	uc003npo.3	-	7	1400	c.1324G>T	c.(1324-1326)GTG>TTG	p.V442L	TRIM10_uc003npn.2_Intron	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	442	B30.2/SPRY.					cytoplasm	zinc ion binding				0						GTGAAGGTCACCCAGCCCACC	0.617													16	39	---	---	---	---	PASS
TRIM26	7726	broad.mit.edu	37	6	30166844	30166844	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30166844C>T	uc003npr.2	-	3	246	c.37G>A	c.(37-39)GAG>AAG	p.E13K	TRIM26_uc003nps.2_Missense_Mutation_p.E13K|TRIM26_uc010jry.2_5'UTR|TRIM26_uc003npt.2_Missense_Mutation_p.E13K|TRIM26_uc003npu.1_Missense_Mutation_p.E13K	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	13							DNA binding|zinc ion binding			ovary(2)|lung(1)	3						CAGGTCACCTCCTCTTCCAGG	0.587													14	25	---	---	---	---	PASS
GTF2H4	2968	broad.mit.edu	37	6	30879926	30879926	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30879926G>T	uc003nsa.1	+						GTF2H4_uc003nsb.1_Intron|GTF2H4_uc011dmw.1_Intron|VARS2_uc003nsc.1_5'Flank|VARS2_uc003nsd.2_5'Flank|VARS2_uc011dmx.1_5'Flank|VARS2_uc011dmy.1_5'Flank|VARS2_uc011dmz.1_5'Flank|VARS2_uc011dna.1_5'Flank|VARS2_uc011dnb.1_5'Flank|VARS2_uc011dnc.1_5'Flank	NM_001517	NP_001508	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4,						mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3						CTACACGGGTGAGGCGGGACA	0.537								NER					17	54	---	---	---	---	PASS
HLA-C	3107	broad.mit.edu	37	6	31237171	31237171	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237171G>C	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						GCCTGGGGTAGAACAAAAAAA	0.562													21	39	---	---	---	---	PASS
BAT1	7919	broad.mit.edu	37	6	31498659	31498659	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31498659T>A	uc003ntt.2	-	10	1798	c.1167A>T	c.(1165-1167)ACA>ACT	p.T389T	BAT1_uc003ntq.2_Silent_p.T122T|BAT1_uc003ntr.2_Silent_p.T196T|BAT1_uc003nts.2_Missense_Mutation_p.H397L|BAT1_uc011dnn.1_Silent_p.T311T|BAT1_uc003ntu.2_Silent_p.T389T|BAT1_uc003ntv.2_Silent_p.T389T	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1	389	Helicase C-terminal.				intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						CGGACACAAATGTGATAGCCA	0.527													22	42	---	---	---	---	PASS
DDAH2	23564	broad.mit.edu	37	6	31695071	31695071	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31695071C>T	uc003nwp.2	-	6	1432	c.801G>A	c.(799-801)AAG>AAA	p.K267K	DDAH2_uc003nwq.2_Silent_p.K267K	NM_013974	NP_039268	O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	267					anti-apoptosis|arginine catabolic process|citrulline metabolic process|nitric oxide biosynthetic process|nitric oxide mediated signal transduction	cytoplasm	dimethylargininase activity|protein binding				0					L-Citrulline(DB00155)	CGGCGCCAGCCTTCTCCAGTT	0.622													72	106	---	---	---	---	PASS
CYP21A2	1589	broad.mit.edu	37	6	32007589	32007589	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32007589G>C	uc003nze.1	+	6	833	c.715G>C	c.(715-717)GAG>CAG	p.E239Q	CYP21A2_uc003nzf.1_Missense_Mutation_p.E209Q	NM_000500	NP_000491	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A,	238					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						TCACATCGTGGAGATGCAGCT	0.607													9	28	---	---	---	---	PASS
PPARD	5467	broad.mit.edu	37	6	35392307	35392307	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35392307G>C	uc003okm.2	+	7	1138	c.829G>C	c.(829-831)GAC>CAC	p.D277H	PPARD_uc003okl.2_Missense_Mutation_p.D277H|PPARD_uc003okn.2_Missense_Mutation_p.D277H|PPARD_uc011dtb.1_Missense_Mutation_p.D238H|PPARD_uc011dtc.1_Missense_Mutation_p.D179H	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,	277	Ligand-binding.				apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	CTTCCTCAACGACCAGGTTAC	0.602													6	40	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43414987	43414987	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43414987G>T	uc003ouy.1	+	17	3761	c.3546G>T	c.(3544-3546)GGG>GGT	p.G1182G	ABCC10_uc003ouz.1_Silent_p.G1154G|ABCC10_uc010jyo.1_Silent_p.G288G	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	1182	ABC transmembrane type-1 2.|Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTCCCCCAGGGCTGGTGGGCT	0.617													42	165	---	---	---	---	PASS
AARS2	57505	broad.mit.edu	37	6	44273518	44273518	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44273518C>T	uc010jza.1	-	10	1309	c.1306G>A	c.(1306-1308)GTG>ATG	p.V436M	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	436					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)	GACCAGGCCACTTCAGCTTTG	0.522													79	137	---	---	---	---	PASS
CYP39A1	51302	broad.mit.edu	37	6	46609894	46609894	+	Intron	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46609894C>G	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						TGAAAATATTCTTTACCTGTA	0.333													13	51	---	---	---	---	PASS
CRISP3	10321	broad.mit.edu	37	6	49701449	49701449	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49701449C>A	uc003ozs.2	-	5	405	c.390G>T	c.(388-390)AAG>AAT	p.K130N		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor	130				K -> R (in Ref. 4; BAD97100).	innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			CGTTGGGAGTCTTTGGCCCTA	0.403													24	116	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524709	51524709	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524709G>T	uc003pah.1	-	61	10491	c.10215C>A	c.(10213-10215)TGC>TGA	p.C3405*		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3405	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CAGTCTGTTTGCAGATGAATC	0.353													25	47	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51934244	51934244	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51934244G>T	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CTTGGTGAAGGGGGATAGTAC	0.478													24	93	---	---	---	---	PASS
IL17A	3605	broad.mit.edu	37	6	52054093	52054093	+	3'UTR	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52054093G>A	uc003pak.1	+	3						NM_002190	NP_002181	Q16552	IL17_HUMAN	interleukin 17A precursor						apoptosis|cell-cell signaling|fibroblast activation|immune response|inflammatory response|positive regulation of interleukin-23 production|positive regulation of osteoclast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein glycosylation	extracellular space	cytokine activity				0	Lung NSC(77;0.116)					TGGCCTAAGAGCTCTGGGGAG	0.587													26	46	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56484784	56484784	+	Intron	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56484784T>A	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Missense_Mutation_p.T1350S	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGGAGACCCGTTACTGCCCTG	0.428													44	124	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70877932	70877932	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70877932G>C	uc003pfc.1	+	38	2578	c.2461G>C	c.(2461-2463)GAA>CAA	p.E821Q		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	821				GIPFNERN -> VSCSRLKI (in Ref. 6; AAA36358).	cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						TCCATTTAATGAACGAAACGG	0.239													36	63	---	---	---	---	PASS
MANEA	79694	broad.mit.edu	37	6	96053844	96053844	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96053844G>T	uc003poo.1	+	5	1092	c.952G>T	c.(952-954)GAT>TAT	p.D318Y		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	318	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AAGTGGTTTTGATGGAATTTA	0.348													10	82	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99283327	99283327	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99283327C>A	uc003ppe.2	+	1	748	c.578C>A	c.(577-579)CCC>CAC	p.P193H		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	193					positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		TACTCGCAGCCCAGCTTCACG	0.736													5	5	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109871492	109871492	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109871492A>G	uc003ptn.2	-	25	2842	c.2765T>C	c.(2764-2766)ATG>ACG	p.M922T	AKD1_uc011eat.1_Missense_Mutation_p.M1T	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	922					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						TCTCTCCTTCATTTTATCTTC	0.358													22	94	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117241612	117241612	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117241612C>T	uc003pxm.2	+	12	1385	c.1322C>T	c.(1321-1323)ACT>ATT	p.T441I		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	441					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						GGTATCTACACTGAACGTAAG	0.269													47	89	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123600211	123600211	+	Silent	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123600211A>T	uc003pzj.1	-	25	1549	c.1527T>A	c.(1525-1527)CCT>CCA	p.P509P	TRDN_uc010kem.1_Silent_p.P10P	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	509	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		GTGGAGGTTTAGGCTTGACTT	0.244													39	34	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127768025	127768025	+	3'UTR	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127768025G>T	uc003qbd.2	-	11					C6orf174_uc003qbc.2_Missense_Mutation_p.T480N|C6orf174_uc003qba.2_Missense_Mutation_p.L46I|C6orf174_uc003qbb.2_Missense_Mutation_p.T363N|KIAA0408_uc011ebs.1_Missense_Mutation_p.T480N	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		ACCTGTGTGAGTAGATGAGGT	0.438													44	63	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129641672	129641672	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129641672G>T	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTACATTCTCGCTGTTTCTAG	0.388													4	63	---	---	---	---	PASS
AKAP7	9465	broad.mit.edu	37	6	131481208	131481208	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131481208A>T	uc003qck.2	+	3	194	c.161A>T	c.(160-162)GAA>GTA	p.E54V	AKAP7_uc011ebz.1_Missense_Mutation_p.E32V	NM_016377	NP_057461	O43687	AKA7A_HUMAN	A-kinase anchor protein 7 isoform gamma	Error:Variant_position_missing_in_O43687_after_alignment					intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding			ovary(2)	2	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		GTCACTGATGAACCTCAAATA	0.294													20	47	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144898392	144898392	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144898392A>G	uc003qkt.2	+	50	7539	c.7447A>G	c.(7447-7449)ATC>GTC	p.I2483V		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	2483	Spectrin 17.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCAGGATAGTATCTTGGCCAG	0.493													20	26	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155606408	155606408	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155606408G>A	uc003qqj.3	-	5	614	c.550C>T	c.(550-552)CTT>TTT	p.L184F	TFB1M_uc003qqk.2_Intron	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	184					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		TTGGCTGCAAGTCTCTAGAGA	0.408													5	26	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161022046	161022046	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161022046C>T	uc003qtl.2	-	20	3150	c.3030G>A	c.(3028-3030)GAG>GAA	p.E1010E		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3518	Kringle 31.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGTTGCAGTACTCCCACCTGA	0.488													37	58	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161071443	161071443	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161071443C>A	uc003qtl.2	-	3	256	c.136G>T	c.(136-138)GGA>TGA	p.G46*		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	2554	Kringle 23.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAGGTCCTTCCTGTGACAGTG	0.448													86	133	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4188935	4188935	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4188935G>T	uc003smx.2	+	30	4604	c.4465G>T	c.(4465-4467)GAA>TAA	p.E1489*	SDK1_uc010kso.2_Nonsense_Mutation_p.E765*|SDK1_uc003smy.2_5'UTR	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1489	Fibronectin type-III 9.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCCCCAGGCAGAAGTGACCGC	0.672													10	32	---	---	---	---	PASS
ETV1	2115	broad.mit.edu	37	7	13950876	13950876	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13950876T>A	uc011jxq.1	-	10	1598	c.859A>T	c.(859-861)AGC>TGC	p.S287C	ETV1_uc011jxn.1_Missense_Mutation_p.S247C|ETV1_uc011jxo.1_Missense_Mutation_p.S184C|ETV1_uc011jxp.1_Missense_Mutation_p.S229C|ETV1_uc003ssw.3_Intron|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Missense_Mutation_p.S269C|ETV1_uc011jxs.1_Missense_Mutation_p.S269C|ETV1_uc010ktv.2_Missense_Mutation_p.S156C	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	287				Missing (in Ref. 5; AAC62435).	transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						TCTGTTCTGCTGGGATGAGCC	0.398			T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								12	29	---	---	---	---	PASS
ETV1	2115	broad.mit.edu	37	7	13971314	13971314	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13971314C>T	uc011jxq.1	-	9	1354	c.615G>A	c.(613-615)AGG>AGA	p.R205R	ETV1_uc011jxn.1_Silent_p.R165R|ETV1_uc011jxo.1_Silent_p.R102R|ETV1_uc011jxp.1_Silent_p.R147R|ETV1_uc003ssw.3_Silent_p.R205R|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Silent_p.R187R|ETV1_uc011jxs.1_Silent_p.R187R|ETV1_uc010ktv.2_Silent_p.R74R	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	205					transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						GACGTCCTTCCCTTGGCATCG	0.502			T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								31	42	---	---	---	---	PASS
IGF2BP3	10643	broad.mit.edu	37	7	23391040	23391040	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23391040G>T	uc003swg.2	-	6	833	c.567C>A	c.(565-567)TCC>TCA	p.S189S		NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding	189					anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2						GTTTCTGCTTGGATACGGATC	0.582													31	66	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28527826	28527826	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28527826G>C	uc003szq.2	+	2	427	c.37G>C	c.(37-39)GAG>CAG	p.E13Q	CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Missense_Mutation_p.E6Q	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	13					positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						TTTGGAGCAGGAGAGGCCGTT	0.512													34	78	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30469038	30469038	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30469038G>T	uc003tav.2	-	13	3264	c.2741C>A	c.(2740-2742)GCC>GAC	p.A914D		NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	914	LRR 8.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						TGCCAGCTGGGCAGTCCCCTT	0.378													87	249	---	---	---	---	PASS
ADCYAP1R1	117	broad.mit.edu	37	7	31124405	31124405	+	Silent	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31124405C>G	uc003tca.1	+	8	715	c.492C>G	c.(490-492)TCC>TCG	p.S164S	ADCYAP1R1_uc003tcb.1_Silent_p.S143S|ADCYAP1R1_uc003tcc.1_Silent_p.S164S|ADCYAP1R1_uc003tcd.1_Silent_p.S164S|ADCYAP1R1_uc003tce.1_Silent_p.S164S|ADCYAP1R1_uc003tcf.1_5'Flank	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	164	Helical; Name=1; (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						ACAGCACATCCCTCGTCACCC	0.562													43	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38370157	38370157	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38370157A>C	uc010kxj.1	-	2	277	c.141T>G	c.(139-141)AAT>AAG	p.N47K	uc010kxk.1_RNA					SubName: Full=Putative uncharacterized protein ENSP00000374866;																		TGTAGACGGCATTTTCTACAG	0.502													27	84	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38794492	38794492	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38794492C>A	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						AAATGACACTCACTGAAATTT	0.343													16	31	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42116341	42116341	+	Intron	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42116341T>A	uc011kbh.1	-						GLI3_uc011kbg.1_Intron	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						AAGAAAGTGTTAATACTTACA	0.428									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				27	36	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43400557	43400557	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43400557C>A	uc003tid.1	+	6	1138	c.533C>A	c.(532-534)ACG>AAG	p.T178K	HECW1_uc011kbi.1_Missense_Mutation_p.T178K|HECW1_uc003tie.1_Missense_Mutation_p.T210K	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	178					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CCCAGTGTCACGGTCAAAAAC	0.428													34	77	---	---	---	---	PASS
NPC1L1	29881	broad.mit.edu	37	7	44576449	44576449	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44576449C>A	uc003tlb.2	-	3	1729	c.1673G>T	c.(1672-1674)GGG>GTG	p.G558V	NPC1L1_uc003tlc.2_Missense_Mutation_p.G558V|NPC1L1_uc011kbw.1_Missense_Mutation_p.G558V|NPC1L1_uc003tld.2_Missense_Mutation_p.G558V	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	558	Extracellular (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	ACCTTTGTACCCCCCAATGGC	0.607													27	77	---	---	---	---	PASS
CCT6A	908	broad.mit.edu	37	7	56127249	56127249	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56127249T>A	uc003trl.1	+	9	1145	c.981T>A	c.(979-981)GCT>GCA	p.A327A	PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Silent_p.A282A|CCT6A_uc011kcu.1_Silent_p.A296A|SNORA15_uc003trn.1_5'Flank	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform	327					'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGACTCTTGCTTGTGGTGGGG	0.388													35	67	---	---	---	---	PASS
CCL24	6369	broad.mit.edu	37	7	75442680	75442680	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75442680G>A	uc011kga.1	-	2	135	c.135C>T	c.(133-135)AAC>AAT	p.N45N		NM_002991	NP_002982	O00175	CCL24_HUMAN	small inducible cytokine A24 precursor	45					cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						TGACCACTCGGTTCTCAGGAA	0.557													24	77	---	---	---	---	PASS
STYXL1	51657	broad.mit.edu	37	7	75651307	75651307	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75651307T>C	uc003uej.3	-	4	342	c.169A>G	c.(169-171)AAT>GAT	p.N57D	STYXL1_uc011kgf.1_5'UTR|STYXL1_uc011kgg.1_5'UTR|STYXL1_uc003ueh.2_5'UTR|STYXL1_uc003uek.3_Intron|STYXL1_uc003uel.2_Missense_Mutation_p.N57D|STYXL1_uc003uem.2_Missense_Mutation_p.N57D|STYXL1_uc010ldg.1_RNA|STYXL1_uc010ldh.1_Missense_Mutation_p.N57D|STYXL1_uc003uen.1_Missense_Mutation_p.N57D	NM_016086	NP_057170	Q9Y6J8	STYL1_HUMAN	map kinase phosphatase-like protein MK-STYX	57	Rhodanese.				intracellular signal transduction|protein dephosphorylation	intracellular	protein binding|protein tyrosine/serine/threonine phosphatase activity				0						TATTCATTATTTTTCTTAAAA	0.468													39	56	---	---	---	---	PASS
GNAT3	346562	broad.mit.edu	37	7	80141170	80141170	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80141170C>T	uc011kgu.1	-	1	73	c.73G>A	c.(73-75)GAG>AAG	p.E25K	CD36_uc003uhc.2_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	25					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						TCAGCATCCTCCTGAAGCTTT	0.388													9	27	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86415633	86415633	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86415633C>T	uc003uid.2	+	3	1624	c.525C>T	c.(523-525)AGC>AGT	p.S175S	GRM3_uc010lef.2_Silent_p.S173S|GRM3_uc010leg.2_Silent_p.S47S|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	175	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	CATCCACCAGCGCCAAACTCA	0.552													76	149	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95499272	95499272	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95499272A>G	uc003uoc.3	+	6	780	c.503A>G	c.(502-504)AAG>AGG	p.K168R	DYNC1I1_uc003uod.3_Missense_Mutation_p.K151R|DYNC1I1_uc003uob.2_Missense_Mutation_p.K131R|DYNC1I1_uc003uoe.3_Missense_Mutation_p.K148R|DYNC1I1_uc010lfl.2_Missense_Mutation_p.K157R	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	168					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCCTACTCAAAGGAGACCCAG	0.438													50	77	---	---	---	---	PASS
C7orf51	222950	broad.mit.edu	37	7	100084641	100084641	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100084641G>T	uc003uvd.1	+	3	425	c.266G>T	c.(265-267)GGC>GTC	p.G89V	C7orf51_uc003uve.1_5'Flank	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN	hypothetical protein FLJ37538	89										skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACTCGGTGGGCAGCATGGAC	0.711													9	20	---	---	---	---	PASS
MOSPD3	64598	broad.mit.edu	37	7	100211278	100211278	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100211278C>T	uc003uvq.2	+	4	662	c.460C>T	c.(460-462)CCA>TCA	p.P154S	MOSPD3_uc003uvr.2_Missense_Mutation_p.P154S|MOSPD3_uc003uvs.2_Missense_Mutation_p.P154S|MOSPD3_uc003uvt.2_Missense_Mutation_p.P144S	NM_001040097	NP_001035186	O75425	MSPD3_HUMAN	motile sperm domain containing 3 isoform a	154						integral to membrane	structural molecule activity			ovary(2)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					AGCGCCTCGCCCAGGGCCTCC	0.622													26	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100608729	100608729	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100608729C>A	uc003uxl.1	+	7	2608	c.1808C>A	c.(1807-1809)GCC>GAC	p.A603D	uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_RNA					SubName: Full=Intestinal mucin; Flags: Fragment;																		CAACCCCCAGCCATCTGCCGC	0.602													16	55	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677337	100677337	+	Silent	SNP	T	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677337T>G	uc003uxp.1	+	3	2693	c.2640T>G	c.(2638-2640)TCT>TCG	p.S880S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	880	Extracellular (Potential).|12.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TGGCCACTTCTGCAATCAGCA	0.493													182	264	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102517978	102517978	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102517978C>T	uc003vaq.2	-	16	1998	c.1571G>A	c.(1570-1572)GGA>GAA	p.G524E	FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Missense_Mutation_p.G524E|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Missense_Mutation_p.G524E	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	524	LRR 12.										0						TACAATATATCCAATTCCTTG	0.318													51	86	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103137095	103137095	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103137095G>A	uc003vca.2	-	56	9231	c.9071C>T	c.(9070-9072)CCT>CTT	p.P3024L	RELN_uc010liz.2_Missense_Mutation_p.P3024L	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3024					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GATCACAAAAGGCTGCCACCA	0.478													31	92	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103194103	103194103	+	Intron	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103194103T>C	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTCTTAATACTTACGGTGCCC	0.373													14	44	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103194108	103194108	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103194108G>C	uc003vca.2	-	39	6128	c.5968C>G	c.(5968-5970)CCT>GCT	p.P1990A	RELN_uc010liz.2_Missense_Mutation_p.P1990A	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1990					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AATACTTACGGTGCCCCCTTT	0.378													16	45	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103205999	103205999	+	Splice_Site	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103205999C>A	uc003vca.2	-	34	5097	c.4937_splice	c.e34-1	p.G1646_splice	RELN_uc010liz.2_Splice_Site_p.G1646_splice	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CGAGGTTTTCCTGAAAAAAAA	0.363													17	22	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103322621	103322621	+	Missense_Mutation	SNP	G	A	A	rs144978163		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103322621G>A	uc003vca.2	-	11	1391	c.1231C>T	c.(1231-1233)CTT>TTT	p.L411F	RELN_uc010liz.2_Missense_Mutation_p.L411F	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	411					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCTGTGGAAAGATCTACATCC	0.433													7	147	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106523475	106523475	+	Intron	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106523475T>C	uc003vdv.3	+						PIK3CG_uc003vdu.2_Intron|PIK3CG_uc003vdw.2_Intron	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma						G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CATCCTTCTGTAGGAATGATC	0.478													135	244	---	---	---	---	PASS
PRKAR2B	5577	broad.mit.edu	37	7	106786783	106786783	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106786783T>C	uc003vdx.2	+	6	793	c.618T>C	c.(616-618)GAT>GAC	p.D206D		NM_002736	NP_002727	P31323	KAP3_HUMAN	cAMP-dependent protein kinase, regulatory	206	cAMP 1.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1						TGAAATGTGATGGTGTTGGAA	0.353													23	98	---	---	---	---	PASS
DLD	1738	broad.mit.edu	37	7	107545940	107545940	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107545940T>A	uc003vet.2	+	7	683	c.573T>A	c.(571-573)CCT>CCA	p.P191P	DLD_uc010ljm.1_RNA|DLD_uc011kmg.1_Intron|DLD_uc011kmh.1_Silent_p.P168P|DLD_uc011kmi.1_Silent_p.P92P	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor	191					branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	CTCCTTTTCCTGGAATCACGG	0.348													32	118	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111430512	111430512	+	Splice_Site	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111430512C>T	uc003vfx.2	-	31	3584	c.3315_splice	c.e31+1	p.Q1105_splice	DOCK4_uc011kmm.1_5'Flank|DOCK4_uc003vfw.2_Splice_Site_p.Q546_splice|DOCK4_uc003vfy.2_Splice_Site_p.Q1141_splice	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CTTCTGCCTACCTGTTTAAAG	0.468													17	32	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117432076	117432076	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117432076G>C	uc003vjf.2	-	4	1266	c.1174C>G	c.(1174-1176)CCA>GCA	p.P392A		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	392	Pro-rich.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTTGGATCTGGTGTTGAGCCA	0.542													61	158	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128494159	128494159	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128494159C>A	uc003vnz.3	+	40	6825	c.6616C>A	c.(6616-6618)CGG>AGG	p.R2206R	FLNC_uc003voa.3_Silent_p.R2173R	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2206	Intradomain insert.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GCGCGAGGTGCGGGTGGAGGA	0.692													34	24	---	---	---	---	PASS
TSPAN33	340348	broad.mit.edu	37	7	128802338	128802338	+	Silent	SNP	C	A	A	rs142963022		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128802338C>A	uc003vop.1	+	3	493	c.264C>A	c.(262-264)CGC>CGA	p.R88R		NM_178562	NP_848657	Q86UF1	TSN33_HUMAN	tetraspanin 33	88	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						GGTCCCTCCGCGAGAACATCT	0.627													19	34	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134890724	134890724	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134890724C>A	uc003vsp.2	-	5	743	c.681G>T	c.(679-681)TTG>TTT	p.L227F	WDR91_uc010lmq.2_5'UTR|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	227										breast(2)|ovary(1)|skin(1)	4						CATAAGGAGGCAATTTGTGTT	0.532													61	166	---	---	---	---	PASS
TRIM24	8805	broad.mit.edu	37	7	138258362	138258362	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138258362A>G	uc003vuc.2	+	12	2204	c.1989A>G	c.(1987-1989)TCA>TCG	p.S663S	TRIM24_uc003vub.2_Silent_p.S629S	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	663					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						CACCAAATTCATCAGTGCCAT	0.398													47	123	---	---	---	---	PASS
TMEM213	155006	broad.mit.edu	37	7	138487700	138487700	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138487700C>T	uc010lna.2	+	3	321	c.210C>T	c.(208-210)TAC>TAT	p.Y70Y	TMEM213_uc010lnb.2_Silent_p.Y69Y	NM_001085429	NP_001078898	A2RRL7	TM213_HUMAN	transmembrane protein 213	70	Extracellular (Potential).					integral to membrane					0						TGGACGAGTACGGCTGGATCG	0.622													25	40	---	---	---	---	PASS
TAS2R41	259287	broad.mit.edu	37	7	143175842	143175842	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143175842G>C	uc003wdc.1	+	1	877	c.877G>C	c.(877-879)GTG>CTG	p.V293L	uc003wda.2_Intron	NM_176883	NP_795364	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	293	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			pancreas(1)|skin(1)	2	Melanoma(164;0.15)					GCTTCGAAGCGTGTTCTCGCA	0.512													21	43	---	---	---	---	PASS
KRBA1	84626	broad.mit.edu	37	7	149420915	149420915	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149420915G>T	uc003wfz.2	+	8	1262	c.863G>T	c.(862-864)AGT>ATT	p.S288I	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'UTR	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	288										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGCATCCCAGTCCCTCAGGA	0.612													37	49	---	---	---	---	PASS
GIMAP6	474344	broad.mit.edu	37	7	150324891	150324891	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150324891C>A	uc003whn.2	-	3	1219	c.795G>T	c.(793-795)GAG>GAT	p.E265D	GIMAP6_uc003whm.2_Missense_Mutation_p.E185D	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	265							GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCAAGACTCCTCACCAGGCA	0.542													41	102	---	---	---	---	PASS
RBM33	155435	broad.mit.edu	37	7	155530995	155530995	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155530995G>T	uc010lqk.1	+	11	2003	c.1635G>T	c.(1633-1635)CAG>CAT	p.Q545H	RBM33_uc011kvv.1_Missense_Mutation_p.Q354H	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	545	Pro-rich.						nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ACTTTAGCCAGCCTGGGTCGG	0.612													26	69	---	---	---	---	PASS
MNX1	3110	broad.mit.edu	37	7	156798509	156798509	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156798509T>C	uc003wnd.1	-	3	1214	c.911A>G	c.(910-912)GAG>GGG	p.E304G	MNX1_uc003wmz.2_Intron|MNX1_uc003wna.2_Intron|MNX1_uc010lqq.1_Missense_Mutation_p.E97G|MNX1_uc003wnc.1_Missense_Mutation_p.E92G|MNX1_uc010lqr.1_RNA	NM_005515	NP_005506	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1 isoform 1	304					humoral immune response|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCCGCCTGCTCTTTGGCCTT	0.577									Currarino_syndrome				20	48	---	---	---	---	PASS
