Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PIK3CD	5293	broad.mit.edu	37	1	9775958	9775958	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9775958C>T	uc001aqb.3	+	5	630	c.422C>T	c.(421-423)GCC>GTC	p.A141V	PIK3CD_uc010oaf.1_Missense_Mutation_p.A141V|PIK3CD_uc001aqe.3_Missense_Mutation_p.A141V	NM_005026	NP_005017	O00329	PK3CD_HUMAN	catalytic phosphatidylinositol 3-kinase delta	141					phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(4)|skin(2)|central_nervous_system(1)	7	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)		GACTTTCGCGCCAAGATGTGC	0.687													5	27	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12416115	12416115	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12416115T>G	uc001atv.2	+	48	9980	c.9839T>G	c.(9838-9840)ATT>AGT	p.I3280S	VPS13D_uc001atw.2_Missense_Mutation_p.I3255S|VPS13D_uc001atx.2_Missense_Mutation_p.I2467S	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3279					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AAGATCTTCATTTCTGCTCCA	0.448													22	69	---	---	---	---	PASS
FAM151A	338094	broad.mit.edu	37	1	55089020	55089020	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55089020C>G	uc001cxn.2	-	1	181	c.49G>C	c.(49-51)GCC>CCC	p.A17P	ACOT11_uc001cxm.1_Intron	NM_176782	NP_788954	Q8WW52	F151A_HUMAN	hypothetical protein LOC338094	17	Helical; (Potential).					integral to membrane					0						GTAATGCCGGCAAACACCCAC	0.597													16	163	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62593720	62593720	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62593720C>G	uc001dab.2	+	40	5234	c.5120C>G	c.(5119-5121)GCC>GGC	p.A1707G	INADL_uc001dac.2_RNA|INADL_uc009wag.2_Missense_Mutation_p.A491G	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	1707	PDZ 10.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GTATTTATTGCCATGATTCAG	0.458													11	74	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	63044554	63044554	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63044554T>C	uc001daq.2	-	17	1989	c.1955A>G	c.(1954-1956)CAT>CGT	p.H652R	DOCK7_uc001dan.2_Missense_Mutation_p.H544R|DOCK7_uc001dao.2_Missense_Mutation_p.H544R|DOCK7_uc001dap.2_Missense_Mutation_p.H652R	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	652	DHR-1.				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						ACAACTAACATGATAAAAAGT	0.313													25	109	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70573448	70573448	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70573448C>G	uc001dep.2	+	24	4475	c.4445C>G	c.(4444-4446)ACT>AGT	p.T1482S	LRRC7_uc009wbg.2_Missense_Mutation_p.T766S|LRRC7_uc001deq.2_Missense_Mutation_p.T676S	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1482	PDZ.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						ATCTTTGTTACTAGGGTTCAG	0.408													23	152	---	---	---	---	PASS
FPGT	8790	broad.mit.edu	37	1	74670968	74670968	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74670968G>T	uc001dgb.1	+	4	1274	c.1237G>T	c.(1237-1239)GTG>TTG	p.V413L	TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron|FPGT_uc010oqt.1_Missense_Mutation_p.V38L|FPGT_uc010oqu