VIPR2	7434	broad.mit.edu	37	7	158851172	158851172	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158851172C>A	uc003woh.2	-	5	641	c.455G>T	c.(454-456)AGG>ATG	p.R152M	VIPR2_uc010lqx.2_RNA|VIPR2_uc010lqy.2_RNA	NM_003382	NP_003373	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	152	Cytoplasmic (Potential).				cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		TGCTCCTTACCTGAAGAGGCA	0.448													46	101	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10466396	10466396	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10466396G>A	uc003wtc.2	-	4	5441	c.5212C>T	c.(5212-5214)CCT>TCT	p.P1738S		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1738					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		TCCACTCCAGGCCCCTGGCTC	0.657													73	172	---	---	---	---	PASS
GATA4	2626	broad.mit.edu	37	8	11607694	11607694	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11607694G>A	uc003wuc.2	+	4	1412	c.858G>A	c.(856-858)GCG>GCA	p.A286A	GATA4_uc003wub.1_Silent_p.A80A|GATA4_uc011kxc.1_Silent_p.A287A	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4	286	GATA-type 2.				atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		GCCGCAATGCGGAGGGCGAGC	0.637													23	39	---	---	---	---	PASS
LPL	4023	broad.mit.edu	37	8	19811777	19811777	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19811777G>T	uc003wzk.3	+	5	1058	c.688G>T	c.(688-690)GTT>TTT	p.V230F		NM_000237	NP_000228	P06858	LIPL_HUMAN	lipoprotein lipase precursor	230					fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)	AGTTGGGCATGTTGACATTTA	0.453													50	112	---	---	---	---	PASS
PEBP4	157310	broad.mit.edu	37	8	22785087	22785087	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22785087C>A	uc003xcn.1	-							NM_144962	NP_659399	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		CCAAGCCTGCCCTGACTTACT	0.572													60	109	---	---	---	---	PASS
SLC25A37	51312	broad.mit.edu	37	8	23423751	23423751	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23423751C>T	uc003xdo.2	+	2	494	c.341C>T	c.(340-342)GCA>GTA	p.A114V	SLC25A37_uc003xdn.1_Missense_Mutation_p.A114V|SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	114	Solcar 1.|Helical; Name=2; (Potential).				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		ATCATGGGTGCAGGGCCGGCC	0.512													20	44	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25222158	25222158	+	Missense_Mutation	SNP	A	G	G	rs139275574	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25222158A>G	uc003xeg.2	+	30	3198	c.3061A>G	c.(3061-3063)ATA>GTA	p.I1021V	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.I735V|DOCK5_uc003xei.2_Missense_Mutation_p.I591V|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1021						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TCTCCGTGCTATAAATCAGTT	0.408													3	17	---	---	---	---	PASS
RBPMS	11030	broad.mit.edu	37	8	30407060	30407060	+	Intron	SNP	C	A	A	rs143076913		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30407060C>A	uc003xic.1	+						RBPMS_uc003xid.1_Missense_Mutation_p.A191D|RBPMS_uc003xie.1_Intron|RBPMS_uc003xif.1_Intron	NM_006867	NP_006858	Q93062	RBPMS_HUMAN	RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)		CCCTTGAGCGCTCCGTCTCCT	0.537													43	115	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32505483	32505483	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505483G>T	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Missense_Mutation_p.A83S|NRG1_uc010lvt.2_Missense_Mutation_p.A83S	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCCCATCCTGGCTTGCCTGGT	0.577													65	126	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35401985	35401985	+	Intron	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35401985A>T	uc003xjr.1	+						UNC5D_uc003xjs.1_Missense_Mutation_p.K7I	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GTGTTAGTTAAAGCTCTCAGT	0.408													28	52	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39468231	39468231	+	Intron	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39468231T>C	uc003xni.2	+						ADAM18_uc003xnh.2_Silent_p.T176T|ADAM18_uc010lww.2_Intron|ADAM18_uc010lwx.2_Intron	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18						cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CACAGGTGACTGTCATCATTC	0.328													4	83	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43147760	43147760	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43147760G>T	uc003xpz.1	+	1	176	c.133G>T	c.(133-135)GCT>TCT	p.A45S	POTEA_uc003xqa.1_Missense_Mutation_p.A45S	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	45										ovary(1)	1						CAACATGGGTGCTTGGAGAGA	0.597													42	85	---	---	---	---	PASS
MYBL1	4603	broad.mit.edu	37	8	67509581	67509581	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67509581T>C	uc003xwj.2	-	5	903	c.496A>G	c.(496-498)AAA>GAA	p.K166E	MYBL1_uc003xwl.2_Missense_Mutation_p.K166E|MYBL1_uc003xwk.2_Missense_Mutation_p.K166E	NM_001080416	NP_001073885	P10243	MYBA_HUMAN	v-myb myeloblastosis viral oncogene homolog	166	HTH myb-type 3.|H-T-H motif (By similarity).				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)	3			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			GGAAGTAGTTTGGCAATTTCT	0.383													12	9	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68007903	68007903	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68007903G>T	uc003xxi.2	+	8	1022	c.991G>T	c.(991-993)GAT>TAT	p.D331Y	CSPP1_uc003xxg.1_Missense_Mutation_p.D323Y|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.D296Y|CSPP1_uc003xxk.2_Missense_Mutation_p.D2Y	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	331						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TGAAGAAATGGATGAGAGGTT	0.328													31	67	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69002805	69002805	+	Intron	SNP	T	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002805T>G	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TTCTCATTTGTATTTATAGGA	0.353													25	48	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69002806	69002806	+	Intron	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002806A>T	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TCTCATTTGTATTTATAGGAA	0.353													26	48	---	---	---	---	PASS
JPH1	56704	broad.mit.edu	37	8	75227867	75227867	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75227867C>T	uc003yae.2	-						JPH1_uc003yaf.2_Intron|JPH1_uc003yag.1_Intron	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			TTGGAGAGACCGCAAGAAAGC	0.657													21	23	---	---	---	---	PASS
SLC7A13	157724	broad.mit.edu	37	8	87242189	87242189	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87242189C>A	uc003ydq.1	-	1	416	c.318G>T	c.(316-318)GGG>GGT	p.G106G	SLC7A13_uc003ydr.1_Silent_p.G106G	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	106	Helical; Name=3; (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						CAGCAACTACCCCTGACCCCA	0.493													16	43	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100871568	100871568	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100871568C>G	uc003yiv.2	+	57	11090	c.10979C>G	c.(10978-10980)CCT>CGT	p.P3660R	VPS13B_uc003yiw.2_Missense_Mutation_p.P3635R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3660					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTTGGCAGCCCTGCAAGCCTG	0.567													29	56	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101074868	101074868	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101074868G>T	uc003yjb.1	-	9	1660	c.1465C>A	c.(1465-1467)CAT>AAT	p.H489N	RGS22_uc003yja.1_Missense_Mutation_p.H308N|RGS22_uc003yjc.1_Missense_Mutation_p.H477N|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	489					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TTTCTTAAATGCTCTTCATTC	0.318													28	65	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361464	105361464	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361464C>A	uc003ylx.1	+	2	733	c.684C>A	c.(682-684)GGC>GGA	p.G228G		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	228	Helical; (Potential).				osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TTGGCACTGGCCTCTTCATGA	0.493													56	96	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120592360	120592360	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120592360T>C	uc003yot.1	-	19	1862	c.1776A>G	c.(1774-1776)ACA>ACG	p.T592T	ENPP2_uc011lic.1_Silent_p.T105T|ENPP2_uc003yor.1_Silent_p.T227T|ENPP2_uc003yos.1_Silent_p.T644T|ENPP2_uc010mdd.1_Silent_p.T592T	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	592					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CCTTACCTTCTGTAGACCCTT	0.343													167	393	---	---	---	---	PASS
FBXO32	114907	broad.mit.edu	37	8	124553144	124553144	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124553144G>A	uc003yqr.2	-	1	303	c.111C>T	c.(109-111)CTC>CTT	p.L37L	FBXO32_uc010mdk.2_Silent_p.L37L	NM_058229	NP_478136	Q969P5	FBX32_HUMAN	F-box only protein 32 isoform 1	37										skin(3)|breast(2)|lung(1)	6	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTCACCTGCTGAGGTCGCTCA	0.687													11	20	---	---	---	---	PASS
TATDN1	83940	broad.mit.edu	37	8	125531058	125531058	+	Splice_Site	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125531058C>A	uc003yrd.2	-	4	244	c.202_splice	c.e4+1	p.G68_splice	TATDN1_uc003yre.2_Splice_Site|TATDN1_uc010mdm.2_Splice_Site_p.G21_splice|TATDN1_uc003yrf.2_Splice_Site_p.G68_splice	NM_032026	NP_114415	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1 isoform a							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TATGAGGATACCATTTGTTTG	0.303													31	87	---	---	---	---	PASS
TATDN1	83940	broad.mit.edu	37	8	125531107	125531107	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125531107C>A	uc003yrd.2	-	4	196	c.154G>T	c.(154-156)GGA>TGA	p.G52*	TATDN1_uc003yre.2_RNA|TATDN1_uc010mdm.2_Nonsense_Mutation_p.G5*|TATDN1_uc003yrf.2_Nonsense_Mutation_p.G52*	NM_032026	NP_114415	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1 isoform a	52						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TGTAGATTTCCACCTGTAATC	0.303													34	80	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131859754	131859754	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131859754C>T	uc003ytd.3	-	11	2674	c.2418G>A	c.(2416-2418)TGG>TGA	p.W806*	ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	806	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CAAAATCACACCACAGCTGCG	0.348										HNSCC(32;0.087)			10	27	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139323161	139323161	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139323161T>C	uc003yuy.2	-	3	251	c.80A>G	c.(79-81)TAT>TGT	p.Y27C	FAM135B_uc003yux.2_5'UTR|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	27										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GATCTGGTAATACCTAAGAAA	0.468										HNSCC(54;0.14)			35	67	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139614404	139614404	+	Splice_Site	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139614404T>A	uc003yvd.2	-	60	4588	c.4141_splice	c.e60-1	p.G1381_splice	COL22A1_uc011ljo.1_Splice_Site_p.G661_splice	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGGGACCCCCTGCAAGGAGAA	0.572										HNSCC(7;0.00092)			22	58	---	---	---	---	PASS
RHPN1	114822	broad.mit.edu	37	8	144463991	144463991	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144463991G>C	uc003yyb.2	+	14	1783	c.1650G>C	c.(1648-1650)AAG>AAC	p.K550N		NM_052924	NP_443156	Q8TCX5	RHPN1_HUMAN	rhophilin 1	575	PDZ.				signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CTGGCCTGAAGGAGGGCGACT	0.677													6	18	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145623947	145623947	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145623947A>T	uc003zcj.2	-	18	1795	c.1720T>A	c.(1720-1722)TTC>ATC	p.F574I		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	574					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AGAATCAGGAATCCGTGTCTG	0.682													9	222	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	396932	396932	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:396932A>G	uc003zgf.2	+	25	3230	c.3118A>G	c.(3118-3120)AAG>GAG	p.K1040E	DOCK8_uc010mgu.2_Missense_Mutation_p.K342E|DOCK8_uc010mgv.2_Missense_Mutation_p.K940E|DOCK8_uc010mgw.1_Missense_Mutation_p.K342E|DOCK8_uc003zgk.2_Missense_Mutation_p.K498E	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1040					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AAAACCACAGAAGGTAACtgt	0.239													89	31	---	---	---	---	PASS
RCL1	10171	broad.mit.edu	37	9	4844532	4844532	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4844532G>T	uc003zis.2	+	7	976	c.718G>T	c.(718-720)GGC>TGC	p.G240C	RCL1_uc003zit.2_Missense_Mutation_p.G82C|RCL1_uc010mhk.1_Missense_Mutation_p.G82C|RCL1_uc010mhl.1_Missense_Mutation_p.G54C	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1	240					ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		CAGGTCTCCGGGCTTTGGGTT	0.517													173	47	---	---	---	---	PASS
DENND4C	55667	broad.mit.edu	37	9	19316473	19316473	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19316473C>T	uc003znq.2	+	7	871	c.838C>T	c.(838-840)CTA>TTA	p.L280L	DENND4C_uc011lnc.1_5'UTR	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	280						integral to membrane				ovary(1)|skin(1)	2						GTGCAAAAATCTACTTAGCAC	0.323													12	79	---	---	---	---	PASS
FANCG	2189	broad.mit.edu	37	9	35076575	35076575	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35076575C>G	uc003zwb.1	-	8	1422	c.930G>C	c.(928-930)TTG>TTC	p.L310F	FANCG_uc003zwa.1_Missense_Mutation_p.L52F|FANCG_uc010mkj.1_Missense_Mutation_p.L52F|FANCG_uc011lot.1_Missense_Mutation_p.L310F	NM_004629	NP_004620	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	310					cell cycle checkpoint|DNA repair|mitochondrion organization	mitochondrion|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|large_intestine(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ATGGGACATTCAAGGCCTAAA	0.443			Mis|N|F|S			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				14	114	---	---	---	---	PASS
RECK	8434	broad.mit.edu	37	9	36087893	36087893	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36087893T>C	uc003zyv.2	+	9	926	c.840T>C	c.(838-840)CCT>CCC	p.P280P	RECK_uc003zyw.2_Silent_p.P152P|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor	280	5 X Knot repeats.					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TACACCCTCCTCCCTCTACAG	0.443													57	46	---	---	---	---	PASS
MELK	9833	broad.mit.edu	37	9	36665428	36665428	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36665428T>C	uc003zzn.2	+	14	1396	c.1258T>C	c.(1258-1260)TTA>CTA	p.L420L	MELK_uc011lpm.1_Silent_p.L289L|MELK_uc011lpn.1_Silent_p.L379L|MELK_uc011lpo.1_Silent_p.L226L|MELK_uc010mll.2_Silent_p.L388L|MELK_uc011lpp.1_Silent_p.L372L|MELK_uc010mlm.2_Silent_p.L349L|MELK_uc011lpq.1_Silent_p.L226L|MELK_uc011lpr.1_Silent_p.L349L|MELK_uc011lps.1_Silent_p.L340L	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	420						cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TGCAAATAAATTAAAGAACAA	0.348													32	97	---	---	---	---	PASS
ANKRD20A3	441425	broad.mit.edu	37	9	67951985	67951985	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67951985A>G	uc004aeu.2	+	9	1060	c.948A>G	c.(946-948)AAA>AAG	p.K316K	ANKRD20A3_uc010mnn.2_Silent_p.K315K	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3	316											0						CGCATGAAAAAGGAAACAGAA	0.303													105	168	---	---	---	---	PASS
PIP5K1B	8395	broad.mit.edu	37	9	71504055	71504055	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71504055G>C	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		ACATGGTAAGGAACTGCACAT	0.353													13	129	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79917921	79917921	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79917921G>T	uc004akr.2	+	34	4163	c.3903G>T	c.(3901-3903)TGG>TGT	p.W1301C	VPS13A_uc004akp.3_Missense_Mutation_p.W1301C|VPS13A_uc004akq.3_Missense_Mutation_p.W1301C|VPS13A_uc004aks.2_Missense_Mutation_p.W1262C|VPS13A_uc010mpo.1_5'UTR	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	1301	TPR 5.				Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						ATTTATGCTGGGAGTGGTACC	0.363													23	257	---	---	---	---	PASS
PSAT1	29968	broad.mit.edu	37	9	80919698	80919698	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80919698G>A	uc004ala.2	+	4	307	c.239G>A	c.(238-240)TGC>TAC	p.C80Y	PSAT1_uc004alb.2_Missense_Mutation_p.C80Y	NM_058179	NP_478059	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1 isoform 1	80	Pyridoxal phosphate binding (By similarity).				L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)	GGAGGTGGGTGCGGCCAGTTC	0.483													18	215	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85616037	85616037	+	Missense_Mutation	SNP	C	A	A	rs140659178	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85616037C>A	uc004amo.1	-	10	1472	c.1211G>T	c.(1210-1212)CGC>CTC	p.R404L		NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	404					protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						ATAGGAAGAGCGGGATGACCT	0.493													59	34	---	---	---	---	PASS
ZNF782	158431	broad.mit.edu	37	9	99580198	99580198	+	3'UTR	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99580198C>G	uc004awp.1	-	6					ZNF782_uc011lup.1_3'UTR	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				TCTTTATATGCATACATTTAA	0.378													11	140	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100204011	100204011	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100204011G>A	uc004axj.2	+	6	934	c.709G>A	c.(709-711)GTT>ATT	p.V237I	TDRD7_uc011lux.1_Missense_Mutation_p.V163I	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	237	Lotus/OST-HTH 2.				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				AATGGATGAGGTTCAAAATCG	0.284													5	120	---	---	---	---	PASS
TRIM14	9830	broad.mit.edu	37	9	100849622	100849622	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100849622G>A	uc004ayd.2	-						TRIM14_uc004ayf.1_Intron|TRIM14_uc011luz.1_3'UTR|TRIM14_uc011lva.1_3'UTR|TRIM14_uc004ayg.1_Intron|TRIM14_uc004ayh.1_3'UTR|TRIM14_uc004ayi.1_Missense_Mutation_p.P233L|TRIM14_uc004ayj.1_3'UTR	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha							cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GTGATTGGTCGGGGAAAGCTG	0.572													32	234	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113149732	113149732	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113149732C>G	uc010mtz.2	-	42	10230	c.9893G>C	c.(9892-9894)AGG>ACG	p.R3298T	SVEP1_uc010mty.2_Missense_Mutation_p.R1224T	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	3298	Sushi 32.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						AGTTTCACACCTGGTCTCTAA	0.388													24	32	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	117069976	117069976	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117069976G>T	uc011lxl.1	+	59	5135	c.5135G>T	c.(5134-5136)GGC>GTC	p.G1712V	COL27A1_uc004bii.2_RNA|COL27A1_uc011lxn.1_Missense_Mutation_p.G27V	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1712	Fibrillar collagen NC1.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						CCAAACCTTGGCTGCTCCTCT	0.562													111	80	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475243	120475243	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475243C>A	uc004bjz.2	+	3	1128	c.837C>A	c.(835-837)GGC>GGA	p.G279G	TLR4_uc004bka.2_Silent_p.G239G|TLR4_uc004bkb.2_Silent_p.G79G	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	279	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						CTCTAGAGGGCCTGTGCAATT	0.363													156	68	---	---	---	---	PASS
OLFML2A	169611	broad.mit.edu	37	9	127563756	127563756	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127563756G>C	uc004bov.2	+	5	846	c.733G>C	c.(733-735)GAC>CAC	p.D245H	OLFML2A_uc010mwr.1_Missense_Mutation_p.D209H|OLFML2A_uc004bow.2_Missense_Mutation_p.D31H	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor	245											0						AAGCTTTGCAGACAGAGGCCT	0.542													14	174	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130207074	130207074	+	Silent	SNP	G	T	T	rs61747648	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130207074G>T	uc004bqw.3	+	5	1509	c.1095G>T	c.(1093-1095)GCG>GCT	p.A365A	ZNF79_uc011maf.1_Silent_p.A341A|ZNF79_uc011mag.1_Silent_p.A341A	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	365	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GATGTGCCGCGTGTGGGAAGG	0.567													79	79	---	---	---	---	PASS
SH2D3C	10044	broad.mit.edu	37	9	130536708	130536708	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130536708G>T	uc004bsc.2	-	2	218	c.76C>A	c.(76-78)CTC>ATC	p.L26I	SH2D3C_uc004bsd.1_5'UTR	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	26					JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						GACCGAGGGAGGTTGGAGAGA	0.488													8	72	---	---	---	---	PASS
FUBP3	8939	broad.mit.edu	37	9	133487899	133487899	+	Intron	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133487899A>G	uc004bzr.1	+						FUBP3_uc010mzd.1_Intron|FUBP3_uc004bzs.1_Intron	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		TTTAGTAAGTATCCATGTTGT	0.343													12	104	---	---	---	---	PASS
NTNG2	84628	broad.mit.edu	37	9	135114558	135114558	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135114558C>T	uc004cbh.2	+	6	1898	c.1122C>T	c.(1120-1122)GTC>GTT	p.V374V		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	374	Laminin EGF-like 2.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		TGACCTGCGTCAGCTGCAAGC	0.582													97	56	---	---	---	---	PASS
GFI1B	8328	broad.mit.edu	37	9	135862758	135862758	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135862758C>A	uc004ccg.2	+	3	341	c.190C>A	c.(190-192)CCG>ACG	p.P64T	GFI1B_uc010mzy.2_Missense_Mutation_p.P64T	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	64					cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		CAAACGAGAGCCGGAGCTGGA	0.617													15	94	---	---	---	---	PASS
C9orf116	138162	broad.mit.edu	37	9	138387325	138387325	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138387325C>T	uc004cft.1	-	3	423	c.359G>A	c.(358-360)CGG>CAG	p.R120Q	C9orf116_uc004cfs.1_3'UTR|C9orf116_uc004cfu.1_RNA	NM_001048265	NP_001041730	Q5BN46	CI116_HUMAN	hypothetical protein LOC138162 isoform 1	120											0				OV - Ovarian serous cystadenocarcinoma(145;7.39e-08)|Epithelial(140;5.19e-07)|all cancers(34;1.04e-05)		GAAGTTGAGCCGGTCACAGGA	0.547													10	189	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139401756	139401756	+	Splice_Site	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139401756C>A	uc004chz.2	-	22	3643	c.3643_splice	c.e22+1	p.G1215_splice	NOTCH1_uc004cia.1_Splice_Site_p.G445_splice	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein						aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCGGCCCTTACCCTGAGTGCC	0.692			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			44	31	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139401757	139401757	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139401757C>A	uc004chz.2	-	22	3643	c.3643G>T	c.(3643-3645)GGT>TGT	p.G1215C	NOTCH1_uc004cia.1_Missense_Mutation_p.G445C	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1215	Extracellular (Potential).|EGF-like 31; calcium-binding (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CGGCCCTTACCCTGAGTGCCC	0.692			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			44	31	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7409832	7409832	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7409832C>A	uc009xio.1	-	4	306	c.215G>T	c.(214-216)AGC>ATC	p.S72I	SFMBT2_uc001ijn.1_Missense_Mutation_p.S72I|SFMBT2_uc010qay.1_Missense_Mutation_p.S72I|SFMBT2_uc001ijo.1_Missense_Mutation_p.S72I	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	72	MBT 1.				regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						CTGGAAGTTGCTCTGAATGCT	0.433													18	24	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8111429	8111429	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8111429C>T	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						TCTCTCCCCACTCTCAGTCTG	0.473			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						4	90	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17275867	17275867	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17275867T>A	uc001iou.2	+	5	1232	c.819T>A	c.(817-819)CGT>CGA	p.R273R	VIM_uc001iov.1_Silent_p.R273R|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Silent_p.R273R|VIM_uc001ioy.1_Silent_p.R273R|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Silent_p.R273R|VIM_uc001ipc.1_Silent_p.R273R	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	273	Rod.|Coil 2.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GTGACGTACGTCAGCAATATG	0.498													31	11	---	---	---	---	PASS
RHOBTB1	9886	broad.mit.edu	37	10	62652608	62652608	+	Missense_Mutation	SNP	C	A	A	rs141139124	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62652608C>A	uc001jli.2	-	6	880	c.442G>T	c.(442-444)GAC>TAC	p.D148Y	RHOBTB1_uc001jlh.2_Missense_Mutation_p.D148Y|RHOBTB1_uc001jlj.2_Missense_Mutation_p.D148Y|RHOBTB1_uc001jlk.2_Missense_Mutation_p.D148Y|RHOBTB1_uc009xpe.1_Intron	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	148	Rho-like.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					GCTTCCAGGTCGGCATAGCGG	0.502													57	27	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84745017	84745017	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84745017G>T	uc001kco.2	+	9	1774	c.1747G>T	c.(1747-1749)GAG>TAG	p.E583*	NRG3_uc010qlz.1_Nonsense_Mutation_p.E582*|NRG3_uc001kcp.2_Nonsense_Mutation_p.E386*|NRG3_uc001kcq.2_Nonsense_Mutation_p.E233*|NRG3_uc001kcr.2_Nonsense_Mutation_p.E257*	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	607	Cytoplasmic (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		AGTGGGTTTAGAGGAAACCTG	0.458													130	88	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89725055	89725055	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89725055C>G	uc001kfb.2	+	10	2069	c.1038C>G	c.(1036-1038)TAC>TAG	p.Y346*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	346	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.Y346*(1)|p.G165_*404del(1)|p.Y346fs*1(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGAAGCTGTACTTCACAAAAA	0.318		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			29	10	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105893440	105893440	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105893440C>G	uc001kxw.2	-	35	4650	c.4534G>C	c.(4534-4536)GAA>CAA	p.E1512Q	C10orf79_uc009xxq.2_Missense_Mutation_p.E791Q	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1512											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TTTAGATCTTCCCTTTCCATC	0.353													19	75	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127438068	127438068	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127438068G>A	uc001liq.1	+	22	3504	c.3211G>A	c.(3211-3213)GAT>AAT	p.D1071N	C10orf137_uc001lio.1_Missense_Mutation_p.D1037N|C10orf137_uc001lip.1_Missense_Mutation_p.D775N|C10orf137_uc001lis.1_Missense_Mutation_p.D397N|C10orf137_uc001lit.1_5'UTR	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	1071					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GCTGCTGAAAGATGCTCCCTG	0.443													61	49	---	---	---	---	PASS
C11orf35	256329	broad.mit.edu	37	11	557899	557899	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:557899C>G	uc001lpx.2	-	5	603	c.540G>C	c.(538-540)CAG>CAC	p.Q180H	uc001lpy.2_RNA|uc001lpz.2_5'Flank|RASSF7_uc001lqa.2_5'Flank	NM_173573	NP_775844	Q8IXW0	CK035_HUMAN	hypothetical protein LOC256329	180										pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CACTGCCAGTCTGGGATCGTA	0.692													5	15	---	---	---	---	PASS
KRTAP5-5	439915	broad.mit.edu	37	11	1651512	1651512	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651512G>T	uc001lty.2	+	1	480	c.442G>T	c.(442-444)GGC>TGC	p.G148C		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	148	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GTCCAAGGGGGGCTGTGGTTC	0.677													16	26	---	---	---	---	PASS
RRM1	6240	broad.mit.edu	37	11	4154832	4154832	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4154832G>T	uc001lyw.3	+	17	2264	c.1945G>T	c.(1945-1947)GGC>TGC	p.G649C	RRM1_uc009yej.2_RNA|RRM1_uc009yei.2_Missense_Mutation_p.G609C|RRM1_uc010qyc.1_Missense_Mutation_p.G552C|RRM1_uc010qyd.1_Missense_Mutation_p.G311C	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain	649					deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	TACCGAGCGGGGCCTATGGCA	0.388													27	60	---	---	---	---	PASS
OR51F1	256892	broad.mit.edu	37	11	4790700	4790700	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4790700T>A	uc010qyl.1	-	1	448	c.448A>T	c.(448-450)ATG>TTG	p.M150L		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	150						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		CGTGTAATCATCAGAAGACCC	0.428													39	61	---	---	---	---	PASS
OR51G2	81282	broad.mit.edu	37	11	4936228	4936228	+	Silent	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4936228A>T	uc001lzr.1	-	1	666	c.666T>A	c.(664-666)TCT>TCA	p.S222S		NM_001005238	NP_001005238	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G,	222	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCAGAGCATAAGAGAAGAGGA	0.522													22	66	---	---	---	---	PASS
OR51V1	283111	broad.mit.edu	37	11	5221333	5221333	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221333C>A	uc010qyz.1	-	1	598	c.598G>T	c.(598-600)GAC>TAC	p.D200Y		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	200	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AATCGGATGTCTGAACAGGCT	0.418													36	62	---	---	---	---	PASS
HBG1	3047	broad.mit.edu	37	11	5270650	5270650	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5270650T>C	uc001mah.1	-	2	316	c.263A>G	c.(262-264)CAG>CGG	p.Q88R	HBG2_uc001mai.1_Intron	NM_000559	NP_000550	P69891	HBG1_HUMAN	A-gamma globin	88					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity|protein binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCACTCAGCTGGGCAAAGGT	0.522													5	55	---	---	---	---	PASS
HBG2	3048	broad.mit.edu	37	11	5275574	5275574	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5275574T>C	uc001mai.1	-	2	700	c.263A>G	c.(262-264)CAG>CGG	p.Q88R	HBG2_uc001mak.1_RNA|HBG2_uc001maj.1_Missense_Mutation_p.Q88R	NM_000559	NP_000550	P69892	HBG2_HUMAN	A-gamma globin	88					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCACTCAGCTGGGCAAAGGT	0.512													26	158	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969255	5969255	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969255C>T	uc010qzt.1	+	1	679	c.679C>T	c.(679-681)CGA>TGA	p.R227*		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	227	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTCATTCTGCGAGCTGTGCT	0.517													69	157	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969377	5969377	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969377G>T	uc010qzt.1	+	1	801	c.801G>T	c.(799-801)GTG>GTT	p.V267V		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	267	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCACACATGTGGCTAAGAAGA	0.522													72	197	---	---	---	---	PASS
OR52L1	338751	broad.mit.edu	37	11	6007834	6007834	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6007834C>A	uc001mcd.2	-	1	382	c.327G>T	c.(325-327)GAG>GAT	p.E109D		NM_001005173	NP_001005173	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L,	109	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTACCCAATCTCGTGGGCAT	0.542													18	27	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6651098	6651098	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6651098C>A	uc001mem.1	-	11	5250	c.4840G>T	c.(4840-4842)GAG>TAG	p.E1614*		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1614	Cadherin 15.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTACGTGCTCAGCTCGTTGT	0.662													26	55	---	---	---	---	PASS
OR10A3	26496	broad.mit.edu	37	11	7960523	7960523	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7960523G>A	uc010rbi.1	-	1	545	c.545C>T	c.(544-546)CCC>CTC	p.P182L		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TAGTACCGGGGGAGTCTCACA	0.438													44	70	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10827516	10827516	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10827516G>A	uc001mjc.2	-	4	603	c.186C>T	c.(184-186)TCC>TCT	p.S62S	EIF4G2_uc001mjb.2_5'UTR|EIF4G2_uc009ygf.2_5'UTR|EIF4G2_uc001mjd.2_Silent_p.S62S|EIF4G2_uc001mjf.1_5'UTR	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	62					cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TGTTTGCTGCGGAGTTGTCAT	0.433													102	229	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17530997	17530997	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17530997G>T	uc001mnf.2	-						USH1C_uc001mne.2_Missense_Mutation_p.T640K|USH1C_uc009yhb.2_Intron|USH1C_uc001mng.2_Intron|USH1C_uc001mnd.2_Intron	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a						equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						TGGATTGCCTGTGTCCCCAGT	0.622													45	102	---	---	---	---	PASS
KCNC1	3746	broad.mit.edu	37	11	17793277	17793277	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17793277C>A	uc001mnk.3	+	2	691	c.636C>A	c.(634-636)CAC>CAA	p.H212Q	KCNC1_uc009yhc.1_Missense_Mutation_p.H212Q	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel	212						voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						TGGAGACCCACGAGCGCTTCA	0.577													48	106	---	---	---	---	PASS
DBX1	120237	broad.mit.edu	37	11	20181497	20181497	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20181497C>T	uc001mpw.1	-							NM_001029865	NP_001025036	A6NMT0	DBX1_HUMAN	developing brain homeobox 1						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GTTCTGACCTCGCTTACCTGT	0.622													23	46	---	---	---	---	PASS
PAX6	5080	broad.mit.edu	37	11	31827968	31827968	+	5'UTR	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31827968T>C	uc001mtd.3	-	3					PAX6_uc001mte.3_5'UTR|PAX6_uc001mtg.3_5'UTR|PAX6_uc001mtf.3_5'UTR|PAX6_uc001mth.3_5'UTR|PAX6_uc009yjr.2_5'UTR	NM_001127612	NP_001121084	P26367	PAX6_HUMAN	paired box gene 6 isoform a						blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity			lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9	Lung SC(675;0.225)					ATGCTGGCTCTGGCTGGGGGC	0.612									Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				7	16	---	---	---	---	PASS
WIT1	51352	broad.mit.edu	37	11	32460662	32460662	+	RNA	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32460662C>G	uc010rec.1	+	2		c.1380C>G			WIT1_uc010red.1_RNA|WIT1_uc010ree.1_Intron	NR_023920				full-length cDNA clone CS0DC024YP12 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).												0	Breast(20;0.247)					AGTGCGCACGCCTGGGCCGCC	0.667													10	19	---	---	---	---	PASS
CAPRIN1	4076	broad.mit.edu	37	11	34113608	34113608	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34113608G>A	uc001mvh.1	+						CAPRIN1_uc001mvg.2_Intron|CAPRIN1_uc001mvi.2_Intron|CAPRIN1_uc001mvj.1_Intron	NM_005898	NP_005889	Q14444	CAPR1_HUMAN	membrane component chromosome 11 surface marker						negative regulation of translation|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis	cytoplasmic mRNA processing body|cytosol|dendrite|integral to plasma membrane|stress granule	protein binding|RNA binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AAACAGGTACGAAATCCAGTG	0.448													13	38	---	---	---	---	PASS
SLC1A2	6506	broad.mit.edu	37	11	35313909	35313909	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35313909A>C	uc001mwd.2	-	7	1608	c.1016T>G	c.(1015-1017)GTG>GGG	p.V339G	SLC1A2_uc001mwe.2_Missense_Mutation_p.V330G|SLC1A2_uc010rev.1_Missense_Mutation_p.V339G	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	339	Helical; (Potential).				D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	TTTCCTGGTCACTACAAAGTA	0.473													72	166	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43411371	43411371	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43411371G>T	uc001mxi.2	+	3	433	c.419G>T	c.(418-420)AGT>ATT	p.S140I	TTC17_uc001mxh.2_Missense_Mutation_p.S140I|TTC17_uc010rfj.1_Missense_Mutation_p.S83I	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	140							binding			ovary(5)	5						AAAGACATCAGGTAAAGAAGT	0.358													52	92	---	---	---	---	PASS
MTCH2	23788	broad.mit.edu	37	11	47660338	47660338	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47660338G>A	uc010rho.1	-	3	381	c.192C>T	c.(190-192)ATC>ATT	p.I64I	MTCH2_uc001nge.2_5'UTR|MTCH2_uc010rhp.1_5'UTR	NM_014342	NP_055157	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	64	Solcar 1.				transport	integral to membrane|mitochondrial inner membrane					0						GCCTCCCATCGATACTGGCAA	0.433													21	78	---	---	---	---	PASS
OR4X2	119764	broad.mit.edu	37	11	48267239	48267239	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48267239G>T	uc001ngs.1	+	1	584	c.584G>T	c.(583-585)GGA>GTA	p.G195V		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	195	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTTGCCAATGGAGGCACCCTG	0.502													98	206	---	---	---	---	PASS
OR4A47	403253	broad.mit.edu	37	11	48510770	48510770	+	Silent	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48510770G>C	uc010rhx.1	+	1	426	c.426G>C	c.(424-426)CTG>CTC	p.L142L		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GTGTTGTGCTGCTGGTAGTGT	0.448													63	100	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974765	49974765	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974765C>A	uc010rhz.1	+	1	791	c.791C>A	c.(790-792)CCC>CAC	p.P264H		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						GCTACTTTACCCATTGATAAA	0.408													76	166	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135439	55135439	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135439C>T	uc010rif.1	+	1	80	c.80C>T	c.(79-81)TCA>TTA	p.S27L		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	27	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCAACACCTTCAGAAGAACAC	0.388													34	52	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135835	55135835	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135835A>G	uc010rif.1	+	1	476	c.476A>G	c.(475-477)CAT>CGT	p.H159R		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	159	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AAGCCTCTTCATGAATTGATC	0.413													18	308	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55321947	55321947	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55321947G>T	uc010rig.1	+	1	165	c.165G>T	c.(163-165)ATG>ATT	p.M55I		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGGGAAACATGCAAAACCAAA	0.363										HNSCC(20;0.049)			70	171	---	---	---	---	PASS
OR8K5	219453	broad.mit.edu	37	11	55927225	55927225	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55927225G>C	uc010rja.1	-	1	569	c.569C>G	c.(568-570)TCA>TGA	p.S190*		NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K,	190	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CTGTGCATTTGAGCAAAGCAT	0.338													50	80	---	---	---	---	PASS
OR9G4	283189	broad.mit.edu	37	11	56510514	56510514	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56510514G>T	uc010rjo.1	-	1	774	c.774C>A	c.(772-774)TCC>TCA	p.S258S		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AGATGAGGTGGGAAGCACAGG	0.468													45	90	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58189970	58189970	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58189970G>A	uc010rkg.1	-	1	765	c.765C>T	c.(763-765)TTC>TTT	p.F255F		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GCAAGTAGATGAAGATTACTG	0.488													20	60	---	---	---	---	PASS
CD5	921	broad.mit.edu	37	11	60886821	60886821	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60886821C>A	uc009ynk.2	+	5	682	c.579C>A	c.(577-579)ACC>ACA	p.T193T		NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor	193	Extracellular (Potential).|SRCR 2.				cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		AGGACAAGACCCAGGACCTGG	0.622													38	97	---	---	---	---	PASS
CD5	921	broad.mit.edu	37	11	60893276	60893276	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60893276A>G	uc009ynk.2	+	10	1556	c.1453A>G	c.(1453-1455)AGT>GGT	p.S485G		NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor	485	Cytoplasmic (Potential).				cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		CTCCTCCGACAGTGACTATGA	0.602													18	32	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62293633	62293633	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62293633T>A	uc001ntl.2	-	5	8556	c.8256A>T	c.(8254-8256)GCA>GCT	p.A2752A	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	2752					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				CAACATCAGGTGCGTCAATGT	0.498													118	197	---	---	---	---	PASS
SLC3A2	6520	broad.mit.edu	37	11	62653041	62653041	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62653041G>A	uc001nwd.2	+	10	1631	c.1407G>A	c.(1405-1407)GGG>GGA	p.G469G	SLC3A2_uc001nwb.2_Silent_p.G500G|SLC3A2_uc001nwc.2_Silent_p.G470G|SLC3A2_uc001nwe.2_Silent_p.G438G|SLC3A2_uc001nwf.2_Silent_p.G407G|SLC3A2_uc001nwg.2_Silent_p.G368G	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	469	Extracellular (Potential).				blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						TCAGCTACGGGGATGAGATTG	0.527													142	373	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65384478	65384478	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65384478C>A	uc001oey.2	+	2	337	c.337C>A	c.(337-339)CCC>ACC	p.P113T	MAP3K11_uc001oew.2_5'Flank	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	113						integral to membrane					0						CAGCAATCCACCCAGGTGGGT	0.617													9	15	---	---	---	---	PASS
NDUFS8	4728	broad.mit.edu	37	11	67799650	67799650	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67799650G>A	uc001onc.2	+	2	139	c.32G>A	c.(31-33)CGG>CAG	p.R11Q	NDUFS8_uc010rpz.1_Missense_Mutation_p.R11Q|NDUFS8_uc009ysb.1_Intron|NDUFS8_uc009ysc.1_Missense_Mutation_p.R11Q	NM_002496	NP_002487	O00217	NDUS8_HUMAN	NADH dehydrogenase ubiquinone Fe-S 8 precursor	11					mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	ATGCTGCTGCGGGCCCTGGCC	0.607													26	269	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70172916	70172916	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70172916G>A	uc001opo.2	+	7	1120	c.922G>A	c.(922-924)GTC>ATC	p.V308I	PPFIA1_uc001opn.1_Missense_Mutation_p.V308I|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	308	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GCAACGAGATGTCCGTGAAGT	0.373													39	70	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71730594	71730594	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71730594C>T	uc001orl.1	-	9	702	c.530G>A	c.(529-531)AGG>AAG	p.R177K	NUMA1_uc001ork.1_Missense_Mutation_p.R177K|NUMA1_uc001orm.1_Missense_Mutation_p.R177K|NUMA1_uc009ysx.1_Missense_Mutation_p.R177K|NUMA1_uc001oro.1_Missense_Mutation_p.R177K|NUMA1_uc009ysy.1_Missense_Mutation_p.R177K|NUMA1_uc001orp.2_Missense_Mutation_p.R177K|NUMA1_uc001orq.2_Missense_Mutation_p.R177K	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	177					G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						GCGAATCTCCCTCTTGGCCTG	0.522			T	RARA	APL								4	189	---	---	---	---	PASS
DNAJB13	374407	broad.mit.edu	37	11	73670544	73670544	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73670544A>T	uc001ouo.2	+	3	929	c.178A>T	c.(178-180)AAG>TAG	p.K60*		NM_153614	NP_705842	P59910	DJB13_HUMAN	testis spermatogenesis apoptosis-related protein	60	J.				apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)					CACAGCCATGAAGAGAGGCAT	0.547													26	48	---	---	---	---	PASS
PGM2L1	283209	broad.mit.edu	37	11	74053659	74053659	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74053659C>G	uc001ovb.1	-	12	1775	c.1479G>C	c.(1477-1479)TTG>TTC	p.L493F		NM_173582	NP_775853	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	493					glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)					GTTCATAACACAAGAAATAGG	0.279													56	125	---	---	---	---	PASS
PRKRIR	5612	broad.mit.edu	37	11	76063707	76063707	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76063707T>C	uc001oxh.1	-	5	487	c.487A>G	c.(487-489)AAA>GAA	p.K163E	PRKRIR_uc010rrz.1_5'UTR	NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double	163					negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						AGGTATTCTTTGTTTTCCTTC	0.408													21	52	---	---	---	---	PASS
PRKRIR	5612	broad.mit.edu	37	11	76063827	76063827	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76063827A>C	uc001oxh.1	-	5	367	c.367T>G	c.(367-369)TCT>GCT	p.S123A	PRKRIR_uc010rrz.1_5'UTR	NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double	123					negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						TCCTGCTCAGAAGTTTCATCA	0.338													11	35	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82893032	82893032	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82893032G>C	uc001ozx.3	+	13	4649	c.4304G>C	c.(4303-4305)GGA>GCA	p.G1435A		NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	1435					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						GTACCTGCTGGACCAGCTGGA	0.428													10	30	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83173090	83173090	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83173090C>T	uc001paj.2	-	22	2764	c.2461G>A	c.(2461-2463)GAT>AAT	p.D821N	DLG2_uc001pai.2_Missense_Mutation_p.D700N|DLG2_uc010rsy.1_Missense_Mutation_p.D770N|DLG2_uc010rsz.1_Missense_Mutation_p.D817N|DLG2_uc010rta.1_Missense_Mutation_p.D803N|DLG2_uc001pak.2_Missense_Mutation_p.D926N|DLG2_uc010rtb.1_Missense_Mutation_p.D788N|DLG2_uc010rsw.1_Missense_Mutation_p.D285N|DLG2_uc010rsx.1_Missense_Mutation_p.D298N	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	821	Guanylate kinase-like.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ATTGCTCGATCATAGGTTTTC	0.363													34	108	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	84028040	84028040	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84028040G>T	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Missense_Mutation_p.T50N	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGAGGGCATGGTCTGAGAACT	0.627													78	168	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	89487059	89487059	+	IGR	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89487059G>T								TRIM77 (36021 upstream) : TRIM49 (43765 downstream)																							TCAGATGGGCGATTATTCTCC	0.413													68	136	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101834490	101834490	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101834490C>T	uc001pgm.2	+	6	2994	c.2724C>T	c.(2722-2724)ACC>ACT	p.T908T	KIAA1377_uc001pgn.2_Silent_p.T864T|KIAA1377_uc010run.1_Silent_p.T709T|KIAA1377_uc009yxa.1_Silent_p.T709T	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	908							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TATATTGCACCCAAAGAAGTC	0.418													75	143	---	---	---	---	PASS
KBTBD3	143879	broad.mit.edu	37	11	105924568	105924568	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105924568C>A	uc001pja.2	-	4	1488	c.848G>T	c.(847-849)GGA>GTA	p.G283V	KBTBD3_uc001pjb.2_Missense_Mutation_p.G283V|KBTBD3_uc009yxm.2_Missense_Mutation_p.G204V	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3	279										ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		AGGGAAGAGTCCACCAGAACC	0.368													38	69	---	---	---	---	PASS
DRD2	1813	broad.mit.edu	37	11	113283468	113283468	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113283468G>T	uc001pnz.2	-	6	1269	c.948C>A	c.(946-948)CAC>CAA	p.H316Q	DRD2_uc010rwv.1_Missense_Mutation_p.H315Q|DRD2_uc001poa.3_Missense_Mutation_p.H316Q|DRD2_uc001pob.3_Missense_Mutation_p.H287Q	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long	316	Cytoplasmic (By similarity).|Interaction with PPP1R9B (By similarity).				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	CGGGAGTGCTGTGGAGACCAT	0.617													15	62	---	---	---	---	PASS
RBM7	10179	broad.mit.edu	37	11	114271399	114271399	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114271399G>T	uc001pov.2	+	1	16	c.6G>T	c.(4-6)GGG>GGT	p.G2G	C11orf71_uc001pot.1_5'Flank|C11orf71_uc001pou.3_5'Flank|RBM7_uc001pow.2_Silent_p.G2G|RBM7_uc001pox.2_5'UTR	NM_016090	NP_057174	Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	2					meiosis		nucleotide binding|protein binding|RNA binding			ovary(2)	2		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		CTGAGATGGGGGCGGCGGCGG	0.637													12	51	---	---	---	---	PASS
TMPRSS13	84000	broad.mit.edu	37	11	117784529	117784529	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117784529A>G	uc001prs.1	-	5	865	c.772T>C	c.(772-774)TAC>CAC	p.Y258H	TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.Y258H	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	253	Extracellular (Potential).|SRCR.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TTCTCTGAGTAGGAGTCATTC	0.547													47	92	---	---	---	---	PASS
SCN3B	55800	broad.mit.edu	37	11	123516382	123516382	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123516382G>A	uc001pza.1	-	3	539	c.132C>T	c.(130-132)CGC>CGT	p.R44R	SCN3B_uc001pzb.1_Silent_p.R44R	NM_001040151	NP_001035241	Q9NY72	SCN3B_HUMAN	voltage-gated sodium channel beta-3 subunit	44	Ig-like C2-type.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	voltage-gated sodium channel activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)		AGGAGATGCAGCGCAGCTTCA	0.582													75	114	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900798	123900798	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900798G>T	uc001pzp.1	+	1	469	c.469G>T	c.(469-471)GTC>TTC	p.V157F		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GCACTCTGCTGTCCAGGCCAT	0.557													94	155	---	---	---	---	PASS
OR8D2	283160	broad.mit.edu	37	11	124189919	124189919	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124189919C>G	uc010sah.1	-	1	175	c.175G>C	c.(175-177)GTG>CTG	p.V59L		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AAATAATACACTGGAGGGTAA	0.433													30	78	---	---	---	---	PASS
OR8A1	390275	broad.mit.edu	37	11	124440378	124440378	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124440378C>A	uc010san.1	+	1	414	c.414C>A	c.(412-414)GAC>GAA	p.D138E		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		TGGCCTACGACCGCTATGTTG	0.488													22	60	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124748513	124748513	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124748513T>C	uc001qbc.2	+	23	3546	c.3354T>C	c.(3352-3354)CCT>CCC	p.P1118P	ROBO3_uc001qbd.2_Silent_p.P43P|ROBO3_uc010sar.1_Silent_p.P167P|ROBO3_uc001qbe.2_Silent_p.P43P|ROBO3_uc001qbf.1_Silent_p.P2P	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	1118	Cytoplasmic (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CGCCAATGCCTGAGAGAAGTC	0.607													11	20	---	---	---	---	PASS
ETS1	2113	broad.mit.edu	37	11	128426297	128426297	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128426297G>C	uc001qej.2	-	3	188	c.103C>G	c.(103-105)CGA>GGA	p.R35G		NM_001143820	NP_001137292	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	Error:Variant_position_missing_in_P14921_after_alignment					cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		CAGTTCATTCGAGGATCTTCA	0.413													24	26	---	---	---	---	PASS
SLC6A13	6540	broad.mit.edu	37	12	330114	330114	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:330114C>T	uc001qic.1	-	15	1862	c.1809G>A	c.(1807-1809)TAG>TAA	p.*603*	SLC6A13_uc009zdj.1_Silent_p.*593*|SLC6A13_uc010sdl.1_Silent_p.*511*	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	603					neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GGCCTGCCCCCTAGCAGTGAG	0.672													10	39	---	---	---	---	PASS
LRTM2	654429	broad.mit.edu	37	12	1943621	1943621	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1943621G>T	uc001qjt.2	+	5	1653	c.847G>T	c.(847-849)GCT>TCT	p.A283S	CACNA2D4_uc001qjp.2_Intron|CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron|CACNA2D4_uc009zdr.1_Intron|LRTM2_uc001qju.2_Missense_Mutation_p.A283S|LRTM2_uc010sdx.1_Missense_Mutation_p.A283S|LRTM2_uc001qjv.2_Missense_Mutation_p.A45S	NM_001039029	NP_001034118	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	283	Extracellular (Potential).					integral to membrane				large_intestine(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			CAAGCCCGGGGCTGAGCCGGA	0.672													7	37	---	---	---	---	PASS
DCP1B	196513	broad.mit.edu	37	12	2058434	2058434	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2058434C>A	uc001qjx.1	-	8	1671	c.1591G>T	c.(1591-1593)GCA>TCA	p.A531S	DCP1B_uc010sdy.1_Missense_Mutation_p.A429S	NM_152640	NP_689853	Q8IZD4	DCP1B_HUMAN	decapping enzyme Dcp1b	531					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			GTGGGTTGTGCGAACACCATG	0.617													22	36	---	---	---	---	PASS
AKAP3	10566	broad.mit.edu	37	12	4736573	4736573	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4736573C>T	uc001qnb.3	-	4	1724	c.1495G>A	c.(1495-1497)GAT>AAT	p.D499N		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	499					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6						TTGCCAATATCTTCAGGGTAC	0.473													20	18	---	---	---	---	PASS
KCNA6	3742	broad.mit.edu	37	12	4920559	4920559	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4920559C>T	uc001qng.2	+	1	2218	c.1352C>T	c.(1351-1353)GCC>GTC	p.A451V		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	451	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						CTCACCATTGCCCTGCCTGTG	0.587										HNSCC(72;0.22)			12	70	---	---	---	---	PASS
ATN1	1822	broad.mit.edu	37	12	7046110	7046110	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7046110A>G	uc001qrw.1	+	5	1917	c.1680A>G	c.(1678-1680)CAA>CAG	p.Q560Q	ATN1_uc001qrx.1_Silent_p.Q560Q	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	560	Involved in binding BAIAP2.				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						CCTACAGCCAAGCAGGCCCCA	0.627													21	103	---	---	---	---	PASS
CLEC4E	26253	broad.mit.edu	37	12	8689780	8689780	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8689780C>A	uc001quo.1	-	4	468	c.303G>T	c.(301-303)TGG>TGT	p.W101C		NM_014358	NP_055173	Q9ULY5	CLC4E_HUMAN	C-type lectin domain family 4, member E	101	C-type lectin.|Extracellular (Potential).					integral to membrane	sugar binding			central_nervous_system(1)	1	Lung SC(5;0.184)					AACTTAACGCCCAGGAAATGG	0.458													34	52	---	---	---	---	PASS
KLRK1	22914	broad.mit.edu	37	12	10530727	10530727	+	Intron	SNP	T	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10530727T>G	uc009zhj.2	-						uc001qya.1_Intron|KLRK1_uc001qyb.2_Intron|KLRK1_uc001qyc.2_Intron|KLRK1_uc009zhk.2_Intron|KLRK1_uc001qyd.2_Intron	NM_007360	NP_031386	P26718	NKG2D_HUMAN	NKG2-D type II integral membrane protein						natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding				0						GGTCAGAGACTTACAGGTTGG	0.393													65	77	---	---	---	---	PASS
KLRC1	3821	broad.mit.edu	37	12	10601997	10601997	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10601997G>C	uc001qyl.2	-						KLRC1_uc009zhm.1_Intron|KLRC1_uc001qym.2_Intron|KLRC1_uc001qyn.2_Intron|KLRC1_uc001qyo.2_Intron	NM_002259	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C,						cell surface receptor linked signaling pathway|regulation of immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0						GCTAAATAAAGATATGAATTA	0.318													97	147	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14628839	14628839	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14628839G>A	uc001rbw.2	+	11	3036	c.2878G>A	c.(2878-2880)GGC>AGC	p.G960S	ATF7IP_uc001rbu.2_Missense_Mutation_p.G960S|ATF7IP_uc001rbv.1_Missense_Mutation_p.G959S|ATF7IP_uc001rbx.2_Missense_Mutation_p.G959S|ATF7IP_uc001rby.3_Missense_Mutation_p.G960S|ATF7IP_uc001rca.2_Missense_Mutation_p.G960S	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	960					DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						AAAAGCCACTGGCAGTGATTC	0.358													18	34	---	---	---	---	PASS
DERA	51071	broad.mit.edu	37	12	16111227	16111227	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16111227A>G	uc001rde.2	+	3	367	c.235A>G	c.(235-237)ATC>GTC	p.I79V	DERA_uc010shx.1_5'UTR	NM_015954	NP_057038	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase-like	79					deoxyribonucleoside catabolic process|deoxyribonucleotide catabolic process	cytoplasm	deoxyribose-phosphate aldolase activity|protein binding				0		Hepatocellular(102;0.121)				CAAATACCCAATCCGGGAAGA	0.353													5	21	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40703009	40703009	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40703009A>G	uc001rmg.3	+	30	4412	c.4291A>G	c.(4291-4293)ATG>GTG	p.M1431V	LRRK2_uc009zjw.2_Missense_Mutation_p.M269V|LRRK2_uc001rmi.2_Missense_Mutation_p.M264V	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1431	Roc.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGTTGATGCCATGAAGCCTTG	0.338													29	64	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43793012	43793012	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43793012T>C	uc010skx.1	-	29	4309	c.4309A>G	c.(4309-4311)AGA>GGA	p.R1437G		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1437	TSP type-1 11.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CGGTACTTTCTACCTTTACCA	0.343													4	19	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43826171	43826171	+	Missense_Mutation	SNP	C	A	A	rs137911452		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43826171C>A	uc010skx.1	-	21	3032	c.3032G>T	c.(3031-3033)CGA>CTA	p.R1011L	ADAMTS20_uc001rno.1_Missense_Mutation_p.R165L|ADAMTS20_uc001rnp.1_Missense_Mutation_p.R165L	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1011	TSP type-1 4.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTCGTCACTCGGGACAGTTC	0.438													29	60	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43847811	43847811	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43847811A>G	uc010skx.1	-	12	1659	c.1659T>C	c.(1657-1659)CGT>CGC	p.R553R		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	553	Disintegrin.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CATTTACAGGACGTGTTTCCG	0.423													18	32	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48378344	48378344	+	Silent	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48378344A>T	uc001rqu.2	-	28	2053	c.1872T>A	c.(1870-1872)GGT>GGA	p.G624G	COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Silent_p.G555G	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	624	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GACCAGGAGCACCAGGCAGTC	0.632													11	58	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54911595	54911595	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54911595T>C	uc001sgc.3	+	13	1290	c.1211T>C	c.(1210-1212)ATT>ACT	p.I404T	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Missense_Mutation_p.I354T	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	404					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						TATAGGAGCATTGCAGAGCTA	0.403													54	93	---	---	---	---	PASS
TMEM5	10329	broad.mit.edu	37	12	64202735	64202735	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64202735G>C	uc001srq.1	+	6	1299	c.1195G>C	c.(1195-1197)GAG>CAG	p.E399Q	TMEM5_uc001srr.1_Missense_Mutation_p.E296Q|TMEM5_uc001srs.1_Missense_Mutation_p.E139Q	NM_014254	NP_055069	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	399	Extracellular (Potential).					integral to plasma membrane					0		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		TTTAGAAAAAGAGAAAACTAT	0.358													29	48	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70990077	70990077	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70990077C>T	uc001swb.3	-	3	386	c.356G>A	c.(355-357)AGT>AAT	p.S119N	PTPRB_uc010sto.1_Missense_Mutation_p.S119N|PTPRB_uc010stp.1_Missense_Mutation_p.S119N|PTPRB_uc001swc.3_Missense_Mutation_p.S337N|PTPRB_uc001swa.3_Missense_Mutation_p.S337N|PTPRB_uc001swd.3_Missense_Mutation_p.S336N|PTPRB_uc009zrr.1_Missense_Mutation_p.S216N|PTPRB_uc001swe.2_Missense_Mutation_p.S337N	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	119	Fibronectin type-III 2.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTTCTCTTTACTGACTCCAAA	0.358													14	28	---	---	---	---	PASS
TBC1D15	64786	broad.mit.edu	37	12	72287057	72287057	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72287057C>G	uc001swu.2	+	6	685	c.676C>G	c.(676-678)CAG>GAG	p.Q226E	TBC1D15_uc009zrv.2_Missense_Mutation_p.Q105E|TBC1D15_uc010stt.1_Missense_Mutation_p.Q212E|TBC1D15_uc001swv.2_Missense_Mutation_p.Q226E|TBC1D15_uc001sww.2_5'UTR	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	204							protein binding|Rab GTPase activator activity				0						GAGTCTTTCACAGTCTTTTGA	0.303													17	68	---	---	---	---	PASS
GLIPR1L2	144321	broad.mit.edu	37	12	75804329	75804329	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75804329G>T	uc001sxr.1	+	2	358	c.350G>T	c.(349-351)GGT>GTT	p.G117V	GLIPR1L2_uc001sxp.1_Missense_Mutation_p.G117V|GLIPR1L2_uc001sxq.1_Missense_Mutation_p.G10V	NM_152436	NP_689649	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	117						integral to membrane				ovary(1)	1						TATGGTATTGGTGAAAATATG	0.348													52	95	---	---	---	---	PASS
CCDC41	51134	broad.mit.edu	37	12	94769671	94769671	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94769671C>A	uc001tdd.2	-	8	1510	c.924G>T	c.(922-924)TTG>TTT	p.L308F	CCDC41_uc001tde.2_Missense_Mutation_p.L308F|CCDC41_uc009zsw.1_RNA|CCDC41_uc001tdf.2_Missense_Mutation_p.L308F	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	300	Potential.										0						CTTTACTGGACAATGTATTTA	0.249													14	31	---	---	---	---	PASS
DEPDC4	120863	broad.mit.edu	37	12	100660851	100660851	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100660851C>A	uc001thi.2	-	1	7	c.4G>T	c.(4-6)GTG>TTG	p.V2L	SCYL2_uc009ztw.1_5'Flank|SCYL2_uc001thm.1_5'Flank|SCYL2_uc001thn.2_5'Flank|DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Missense_Mutation_p.V2L|DEPDC4_uc009ztv.1_Missense_Mutation_p.V2L|DEPDC4_uc001thk.1_5'UTR|DEPDC4_uc001thl.1_RNA	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	2					intracellular signal transduction						0						TCCCCTGGCACCATAGCCCCG	0.652													15	58	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105623013	105623013	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105623013G>C	uc001tlf.1	-						APPL2_uc010swt.1_Intron|APPL2_uc001tlg.1_Intron|APPL2_uc010swu.1_Intron|APPL2_uc009zuq.2_Intron	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH						cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						TGGAAGAAAAGAAGAAAAAAG	0.468													8	16	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109644571	109644571	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109644571G>A	uc001tob.2	+	20	3089	c.2970G>A	c.(2968-2970)GAG>GAA	p.E990E	ACACB_uc001toc.2_Silent_p.E990E	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	990					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TCCTCGGAGAGAAACTGCACC	0.527													16	241	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112182553	112182553	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112182553G>C	uc001tsq.2	+	13	2021	c.1821G>C	c.(1819-1821)GAG>GAC	p.E607D	ACAD10_uc001tsp.2_Missense_Mutation_p.E607D|ACAD10_uc009zvx.2_Missense_Mutation_p.E638D|ACAD10_uc001tss.1_RNA	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	607							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						TTTTCAAAGAGATGCCCTTCA	0.537													33	69	---	---	---	---	PASS
TAOK3	51347	broad.mit.edu	37	12	118639252	118639252	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118639252C>A	uc001twx.2	-	12	1131	c.836G>T	c.(835-837)CGA>CTA	p.R279L	TAOK3_uc001tww.2_Missense_Mutation_p.R109L|TAOK3_uc001twy.3_Missense_Mutation_p.R279L	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	279					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGCCGGTCTCGTCGAACAAA	0.393													25	45	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121789999	121789999	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121789999C>A	uc001uag.2	-	1	267	c.145G>T	c.(145-147)GAG>TAG	p.E49*	ANAPC5_uc001uah.2_Intron	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a	49					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACGGCGCCCTCGCCTGTGCGG	0.617													18	32	---	---	---	---	PASS
KDM2B	84678	broad.mit.edu	37	12	121958890	121958890	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121958890G>A	uc001uat.2	-	9	1049	c.945C>T	c.(943-945)GCC>GCT	p.A315A	KDM2B_uc001uas.2_Silent_p.A284A|KDM2B_uc001uau.2_Silent_p.A198A|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	315	JmjC.				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						GGGTGTAGACGGCATGGATCC	0.617													12	38	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124812033	124812033	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124812033T>C	uc010tay.1	-	47	7291	c.7135A>G	c.(7135-7137)AAT>GAT	p.N2379D	NCOR2_uc010taz.1_Intron|NCOR2_uc010tax.1_Intron	NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1	2380					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GCACTGGCATTCAGAGGGTTA	0.602													30	62	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132549312	132549312	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132549312C>T	uc001ujn.2	+	47	8469	c.8434C>T	c.(8434-8436)CAA>TAA	p.Q2812*	EP400_uc001ujl.2_Nonsense_Mutation_p.Q2811*|EP400_uc001ujm.2_Nonsense_Mutation_p.Q2731*|EP400_uc001ujp.2_Nonsense_Mutation_p.Q29*	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2848					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGCCCAAGTGCAAGTGCAGAC	0.677													19	34	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32920973	32920973	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32920973A>G	uc001uub.1	+	13	7174	c.6947A>G	c.(6946-6948)AAA>AGA	p.K2316R		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2316					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GGCACAATAAAAGATCGAAGA	0.269			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			10	51	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32944672	32944672	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32944672T>C	uc001uub.1	+	19	8692	c.8465T>C	c.(8464-8466)ATT>ACT	p.I2822T		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2822					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GATGTAATTATTCAAAGAGCA	0.303			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			46	67	---	---	---	---	PASS
DGKH	160851	broad.mit.edu	37	13	42740818	42740818	+	Intron	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42740818A>T	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		AGGGTAACTGATTATTGATAA	0.373													13	68	---	---	---	---	PASS
ENOX1	55068	broad.mit.edu	37	13	43934079	43934079	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43934079C>T	uc001uza.3	-	7	797	c.497G>A	c.(496-498)GGT>GAT	p.G166D	ENOX1_uc001uzb.3_Missense_Mutation_p.G166D|ENOX1_uc001uzc.3_Missense_Mutation_p.G166D|ENOX1_uc010tfm.1_Translation_Start_Site	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	166	RRM.				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TGTAATATCACCGCACTGTTC	0.408													17	86	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70413282	70413282	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70413282G>T	uc001vip.2	-	6	2034	c.1240C>A	c.(1240-1242)CTA>ATA	p.L414I	KLHL1_uc010thm.1_Missense_Mutation_p.L353I	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	414					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TGATTTTCTAGGTCAGCCAAT	0.308													40	75	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70413283	70413283	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70413283G>T	uc001vip.2	-	6	2033	c.1239C>A	c.(1237-1239)GAC>GAA	p.D413E	KLHL1_uc010thm.1_Missense_Mutation_p.D352E	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	413					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GATTTTCTAGGTCAGCCAATA	0.308													42	75	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70514187	70514187	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70514187G>T	uc001vip.2	-	4	1793	c.999C>A	c.(997-999)GCC>GCA	p.A333A	KLHL1_uc010thm.1_Silent_p.A272A	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	333					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TGTAGCTGTGGGCCACCTTCA	0.403													6	31	---	---	---	---	PASS
CLN5	1203	broad.mit.edu	37	13	77570191	77570191	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77570191G>T	uc001vkc.2	+	3	669	c.641G>T	c.(640-642)TGC>TTC	p.C214F		NM_006493	NP_006484	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	165					brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		GGCGCTGCCTGCTTTTTTGAG	0.403													24	167	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78173468	78173468	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78173468C>A	uc001vki.2	+	14	972	c.802C>A	c.(802-804)CAA>AAA	p.Q268K	SCEL_uc001vkj.2_Missense_Mutation_p.Q248K|SCEL_uc010thx.1_Missense_Mutation_p.Q246K	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	268	2.|16 X approximate tandem repeats.				embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TTAAAGGAATCAAGGTCTTGA	0.343													19	33	---	---	---	---	PASS
SLAIN1	122060	broad.mit.edu	37	13	78334967	78334967	+	Silent	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78334967A>T	uc010thy.1	+	6	970	c.927A>T	c.(925-927)CCA>CCT	p.P309P	SLAIN1_uc001vkk.1_Silent_p.P232P|SLAIN1_uc001vkl.1_Silent_p.P188P|SLAIN1_uc010thz.1_Silent_p.P187P|SLAIN1_uc010aex.1_Silent_p.P74P|SLAIN1_uc010aey.1_Silent_p.P74P|SLAIN1_uc001vkm.2_Silent_p.P188P	NM_144595	NP_653196	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1 B	451										ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		TTCTAGTTCCATCACCGGGAC	0.473													64	80	---	---	---	---	PASS
POU4F1	5457	broad.mit.edu	37	13	79176554	79176554	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79176554T>C	uc001vkv.2	-	2	490	c.256A>G	c.(256-258)AAC>GAC	p.N86D	uc001vku.1_Intron	NM_006237	NP_006228	Q01851	PO4F1_HUMAN	POU domain, class 4, transcription factor 1	86					axonogenesis|regulation of transcription from RNA polymerase II promoter|synapse assembly	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		GGCACGCTGTTCATCGTGTGG	0.592													4	8	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88327907	88327907	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88327907G>T	uc001vln.2	+	2	483	c.264G>T	c.(262-264)TTG>TTT	p.L88F	SLITRK5_uc010tic.1_Intron	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	88	LRR 1.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					ACCTCTTGTTGTCCGGAAACC	0.453													36	221	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92101100	92101100	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92101100G>C	uc010tif.1	+	2	615	c.249G>C	c.(247-249)CAG>CAC	p.Q83H		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	83						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CGGCTCGCCAGGATATGCAGC	0.438													7	66	---	---	---	---	PASS
TMTC4	84899	broad.mit.edu	37	13	101294518	101294518	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101294518T>C	uc001vou.2	-	6	791	c.631A>G	c.(631-633)ATC>GTC	p.I211V	TMTC4_uc001vot.2_Missense_Mutation_p.I230V|TMTC4_uc010tja.1_Missense_Mutation_p.I100V|TMTC4_uc001vow.1_5'UTR	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	211	Helical; (Potential).					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCCAGAAAGATACTCAGCAGC	0.507													19	148	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103519152	103519152	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103519152G>T	uc001vpw.2	+	11	2933	c.2490G>T	c.(2488-2490)AAG>AAT	p.K830N	ERCC5_uc001vpu.1_Missense_Mutation_p.K1284N|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.K662N	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	830	I-domain.				negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ATAAAAACAAGTTTGTAGAAT	0.373			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				14	32	---	---	---	---	PASS
OR4K2	390431	broad.mit.edu	37	14	20345275	20345275	+	Missense_Mutation	SNP	C	A	A	rs74597543	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20345275C>A	uc001vwh.1	+	1	849	c.849C>A	c.(847-849)AAC>AAA	p.N283K		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCACTCTGAACCCAATAATCT	0.368													27	61	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20404190	20404190	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20404190G>C	uc001vwj.1	+	1	365	c.365G>C	c.(364-366)AGA>ACA	p.R122T		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GCATATGACAGATTTATAGCC	0.443													41	88	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20444145	20444145	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20444145C>A	uc010tkx.1	+	1	468	c.468C>A	c.(466-468)TAC>TAA	p.Y156*		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	156	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTCTCCACTACATGACAGTCA	0.458													66	117	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20482683	20482683	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20482683G>T	uc010tky.1	-	1	670	c.670C>A	c.(670-672)CTC>ATC	p.L224I		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	224	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		CTGATAGCGAGGAGGATCACG	0.493													8	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22192539	22192539	+	RNA	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22192539C>A	uc001wbn.2	+	2		c.442C>A								Homo sapiens mRNA for T cell receptor alpha variable 3, partial cds, clone: SEB 36.																		GTGAGCGACTCCGCTTTGTAC	0.488													16	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22265876	22265876	+	Intron	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22265876C>G	uc010tmf.1	+						uc010air.1_Missense_Mutation_p.F53L					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TTAATCTCTTCTGGTATGTCC	0.478													19	92	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22363119	22363119	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22363119G>C	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Missense_Mutation_p.A84P|uc010tmj.1_Missense_Mutation_p.A84P|uc010aiw.1_RNA					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CGGTTTTGAGGCTGAATTTAA	0.502													16	112	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22539448	22539448	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22539448G>T	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wcy.2_Missense_Mutation_p.G115V					SubName: Full=Alpha-chain C region; Flags: Fragment;																		ACAGACTCAGGCGTTTATTTC	0.537													11	48	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22749433	22749433	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22749433G>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc010tmr.1_Missense_Mutation_p.D51H					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CAGTGAGAGTGATTATTATTT	0.463													27	55	---	---	---	---	PASS
HEATR5A	25938	broad.mit.edu	37	14	31774224	31774224	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31774224C>T	uc001wrf.3	-	26	4324	c.4247G>A	c.(4246-4248)GGT>GAT	p.G1416D	HEATR5A_uc010ami.2_Missense_Mutation_p.G1314D	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1703							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TCCTGGGCTACCTGTCAATTT	0.438													36	68	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36096989	36096989	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36096989G>A	uc001wti.2	-	33	5037	c.4646C>T	c.(4645-4647)CCT>CTT	p.P1549L	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.P1549L|RALGAPA1_uc010tpv.1_Missense_Mutation_p.P1562L|RALGAPA1_uc010tpw.1_Missense_Mutation_p.P1596L	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1549	Minimal domain that binds to TCF3/E12 (By similarity).				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						AAAGAGTTCAGGAGAAAGTTC	0.308													28	43	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356450	42356450	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356450C>G	uc001wvm.2	+	3	1820	c.622C>G	c.(622-624)CAG>GAG	p.Q208E	LRFN5_uc010ana.2_Missense_Mutation_p.Q208E	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	208	Extracellular (Potential).|LRR 7.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		AAATAAATTGCAGAAGCTACC	0.428										HNSCC(30;0.082)			31	66	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45658089	45658089	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45658089G>T	uc001wwd.3	+	20	4963	c.4864G>T	c.(4864-4866)GAA>TAA	p.E1622*	FANCM_uc010anf.2_Nonsense_Mutation_p.E1596*|FANCM_uc001wwe.3_Nonsense_Mutation_p.E1158*|FANCM_uc010ang.2_Nonsense_Mutation_p.E836*	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1622					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						AAGTGAAGAAGAAGTTTGTGT	0.323								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				39	59	---	---	---	---	PASS
MGAT2	4247	broad.mit.edu	37	14	50088626	50088626	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50088626G>T	uc001wwr.2	+	1	1138	c.640G>T	c.(640-642)GAG>TAG	p.E214*	SDCCAG1_uc010anj.1_Intron|RPL36AL_uc001wwq.1_5'Flank	NM_002408	NP_002399	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein	214	Lumenal (Potential).				oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity				0	all_epithelial(31;0.0021)|Breast(41;0.0124)					CATCAATGCTGAGTATCCCGA	0.483													61	85	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51259444	51259444	+	Missense_Mutation	SNP	C	G	G	rs143800977	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51259444C>G	uc001wym.2	-	5	612	c.421G>C	c.(421-423)GGT>CGT	p.G141R	NIN_uc001wyi.2_Missense_Mutation_p.G141R|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.G141R|NIN_uc010tqp.1_Missense_Mutation_p.G147R|NIN_uc001wyo.2_Missense_Mutation_p.G141R|NIN_uc001wyp.1_Missense_Mutation_p.G103R	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	141					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CTGCAGTCACCGGCTGGGATG	0.582			T	PDGFRB	MPD								21	32	---	---	---	---	PASS
PYGL	5836	broad.mit.edu	37	14	51398409	51398409	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51398409C>A	uc001wyu.2	-	4	637	c.510G>T	c.(508-510)AAG>AAT	p.K170N	PYGL_uc010tqq.1_Missense_Mutation_p.K136N|PYGL_uc001wyv.2_5'UTR|PYGL_uc001wyw.3_Missense_Mutation_p.K170N	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1	170					glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	CATCTCGGATCTTCTGATTGA	0.423													17	130	---	---	---	---	PASS
SLC35F4	341880	broad.mit.edu	37	14	58048010	58048010	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58048010G>T	uc001xdb.1	-	4	837	c.837C>A	c.(835-837)TCC>TCA	p.S279S	SLC35F4_uc010aoz.1_RNA|SLC35F4_uc010apa.1_Silent_p.S120S	NM_001080455	NP_001073924			solute carrier family 35, member F4											ovary(2)	2						AGAACAGAGCGGAGACATCCG	0.408													6	24	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58471896	58471896	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58471896C>A	uc001xdc.2	-	7	2237	c.2126G>T	c.(2125-2127)GGT>GTT	p.G709V	C14orf37_uc010tro.1_Missense_Mutation_p.G747V|C14orf37_uc001xdd.2_Missense_Mutation_p.G709V	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	709	Extracellular (Potential).					integral to membrane	binding				0						AGACATGTAACCAGCCTGCAT	0.507													32	56	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60193708	60193708	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60193708G>T	uc001xen.1	-	3	1903	c.1694C>A	c.(1693-1695)GCG>GAG	p.A565E	RTN1_uc001xem.1_Missense_Mutation_p.A145E	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	565					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CTTTGTGGCCGCAGGACTTTG	0.617													4	9	---	---	---	---	PASS
SIX1	6495	broad.mit.edu	37	14	61115903	61115903	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61115903G>T	uc001xfb.3	-	1	253	c.5C>A	c.(4-6)TCG>TAG	p.S2*		NM_005982	NP_005973	Q15475	SIX1_HUMAN	SIX homeobox 1	2					branching involved in ureteric bud morphogenesis|embryonic cranial skeleton morphogenesis|epithelial cell differentiation|inner ear morphogenesis|mesonephric tubule formation|metanephric mesenchyme development|myoblast migration|negative regulation of neuron apoptosis|organ induction|pattern specification process|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|protein localization to nucleus|regulation of branch elongation involved in ureteric bud branching|regulation of neuron differentiation|skeletal muscle tissue development|thymus development|thyroid gland development	nucleolus|transcription factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		CGGCAGCATCGACATGGCTGG	0.726													7	34	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68038551	68038551	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68038551G>T	uc001xjl.1	+	10	1659	c.1517G>T	c.(1516-1518)CGA>CTA	p.R506L	PLEKHH1_uc010tsw.1_Missense_Mutation_p.R74L|PLEKHH1_uc001xjm.1_Missense_Mutation_p.R21L|PLEKHH1_uc001xjn.1_Missense_Mutation_p.R21L	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	506						cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GCGAGTTTCCGAATCTCGGTC	0.602													12	39	---	---	---	---	PASS
DCAF5	8816	broad.mit.edu	37	14	69529207	69529207	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69529207T>C	uc001xkp.2	-	8	1187	c.968A>G	c.(967-969)AAC>AGC	p.N323S	DCAF5_uc001xkq.2_Missense_Mutation_p.N322S	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	323						CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2						GAAGGCTCCGTTGACCACCCT	0.418													41	45	---	---	---	---	PASS
ADAM20	8748	broad.mit.edu	37	14	70989980	70989980	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70989980C>A	uc001xme.2	-	2	1890	c.1645G>T	c.(1645-1647)GTG>TTG	p.V549L		NM_003814	NP_003805	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20 preproprotein	499	Cys-rich.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		AAGGCATTCACATTACAGGAG	0.438													41	153	---	---	---	---	PASS
C14orf169	79697	broad.mit.edu	37	14	73957825	73957825	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73957825A>T	uc001xok.1	+	1	182	c.103A>T	c.(103-105)AGG>TGG	p.R35W	HEATR4_uc010tua.1_Intron	NM_024644	NP_078920	Q9H6W3	NO66_HUMAN	chromosome 14 open reading frame 169	35					negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K4 specific)|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.215)		CCTGCCCTTGAGGTCCAGGAA	0.672													21	36	---	---	---	---	PASS
CHGA	1113	broad.mit.edu	37	14	93397669	93397669	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93397669G>A	uc001ybc.3	+	6	690	c.430G>A	c.(430-432)GAA>AAA	p.E144K	CHGA_uc010aum.2_RNA|CHGA_uc001ybd.3_Intron	NM_001275	NP_001266	P10645	CMGA_HUMAN	chromogranin A precursor	144					regulation of blood pressure	extracellular region|stored secretory granule				skin(2)	2		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		GAAAAGTGGTGAAGCCACAGA	0.537													5	25	---	---	---	---	PASS
MIR655	724025	broad.mit.edu	37	14	101515907	101515907	+	RNA	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101515907G>A	hsa-mir-655|MI0003677	+			c.21G>A			MIR487A_hsa-mir-487a|MI0002471_5'Flank																	0						GGATATTTGAGGAGAGGTTAT	0.463													43	73	---	---	---	---	PASS
MARK3	4140	broad.mit.edu	37	14	103915265	103915265	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103915265G>T	uc001ymz.3	+	4	973	c.307G>T	c.(307-309)GAA>TAA	p.E103*	MARK3_uc001ymx.3_Nonsense_Mutation_p.E103*|MARK3_uc001ymw.3_Nonsense_Mutation_p.E103*|MARK3_uc001yna.3_Nonsense_Mutation_p.E103*|MARK3_uc001ymy.3_Nonsense_Mutation_p.E103*|MARK3_uc010awp.2_Nonsense_Mutation_p.E103*	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	103	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			GCTCTTCAGAGAAGTAAGAAT	0.254													26	136	---	---	---	---	PASS
TMEM179	388021	broad.mit.edu	37	14	105070804	105070804	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105070804G>T	uc001yox.1	-	1	294	c.275C>A	c.(274-276)ACG>AAG	p.T92K		NM_207379	NP_997262	Q6ZVK1	T179A_HUMAN	transmembrane protein 179	92	Helical; (Potential).					integral to membrane					0			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		GAAGAAGAGCGTGCGCCAGGC	0.751													3	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22482857	22482857	+	IGR	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482857C>A								OR4N3P (68472 upstream) : MIR1268 (30372 downstream)																							AATACACGGCCATGTCCTCAG	0.547													96	750	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25307495	25307495	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25307495C>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-5_uc001yxo.2_RNA|SNORD116-2_uc001yxp.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GATGATGAGTCCCCCATAAAA	0.498													49	96	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25494364	25494364	+	Intron	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25494364T>C	uc001zae.2	+						SNORD115-11_uc001zal.1_RNA|SNORD115-44_uc001zam.1_5'Flank					Homo sapiens clone Rt-16 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		ATGAGAACCTTATATTGTCCT	0.517													41	298	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25616127	25616127	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25616127G>A	uc001zaq.2	-	4	1203	c.1203C>T	c.(1201-1203)ATC>ATT	p.I401I	uc001zae.2_Intron|UBE3A_uc001zar.2_Silent_p.I378I|UBE3A_uc001zas.2_Silent_p.I398I|UBE3A_uc001zat.2_Silent_p.I378I	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	401	E6-binding.				brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TGGACTCAGGGATGGGCTCTT	0.458													27	60	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	27890494	27890494	+	IGR	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27890494C>A								GABRG3 (112360 upstream) : OCA2 (109531 downstream)																							TGAAGCTGATCGTTGTGTAAT	0.428													89	195	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28196993	28196993	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28196993A>C	uc001zbh.3	-	18	1998	c.1888T>G	c.(1888-1890)TTG>GTG	p.L630V	OCA2_uc010ayv.2_Missense_Mutation_p.L606V	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	630	Helical; (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ACAAATCCCAACACTGTCAGG	0.433									Oculocutaneous_Albinism				10	40	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28389936	28389936	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28389936C>G	uc001zbj.2	-	72	11129	c.11023G>C	c.(11023-11025)GAC>CAC	p.D3675H		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3675					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTGGACCAGTCGGACCACTCT	0.557													20	69	---	---	---	---	PASS
MTMR10	54893	broad.mit.edu	37	15	31234047	31234047	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31234047T>C	uc001zfh.1	-	16	2058	c.1960A>G	c.(1960-1962)ATA>GTA	p.I654V	MTMR15_uc001zff.2_3'UTR|MTMR15_uc001zfe.2_3'UTR|MTMR10_uc010ubk.1_Missense_Mutation_p.I68V|MTMR10_uc001zfg.1_Missense_Mutation_p.I235V|MTMR10_uc010azx.1_Missense_Mutation_p.I406V|MTMR10_uc001zfi.1_3'UTR	NM_017762	NP_060232	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	654	Myotubularin phosphatase.						phosphatase activity			ovary(1)	1		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		CACAGTTTTATGTGTGTTCCA	0.532													46	98	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31294039	31294039	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31294039C>T	uc001zfm.2	-	27	4926	c.4798G>A	c.(4798-4800)GAA>AAA	p.E1600K	TRPM1_uc010azy.2_Missense_Mutation_p.E1507K|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1600	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CATTCAGTTTCTGTGGAAGCT	0.358													26	75	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34049697	34049697	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34049697C>A	uc001zhi.2	+	60	8675	c.8605C>A	c.(8605-8607)CAG>AAG	p.Q2869K	RYR3_uc010bar.2_Missense_Mutation_p.Q2869K	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2869	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCTGGTTGACCAGTACTTCAC	0.468													5	11	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34102748	34102748	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34102748C>T	uc001zhi.2	+	71	10165	c.10095C>T	c.(10093-10095)TCC>TCT	p.S3365S	RYR3_uc010bar.2_Silent_p.S3360S	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3365					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCCAGACCTCCCTCATCGTGG	0.517													19	45	---	---	---	---	PASS
VPS18	57617	broad.mit.edu	37	15	41192320	41192320	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41192320G>T	uc001zne.2	+	4	1643	c.1304G>T	c.(1303-1305)CGC>CTC	p.R435L		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	435					endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TTCTGCTTTCGCCAGCGTCGC	0.607													75	137	---	---	---	---	PASS
LCMT2	9836	broad.mit.edu	37	15	43621185	43621185	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43621185T>A	uc001zrg.2	-	1	1707	c.1503A>T	c.(1501-1503)CGA>CGT	p.R501R	LCMT2_uc010udn.1_Silent_p.R80R|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	501					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CCACCACGCTTCGACCCCCAT	0.512													99	146	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44876661	44876661	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44876661C>G	uc001ztx.2	-	30	5248	c.5217G>C	c.(5215-5217)AAG>AAC	p.K1739N	SPG11_uc010bdw.2_Missense_Mutation_p.K28N|SPG11_uc010ueh.1_Missense_Mutation_p.K1739N|SPG11_uc010uei.1_Missense_Mutation_p.K1739N|SPG11_uc001zty.1_Missense_Mutation_p.K468N	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1739	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TTGAATTTTTCTTAAAATTCT	0.433													5	92	---	---	---	---	PASS
DUOXA2	405753	broad.mit.edu	37	15	45409295	45409295	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45409295G>A	uc001zuo.2	+	5	841	c.561G>A	c.(559-561)GCG>GCA	p.A187A	DUOX2_uc010bea.2_5'Flank|DUOX2_uc001zun.2_5'Flank|DUOXA2_uc010beb.2_RNA	NM_207581	NP_997464	Q1HG44	DOXA2_HUMAN	dual oxidase activator 2	187	Helical; (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane					0		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCAGGGTGGCGTTCTGCTTCT	0.692													9	39	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48543965	48543965	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48543965C>A	uc001zwn.3	+	15	2156	c.1940C>A	c.(1939-1941)CCA>CAA	p.P647Q	SLC12A1_uc010uew.1_Missense_Mutation_p.P453Q|SLC12A1_uc010bem.2_Missense_Mutation_p.P647Q|SLC12A1_uc001zwq.3_Missense_Mutation_p.P418Q|SLC12A1_uc001zwr.3_Missense_Mutation_p.P374Q	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	647					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TGTAAGAAGCCAGGTAAGATA	0.313													16	47	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48780307	48780307	+	Intron	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48780307T>A	uc001zwx.1	-							NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor						heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ATCCCAAACTTACCCATGCAG	0.478													55	116	---	---	---	---	PASS
SHC4	399694	broad.mit.edu	37	15	49254801	49254801	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49254801T>C	uc001zxb.1	-	1	841	c.412A>G	c.(412-414)AGT>GGT	p.S138G		NM_203349	NP_976224	Q6S5L8	SHC4_HUMAN	rai-like protein	138	CH2.				intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CCGGACCTACTTAAACTGGTT	0.627													25	39	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50271996	50271996	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50271996C>A	uc001zxu.2	-	12	994	c.852G>T	c.(850-852)CTG>CTT	p.L284L	ATP8B4_uc010ber.2_Silent_p.L157L|ATP8B4_uc010ufd.1_Silent_p.L157L|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	284	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CCAAGCATATCAGAAACCCAA	0.353													41	69	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50549686	50549686	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50549686A>C	uc001zxz.2	-	4	483	c.377T>G	c.(376-378)ATG>AGG	p.M126R	HDC_uc010uff.1_Missense_Mutation_p.M126R|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Missense_Mutation_p.M126R	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	126					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	AAGTCCCAGCATTTTTGCCAA	0.582													53	111	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51830482	51830482	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51830482C>A	uc002abf.2	-	10	1498	c.1273G>T	c.(1273-1275)GAT>TAT	p.D425Y	DMXL2_uc010ufy.1_Missense_Mutation_p.D425Y|DMXL2_uc010bfa.2_Missense_Mutation_p.D425Y	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	425						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		CTATCTGCATCATCATTTTCA	0.338													62	109	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51830483	51830483	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51830483A>C	uc002abf.2	-	10	1497	c.1272T>G	c.(1270-1272)GAT>GAG	p.D424E	DMXL2_uc010ufy.1_Missense_Mutation_p.D424E|DMXL2_uc010bfa.2_Missense_Mutation_p.D424E	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	424						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		TATCTGCATCATCATTTTCAT	0.338													61	106	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59497690	59497690	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59497690C>A	uc002aga.2	-						LDHAL6B_uc002agb.2_5'Flank	NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE						actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		GATACCTGGCCAAGAATGGAA	0.348													33	73	---	---	---	---	PASS
RORA	6095	broad.mit.edu	37	15	60919521	60919521	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60919521G>A	uc002agv.2	-	1	209	c.53C>T	c.(52-54)CCG>CTG	p.P18L	RORA_uc002agw.2_Missense_Mutation_p.P18L|RORA_uc002agx.2_Intron	NM_134260	NP_599022	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform b	18	Modulating.		P -> S (in a colorectal cancer sample; somatic mutation).		positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	p.P18S(1)		large_intestine(1)|ovary(1)	2						GATTGACCACGGCACTCTTGC	0.488													31	186	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70976770	70976770	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70976770T>A	uc002asr.2	-	8	722	c.618A>T	c.(616-618)CTA>CTT	p.L206L	UACA_uc010uke.1_Intron|UACA_uc002asq.2_Silent_p.L193L|UACA_uc010bin.1_Silent_p.L192L	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	206	ANK 6.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						ATTCGCAACCTAGCATGAGGG	0.393													73	148	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77450849	77450849	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77450849G>A	uc002bcm.2	-	4	3635	c.3327C>T	c.(3325-3327)AAC>AAT	p.N1109N	SGK269_uc002bcn.2_Silent_p.N1109N	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1109					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		ACTTACCTAAGTTGCTGTATG	0.398													51	87	---	---	---	---	PASS
ACSBG1	23205	broad.mit.edu	37	15	78466839	78466839	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78466839T>C	uc002bdh.2	-	12	1786	c.1730A>G	c.(1729-1731)AAT>AGT	p.N577S	ACSBG1_uc010umw.1_Missense_Mutation_p.N573S|ACSBG1_uc010umx.1_Missense_Mutation_p.N335S	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN	lipidosin	577					long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1						AGGGGGCACATTCTCCCCACC	0.597													24	47	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84558881	84558881	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84558881G>T	uc002bjz.3	+	11	1317	c.1093G>T	c.(1093-1095)GAA>TAA	p.E365*	ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.E365*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.E365*	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	365						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAATTCTGCTGAATGTGTGGA	0.393													59	121	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85360218	85360218	+	Silent	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85360218G>C	uc002ble.2	+	1	308	c.141G>C	c.(139-141)GCG>GCC	p.A47A		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	47					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCTGGCCAGCGGTTGACCTGG	0.701													12	31	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85619149	85619149	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85619149G>T	uc002blh.2	+	4	680	c.491G>T	c.(490-492)AGG>ATG	p.R164M	PDE8A_uc002bli.2_Missense_Mutation_p.R164M|PDE8A_uc010bnc.2_Translation_Start_Site|PDE8A_uc010bnd.2_Translation_Start_Site|PDE8A_uc002blj.2_Translation_Start_Site|PDE8A_uc002blk.2_Translation_Start_Site	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	164					cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			GTAGTACGCAGGTAAACTTTC	0.328													98	240	---	---	---	---	PASS
KIF7	374654	broad.mit.edu	37	15	90176085	90176085	+	Missense_Mutation	SNP	G	A	A	rs141463861	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90176085G>A	uc002bof.2	-	14	2938	c.2861C>T	c.(2860-2862)ACG>ATG	p.T954M	KIF7_uc010upw.1_Missense_Mutation_p.T440M	NM_198525	NP_940927	Q2M1P5	KIF7_HUMAN	kinesin family member 7	954	Potential.				microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CTCCAGCCCCGTCTTCTCCTG	0.652													11	16	---	---	---	---	PASS
NR2F2	7026	broad.mit.edu	37	15	96877844	96877844	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96877844C>A	uc010uri.1	+						NR2F2_uc002btp.2_Intron|NR2F2_uc010urj.1_Intron|NR2F2_uc010urk.1_Intron	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TAGGAAGGAGCCCTGTCTTCT	0.592													21	36	---	---	---	---	PASS
MSLN	10232	broad.mit.edu	37	16	814992	814992	+	Missense_Mutation	SNP	G	T	T	rs34729817		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:814992G>T	uc002cjw.1	+	7	517	c.466G>T	c.(466-468)GCT>TCT	p.A156S	MSLN_uc002cjt.1_Missense_Mutation_p.A156S|MSLN_uc002cju.1_Missense_Mutation_p.A156S|MSLN_uc010brd.1_Missense_Mutation_p.A155S|MSLN_uc002cjv.1_Missense_Mutation_p.A156S|MSLN_uc002cjx.1_Missense_Mutation_p.A156S|MSLN_uc002cjy.1_5'Flank	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	156					cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)				CCCGAGGGGGGCTCCCGAGCG	0.692													12	19	---	---	---	---	PASS
C1QTNF8	390664	broad.mit.edu	37	16	1144031	1144031	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1144031C>T	uc010uuw.1	-	4	503	c.229G>A	c.(229-231)GTC>ATC	p.V77I		NM_207419	NP_997302	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8	77	Collagen-like.					collagen				skin(1)	1		Hepatocellular(780;0.00369)				CGACCTCGGACGCCGGCCTCA	0.766													9	12	---	---	---	---	PASS
ZNF434	54925	broad.mit.edu	37	16	3434703	3434703	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3434703G>C	uc002cuz.2	-	5	1156	c.354C>G	c.(352-354)ATC>ATG	p.I118M	ZNF434_uc002cux.3_Missense_Mutation_p.I329M|ZNF434_uc010uwx.1_Missense_Mutation_p.I41M|ZNF434_uc002cuy.3_Missense_Mutation_p.I41M|ZNF434_uc010uwy.1_Missense_Mutation_p.I41M|ZNF434_uc010uwz.1_Missense_Mutation_p.I329M|ZNF434_uc010uxa.1_Missense_Mutation_p.I118M	NM_017810	NP_060280	Q9NX65	ZN434_HUMAN	zinc finger protein 434	118					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CCTCATAAAAGATACAAGGCT	0.517													98	207	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4415002	4415002	+	Splice_Site	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4415002A>T	uc002cwh.3	-	11	1018	c.898_splice	c.e11+1	p.V300_splice	CORO7_uc002cwe.2_Splice_Site|CORO7_uc002cwf.2_Splice_Site_p.V300_splice|CORO7_uc002cwg.3_Splice_Site_p.V80_splice|CORO7_uc010uxh.1_Splice_Site_p.V282_splice|CORO7_uc010uxi.1_Splice_Site_p.V215_splice|CORO7_uc002cwi.1_Splice_Site_p.V80_splice|CORO7_uc010uxj.1_Splice_Site|CORO7_uc010btp.1_Splice_Site_p.V80_splice	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						AGCAAGGCTTACCTGGGCTCA	0.622													5	10	---	---	---	---	PASS
ANKS3	124401	broad.mit.edu	37	16	4752157	4752157	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4752157T>C	uc002cxj.1	-	9	1250	c.955A>G	c.(955-957)ACC>GCC	p.T319A	ANKS3_uc010uxr.1_5'Flank|ANKS3_uc002cxh.1_5'Flank|ANKS3_uc002cxi.1_Missense_Mutation_p.T246A|ANKS3_uc002cxk.2_Missense_Mutation_p.T190A|ANKS3_uc002cxl.2_Missense_Mutation_p.T146A|ANKS3_uc010uxs.1_Missense_Mutation_p.T246A|ANKS3_uc002cxm.2_Missense_Mutation_p.T113A	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain	319											0						ATGGGGGAGGTGACATCCCGG	0.572													15	26	---	---	---	---	PASS
ZP2	7783	broad.mit.edu	37	16	21210929	21210929	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21210929C>A	uc002dii.2	-	16	1889	c.1889G>T	c.(1888-1890)TGT>TTT	p.C630F	ZP2_uc010bwn.1_Missense_Mutation_p.C660F	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	630	Extracellular (Potential).|ZP.				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		GGTCACAGAACACAGTGGGGA	0.448													18	45	---	---	---	---	PASS
NFATC2IP	84901	broad.mit.edu	37	16	28970373	28970373	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28970373G>T	uc002dru.2	+	7	1068	c.1053G>T	c.(1051-1053)CGG>CGT	p.R351R	uc010vct.1_Intron|NFATC2IP_uc002drt.2_Silent_p.R72R|NFATC2IP_uc002drv.2_Silent_p.R70R|NFATC2IP_uc010vdh.1_Silent_p.R59R	NM_032815	NP_116204	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells,	351	Ubiquitin-like.					cytoplasm|nucleus				ovary(1)	1						TCCAGCTCCGGGTGCAGGGAA	0.587													22	96	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30990907	30990907	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30990907G>A	uc002ead.1	+	14	4486	c.3800G>A	c.(3799-3801)GGG>GAG	p.G1267E		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	1267					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						GCCCGGCGCGGGCTGCCTGCC	0.706													14	17	---	---	---	---	PASS
PRSS36	146547	broad.mit.edu	37	16	31151700	31151700	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31151700C>T	uc002ebd.2	-	14	2263	c.2204G>A	c.(2203-2205)CGA>CAA	p.R735Q	PRSS36_uc010vff.1_Missense_Mutation_p.R510Q|PRSS36_uc010vfg.1_Missense_Mutation_p.R730Q|PRSS36_uc010vfh.1_Intron	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor	735	Peptidase S1 3.				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						GTCACAGATTCGTTGTGTCAA	0.597													11	90	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46695755	46695755	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46695755C>A	uc002eef.3	-	16	2185	c.2086G>T	c.(2086-2088)GTA>TTA	p.V696L	VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_Missense_Mutation_p.V657L	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	696					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CACTCCATTACCCTCTTGCCT	0.398													24	124	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47622893	47622893	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47622893A>G	uc002eev.3	+	10	1000	c.948A>G	c.(946-948)ACA>ACG	p.T316T	PHKB_uc002eeu.3_Silent_p.T309T	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	316					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TTAGCCAGACACTTGATAAAG	0.403													16	61	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50744941	50744941	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50744941T>A	uc002egm.1	+	4	1224	c.1119T>A	c.(1117-1119)CGT>CGA	p.R373R	NOD2_uc010cbk.1_Silent_p.R346R|NOD2_uc002egl.1_Silent_p.R151R|NOD2_uc010cbl.1_Silent_p.R151R|NOD2_uc010cbm.1_Silent_p.R151R|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	373	NACHT.		R -> C (associated with Crohn disease).		activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				ACCCTGACCGTGTCCTGTTAA	0.542													17	81	---	---	---	---	PASS
C16orf70	80262	broad.mit.edu	37	16	67168067	67168067	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67168067G>T	uc002erc.2	+						C16orf70_uc002erd.2_Intron|C16orf70_uc002ere.1_Intron	NM_025187	NP_079463	Q9BSU1	CP070_HUMAN	lin-10											ovary(2)	2		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ACCTTTGTTTGCAGCCCAATT	0.498													20	86	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67290598	67290598	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67290598G>T	uc002esm.2	+						SLC9A5_uc010cee.2_Intron|SLC9A5_uc010vji.1_Intron	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CCTCGGTATTGCTGGCACCCT	0.577													4	95	---	---	---	---	PASS
CHST5	23563	broad.mit.edu	37	16	75563610	75563610	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75563610C>A	uc002fei.2	-	3	2068	c.673G>T	c.(673-675)GAC>TAC	p.D225Y	CHST5_uc002fej.1_Missense_Mutation_p.D231Y	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	225	Lumenal (Potential).|PAPS (By similarity).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						GCCCGCGGGTCGCGCACCAGG	0.701													14	46	---	---	---	---	PASS
MON1B	22879	broad.mit.edu	37	16	77225393	77225393	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77225393G>A	uc002fez.2	+	2	341	c.11G>A	c.(10-12)GGA>GAA	p.G4E	MON1B_uc010vnf.1_Missense_Mutation_p.G4E|MON1B_uc010vng.1_Intron|MON1B_uc002ffa.2_5'Flank	NM_014940	NP_055755	Q7L1V2	MON1B_HUMAN	MON1 homolog B	4							protein binding				0						ATGGAGGTCGGAGGAGACACT	0.512													3	26	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81199487	81199487	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81199487G>A	uc002fgh.1	-	19	3175	c.3175C>T	c.(3175-3177)CCA>TCA	p.P1059S	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1059	REJ.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AGCATGGCTGGAAGGCCCCCT	0.562													12	13	---	---	---	---	PASS
FBXO31	79791	broad.mit.edu	37	16	87367544	87367544	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87367544G>A	uc002fjw.2	-	8	1389	c.1345C>T	c.(1345-1347)CCC>TCC	p.P449S	FBXO31_uc010vot.1_Missense_Mutation_p.P277S|FBXO31_uc002fjv.2_Missense_Mutation_p.P341S	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31	449					cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		ACGCCCACGGGCAGCACGAAC	0.672													10	58	---	---	---	---	PASS
GALNS	2588	broad.mit.edu	37	16	88908314	88908314	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88908314C>A	uc002fly.3	-	3	399	c.310G>T	c.(310-312)GCC>TCC	p.A104S	GALNS_uc010cid.2_Missense_Mutation_p.A110S|GALNS_uc002flz.3_5'UTR	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	104						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	CCGTTTCTGGCATGGGCGTTG	0.632													5	25	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89927144	89927144	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89927144G>A	uc002foz.1	+	10	1568	c.1516G>A	c.(1516-1518)GGC>AGC	p.G506S	SPIRE2_uc010ciw.1_Missense_Mutation_p.G506S|SPIRE2_uc002fpa.1_Missense_Mutation_p.G458S|SPIRE2_uc010cix.1_Missense_Mutation_p.G373S	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	506					transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		CAGCAACCGGGGCTCCTCGGG	0.677											OREG0024056	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	9	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	973199	973199	+	Intron	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:973199A>G	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010vqg.1_Intron|ABR_uc002fsg.2_Intron|ABR_uc002fsh.1_Intron	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CCCTGGACTCACACACTCACC	0.652													12	17	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2601427	2601427	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2601427T>C	uc002fuy.1	-	10	1696	c.1610A>G	c.(1609-1611)AAC>AGC	p.N537S	KIAA0664_uc002fux.1_Missense_Mutation_p.N469S	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	537							binding			breast(2)	2						GTCACGGTCGTTGAGCACCTG	0.642													4	6	---	---	---	---	PASS
P2RX1	5023	broad.mit.edu	37	17	3807227	3807227	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3807227G>T	uc002fww.2	-	5	960	c.519C>A	c.(517-519)ATC>ATA	p.I173I		NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1	173	Extracellular (Potential).				platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		GTTACCGCGGGATGTCGTCAT	0.572													10	70	---	---	---	---	PASS
MINK1	50488	broad.mit.edu	37	17	4764042	4764042	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4764042C>A	uc010vsl.1	+						MINK1_uc010vsk.1_Intron|MINK1_uc010vsm.1_Intron|MINK1_uc010vsn.1_Intron|MINK1_uc010vso.1_Intron	NM_153827	NP_722549	Q8N4C8	MINK1_HUMAN	misshapen-like kinase 1 isoform 3						JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6						CTCCCCTGGTCAGTTCTAGGG	0.622													16	40	---	---	---	---	PASS
ZNF232	7775	broad.mit.edu	37	17	5015123	5015123	+	5'UTR	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5015123C>A	uc002gas.2	-	1					ZNF232_uc002gar.1_5'UTR|ZNF232_uc002gat.2_5'UTR|ZNF232_uc010vsv.1_5'UTR	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN	zinc finger protein 232						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TCCATCGGGGCGCTGCCGCGA	0.697													9	41	---	---	---	---	PASS
PITPNM3	83394	broad.mit.edu	37	17	6374626	6374626	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6374626C>A	uc002gdd.3	-	12	1630	c.1479G>T	c.(1477-1479)CGG>CGT	p.R493R	PITPNM3_uc010cln.2_Silent_p.R457R|PITPNM3_uc010clm.2_5'UTR|PITPNM3_uc002gdc.3_Silent_p.R84R	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	493	DDHD.				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GCGGGCTGTCCCGGGAGCTGC	0.662													8	12	---	---	---	---	PASS
TEKT1	83659	broad.mit.edu	37	17	6733599	6733599	+	Missense_Mutation	SNP	G	C	C	rs143066578		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6733599G>C	uc002gdt.2	-	2	207	c.97C>G	c.(97-99)CGA>GGA	p.R33G	TEKT1_uc010vth.1_5'UTR	NM_053285	NP_444515	Q969V4	TEKT1_HUMAN	tektin 1	33	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule		p.R33*(1)		ovary(1)|skin(1)	2		Myeloproliferative disorder(207;0.0255)				CGTTCTGATCGGGACCTTTGA	0.468													22	55	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577536	7577536	+	Missense_Mutation	SNP	T	A	A	rs67185453		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577536T>A	uc002gim.2	-	7	939	c.745A>T	c.(745-747)AGG>TGG	p.R249W	TP53_uc002gig.1_Missense_Mutation_p.R249W|TP53_uc002gih.2_Missense_Mutation_p.R249W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117W|TP53_uc010cng.1_Missense_Mutation_p.R117W|TP53_uc002gii.1_Missense_Mutation_p.R117W|TP53_uc010cnh.1_Missense_Mutation_p.R249W|TP53_uc010cni.1_Missense_Mutation_p.R249W|TP53_uc002gij.2_Missense_Mutation_p.R249W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156W|TP53_uc002gio.2_Missense_Mutation_p.R117W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	249	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.N247_P250delNRRP(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.N247_R248delNR(1)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.R249_T256delRPILTIIT(1)|p.R249_P250>SS(1)|p.G245fs*14(1)|p.R249fs*19(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGATGGGCCTCCGGTTCATG	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	64	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578457C>A	uc002gim.2	-	5	667	c.473G>T	c.(472-474)CGC>CTC	p.R158L	TP53_uc002gig.1_Missense_Mutation_p.R158L|TP53_uc002gih.2_Missense_Mutation_p.R158L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26L|TP53_uc010cng.1_Missense_Mutation_p.R26L|TP53_uc002gii.1_Missense_Mutation_p.R26L|TP53_uc010cnh.1_Missense_Mutation_p.R158L|TP53_uc010cni.1_Missense_Mutation_p.R158L|TP53_uc002gij.2_Missense_Mutation_p.R158L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65L|TP53_uc002gio.2_Missense_Mutation_p.R26L|TP53_uc010vug.1_Missense_Mutation_p.R119L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R158H(58)|p.R158L(55)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R65L(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*21(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCCATGGCGCGGACGCGGGT	0.627		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			27	49	---	---	---	---	PASS
PFAS	5198	broad.mit.edu	37	17	8161517	8161517	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8161517G>T	uc002gkr.2	+	11	1477	c.1336G>T	c.(1336-1338)GGC>TGC	p.G446C	PFAS_uc010vuv.1_Missense_Mutation_p.G22C	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	446					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CCCAGAGCCAGGTAAGAGCCT	0.562													46	59	---	---	---	---	PASS
NDEL1	81565	broad.mit.edu	37	17	8351896	8351896	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8351896G>T	uc002glj.2	+	5	615	c.418G>T	c.(418-420)GAA>TAA	p.E140*	NDEL1_uc002gli.2_Nonsense_Mutation_p.E140*	NM_030808	NP_110435	Q9GZM8	NDEL1_HUMAN	nudE nuclear distribution gene E homolog (A.	140	Interaction with KATNB1 (By similarity).|Potential.|Self-association (By similarity).				chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|microtubule|spindle					0						GGAAGACTTTGAACAAAGGCT	0.333													18	65	---	---	---	---	PASS
WDR16	146845	broad.mit.edu	37	17	9480081	9480081	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9480081T>G	uc002gly.2	+	1	138	c.69T>G	c.(67-69)AAT>AAG	p.N23K	STX8_uc002glx.2_5'Flank|WDR16_uc002glz.2_Missense_Mutation_p.N23K|WDR16_uc010coc.2_5'UTR	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform	23						cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						TCGGCTTCAATGGTGAGGCCT	0.537											OREG0024167	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	41	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9830031	9830031	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9830031T>A	uc002gmg.1	-	10	1102	c.941A>T	c.(940-942)GAC>GTC	p.D314V	GAS7_uc010vvc.1_Missense_Mutation_p.D128V|GAS7_uc002gmh.1_Missense_Mutation_p.D174V|GAS7_uc010vvd.1_Missense_Mutation_p.D266V|GAS7_uc002gmi.2_Missense_Mutation_p.D250V|GAS7_uc002gmj.1_Missense_Mutation_p.D254V|GAS7_uc010coh.1_Missense_Mutation_p.D254V	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	314	Potential.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						CTTCTTCATGTCTTTCTTGAA	0.592			T	MLL	AML*								43	69	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10356533	10356533	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10356533A>G	uc002gmn.2	-	24	3158	c.3047T>C	c.(3046-3048)ATG>ACG	p.M1016T	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1016	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GTCCTCCTCCATCTGCAGGTC	0.493													55	76	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12656550	12656550	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12656550A>G	uc002gnn.2	+	10	2244	c.1945A>G	c.(1945-1947)ATC>GTC	p.I649V	MYOCD_uc002gno.2_Missense_Mutation_p.I649V|MYOCD_uc002gnp.1_Missense_Mutation_p.I553V|MYOCD_uc002gnq.2_Missense_Mutation_p.I368V	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	649					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CCCACAGCACATCAGTTTGCC	0.582													37	142	---	---	---	---	PASS
TBC1D26	353149	broad.mit.edu	37	17	15641352	15641352	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15641352G>T	uc010cov.2	+	6	490	c.240G>T	c.(238-240)AAG>AAT	p.K80N	TBC1D26_uc010cou.1_Missense_Mutation_p.K80N|TBC1D26_uc002gpb.3_RNA	NM_178571	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	80						intracellular	Rab GTPase activator activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		AGTGGCAAAAGATGCTTGCAG	0.542													18	114	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18039048	18039048	+	Silent	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18039048A>C	uc010vxh.1	+	12	4844	c.4506A>C	c.(4504-4506)TCA>TCC	p.S1502S		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1502	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					AGGTGGCCTCAGTGGTGAGTG	0.488													12	34	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18070961	18070961	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18070961G>A	uc010vxh.1	+	61	10344	c.10006G>A	c.(10006-10008)GAG>AAG	p.E3336K	MYO15A_uc010vxi.1_Missense_Mutation_p.E600K|MYO15A_uc010vxk.1_Missense_Mutation_p.E29K|MYO15A_uc010vxl.1_Missense_Mutation_p.E325K|MYO15A_uc002gsl.2_Missense_Mutation_p.E343K|MYO15A_uc010vxm.1_Intron|MYO15A_uc010cpv.2_RNA	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	3336	Tail.|FERM.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					CCGGCCCAGCGAGCAGCTGCT	0.662													18	21	---	---	---	---	PASS
TOP3A	7156	broad.mit.edu	37	17	18178286	18178286	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18178286C>G	uc002gsx.1	-	19	3065	c.2836G>C	c.(2836-2838)GGA>CGA	p.G946R	TOP3A_uc010cpz.1_Missense_Mutation_p.G398R|TOP3A_uc010vxr.1_Missense_Mutation_p.G476R|TOP3A_uc002gsw.1_Missense_Mutation_p.G398R|TOP3A_uc010vxs.1_Missense_Mutation_p.G844R	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	946					DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						GACGGGGCTCCAGAAGTCCCT	0.502													50	67	---	---	---	---	PASS
FNDC8	54752	broad.mit.edu	37	17	33456482	33456482	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33456482C>T	uc002hix.2	+	3	709	c.627C>T	c.(625-627)TTC>TTT	p.F209F		NM_017559	NP_060029	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	209	Fibronectin type-III.									ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		CGGTCAGTTTCTACCAGCTCC	0.537													39	55	---	---	---	---	PASS
TAF15	8148	broad.mit.edu	37	17	34171708	34171708	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34171708G>C	uc002hkd.2	+	15	1491	c.1405G>C	c.(1405-1407)GGC>CGC	p.G469R	TAF15_uc002hkc.2_Missense_Mutation_p.G466R	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1	469	Arg/Gly-rich.|21 X approximate tandem repeats of D-R- [S,G](0,3)-G-G-Y-G-G.|8.				positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ggacagaggaggcggctatgg	0.000			T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								3	9	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36714569	36714569	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36714569C>A	uc002hqd.2	-	11	2320	c.2095G>T	c.(2095-2097)GAG>TAG	p.E699*	SRCIN1_uc002hqf.1_Nonsense_Mutation_p.E571*|SRCIN1_uc002hqe.2_Nonsense_Mutation_p.E553*|SRCIN1_uc002hqg.2_Nonsense_Mutation_p.E5*	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	571					exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						CGCGCCGCCTCCGACACGCGC	0.682											OREG0024362	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	18	---	---	---	---	PASS
ATXN7L3	56970	broad.mit.edu	37	17	42274398	42274398	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42274398C>A	uc002iga.2	-						ATXN7L3_uc010wiv.1_5'Flank|ATXN7L3_uc002ifz.2_Intron	NM_001098833	NP_001092303	Q14CW9	AT7L3_HUMAN	ataxin 7-like 3 isoform b						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|metal ion binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGCAATCCTGCCAAGGGGAGG	0.507													59	69	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45235617	45235617	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45235617A>C	uc002ild.3	-	5	557	c.430T>G	c.(430-432)TTA>GTA	p.L144V	CDC27_uc002ile.3_Missense_Mutation_p.L144V|CDC27_uc002ilf.3_Missense_Mutation_p.L144V|CDC27_uc010wkp.1_Missense_Mutation_p.L83V|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	144	TPR 2.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AAAGGATTTAAACTAAGGCTC	0.433													12	35	---	---	---	---	PASS
NPEPPS	9520	broad.mit.edu	37	17	45668243	45668243	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45668243T>C	uc002ilr.3	+	10	1479	c.1256T>C	c.(1255-1257)ATT>ACT	p.I419T	NPEPPS_uc010wkt.1_Missense_Mutation_p.I415T|NPEPPS_uc010wku.1_Missense_Mutation_p.I383T|NPEPPS_uc010wkv.1_5'UTR	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	419					proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						AGCCATCCTATTGAAGTGAGC	0.398													16	159	---	---	---	---	PASS
NGFR	4804	broad.mit.edu	37	17	47587857	47587857	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47587857C>A	uc002ioz.3	+	4	777	c.652C>A	c.(652-654)CCT>ACT	p.P218T		NM_002507	NP_002498	P08138	TNR16_HUMAN	nerve growth factor receptor precursor	218	Ser/Thr-rich.|Extracellular (Potential).				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm				ovary(1)|lung(1)	2	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GCCTGAGGCACCTCCAGAACA	0.642													4	108	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48649240	48649240	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48649240C>A	uc002irk.1	+	5	960	c.588C>A	c.(586-588)AGC>AGA	p.S196R	CACNA1G_uc002iri.1_Missense_Mutation_p.S196R|CACNA1G_uc002irj.1_Missense_Mutation_p.S196R|CACNA1G_uc002irl.1_Missense_Mutation_p.S196R|CACNA1G_uc002irm.1_Missense_Mutation_p.S196R|CACNA1G_uc002irn.1_Missense_Mutation_p.S196R|CACNA1G_uc002iro.1_Missense_Mutation_p.S196R|CACNA1G_uc002irp.1_Missense_Mutation_p.S196R|CACNA1G_uc002irq.1_Missense_Mutation_p.S196R|CACNA1G_uc002irr.1_Missense_Mutation_p.S196R|CACNA1G_uc002irs.1_Missense_Mutation_p.S196R|CACNA1G_uc002irt.1_Missense_Mutation_p.S196R|CACNA1G_uc002irv.1_Missense_Mutation_p.S196R|CACNA1G_uc002irw.1_Missense_Mutation_p.S196R|CACNA1G_uc002iru.1_Missense_Mutation_p.S196R|CACNA1G_uc002irx.1_Missense_Mutation_p.S109R|CACNA1G_uc002iry.1_Missense_Mutation_p.S109R|CACNA1G_uc002irz.1_Missense_Mutation_p.S109R|CACNA1G_uc002isa.1_Missense_Mutation_p.S109R|CACNA1G_uc002isb.1_Missense_Mutation_p.S109R|CACNA1G_uc002isc.1_Missense_Mutation_p.S109R|CACNA1G_uc002isd.1_Missense_Mutation_p.S109R|CACNA1G_uc002ise.1_Missense_Mutation_p.S109R|CACNA1G_uc002isf.1_Missense_Mutation_p.S109R|CACNA1G_uc002isg.1_Missense_Mutation_p.S109R|CACNA1G_uc002ish.1_Missense_Mutation_p.S109R|CACNA1G_uc002isi.1_Missense_Mutation_p.S109R	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	196	I.|Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CCCCCACAGGCATGCGCATCC	0.662													14	48	---	---	---	---	PASS
WFIKKN2	124857	broad.mit.edu	37	17	48917537	48917537	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48917537G>A	uc002isv.3	+	2	1582	c.888G>A	c.(886-888)CTG>CTA	p.L296L	WFIKKN2_uc010dbu.2_Silent_p.L203L	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	296	Ig-like C2-type.					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CTGGGGTCCTGAGGGCTGATT	0.637													8	51	---	---	---	---	PASS
OR4D2	124538	broad.mit.edu	37	17	56247867	56247867	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56247867C>T	uc010wnp.1	+	1	851	c.851C>T	c.(850-852)CCC>CTC	p.P284L		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	284	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						ATGCTCAACCCCATGATCTAT	0.517													29	143	---	---	---	---	PASS
LPO	4025	broad.mit.edu	37	17	56343621	56343621	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56343621C>G	uc002ivt.2	+	11	1943	c.1627C>G	c.(1627-1629)CAC>GAC	p.H543D	LPO_uc010wns.1_Missense_Mutation_p.H484D|LPO_uc010dcp.2_Missense_Mutation_p.H460D|LPO_uc010dcq.2_Missense_Mutation_p.H214D|LPO_uc010dcr.2_Missense_Mutation_p.H106D	NM_006151	NP_006142	P22079	PERL_HUMAN	lactoperoxidase isoform 1 preproprotein	543					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2						CCAGCCAACTCACAGGATCCA	0.542													13	51	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57733350	57733350	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57733350G>T	uc002ixq.1	+	6	1374	c.931G>T	c.(931-933)GCC>TCC	p.A311S	CLTC_uc002ixp.2_Missense_Mutation_p.A311S|CLTC_uc002ixr.1_Missense_Mutation_p.A315S	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	311	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ACCTCATGAAGCCACAGCTGG	0.378			T	ALK|TFE3	ALCL|renal 								25	96	---	---	---	---	PASS
GNA13	10672	broad.mit.edu	37	17	63010558	63010558	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63010558G>A	uc002jfc.2	-	4	1160	c.951C>T	c.(949-951)CAC>CAT	p.H317H	GNA13_uc010wqh.1_Silent_p.H222H	NM_006572	NP_006563	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein),	317					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase D activity|cellular component movement|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex|melanosome	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity|type 1 angiotensin receptor binding				0						CTCTTAAGCAGTGGGGATCCC	0.448													42	64	---	---	---	---	PASS
AMZ2	51321	broad.mit.edu	37	17	66251840	66251840	+	Splice_Site	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66251840G>T	uc002jgs.1	+	7	868	c.751_splice	c.e7-1	p.T251_splice	AMZ2_uc002jgr.1_Splice_Site_p.T251_splice|AMZ2_uc002jgt.1_Splice_Site_p.T251_splice|AMZ2_uc002jgu.1_Splice_Site_p.T251_splice|AMZ2_uc002jgv.1_Splice_Site_p.T251_splice|AMZ2_uc002jgw.1_Splice_Site_p.T193_splice|AMZ2_uc002jgy.1_Splice_Site_p.T251_splice	NM_001033572	NP_001028744	Q86W34	AMZ2_HUMAN	archaemetzincins-2 isoform 1								metallopeptidase activity|zinc ion binding				0	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTGTCTTGCAGACTTTAACCC	0.468													58	95	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66928541	66928541	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66928541A>T	uc002jhp.2	-	6	864	c.685T>A	c.(685-687)TGC>AGC	p.C229S	ABCA8_uc002jhq.2_Missense_Mutation_p.C229S|ABCA8_uc010wqq.1_Missense_Mutation_p.C229S|ABCA8_uc010wqr.1_Missense_Mutation_p.C168S|ABCA8_uc002jhr.2_Missense_Mutation_p.C229S|ABCA8_uc002jhs.2_Missense_Mutation_p.C229S|ABCA8_uc002jht.2_Missense_Mutation_p.C229S	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	229	Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					GAAATAATGCAGGAAAAAAGG	0.383													14	79	---	---	---	---	PASS
CD300LB	124599	broad.mit.edu	37	17	72522227	72522227	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72522227G>A	uc002jkx.2	-						CD300LB_uc010wqz.1_Intron	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b							integral to membrane|plasma membrane	receptor activity			ovary(1)	1						CTGGAAAACAGAATCCCAAGA	0.552													5	165	---	---	---	---	PASS
NPTX1	4884	broad.mit.edu	37	17	78449800	78449800	+	Intron	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78449800G>C	uc002jyp.1	-							NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor						central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GGCGCGCGCGGACCTCGAGGT	0.716													12	43	---	---	---	---	PASS
CETN1	1068	broad.mit.edu	37	18	580553	580553	+	Missense_Mutation	SNP	G	T	T	rs116290875	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580553G>T	uc002kko.1	+	1	187	c.145G>T	c.(145-147)GAC>TAC	p.D49Y		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	49	1 (Probable).|EF-hand 1.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2						TGGGACCATCGACGCGAAGGA	0.557													9	46	---	---	---	---	PASS
YES1	7525	broad.mit.edu	37	18	724498	724498	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:724498C>T	uc002kky.2	-	12	1779	c.1558G>A	c.(1558-1560)GAA>AAA	p.E520K	YES1_uc002kkz.2_Missense_Mutation_p.E520K	NM_005433	NP_005424	P07947	YES_HUMAN	viral oncogene yes-1 homolog 1	520	Protein kinase.				blood coagulation|leukocyte migration|regulation of vascular permeability|T cell costimulation	cytosol|plasma membrane	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|ovary(1)	3					Dasatinib(DB01254)	TGAATATATTCAAATGTTGGT	0.438													13	86	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21478918	21478918	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21478918G>T	uc002kuq.2	+	46	5811	c.5725G>T	c.(5725-5727)GCT>TCT	p.A1909S	LAMA3_uc002kur.2_Missense_Mutation_p.A1909S|LAMA3_uc002kus.3_Missense_Mutation_p.A300S|LAMA3_uc002kut.3_Missense_Mutation_p.A300S	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1909	Domain II and I.|Potential.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TTTCATATAGGCTCAAGTAAA	0.313													8	33	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46162976	46162976	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46162976G>A	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GCTCCTTTCTGTTCTGCAGTG	0.632													6	6	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54398666	54398666	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54398666T>C	uc002lgk.1	+	14	2038	c.1827T>C	c.(1825-1827)GCT>GCC	p.A609A	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Silent_p.A609A	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	609										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		TTCTAAACGCTTGTGATGAAG	0.388													8	47	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61304959	61304959	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61304959G>T	uc002ljf.2	-	8	1253	c.1167C>A	c.(1165-1167)TCC>TCA	p.S389S	SERPINB4_uc002lje.2_Silent_p.S368S|SERPINB4_uc002ljg.2_Silent_p.S389S	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	389					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						GCATCTATGGGGATGAGAATC	0.398													64	63	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63530159	63530159	+	Intron	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63530159T>C	uc002ljz.2	+						CDH7_uc002lka.2_Missense_Mutation_p.Y624H|CDH7_uc002lkb.2_Intron	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				ATTGGGTAGGTACTGTTTCCA	0.483													24	32	---	---	---	---	PASS
DOK6	220164	broad.mit.edu	37	18	67231765	67231765	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67231765A>C	uc002lkl.2	+	2	299	c.109A>C	c.(109-111)AAA>CAA	p.K37Q		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	37	PH.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				GGCTTCTAGCAAAGGACCCAG	0.388													25	26	---	---	---	---	PASS
DOK6	220164	broad.mit.edu	37	18	67231767	67231767	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67231767A>T	uc002lkl.2	+	2	301	c.111A>T	c.(109-111)AAA>AAT	p.K37N		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	37	PH.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				CTTCTAGCAAAGGACCCAGAA	0.388													26	27	---	---	---	---	PASS
PRSSL1	400668	broad.mit.edu	37	19	694935	694935	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:694935C>G	uc002lpl.1	-	2	146	c.115G>C	c.(115-117)GAG>CAG	p.E39Q	PRSSL1_uc010xfs.1_Missense_Mutation_p.E38Q	NM_214710	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine-like 1 precursor	39	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGTCACCTCGTGGCCCCCG	0.706													11	9	---	---	---	---	PASS
THOP1	7064	broad.mit.edu	37	19	2810340	2810340	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2810340G>T	uc002lwj.2	+	10	1649	c.1494G>T	c.(1492-1494)CGG>CGT	p.R498R	THOP1_uc010xgz.1_Silent_p.R377R|THOP1_uc002lwk.2_Silent_p.R9R	NM_003249	NP_003240	P52888	THOP1_HUMAN	thimet oligopeptidase 1	498					proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGTGGAGCGGGACTTTGTGG	0.692													5	21	---	---	---	---	PASS
TJP3	27134	broad.mit.edu	37	19	3730707	3730707	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3730707C>T	uc010xhv.1	+						TJP3_uc010xhs.1_Intron|TJP3_uc010xht.1_Intron|TJP3_uc010xhu.1_Intron|TJP3_uc010xhw.1_Intron	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3							tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGAAGGTCAGAAGAGGCG	0.512													39	78	---	---	---	---	PASS
PLIN4	729359	broad.mit.edu	37	19	4513257	4513257	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4513257A>G	uc002mar.1	-	3	673	c.673T>C	c.(673-675)TCC>CCC	p.S225P	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	225	27 X 33 AA approximate tandem repeat.|4.					lipid particle|plasma membrane					0						AGCCCAGTGGACACAGCATCT	0.577													7	246	---	---	---	---	PASS
SLC25A23	79085	broad.mit.edu	37	19	6444156	6444156	+	Intron	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6444156C>A	uc002mex.1	-						SLC25A23_uc010duu.1_Intron|SLC25A23_uc002meu.2_Intron|SLC25A23_uc002mev.2_Intron|SLC25A23_uc002mew.1_Intron|SLC25A23_uc010xjd.1_Intron	NM_024103	NP_077008	Q9BV35	SCMC3_HUMAN	solute carrier family 25, member 23						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)|pancreas(1)	2						CCCGCCCAGGCCTCACCTTGT	0.657													7	15	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7810768	7810768	+	Silent	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7810768G>C	uc002mht.2	-	4	451	c.384C>G	c.(382-384)ACC>ACG	p.T128T	CD209_uc010xju.1_Intron|CD209_uc010dvp.2_Silent_p.T104T|CD209_uc002mhr.2_Silent_p.T104T|CD209_uc002mhs.2_Silent_p.T104T|CD209_uc002mhu.2_Silent_p.T128T|CD209_uc010dvq.2_Silent_p.T128T|CD209_uc002mhq.2_Silent_p.T128T|CD209_uc002mhv.2_Silent_p.T104T|CD209_uc002mhx.2_Silent_p.T84T|CD209_uc002mhw.2_Silent_p.T84T|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	128	Extracellular (Probable).|2.|7 X approximate tandem repeats.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						CCTTCAGCCGGGTCAGCTCCT	0.572													72	153	---	---	---	---	PASS
PRAM1	84106	broad.mit.edu	37	19	8563166	8563166	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8563166C>A	uc002mkd.2	-	3	1460	c.1440G>T	c.(1438-1440)CGG>CGT	p.R480R	PRAM1_uc002mkc.2_Silent_p.R480R	NM_032152	NP_115528	Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	528							lipid binding|protein binding				0						AGCGGGTCCTCCGTAGATCTG	0.682													13	17	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8615039	8615039	+	Intron	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8615039C>T	uc002mkg.2	-						MYO1F_uc002mkh.2_Splice_Site_p.S369_splice	NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF							unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						CCCAGCCCCACTCGCCTCCAC	0.468													16	30	---	---	---	---	PASS
OR2Z1	284383	broad.mit.edu	37	19	8841616	8841616	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8841616G>T	uc010xkg.1	+	1	226	c.226G>T	c.(226-228)GTC>TTC	p.V76F		NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z,	76	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2						CTGTCCCATGGTCACCATCCC	0.542													44	85	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9005596	9005596	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9005596T>C	uc002mkp.2	-	46	40014	c.39810A>G	c.(39808-39810)GGA>GGG	p.G13270G	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.G87G|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13272	SEA 8.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGGTGTAGGGTCCCAGCTCAG	0.552													83	141	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9056214	9056214	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056214G>C	uc002mkp.2	-	3	31436	c.31232C>G	c.(31231-31233)ACA>AGA	p.T10411R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10413	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATAAGCACTTGTCACTGTTCC	0.483													98	208	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9056609	9056609	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056609C>A	uc002mkp.2	-	3	31041	c.30837G>T	c.(30835-30837)ATG>ATT	p.M10279I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10281	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATAGAGAAGGCATCACTGTGC	0.483													47	75	---	---	---	---	PASS
OR7G2	390882	broad.mit.edu	37	19	9213749	9213749	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9213749G>T	uc010xkk.1	-	1	234	c.234C>A	c.(232-234)ACC>ACA	p.T78T		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AGTACATGGGGGTGTGGAGGT	0.502													42	84	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9584931	9584931	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9584931T>A	uc002mlp.1	-	4	311	c.101A>T	c.(100-102)CAG>CTG	p.Q34L	ZNF560_uc010dwr.1_5'UTR	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	34	KRAB 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						TAAGTTTCTCTGAACTGGGTC	0.438													48	98	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10251546	10251546	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10251546T>C	uc002mng.2	-	31	3566	c.3386A>G	c.(3385-3387)GAG>GGG	p.E1129G	DNMT1_uc002mne.2_5'Flank|DNMT1_uc002mnf.2_Missense_Mutation_p.E53G|DNMT1_uc010xlc.1_Missense_Mutation_p.E1145G|DNMT1_uc002mnh.2_Missense_Mutation_p.E1024G|DNMT1_uc010xld.1_Missense_Mutation_p.E1129G	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	1129	Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	TATCTCTGGCTCGCTCGGCTC	0.617													64	126	---	---	---	---	PASS
ICAM5	7087	broad.mit.edu	37	19	10404741	10404741	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10404741C>A	uc002mnu.3	+	8	1802	c.1737C>A	c.(1735-1737)AGC>AGA	p.S579R	ICAM5_uc002mnv.3_Missense_Mutation_p.S454R	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor	579	Extracellular (Potential).|Ig-like C2-type 7.				cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			AGGAGCCGAGCTGCCCCAGCA	0.627													4	98	---	---	---	---	PASS
MAN2B1	4125	broad.mit.edu	37	19	12768923	12768923	+	Silent	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12768923C>G	uc002mub.2	-	10	1339	c.1263G>C	c.(1261-1263)CTG>CTC	p.L421L	MAN2B1_uc010dyv.1_Silent_p.L420L	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	421					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						CGTTGGCCGCCAGGCCCACCA	0.667													32	49	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12963199	12963199	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12963199A>T	uc002mvm.2	+	10	1195	c.1067A>T	c.(1066-1068)GAT>GTT	p.D356V	MAST1_uc002mvk.2_Missense_Mutation_p.D352V	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	356					cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						GAGCAAGACGATCTCTCTGAG	0.323													19	66	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15536511	15536511	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15536511C>A	uc002nbc.2	-	5	1695	c.1672G>T	c.(1672-1674)GGC>TGC	p.G558C	WIZ_uc002nba.3_Missense_Mutation_p.G425C|WIZ_uc002nbb.3_Missense_Mutation_p.G384C	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1241	C2H2-type 9.					nucleus	zinc ion binding				0						CTCGACAGGCCCTTGCGGTTC	0.597													22	27	---	---	---	---	PASS
EPS15L1	58513	broad.mit.edu	37	19	16535895	16535895	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16535895T>C	uc002ndz.1	-	9	797	c.791A>G	c.(790-792)CAG>CGG	p.Q264R	EPS15L1_uc002ndx.2_Missense_Mutation_p.Q264R|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpe.1_Missense_Mutation_p.Q154R|EPS15L1_uc010xpf.1_Missense_Mutation_p.Q167R|EPS15L1_uc002nea.1_Missense_Mutation_p.Q264R|EPS15L1_uc010eah.1_Missense_Mutation_p.Q264R|EPS15L1_uc002neb.1_Missense_Mutation_p.Q110R|EPS15L1_uc002nec.1_Missense_Mutation_p.Q264R	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	264					endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						GCTCCGTACCTGTGTTTGCTT	0.602													3	115	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17720813	17720813	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17720813G>T	uc002nhd.2	-	42	5011	c.5011C>A	c.(5011-5013)CGC>AGC	p.R1671S		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1583	C2 3.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GCAAACTTGCGTTTCTTGTCG	0.522													65	121	---	---	---	---	PASS
C19orf50	79036	broad.mit.edu	37	19	18679273	18679273	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18679273G>T	uc002njo.2	+	5	505	c.363G>T	c.(361-363)ACG>ACT	p.T121T	C19orf50_uc002njp.2_RNA|C19orf50_uc002njq.2_Silent_p.T121T	NM_024069	NP_076974	Q9BQD3	CS050_HUMAN	hypothetical protein LOC79036	121							protein binding				0						CCAGCACCACGACCACCATTG	0.612													155	357	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807265	20807265	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807265T>C	uc002npb.1	-	4	1568	c.1418A>G	c.(1417-1419)AAA>AGA	p.K473R	ZNF626_uc002npc.1_Missense_Mutation_p.K397R	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	473	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						AGTATGAATTTTCTTATGTGT	0.388													2	12	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807398	20807398	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807398C>T	uc002npb.1	-	4	1435	c.1285G>A	c.(1285-1287)GAA>AAA	p.E429K	ZNF626_uc002npc.1_Missense_Mutation_p.E353K	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	429	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TTGCCACATTCTTCACATTTG	0.383													12	101	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21607137	21607137	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21607137A>T	uc002npx.2	+	2	1572	c.1292A>T	c.(1291-1293)CAC>CTC	p.H431L	ZNF493_uc002npw.2_Missense_Mutation_p.H559L|ZNF493_uc002npy.2_Missense_Mutation_p.H431L	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	431	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CGGTCCTCACACCTTACTACA	0.358													7	34	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22154701	22154701	+	Silent	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22154701A>C	uc002nqp.2	-	6	2900	c.2751T>G	c.(2749-2751)ACT>ACG	p.T917T	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCTTATGTTCAGTAAGGCTTG	0.443													49	127	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271571	22271571	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271571G>C	uc010ecx.2	+	4	1188	c.1019G>C	c.(1018-1020)GGA>GCA	p.G340A	ZNF257_uc010ecy.2_Missense_Mutation_p.G308A	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	340					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTCATACTGGAGAGAAACCC	0.403													20	45	---	---	---	---	PASS
PLEKHF1	79156	broad.mit.edu	37	19	30164860	30164860	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30164860C>T	uc002nsh.3	+	2	216	c.114C>T	c.(112-114)GGC>GGT	p.G38G	PLEKHF1_uc002nsi.3_Silent_p.G123G	NM_024310	NP_077286	Q96S99	PKHF1_HUMAN	apoptosis-inducing protein D	38	PH.				apoptosis	lysosome|nucleus|perinuclear region of cytoplasm	metal ion binding				0	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			TGCTGCTGGGCGAGGGCGTGC	0.637													27	48	---	---	---	---	PASS
DMKN	93099	broad.mit.edu	37	19	35996900	35996900	+	Intron	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35996900A>C	uc002nzm.3	-						DMKN_uc002nzj.2_Intron|DMKN_uc002nzk.3_Intron|DMKN_uc002nzl.3_Intron|DMKN_uc002nzo.3_Intron|DMKN_uc002nzn.3_Intron|DMKN_uc002nzw.2_Intron|DMKN_uc002nzr.2_Intron|DMKN_uc002nzp.2_Intron|DMKN_uc002nzq.2_Intron|DMKN_uc002nzt.2_Intron|DMKN_uc002nzs.2_Intron|DMKN_uc002nzu.2_Intron|DMKN_uc002nzv.2_Intron|DMKN_uc010xsv.1_Intron|DMKN_uc010xsw.1_Intron|DMKN_uc002nzx.3_Intron|DMKN_uc002nzy.3_Intron|DMKN_uc002nzz.2_Intron|DMKN_uc002oac.3_Intron|DMKN_uc010eeb.2_Intron|DMKN_uc002oaa.3_Intron|DMKN_uc002oab.3_Intron	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine isoform 2 precursor							extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TATGGAACCAAGGAGATATGG	0.512													66	100	---	---	---	---	PASS
SBSN	374897	broad.mit.edu	37	19	36017690	36017690	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36017690G>T	uc002oae.1	-	2	535	c.465C>A	c.(463-465)GTC>GTA	p.V155V	SBSN_uc002oad.1_Silent_p.V498V	NM_198538	NP_940940	Q6UWP8	SBSN_HUMAN	suprabasin isoform 2 precursor	155	Ala/Gly/His-rich.					extracellular region				ovary(1)	1	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CAGCATGGTTGACCCCTTGGC	0.597													32	70	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36223758	36223758	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36223758C>T	uc010eei.2	+	29	6308	c.6308C>T	c.(6307-6309)GCC>GTC	p.A2103V		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2103					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGGACAGGGCCCGGCCTCCT	0.657													5	12	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39096258	39096258	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39096258C>T	uc002oix.1	-	18	1421	c.1313G>A	c.(1312-1314)CGT>CAT	p.R438H	MAP4K1_uc002oiw.1_Missense_Mutation_p.R25H|MAP4K1_uc002oiy.1_Missense_Mutation_p.R438H|MAP4K1_uc010xug.1_Missense_Mutation_p.R100H	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	438					activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGCCCAGGACGGGGGCTGTT	0.687													9	9	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40392476	40392476	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40392476G>C	uc002omp.3	-	16	8036	c.8028C>G	c.(8026-8028)CAC>CAG	p.H2676Q		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2676	VWFD 6.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCACCAGCTTGTGGCAAGAGG	0.577													4	21	---	---	---	---	PASS
RTN2	6253	broad.mit.edu	37	19	45992250	45992250	+	Intron	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45992250G>A	uc002pcb.2	-						RTN2_uc002pcc.2_Intron|RTN2_uc002pcd.2_Intron	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A							integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		AGGCCCTGCGGGGACAAAGGA	0.637													7	10	---	---	---	---	PASS
PGLYRP1	8993	broad.mit.edu	37	19	46526126	46526126	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46526126G>A	uc002pdx.1	-	1	198	c.154C>T	c.(154-156)CTG>TTG	p.L52L		NM_005091	NP_005082	O75594	PGRP1_HUMAN	peptidoglycan recognition protein 1 precursor	52					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region	bacterial cell surface binding|N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(2)	2		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		CGTAAGGGCAGGCTCAGGTGC	0.662													8	21	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49812653	49812653	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49812653C>A	uc002pmz.2	-	6	1126	c.892G>T	c.(892-894)GTA>TTA	p.V298L	SLC6A16_uc002pna.2_Missense_Mutation_p.V298L|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	298	Helical; Name=5; (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GGGAGCAGTACCAAGACATAG	0.478													16	32	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51917030	51917030	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51917030G>A	uc002pwo.2	-	10	2373	c.1757C>T	c.(1756-1758)CCC>CTC	p.P586L	SIGLEC10_uc002pwp.2_Missense_Mutation_p.P528L|SIGLEC10_uc002pwq.2_Missense_Mutation_p.P433L|SIGLEC10_uc002pwr.2_Missense_Mutation_p.P491L|SIGLEC10_uc010ycy.1_Missense_Mutation_p.P401L|SIGLEC10_uc010ycz.1_Missense_Mutation_p.P443L|SIGLEC10_uc010eow.2_Missense_Mutation_p.P303L|SIGLEC10_uc002pws.1_Missense_Mutation_p.P327L	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	586	Cytoplasmic (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGAGAACCTGGGCCTCGGGGT	0.542													50	110	---	---	---	---	PASS
SIGLEC6	946	broad.mit.edu	37	19	52034754	52034754	+	Silent	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52034754C>G	uc002pwy.2	-	2	249	c.87G>C	c.(85-87)CGG>CGC	p.R29R	SIGLEC6_uc002pwz.2_Silent_p.R29R|SIGLEC6_uc002pxa.2_Silent_p.R29R|SIGLEC6_uc010ydb.1_Intron|SIGLEC6_uc010ydc.1_Silent_p.R18R|SIGLEC6_uc010eoz.1_Silent_p.R18R|SIGLEC6_uc010epb.1_Intron|SIGLEC6_uc010epa.1_Silent_p.R18R	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1	29	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GCTGGAATCTCCGCTCCTGAG	0.657													27	67	---	---	---	---	PASS
FPR1	2357	broad.mit.edu	37	19	52249292	52249292	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52249292C>T	uc002pxq.2	-	2	1051	c.956G>A	c.(955-957)AGT>AAT	p.S319N		NM_002029	NP_002020	P21462	FPR1_HUMAN	formyl peptide receptor 1	319	Cytoplasmic (Potential).				activation of MAPK activity|cellular component movement|chemotaxis|G-protein signaling, coupled to cAMP nucleotide second messenger|nitric oxide mediated signal transduction	endosome|integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)|lung(1)|skin(1)	3		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CCTCTCCAGACTGGCGGGAAG	0.562													56	99	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55146609	55146609	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55146609C>A	uc002qgj.2	+	12	1878	c.1538C>A	c.(1537-1539)ACA>AAA	p.T513K	LILRB1_uc010erp.1_Missense_Mutation_p.T128K|LILRB1_uc002qgl.2_Missense_Mutation_p.T513K|LILRB1_uc002qgk.2_Missense_Mutation_p.T514K|LILRB1_uc002qgm.2_Missense_Mutation_p.T514K|LILRB1_uc010erq.2_Missense_Mutation_p.T497K|LILRB1_uc010err.2_Intron	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	513	Cytoplasmic (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CCAGAGCCCACAGACAGAGGC	0.612										HNSCC(37;0.09)			11	34	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55670582	55670582	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55670582C>A	uc002qji.1	-	12	1508	c.1474G>T	c.(1474-1476)GGC>TGC	p.G492C	TNNI3_uc002qjg.3_5'Flank|TNNI3_uc010yft.1_5'Flank|C19orf51_uc002qjh.1_Missense_Mutation_p.G307C|C19orf51_uc002qjj.1_Missense_Mutation_p.G539C|C19orf51_uc002qjk.1_Missense_Mutation_p.G438C|C19orf51_uc002qjl.1_Missense_Mutation_p.G559C			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	492											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		TGGGTCAGGCCCTCAAGGGCT	0.632													8	35	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56321514	56321514	+	Missense_Mutation	SNP	C	G	G	rs143277549	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56321514C>G	uc010ygf.1	-	5	1173	c.462G>C	c.(460-462)GAG>GAC	p.E154D	NLRP11_uc002qlz.2_Missense_Mutation_p.E55D|NLRP11_uc002qmb.2_Missense_Mutation_p.E55D|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	154	ATP (Potential).|NACHT.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAGATGCTCTCTCTCCCATCA	0.423													24	63	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56370413	56370413	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56370413G>C	uc002qmd.3	+	3	2076	c.1654G>C	c.(1654-1656)GCG>CCG	p.A552P	NLRP4_uc002qmf.2_Missense_Mutation_p.A477P|NLRP4_uc010etf.2_Missense_Mutation_p.A383P	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	552							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GGATTCCTTGGCGATATTTTA	0.468													37	73	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56538652	56538652	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56538652G>A	uc002qmj.2	+	7	1053	c.1053G>A	c.(1051-1053)ATG>ATA	p.M351I	NLRP5_uc002qmi.2_Missense_Mutation_p.M332I	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	351	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CGGAGATCATGTCCCGACCAG	0.547													12	31	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328278	57328278	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328278C>A	uc002qnu.2	-	7	1883	c.1532G>T	c.(1531-1533)GGA>GTA	p.G511V	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.G482V|PEG3_uc002qnv.2_Missense_Mutation_p.G511V|PEG3_uc002qnw.2_Missense_Mutation_p.G387V|PEG3_uc002qnx.2_Missense_Mutation_p.G385V|PEG3_uc010etr.2_Missense_Mutation_p.G511V	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	511	C2H2-type 2.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GAAGGTCTCTCCACAGTCCTT	0.448													63	141	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328279	57328279	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328279C>A	uc002qnu.2	-	7	1882	c.1531G>T	c.(1531-1533)GGA>TGA	p.G511*	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Nonsense_Mutation_p.G482*|PEG3_uc002qnv.2_Nonsense_Mutation_p.G511*|PEG3_uc002qnw.2_Nonsense_Mutation_p.G387*|PEG3_uc002qnx.2_Nonsense_Mutation_p.G385*|PEG3_uc010etr.2_Nonsense_Mutation_p.G511*	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	511	C2H2-type 2.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AAGGTCTCTCCACAGTCCTTA	0.448													61	141	---	---	---	---	PASS
ZNF304	57343	broad.mit.edu	37	19	57867773	57867773	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57867773G>C	uc010ygw.1	+	3	924	c.536G>C	c.(535-537)AGC>ACC	p.S179T	ZNF304_uc010etw.2_Missense_Mutation_p.S226T|ZNF304_uc010etx.2_Missense_Mutation_p.S137T	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN	zinc finger protein 304	179					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		TTACCAGATAGCTCTGGCCTT	0.517													27	68	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58100030	58100030	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58100030C>T	uc002qpg.2	+	3	293	c.196C>T	c.(196-198)CTG>TTG	p.L66L	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Silent_p.L11L|ZIK1_uc002qpi.2_Silent_p.L53L|ZIK1_uc002qpj.2_Intron	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	66	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGTAGCCTCACTGGGTAAGGC	0.502													27	71	---	---	---	---	PASS
SLC27A5	10998	broad.mit.edu	37	19	59021301	59021301	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59021301C>A	uc002qtc.2	-	3	1080	c.970G>T	c.(970-972)GCC>TCC	p.A324S		NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid	324	Cytoplasmic (Probable).				bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		TCAGCTGTGGCCCCAGATAAG	0.577													32	53	---	---	---	---	PASS
ZNF343	79175	broad.mit.edu	37	20	2464715	2464715	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2464715C>A	uc002wge.1	-	6	1380	c.892G>T	c.(892-894)GTG>TTG	p.V298L	ZNF343_uc010gao.1_Missense_Mutation_p.V298L|ZNF343_uc002wgd.1_Missense_Mutation_p.V208L	NM_024325	NP_077301	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	298	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCACTGCACACATAAGGCTTC	0.488													34	63	---	---	---	---	PASS
C20orf194	25943	broad.mit.edu	37	20	3274874	3274874	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3274874T>A	uc002wii.2	-	25	2200	c.2149A>T	c.(2149-2151)ATT>TTT	p.I717F	C20orf194_uc002wij.3_Missense_Mutation_p.I456F|C20orf194_uc002wik.2_Missense_Mutation_p.I391F	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943	717											0						TCCTGGCTAATGCTGCTGATG	0.463													7	41	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3673596	3673596	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3673596G>T	uc002wja.2	-	14	3691	c.3691C>A	c.(3691-3693)CCA>ACA	p.P1231T	SIGLEC1_uc002wjb.1_5'UTR|SIGLEC1_uc002wiz.3_Missense_Mutation_p.P1231T	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1231	Ig-like C2-type 12.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CTGGGCTGTGGCCCTCGCAGC	0.716													30	31	---	---	---	---	PASS
ANKRD5	63926	broad.mit.edu	37	20	10032359	10032359	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10032359T>C	uc002wno.2	+	8	2085	c.1692T>C	c.(1690-1692)TTT>TTC	p.F564F	uc002wnn.1_Intron|ANKRD5_uc002wnp.2_Silent_p.F564F|ANKRD5_uc010gbz.2_Silent_p.F375F	NM_022096	NP_071379	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	564	ANK 6.						calcium ion binding			ovary(1)|breast(1)	2						CACTTCATTTTGCATGCCATG	0.373													19	103	---	---	---	---	PASS
SPTLC3	55304	broad.mit.edu	37	20	13055143	13055143	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13055143T>C	uc002wod.1	+	4	894	c.605T>C	c.(604-606)ATG>ACG	p.M202T		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	202					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	AGGCATGAAATGGGTATGTAC	0.423													9	189	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13830172	13830172	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13830172C>A	uc010gcf.2	-	20	2108	c.2026G>T	c.(2026-2028)GTT>TTT	p.V676F	SEL1L2_uc002woq.3_Missense_Mutation_p.V537F|SEL1L2_uc010zrl.1_Missense_Mutation_p.V563F|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	676	Helical; (Potential).					integral to membrane	binding			ovary(2)	2						AGCCCAGGAACAATGAGGCCA	0.483													11	75	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	14066307	14066307	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14066307G>T	uc002wou.2	+	3	468	c.204G>T	c.(202-204)TTG>TTT	p.L68F	MACROD2_uc002wot.2_Missense_Mutation_p.L68F	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	68	Macro.										0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AGAAAAGTTTGACTGAAAAAG	0.313													19	27	---	---	---	---	PASS
SEC23B	10483	broad.mit.edu	37	20	18505080	18505080	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18505080G>T	uc002wqz.1	+	5	813	c.370G>T	c.(370-372)GGT>TGT	p.G124C	SEC23B_uc002wra.1_Missense_Mutation_p.G124C|SEC23B_uc002wrb.1_Missense_Mutation_p.G124C|SEC23B_uc010zsb.1_Intron|SEC23B_uc002wrc.1_Missense_Mutation_p.G124C	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	124					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						CCCAAAGCGAGGTGCTCAGTC	0.418													23	105	---	---	---	---	PASS
ACSS1	84532	broad.mit.edu	37	20	25003611	25003611	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25003611C>T	uc002wub.2	-	5	1803	c.925G>A	c.(925-927)GCA>ACA	p.A309T	ACSS1_uc002wuc.2_Missense_Mutation_p.A309T|ACSS1_uc010gdc.2_Intron|ACSS1_uc002wud.1_RNA|ACSS1_uc002wua.2_Missense_Mutation_p.A226T	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	309					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AGGTAGCCTGCCTGGGTATGG	0.637													11	39	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31673913	31673913	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31673913T>A	uc010zue.1	+	5	884	c.869T>A	c.(868-870)CTG>CAG	p.L290Q		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	290						cytoplasm|extracellular region	lipid binding				0						TATCCTCGGCTGGTCATTGAG	0.582													92	98	---	---	---	---	PASS
CBFA2T2	9139	broad.mit.edu	37	20	32078086	32078086	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32078086C>T	uc002wze.1	+	1	159	c.13C>T	c.(13-15)CCT>TCT	p.P5S	CBFA2T2_uc010zug.1_5'UTR	NM_001032999	NP_001028171	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit	Error:Variant_position_missing_in_O43439_after_alignment						nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						GGTAGGCGTCCCTGGAGCGGC	0.662													6	5	---	---	---	---	PASS
SPINLW1	57119	broad.mit.edu	37	20	44171468	44171468	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44171468C>G	uc002xou.2	-	3	294	c.262G>C	c.(262-264)GCT>CCT	p.A88P	SPINLW1_uc010zxc.1_Missense_Mutation_p.A88P|SPINLW1_uc002xot.2_Missense_Mutation_p.A72P|SPINLW1_uc002xov.1_3'UTR	NM_020398	NP_065131	O95925	EPPI_HUMAN	serine peptidase inhibitor-like, with Kunitz and	88	BPTI/Kunitz inhibitor.					extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				AGAAAATAAGCCAGGCAGGGG	0.428													41	44	---	---	---	---	PASS
C20orf165	128497	broad.mit.edu	37	20	44515306	44515306	+	Silent	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44515306G>T	uc002xqf.2	-	2	543	c.534C>A	c.(532-534)ATC>ATA	p.I178I		NM_080608	NP_542175	Q9BR10	CT165_HUMAN	chromosome 20 open reading frame 165	178						integral to membrane					0		Myeloproliferative disorder(115;0.0122)				GAGCGGCCCAGATCAGGTCCT	0.642													45	41	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57415389	57415389	+	Silent	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57415389C>T	uc002xzt.2	+	1	595	c.228C>T	c.(226-228)TTC>TTT	p.F76F	GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	NM_016592	NP_057676	P63092	GNAS2_HUMAN	GNAS complex locus NESP55	76					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CCCAGGTATTCCCTGAGTCCC	0.662			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			63	64	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58318262	58318262	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58318262G>T	uc002yau.2	+	2	686	c.219G>T	c.(217-219)AGG>AGT	p.R73S	PHACTR3_uc002yat.2_Missense_Mutation_p.R70S|PHACTR3_uc010zzw.1_Missense_Mutation_p.R32S|PHACTR3_uc002yav.2_Missense_Mutation_p.R32S|PHACTR3_uc002yaw.2_Missense_Mutation_p.R32S|PHACTR3_uc002yax.2_Missense_Mutation_p.R32S	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	73						nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CCCTGGGCAGGATCTTCAAAC	0.557													42	35	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60884880	60884880	+	Missense_Mutation	SNP	C	T	T	rs77106948	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60884880C>T	uc002ycq.2	-	79	10907	c.10840G>A	c.(10840-10842)GGG>AGG	p.G3614R		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	3614	Laminin G-like 5.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGCACATTCCCGCTTTTCATC	0.672													15	23	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	31062053	31062053	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31062053C>A	uc002yno.1	-	3	1003	c.539G>T	c.(538-540)AGC>ATC	p.S180I	GRIK1_uc002ynn.2_Missense_Mutation_p.S180I|GRIK1_uc011acs.1_Missense_Mutation_p.S180I|GRIK1_uc011act.1_Missense_Mutation_p.S124I|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Missense_Mutation_p.S180I	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	180	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	CATACCTGTGCTGTCTTCATA	0.448													95	227	---	---	---	---	PASS
KRTAP13-2	337959	broad.mit.edu	37	21	31744209	31744209	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31744209C>G	uc002ynz.3	-	1	349	c.323G>C	c.(322-324)CGC>CCC	p.R108P		NM_181621	NP_853652	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	108						intermediate filament					0						GCCCAGGGAGCGGCAGCTGCT	0.607													32	34	---	---	---	---	PASS
KRTAP13-3	337960	broad.mit.edu	37	21	31798236	31798236	+	5'Flank	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31798236C>T	uc002yob.1	-							NM_181622	NP_853653	Q3SY46	KR133_HUMAN	keratin associated protein 13-3							intermediate filament				ovary(1)|lung(1)	2						GACATGTTGACGGGAAGATGT	0.507													24	100	---	---	---	---	PASS
KRTAP10-12	386685	broad.mit.edu	37	21	46117425	46117425	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46117425C>A	uc002zfw.1	+	1	339	c.309C>A	c.(307-309)GCC>GCA	p.A103A	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198699	NP_941972	P60413	KR10C_HUMAN	keratin associated protein 10-12	103	19 X 5 AA repeats of C-C-X(3).					keratin filament					0						GCCAGCAGGCCTGCTGCGTGC	0.647													76	117	---	---	---	---	PASS
CECR5	27440	broad.mit.edu	37	22	17619552	17619552	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17619552C>A	uc002zmf.2	-	7	851	c.823G>T	c.(823-825)GGC>TGC	p.G275C	CECR5_uc002zmd.2_Missense_Mutation_p.G86C|CECR5_uc002zme.2_Missense_Mutation_p.G67C|CECR5_uc002zmg.2_Intron|CECR5_uc002zmh.2_Missense_Mutation_p.G245C	NM_033070	NP_149061	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	275							hydrolase activity				0		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				CCCATCAGGCCCTCGTATCTC	0.602													120	147	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21096529	21096529	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21096529C>A	uc002zsz.3	-	32	3785	c.3554G>T	c.(3553-3555)GGA>GTA	p.G1185V		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1185					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CACTTCCACTCCATCCTTGCC	0.537											OREG0026324	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	85	75	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24487755	24487755	+	Silent	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24487755C>A	uc002zzi.1	+	24	3871	c.3744C>A	c.(3742-3744)ATC>ATA	p.I1248I	CABIN1_uc002zzj.1_Silent_p.I1198I|CABIN1_uc002zzl.1_Silent_p.I1248I	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1248					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CCAAGAAGATCCACTACCACA	0.627													48	72	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26270389	26270389	+	Intron	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26270389A>T	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						AAGGTACTGCATGCCGTTCCC	0.557													7	6	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26423607	26423607	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26423607A>T	uc003abz.1	+	43	7917	c.7667A>T	c.(7666-7668)GAT>GTT	p.D2556V	MYO18B_uc003aca.1_Missense_Mutation_p.D2437V|MYO18B_uc010guy.1_Missense_Mutation_p.D2438V|MYO18B_uc010guz.1_Missense_Mutation_p.D2436V|MYO18B_uc011aka.1_Missense_Mutation_p.D1710V|MYO18B_uc011akb.1_Missense_Mutation_p.D2069V|MYO18B_uc010gva.1_Missense_Mutation_p.D539V|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2556						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						AAAGACGACGATGTTGCGAGC	0.552													16	9	---	---	---	---	PASS
MTMR3	8897	broad.mit.edu	37	22	30398972	30398972	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30398972G>T	uc003agv.3	+	9	989	c.661G>T	c.(661-663)GTC>TTC	p.V221F	MTMR3_uc003agu.3_Missense_Mutation_p.V221F|MTMR3_uc003agw.3_Missense_Mutation_p.V221F	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	221	Myotubularin phosphatase.		V -> L (in a breast cancer sample; somatic mutation).		phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity	p.V221L(1)		breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CATCCCTGCCGTCATCTACAG	0.532													21	22	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	34046499	34046499	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34046499C>A	uc003and.3	-	4	841	c.262G>T	c.(262-264)GGC>TGC	p.G88C	LARGE_uc003ane.3_Missense_Mutation_p.G88C|LARGE_uc010gwp.2_Missense_Mutation_p.G88C|LARGE_uc011ame.1_Missense_Mutation_p.G20C|LARGE_uc011amf.1_Missense_Mutation_p.G88C	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	88	Lumenal (Potential).|Potential.				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				GGGGCTCGGCCCTGGGCCAGG	0.697													8	68	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36702581	36702581	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36702581C>T	uc003apg.2	-	16	2147	c.1916G>A	c.(1915-1917)CGG>CAG	p.R639Q	MYH9_uc003aph.1_Missense_Mutation_p.R503Q	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	639	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CATGCCCTTCCGCGTCTTGAA	0.617			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				16	26	---	---	---	---	PASS
FAM118A	55007	broad.mit.edu	37	22	45731235	45731235	+	Silent	SNP	T	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45731235T>A	uc003bfz.3	+	8	1558	c.942T>A	c.(940-942)GCT>GCA	p.A314A	FAM118A_uc003bga.3_Silent_p.A314A|FAM118A_uc011aqr.1_Silent_p.A132A	NM_001104595	NP_001098065	Q9NWS6	F118A_HUMAN	hypothetical protein LOC55007	314						integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTTCAGATGCTGATCGCGTGG	0.517													29	73	---	---	---	---	PASS
ATXN10	25814	broad.mit.edu	37	22	46088935	46088935	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46088935T>C	uc003bgm.1	+	3	625	c.368T>C	c.(367-369)GTG>GCG	p.V123A	ATXN10_uc011aqt.1_Missense_Mutation_p.V59A|ATXN10_uc003bgn.1_5'UTR	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10	123					cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		GAACTGCGAGTGGAACAGGAA	0.313													4	62	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50191604	50191604	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50191604A>G	uc003biv.2	-	5	2434	c.1947T>C	c.(1945-1947)TAT>TAC	p.Y649Y	BRD1_uc011arf.1_Silent_p.Y244Y|BRD1_uc011arg.1_Silent_p.Y698Y|BRD1_uc011arh.1_Silent_p.Y649Y|BRD1_uc003biu.3_Silent_p.Y649Y	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	649	Bromo.				histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CCGCGGCTCTATAGAACACGG	0.537													38	26	---	---	---	---	PASS
CRLF2	64109	broad.mit.edu	37	X	1317479	1317479	+	Intron	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1317479G>T	uc004cpm.1	-									Q9HC73	CRLF2_HUMAN	Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TATGTGTCTGGCCCATATACA	0.517			Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								59	52	---	---	---	---	PASS
PRKX	5613	broad.mit.edu	37	X	3544547	3544547	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3544547G>A	uc010nde.2	-	5	1095	c.728C>T	c.(727-729)CCG>CTG	p.P243L		NM_005044	NP_005035	P51817	PRKX_HUMAN	protein kinase, X-linked	243	Protein kinase.						ATP binding|cAMP-dependent protein kinase activity			skin(2)|lung(1)	3		all_lung(23;0.000396)|Lung NSC(23;0.00123)				ATCAAAAAACGGAGGAAACCT	0.373													28	8	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5811062	5811062	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5811062G>A	uc010ndh.2	-	6	2748	c.2247C>T	c.(2245-2247)CAC>CAT	p.H749H	NLGN4X_uc004crp.2_Silent_p.H769H|NLGN4X_uc004crq.2_Silent_p.H749H|NLGN4X_uc010ndi.2_Silent_p.H786H|NLGN4X_uc004crr.2_Silent_p.H749H|NLGN4X_uc010ndj.2_Silent_p.H749H	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	749	Cytoplasmic (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						TCAGTGTGTCGTGTGCCTGCA	0.547													14	51	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18845392	18845392	+	Splice_Site	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18845392A>T	uc004cyq.2	+	19	2232	c.1751_splice	c.e19-2	p.G584_splice	PPEF1_uc004cyp.2_Splice_Site_p.G556_splice|PPEF1_uc004cyr.2_Splice_Site_p.G522_splice|PPEF1_uc004cys.2_Splice_Site_p.G584_splice|PPEF1_uc011mja.1_Splice_Site_p.G519_splice|PPEF1_uc011mjb.1_Splice_Site_p.G528_splice	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding						detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					ATATTCTTTTAGGCCTGATCT	0.418													38	18	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29301304	29301304	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29301304A>C	uc004dby.2	+	3	840	c.332A>C	c.(331-333)CAG>CCG	p.Q111P		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	111	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						ACATTGCTACAGGACAGTGGT	0.438													27	26	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48542368	48542368	+	Silent	SNP	A	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48542368A>G	uc004dkm.3	+	1	183	c.126A>G	c.(124-126)AAA>AAG	p.K42K		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	42	WH1.				blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				TTGGACGAAAATGCTTGGTGA	0.473			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				43	26	---	---	---	---	PASS
GAGE10	643832	broad.mit.edu	37	X	49161385	49161385	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49161385A>T	uc010nir.1	+	2	163	c.47A>T	c.(46-48)TAT>TTT	p.Y16F		NM_001098413	NP_001091883	A6NGK3	GAG10_HUMAN	G antigen 10	16											0	Ovarian(276;0.236)					CCAAGACTCTATGTAGAGCCC	0.433													146	70	---	---	---	---	PASS
FAAH2	158584	broad.mit.edu	37	X	57313335	57313335	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57313335G>T	uc004dvc.2	+	1	226	c.77G>T	c.(76-78)CGA>CTA	p.R26L		NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	26	Helical; (Potential).					integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						TTAGTAGGCCGAGCAGCTTTA	0.572										HNSCC(52;0.14)			9	12	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71359733	71359733	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71359733C>T	uc011mqa.1	+	6	2335	c.2335C>T	c.(2335-2337)CCC>TCC	p.P779S	NHSL2_uc004eak.1_Missense_Mutation_p.P413S|NHSL2_uc010nli.2_Missense_Mutation_p.P548S	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2	779											0	Renal(35;0.156)					GACCTCTTCACCCAACCTGGA	0.507													27	20	---	---	---	---	PASS
POF1B	79983	broad.mit.edu	37	X	84563147	84563147	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84563147G>A	uc004eer.2	-	10	1179	c.1033C>T	c.(1033-1035)CTT>TTT	p.L345F	POF1B_uc004ees.2_Missense_Mutation_p.L345F	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	345	Potential.						actin binding				0						TCATTTTGAAGATGTCCAAGC	0.368													25	11	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99661673	99661673	+	Silent	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99661673G>A	uc010nmz.2	-	1	3599	c.1923C>T	c.(1921-1923)ATC>ATT	p.I641I	PCDH19_uc004efw.3_Silent_p.I641I|PCDH19_uc004efx.3_Silent_p.I641I	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	641	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GAGCCACCACGATAAGCTCAT	0.572													20	13	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101909538	101909538	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101909538G>T	uc004ejj.3	+	5	1498	c.697G>T	c.(697-699)GCT>TCT	p.A233S	GPRASP1_uc004eji.3_Missense_Mutation_p.A233S|GPRASP1_uc010nod.2_Missense_Mutation_p.A233S	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	233						cytoplasm	protein binding			ovary(1)|lung(1)	2						CAATCAAGAGGCTAATACCAT	0.463													107	62	---	---	---	---	PASS
SERPINA7	6906	broad.mit.edu	37	X	105279351	105279351	+	Silent	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105279351T>C	uc004eme.1	-	2	664	c.648A>G	c.(646-648)CCA>CCG	p.P216P	SERPINA7_uc010npd.2_Silent_p.P216P|SERPINA7_uc010npe.1_Silent_p.P216P	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	216					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	CTGTCTTGGATGGATCAAAAG	0.403													60	39	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117700047	117700047	+	Missense_Mutation	SNP	A	T	T	rs150521474	byFrequency	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117700047A>T	uc004eqp.2	+	8	836	c.773A>T	c.(772-774)CAG>CTG	p.Q258L	DOCK11_uc004eqq.2_Missense_Mutation_p.Q24L	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	258	PH.				blood coagulation	cytosol	GTP binding			ovary(3)	3						GAAACTGAGCAGGAAATGGAG	0.398													90	45	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128709967	128709967	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128709967C>T	uc004euq.2	+	17	1972	c.1807C>T	c.(1807-1809)CCT>TCT	p.P603S	OCRL_uc004eur.2_Missense_Mutation_p.P603S	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	603					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						TTCTTTCATCCCTAAACTTAA	0.453													62	31	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135429395	135429395	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135429395T>C	uc004ezu.1	+	6	3821	c.3530T>C	c.(3529-3531)GTA>GCA	p.V1177A	GPR112_uc010nsb.1_Missense_Mutation_p.V972A|GPR112_uc010nsc.1_Missense_Mutation_p.V944A	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1177	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					ATATCTCAAGTAGAGGAGACT	0.493													98	36	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140967084	140967084	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140967084G>T	uc011mwp.1	+	3	382	c.382G>T	c.(382-384)GAC>TAC	p.D128Y		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	128										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGAACCCCAGGACTGGCCACT	0.547													5	9	---	---	---	---	PASS
MIR514-1	574516	broad.mit.edu	37	X	146360842	146360842	+	RNA	SNP	G	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146360842G>A	hsa-mir-514-1|MI0003198	-			c.21G>A																				0						CTCCAGAGTAGGGTACCACAG	0.438													11	6	---	---	---	---	PASS
IRAK1	3654	broad.mit.edu	37	X	153279680	153279680	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153279680C>A	uc004fjs.1	-	11	1431	c.1352G>T	c.(1351-1353)AGC>ATC	p.S451I	IRAK1_uc004fjr.1_Missense_Mutation_p.S451I|IRAK1_uc004fjt.1_Intron|IRAK1_uc010nur.2_Intron|IRAK1_uc004fju.2_Missense_Mutation_p.S477I	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	451	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTCTGGGTGCTTCTCAAAGC	0.597													81	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	116107918	116107919	+	IGR	DEL	GA	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116107918_116107919delGA								NGF (227061 upstream) : VANGL1 (76655 downstream)																							TTTCTAAAATGAGAGAAATGTT	0.455													43	37	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118120487	118120488	+	IGR	DEL	GT	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118120487_118120488delGT								MAN1A2 (52167 upstream) : FAM46C (28116 downstream)																							CAGCTGGACCgtgtgtgtgtgt	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149060159	149060159	+	IGR	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149060159delC								LOC645166 (107105 upstream) : LOC388692 (219317 downstream)																							ACAAGAACTTCCCAGCCAGCA	0.542													36	31	---	---	---	---	
IKBKE	9641	broad.mit.edu	37	1	206666293	206666293	+	Intron	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206666293delG	uc001hdz.1	+						IKBKE_uc009xbv.1_Intron|IKBKE_uc001hea.1_Intron	NM_014002	NP_054721	Q14164	IKKE_HUMAN	IKK-related kinase epsilon						DNA damage response, signal transduction resulting in induction of apoptosis|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane|PML body	ATP binding|IkappaB kinase activity|NF-kappaB-inducing kinase activity|protein binding			ovary(3)|lung(3)|central_nervous_system(1)|skin(1)	8	Breast(84;0.137)					ATGGCAGCTAGGCGAGCCCTG	0.622													3	7	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236630727	236630728	+	Intron	DEL	CA	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236630727_236630728delCA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			cacacacgcgcacacacacaca	0.312													3	5	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11777093	11777098	+	Intron	DEL	GACAGA	-	-	rs146541156		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11777093_11777098delGACAGA	uc002rbk.1	+						GREB1_uc002rbp.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		caggggcagggacagaggcaggggca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89870682	89870683	+	IGR	INS	-	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89870682_89870683insC								FLJ40330 (764557 upstream) : None (None downstream)																							tccattccattccattcacttg	0.000													9	4	---	---	---	---	
SNRNP200	23020	broad.mit.edu	37	2	96967133	96967134	+	Intron	INS	-	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96967133_96967134insA	uc002svu.2	-							NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TGTAACTCTTCAAAAAACACAG	0.386													15	15	---	---	---	---	
TMEM87B	84910	broad.mit.edu	37	2	112870703	112870706	+	Intron	DEL	TACT	-	-	rs142414944		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112870703_112870706delTACT	uc002thm.2	+							NM_032824	NP_116213	Q96K49	TM87B_HUMAN	transmembrane protein 87B precursor							integral to membrane					0						ACAAGATAAATACTTACTGGTATG	0.294													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103992	113103992	+	IGR	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103992delC								ZC3H6 (6352 upstream) : RGPD8 (21974 downstream)																							tcaccaccatcaccactgcca	0.000													4	3	---	---	---	---	
CSRNP3	80034	broad.mit.edu	37	2	166532979	166532980	+	Frame_Shift_Ins	INS	-	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166532979_166532980insT	uc002udf.2	+	6	942_943	c.566_567insT	c.(565-567)TCTfs	p.S189fs	CSRNP3_uc002udg.2_Frame_Shift_Ins_p.S189fs	NM_024969	NP_079245	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	189					apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5						CTGCGTGCCTCTGGAGTGAAAA	0.490													101	134	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169668048	169668049	+	Intron	INS	-	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169668048_169668049insT	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_5'Flank	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						CCTGTTCATTGTTTTTTTGTTA	0.337													11	9	---	---	---	---	
NOP58	51602	broad.mit.edu	37	2	203152303	203152304	+	Intron	INS	-	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203152303_203152304insA	uc002uzb.2	+							NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						AAAACAAAAACAAAAAAAAACT	0.327													27	14	---	---	---	---	
NCL	4691	broad.mit.edu	37	2	232325997	232325998	+	Intron	INS	-	A	A	rs34075637		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325997_232325998insA	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		caaaaaaatttaaaaaaaaaaa	0.119													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	24029514	24029515	+	IGR	INS	-	TCCTTCCT	TCCTTCCT	rs35508585		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24029514_24029515insTCCTTCCT								NR1D2 (7405 upstream) : LOC152024 (108265 downstream)																							tcctttctttctccttccttcc	0.054													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	44742535	44742538	+	IGR	DEL	AGGA	-	-	rs62244187		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44742535_44742538delAGGA								ZNF35 (40253 upstream) : ZNF502 (11597 downstream)																							ggagggagggaggaaggaaggaag	0.025													4	2	---	---	---	---	
KPNA1	3836	broad.mit.edu	37	3	122149407	122149408	+	Intron	DEL	TG	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122149407_122149408delTG	uc003efd.1	-						KPNA1_uc003efb.1_Intron|KPNA1_uc003efc.1_Intron|KPNA1_uc011bjr.1_Intron|KPNA1_uc010hrh.2_Intron|KPNA1_uc003efe.2_Intron	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		TCAAATAAACtgtgtgtgtgtg	0.188													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179137463	179137463	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179137463delT	uc003fjv.3	-							NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			AATATGTTCCTGAAAATTATG	0.264													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31961703	31961703	+	IGR	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31961703delT								PCDH7 (813282 upstream) : None (None downstream)																							ccttctttccttcccttcctc	0.080													4	2	---	---	---	---	
LRAT	9227	broad.mit.edu	37	4	155666144	155666145	+	Intron	INS	-	CTTTTT	CTTTTT	rs146204691	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155666144_155666145insCTTTTT	uc003iom.1	+						uc003iol.2_Intron|LRAT_uc003ion.1_Intron	NM_004744	NP_004735	O95237	LRAT_HUMAN	lecithin retinol acyltransferase						response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	TCCATACCAtcctttttctttt	0.292													4	3	---	---	---	---	
TRIP13	9319	broad.mit.edu	37	5	911759	911760	+	Intron	INS	-	AGG	AGG	rs145194585	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:911759_911760insAGG	uc003jbr.2	+							NM_004237	NP_004228	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13						double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity				0			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			AGTGGGGCTGTAGAATTCCCAG	0.450													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3276430	3276430	+	IGR	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276430delG								C5orf38 (520918 upstream) : IRX1 (319738 downstream)																							ggatgaaggagggaggggagg	0.000													3	3	---	---	---	---	
SLC22A4	6583	broad.mit.edu	37	5	131676126	131676126	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131676126delT	uc003kwq.2	+						uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4						body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	TTTTGCTTACTTTTTTTTCTC	0.348													56	36	---	---	---	---	
FAM114A2	10827	broad.mit.edu	37	5	153407574	153407574	+	Intron	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153407574delC	uc003lvb.2	-						FAM114A2_uc003lvc.2_Intron|FAM114A2_uc003lvd.2_Intron|FAM114A2_uc003lve.2_Intron|FAM114A2_uc011dda.1_Intron	NM_018691	NP_061161	Q9NRY5	F1142_HUMAN	hypothetical protein LOC10827								purine nucleotide binding				0						CATCCCTGATCCCCCCAAAAA	0.408													11	6	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	170101134	170101137	+	Intron	DEL	AGGA	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170101134_170101137delAGGA	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAAAGCAATGaggaaggaaggaag	0.049													3	4	---	---	---	---	
FAM153B	202134	broad.mit.edu	37	5	175530031	175530031	+	Intron	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175530031delG	uc003mdk.2	+							NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134											ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CCTGCACTGCGTGGTGTGCAC	0.507													4	2	---	---	---	---	
KAAG1	353219	broad.mit.edu	37	6	24357526	24357526	+	5'UTR	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24357526delC	uc003ndz.1	+	1					DCDC2_uc003ndx.2_Intron|DCDC2_uc003ndy.2_Intron	NM_181337	NP_851854	Q9UBP8	KAAG1_HUMAN	kidney associated antigen 1						immune response						0						TCAACCTCTACCCCCCAACTG	0.463													5	8	---	---	---	---	
FKBP5	2289	broad.mit.edu	37	6	35554624	35554625	+	Intron	INS	-	T	T	rs112376611		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35554624_35554625insT	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_3'UTR	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						GGAATCTGTACTTTTTTTTTTT	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	75560075	75560075	+	IGR	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75560075delT								None (None upstream) : COL12A1 (233968 downstream)																							TACGTGTTGCTTTTTTTTTTT	0.373													6	5	---	---	---	---	
ECHDC1	55862	broad.mit.edu	37	6	127652297	127652297	+	Intron	DEL	T	-	-	rs66884305		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127652297delT	uc003qax.2	-						ECHDC1_uc003qaz.3_Intron|ECHDC1_uc010key.2_Intron|ECHDC1_uc003qay.3_Intron|ECHDC1_uc010kez.2_Intron|ECHDC1_uc010kex.2_5'Flank	NM_001139510	NP_001132982	Q9NTX5	ECHD1_HUMAN	enoyl Coenzyme A hydratase domain containing 1								catalytic activity				0				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TCCCCAtttcttttttttttt	0.189													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	129002224	129002225	+	IGR	INS	-	CC	CC	rs55939876	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129002224_129002225insCC								PTPRK (160354 upstream) : LAMA2 (202061 downstream)																							acacacacacaccacacacaca	0.000													6	3	---	---	---	---	
HOXA5	3202	broad.mit.edu	37	7	27185066	27185075	+	5'Flank	DEL	GTTTTGTTTT	-	-	rs70994631		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27185066_27185075delGTTTTGTTTT	uc003syn.1	-						uc003syp.1_5'Flank	NM_019102	NP_061975	P20719	HXA5_HUMAN	homeobox A5						negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTGTGTGAGgttttgttttgttttgtttt	0.467													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65082637	65082637	+	IGR	DEL	A	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65082637delA								ZNF92 (216640 upstream) : INTS4L2 (30140 downstream)																							TTGGGGATCCAAAATAGCACC	0.408													44	44	---	---	---	---	
GTF2IP1	2970	broad.mit.edu	37	7	72614315	72614316	+	Intron	INS	-	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72614315_72614316insA	uc003txo.3	+						FKBP6_uc003twz.2_Intron|GTF2IP1_uc011keq.1_Intron	NR_003580				SubName: Full=cDNA FLJ61347, highly similar to General transcription factor II-I;												0						gactctgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
POR	5447	broad.mit.edu	37	7	75552252	75552252	+	Intron	DEL	G	-	-	rs11769059	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75552252delG	uc003udy.2	+							NM_000941	NP_000932	P16435	NCPR_HUMAN	cytochrome P450 reductase						cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)	GATTCCTGGCGGCAGAAACAT	0.478													23	16	---	---	---	---	
TECPR1	25851	broad.mit.edu	37	7	97862097	97862098	+	Intron	INS	-	A	A	rs139511001		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97862097_97862098insA	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1						atgattgctggaaaaaaaaaAA	0.287													4	3	---	---	---	---	
PILRB	29990	broad.mit.edu	37	7	99951274	99951274	+	5'UTR	DEL	A	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99951274delA	uc003uuk.2	+	12					PILRB_uc003uul.2_Intron|PILRB_uc003uum.1_Intron	NM_013440	NP_038468	Q9UKJ0	PILRB_HUMAN	paired immunoglobulin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTTTTCCCTGACCCTTGGGGC	0.607													11	5	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108150621	108150622	+	Intron	INS	-	A	A	rs35880371		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108150621_108150622insA	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						taaagtataataaaaaaaaaaa	0.203													4	3	---	---	---	---	
CDK5	1020	broad.mit.edu	37	7	150753810	150753810	+	Intron	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150753810delC	uc003wir.1	-						CDK5_uc003wis.1_Intron|SLC4A2_uc003wit.3_5'Flank	NM_004935	NP_004926	Q00535	CDK5_HUMAN	cyclin-dependent kinase 5 isoform 1						activation of pro-apoptotic gene products|blood coagulation|cell division|cell proliferation|embryo development|negative regulation of transcription, DNA-dependent|positive regulation of neuron apoptosis	axon|cytosol|dendrite|growth cone|lamellipodium|membrane|neuromuscular junction|neuronal cell body	acetylcholine receptor activator activity|ATP binding|cyclin-dependent protein kinase activity|ErbB-2 class receptor binding|ErbB-3 class receptor binding|tau-protein kinase activity			lung(1)|central_nervous_system(1)	2		Breast(660;0.159)|Ovarian(593;0.182)	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.008)|Lung(243;0.00942)|BRCA - Breast invasive adenocarcinoma(188;0.242)		GTCCTCCAAACCCCGCCTTTC	0.512													21	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7347247	7347247	+	IGR	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7347247delT								DEFB105A (175 upstream) : DEFB107A (6121 downstream)																							ACtttttttcttttttttttt	0.075													5	8	---	---	---	---	
SGK223	157285	broad.mit.edu	37	8	8175875	8175875	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8175875delC	uc003wsh.3	-	5	4010	c.4010delG	c.(4009-4011)GGCfs	p.G1337fs		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	1337							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						CTCCGAGGTGCCCGGCTGCTG	0.672													144	73	---	---	---	---	
MSRA	4482	broad.mit.edu	37	8	10275264	10275265	+	Intron	INS	-	TGTG	TGTG	rs144936992	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10275264_10275265insTGTG	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	AACCTGCATGTtgtgtgtgtgt	0.366											OREG0018542	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
KCNU1	157855	broad.mit.edu	37	8	36779849	36779849	+	Intron	DEL	A	-	-	rs68098747		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36779849delA	uc010lvw.2	+						KCNU1_uc003xjw.2_Intron	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		GAAAGGAAAGAAAAAAAAAAT	0.443													8	13	---	---	---	---	
MOS	4342	broad.mit.edu	37	8	57025797	57025797	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025797delC	uc011leb.1	-	1	745	c.745delG	c.(745-747)GAGfs	p.E249fs		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	249	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			TTCAGGAGCTCCGGGGCGCGG	0.537													72	43	---	---	---	---	
SLC25A32	81034	broad.mit.edu	37	8	104413535	104413536	+	Intron	INS	-	C	C	rs146562515	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104413535_104413536insC	uc003yll.2	-						SLC25A32_uc011lhr.1_Intron	NM_030780	NP_110407	Q9H2D1	MFTC_HUMAN	solute carrier family 25, member 32						folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	aacctattagttagaaagtctt	0.059													5	3	---	---	---	---	
PLAA	9373	broad.mit.edu	37	9	26908166	26908166	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26908166delT	uc003zqd.2	-						PLAA_uc003zqe.2_Intron	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GAGCtttgtcttttttttttt	0.169													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	29651459	29651460	+	IGR	INS	-	ACAC	ACAC	rs5742188		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29651459_29651460insACAC								MIR873 (762506 upstream) : None (None downstream)																							ATCAGCTTAAAacacacacaca	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34923047	34923047	+	IGR	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34923047delT								C9orf144 (84464 upstream) : KIAA1045 (34474 downstream)																							TTTGTTTTTGTTTTTTttttt	0.308													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69787982	69787985	+	IGR	DEL	AACA	-	-	rs59524350		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69787982_69787985delAACA								LOC100133920 (123033 upstream) : FOXD4L5 (387724 downstream)																							AGATAGAGGTAACAAACTTAAATA	0.368													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													7	4	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113243811	113243817	+	Intron	DEL	CTGTCTA	-	-	rs3841727		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113243811_113243817delCTGTCTA	uc010mtz.2	-						SVEP1_uc010mua.1_Intron|SVEP1_uc004beu.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						AGGACTCCTCCTGTCTATCGCTATTTC	0.348													3	3	---	---	---	---	
HSDL2	84263	broad.mit.edu	37	9	115200823	115200823	+	Frame_Shift_Del	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115200823delT	uc004bga.1	+	7	804	c.711delT	c.(709-711)AGTfs	p.S237fs	HSDL2_uc011lwv.1_Frame_Shift_Del_p.S116fs|HSDL2_uc004bgb.1_Frame_Shift_Del_p.N71fs|HSDL2_uc004bgc.1_Frame_Shift_Del_p.S164fs|HSDL2_uc011lww.1_Frame_Shift_Del_p.S32fs	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	237						peroxisome	oxidoreductase activity|sterol binding				0						AGCCAAAAAGTTTTACTGGCA	0.343													58	78	---	---	---	---	
TTC16	158248	broad.mit.edu	37	9	130485247	130485247	+	Intron	DEL	A	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130485247delA	uc004brq.1	+						PTRH1_uc011mah.1_Intron|TTC16_uc011mai.1_Intron|TTC16_uc004brr.1_Intron|TTC16_uc010mxn.1_Intron	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16								binding				0						aatccatctcaaaaaaaaaaa	0.239													10	7	---	---	---	---	
ADAMTS13	11093	broad.mit.edu	37	9	136288055	136288055	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136288055delT	uc004cdv.3	+						ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Intron|ADAMTS13_uc004cdu.1_Intron|ADAMTS13_uc004cdw.3_Intron|ADAMTS13_uc004cdx.3_Intron|ADAMTS13_uc004cdq.1_Intron|ADAMTS13_uc004cds.1_Intron|ADAMTS13_uc004cdr.1_Intron	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1						cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		tctctctctcttttttttttt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	13199671	13199672	+	IGR	INS	-	G	G	rs113702003		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13199671_13199672insG								OPTN (19395 upstream) : MCM10 (3909 downstream)																							tttttttttttttttttttttg	0.183													4	4	---	---	---	---	
CACNB2	783	broad.mit.edu	37	10	18690925	18690925	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18690925delC	uc001ipr.2	+	3	346	c.286delC	c.(286-288)CGCfs	p.R96fs	CACNB2_uc009xjz.1_Frame_Shift_Del_p.R96fs|CACNB2_uc001ips.2_Frame_Shift_Del_p.R96fs|CACNB2_uc001ipt.2_Frame_Shift_Del_p.R96fs|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Frame_Shift_Del_p.R68fs|CACNB2_uc001ipv.2_Frame_Shift_Del_p.R68fs|CACNB2_uc009xka.1_Frame_Shift_Del_p.R68fs|CACNB2_uc001ipw.2_Frame_Shift_Del_p.R41fs|CACNB2_uc001ipx.2_Frame_Shift_Del_p.R41fs|CACNB2_uc009xkb.1_Frame_Shift_Del_p.R42fs|CACNB2_uc010qcm.1_Frame_Shift_Del_p.R42fs|CACNB2_uc001ipz.2_Frame_Shift_Del_p.R42fs|CACNB2_uc001ipy.2_Frame_Shift_Del_p.R42fs|CACNB2_uc010qcn.1_Frame_Shift_Del_p.R48fs|CACNB2_uc010qco.1_Frame_Shift_Del_p.R48fs|CACNB2_uc001iqa.2_Frame_Shift_Del_p.R48fs	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2	96					axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GGAGGCAGTGCGCAGAGAAGC	0.532													28	30	---	---	---	---	
EPC1	80314	broad.mit.edu	37	10	32558131	32558131	+	Intron	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32558131delC	uc001iwg.1	-						EPC1_uc001iwi.3_Intron|uc001iwf.2_5'Flank|EPC1_uc001iwh.1_Intron	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				ACATTATCTTCCCAACAAAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	58597595	58597596	+	IGR	INS	-	ACACAC	ACACAC	rs147403914	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58597595_58597596insACACAC								ZWINT (476561 upstream) : None (None downstream)																							gtgctcaccatacacacacaca	0.010													3	3	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105528893	105528898	+	Intron	DEL	TGTGTG	-	-	rs72354577		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105528893_105528898delTGTGTG	uc001kxj.1	-							NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GGCTAGACTCtgtgtgtgtgtgtgtg	0.121													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122715675	122715676	+	IGR	INS	-	TG	TG	rs140381439	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122715675_122715676insTG								WDR11 (46640 upstream) : FGFR2 (522169 downstream)																							TAAACATCACTtgtgtgtgtgt	0.287													5	3	---	---	---	---	
ZNF143	7702	broad.mit.edu	37	11	9493100	9493100	+	Intron	DEL	G	-	-	rs7119680	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9493100delG	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		GTGTTTTGGTGtttttttttt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	18893143	18893143	+	IGR	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18893143delC								PTPN5 (79754 upstream) : MRGPRX1 (62218 downstream)																							CAGCCATCTGCCACCAACTGG	0.502													10	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45609486	45609489	+	IGR	DEL	GAAG	-	-	rs71979259		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45609486_45609489delGAAG								SYT13 (301602 upstream) : CHST1 (60938 downstream)																							aagaaagaaagaaggaaagaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64211760	64211763	+	IGR	DEL	TTCC	-	-	rs7943485	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64211760_64211763delTTCC								RPS6KA4 (72074 upstream) : SLC22A11 (111335 downstream)																							ctttctttctttccttccttcctt	0.000													4	2	---	---	---	---	
NRXN2	9379	broad.mit.edu	37	11	64409988	64409988	+	Intron	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64409988delC	uc001oap.2	-						NRXN2_uc001oar.2_Intron|NRXN2_uc001oas.2_Intron|NRXN2_uc001oaq.2_Intron	NM_138734	NP_620063	P58401	NRX2B_HUMAN	neurexin 2 isoform beta precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						AACCGGGTGGCCGGCATCTAC	0.731													16	13	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72296159	72296159	+	Intron	DEL	T	-	-	rs5792596		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72296159delT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	AAGTGTTTTGTTTTTTTTTtt	0.284											OREG0021196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	5	---	---	---	---	
FOXRED1	55572	broad.mit.edu	37	11	126141584	126141584	+	Intron	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126141584delG	uc001qdi.2	+						SRPR_uc001qdh.2_5'Flank|SRPR_uc010sbm.1_5'Flank|FOXRED1_uc010sbn.1_Intron|FOXRED1_uc010sbo.1_Intron|FOXRED1_uc010sbp.1_Intron|FOXRED1_uc010sbq.1_Intron|FOXRED1_uc001qdj.2_Intron|FOXRED1_uc010sbr.1_Intron|FOXRED1_uc001qdk.2_Intron	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		AGTCATGAGTGGGGCAAGAAA	0.532													47	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127335979	127335980	+	IGR	DEL	AG	-	-	rs34816322		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127335979_127335980delAG								KIRREL3 (462624 upstream) : ETS1 (992676 downstream)																							gaaggaaggaagagagagagag	0.000													4	2	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21242746	21242746	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242746delT	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					ATAACTTCTGTTTTTTTTTTC	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76629682	76629683	+	IGR	DEL	AC	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76629682_76629683delAC								NAP1L1 (150944 upstream) : BBS10 (108583 downstream)																							aGacacacaaacacacacacac	0.134													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110073043	110073044	+	IGR	INS	-	CAT	CAT			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073043_110073044insCAT								MVK (37973 upstream) : C12orf34 (79146 downstream)																							accaccatcaccaccaccacca	0.010													3	3	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119957682	119957683	+	Intron	DEL	TA	-	-	rs71900111	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957682_119957683delTA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		tgtgtgtgtgtatacctgtgtg	0.168													4	2	---	---	---	---	
PLA2G1B	5319	broad.mit.edu	37	12	120763036	120763036	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120763036delT	uc001tyd.2	-						PLA2G1B_uc009zwx.2_Intron	NM_000928	NP_000919	P04054	PA21B_HUMAN	phospholipase A2 group IB precursor						actin filament organization|activation of MAPK activity|activation of phospholipase A2 activity|arachidonic acid secretion|cellular response to insulin stimulus|glucose transport|interleukin-8 production|leukotriene biosynthetic process|multicellular organismal lipid catabolic process|neutrophil chemotaxis|neutrophil mediated immunity|phosphatidylcholine metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of DNA replication|positive regulation of immune response|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein secretion|positive regulation of transcription from RNA polymerase II promoter	extracellular space	bile acid binding|calcium ion binding|calcium-dependent phospholipase A2 activity|cell surface binding|receptor binding			skin(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATTGAAAGCAttttttttttt	0.184											OREG0022189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
LRRC43	254050	broad.mit.edu	37	12	122658231	122658231	+	Intron	DEL	A	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122658231delA	uc001ubw.3	+						LRRC43_uc009zxl.1_Intron|IL31_uc001ubv.2_Intron	NM_152759	NP_689972	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 2												0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		actctgtctcaaaaaaaaaaa	0.244													8	4	---	---	---	---	
PIWIL1	9271	broad.mit.edu	37	12	130838924	130838925	+	Intron	INS	-	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130838924_130838925insA	uc001uik.2	+						PIWIL1_uc001uij.1_Intron	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1						gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TTAAGAATGTTAAAAAAAATGC	0.356													33	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28260583	28260584	+	IGR	DEL	TG	-	-	rs67497109		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28260583_28260584delTG								POLR1D (19036 upstream) : GSX1 (106196 downstream)																							acactgtgtttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
MCF2L	23263	broad.mit.edu	37	13	113730586	113730586	+	Intron	DEL	T	-	-	rs111246282		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113730586delT	uc001vsu.2	+						MCF2L_uc001vsq.2_Intron|MCF2L_uc010tjr.1_Intron|MCF2L_uc001vsr.2_Intron|MCF2L_uc001vss.3_Intron|MCF2L_uc010tjs.1_Intron|MCF2L_uc001vst.1_Intron	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				tttattattattttttttttg	0.179													4	3	---	---	---	---	
PYGL	5836	broad.mit.edu	37	14	51379236	51379236	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51379236delT	uc001wyu.2	-						PYGL_uc010tqq.1_Intron|PYGL_uc001wyv.2_Intron	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1						glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	aatttttgtatttttagtaga	0.000													4	2	---	---	---	---	
DLST	1743	broad.mit.edu	37	14	75356828	75356830	+	Intron	DEL	TTT	-	-	rs34237381		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75356828_75356830delTTT	uc001xqv.2	+						DLST_uc001xqu.2_Intron|DLST_uc001xqt.2_Intron|DLST_uc010tuw.1_Intron|DLST_uc010tuu.1_Intron|DLST_uc001xqs.2_Intron|DLST_uc010tuv.1_Intron	NM_001933	NP_001924	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2						lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TACATTTAACttttttttttttt	0.103													4	2	---	---	---	---	
PTPN21	11099	broad.mit.edu	37	14	88971026	88971026	+	Intron	DEL	A	-	-	rs138863875		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88971026delA	uc001xwv.3	-						PTPN21_uc010twc.1_Intron|PTPN21_uc010atf.1_Intron	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						CACAAGAGCCAAAAAAAAAAA	0.398													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347467	92347468	+	Intron	INS	-	CC	CC	rs113395651		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347467_92347468insCC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				TCTATTCTacacacacacacac	0.203													6	3	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100602451	100602463	+	Intron	DEL	CCCCCAGAGCCTC	-	-	rs67380624		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100602451_100602463delCCCCCAGAGCCTC	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				TCTTATGGGTCCCCCAGAGCCTCCCCCAGGAGC	0.629													11	7	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30000937	30000937	+	Frame_Shift_Del	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30000937delT	uc001zcr.2	-	25	5151	c.4676delA	c.(4675-4677)CATfs	p.H1559fs	TJP1_uc010azl.2_Frame_Shift_Del_p.H1547fs|TJP1_uc001zcq.2_Frame_Shift_Del_p.H1483fs|TJP1_uc001zcs.2_Frame_Shift_Del_p.H1479fs	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	1559					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GTCAGGTTTATGTGCAGTTTC	0.418													227	105	---	---	---	---	
CCDC33	80125	broad.mit.edu	37	15	74564962	74564962	+	Intron	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74564962delC	uc002axo.2	+						CCDC33_uc002axp.2_Intron	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5						GCCCAGTGGTCCCCACTTGTC	0.572													10	7	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81627216	81627216	+	Frame_Shift_Del	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81627216delG	uc002bgo.1	-	21	2304	c.2304delC	c.(2302-2304)AACfs	p.N768fs	TMC3_uc010blr.1_RNA	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	768	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						CCACGTTGCCGTTGTTTTGGG	0.592													97	45	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	100328635	100328640	+	IGR	DEL	CTTTTC	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100328635_100328640delCTTTTC								LYSMD4 (55009 upstream) : C15orf51 (1721 downstream)																							cctttcctttcttttccttttccttt	0.039													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8449409	8449410	+	IGR	DEL	GA	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8449409_8449410delGA								A2BP1 (686069 upstream) : TMEM114 (170093 downstream)																							atgagaaagggagagagagaga	0.010													9	4	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8861847	8861848	+	Intron	INS	-	A	A			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8861847_8861848insA	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	ATTTGTGACTTAAAAAAAAAAA	0.198													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5620607	5620610	+	IGR	DEL	TTCT	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5620607_5620610delTTCT								NLRP1 (132775 upstream) : WSCD1 (351827 downstream)																							ccttctttccttctttctttcttt	0.113													4	3	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16011663	16011664	+	Intron	INS	-	T	T			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16011663_16011664insT	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TAAGTTTCGTGTTTTTTTTTTC	0.248													9	4	---	---	---	---	
ZNF286B	729288	broad.mit.edu	37	17	18581222	18581224	+	Intron	DEL	AGC	-	-	rs1071711		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18581222_18581224delAGC	uc010vyd.1	-							NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAGTTGGAAAAGCaaaaaaaaaa	0.315													4	2	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20768929	20768930	+	Intron	DEL	AT	-	-	rs76262633		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768929_20768930delAT	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						CCAGAAAAAAATATGTGAGAGA	0.292													5	3	---	---	---	---	
C17orf63	55731	broad.mit.edu	37	17	27162043	27162044	+	Intron	DEL	TG	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27162043_27162044delTG	uc010wax.1	-						C17orf63_uc010way.1_Intron|C17orf63_uc002hcw.2_Intron	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731											ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)			cagctaattttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29649111	29649114	+	Intron	DEL	ATAC	-	-	rs147816117	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29649111_29649114delATAC	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2A_uc002hgl.2_5'Flank|EVI2A_uc002hgm.2_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TAGTGTGTGTATacacacacacac	0.284			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43675427	43675427	+	IGR	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43675427delT								LRRC37A4 (79911 upstream) : LOC644172 (2064 downstream)																							TCTTACACTGTTTTTTTTTTT	0.284													5	6	---	---	---	---	
MFSD11	79157	broad.mit.edu	37	17	74766114	74766114	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74766114delT	uc002jta.2	+						MFSD11_uc002jtb.2_Intron|MFSD11_uc010dha.2_Intron|MFSD11_uc002jtc.2_Intron|MFSD11_uc002jtd.3_Intron|MFSD11_uc010dhb.2_Intron|MFSD11_uc002jte.2_Intron	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing							integral to membrane				ovary(1)	1						Attctttttcttttttttttt	0.124													6	3	---	---	---	---	
SEC14L1	6397	broad.mit.edu	37	17	75209703	75209704	+	Intron	INS	-	A	A	rs138018754	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75209703_75209704insA	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron|SEC14L1_uc010wtj.1_Intron|SEC14L1_uc002jtr.2_Frame_Shift_Ins_p.G118fs	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						GGCCAGGAGGGAGTGGCTTTGG	0.619													6	5	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14752820	14752820	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14752820delT	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						AATGTACTTCTTGCTTTAATA	0.313													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	703593	703593	+	IGR	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:703593delG								PRSSL1 (8132 upstream) : PALM (5360 downstream)																							GGGTTGGGGTGGGGGCCATAA	0.612													4	2	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3823090	3823090	+	Intron	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3823090delG	uc002lyw.2	-						ZFR2_uc010xhx.1_Intron	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GGGTCTGCACGGGGTTTTGGT	0.587													12	8	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10094530	10094531	+	Intron	INS	-	AA	AA	rs141118767	by1000genomes	TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10094530_10094531insAA	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TCGTTAAAAAGAAAAAAaaatc	0.079													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15674985	15674985	+	IGR	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15674985delC								CYP4F22 (11858 upstream) : CYP4F8 (51044 downstream)																							TGGCCCGTGTCCTGGCCTGGA	0.647													16	7	---	---	---	---	
NFKBIB	4793	broad.mit.edu	37	19	39399178	39399179	+	Intron	INS	-	AA	AA			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39399178_39399179insAA	uc002ojw.2	+						NFKBIB_uc002ojx.2_3'UTR|NFKBIB_uc002ojy.2_3'UTR	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			gactccatcttaaaaaaaaaaa	0.193													6	3	---	---	---	---	
C19orf47	126526	broad.mit.edu	37	19	40827777	40827777	+	3'UTR	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40827777delC	uc002oni.3	-	9					C19orf47_uc002ong.2_3'UTR|C19orf47_uc002onh.2_3'UTR	NM_178830	NP_849152	Q8N9M1	CS047_HUMAN	hypothetical protein LOC126526											ovary(1)|skin(1)	2			Lung(22;0.000636)			CTGCACCCCGCCCACAGGTGG	0.667													15	11	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46142640	46142641	+	5'UTR	INS	-	G	G			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46142640_46142641insG	uc002pcn.2	-	1					EML2_uc002pco.2_RNA|EML2_uc002pcp.2_5'UTR|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_5'UTR|EML2_uc010ekj.2_5'UTR|uc002pcr.1_5'Flank|MIR330_hsa-mir-330|MI0000803_5'Flank|uc002pcs.2_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CTCATGGCGGCGGGTGGCGGAG	0.579													4	2	---	---	---	---	
ZNF320	162967	broad.mit.edu	37	19	53393667	53393667	+	Intron	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53393667delC	uc002qag.2	-						ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Intron|ZNF320_uc002qai.2_Intron	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		GGAGGCCTCACCCTGGGAAAT	0.478													5	3	---	---	---	---	
SAMHD1	25939	broad.mit.edu	37	20	35555435	35555436	+	Intron	DEL	AT	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35555435_35555436delAT	uc002xgh.1	-							NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1						defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				aaacaaaagcatatatatatat	0.094													4	2	---	---	---	---	
LAMA5	3911	broad.mit.edu	37	20	60904422	60904426	+	Intron	DEL	CAGCC	-	-	rs3065756		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60904422_60904426delCAGCC	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGGCAGCAGcagcccagcccagcc	0.600													9	6	---	---	---	---	
APOL5	80831	broad.mit.edu	37	22	36113785	36113786	+	5'Flank	INS	-	AA	AA	rs71322979		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36113785_36113786insAA	uc003aof.2	+							NM_030642	NP_085145	Q9BWW9	APOL5_HUMAN	apolipoprotein L5						lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding				0						agctccatcgcaaaaaaaaaaa	0.139													4	3	---	---	---	---	
MLC1	23209	broad.mit.edu	37	22	50502369	50502370	+	Intron	DEL	TT	-	-	rs13053814		TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50502369_50502370delTT	uc003bjg.1	-						MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Intron|MLC1_uc011arm.1_Intron|MLC1_uc011arn.1_Intron|MLC1_uc011aro.1_Intron	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with							basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CCTCCCCAGCTTCCCCCCACCC	0.733													3	4	---	---	---	---	
MAGEB4	4115	broad.mit.edu	37	X	30261139	30261139	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30261139delC	uc004dcb.2	+	1	971	c.887delC	c.(886-888)ACCfs	p.T296fs	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	296	MAGE.									ovary(1)	1						AATGACACCACCCCCAATAAC	0.532													29	38	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	73094944	73094944	+	IGR	DEL	G	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73094944delG								XIST (22356 upstream) : NCRNA00183 (69215 downstream)																							TGCTCGTCCCGGTGGTCCTGG	0.483													30	49	---	---	---	---	
ZDHHC9	51114	broad.mit.edu	37	X	128948898	128948898	+	Intron	DEL	T	-	-			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128948898delT	uc004euv.2	-						ZDHHC9_uc004euw.2_Intron|ZDHHC9_uc004eux.1_Intron|ZDHHC9_uc004euy.1_Intron	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						AAATATAGGGTTTTTTTTTTT	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13462891	13462892	+	IGR	INS	-	C	C			TCGA-33-4583-01A-01D-1441-08	TCGA-33-4583-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13462891_13462892insC								None (None upstream) : None (None downstream)																							AAAGCAGACTGCGTCACCGGAT	0.629													12	8	---	---	---	---	
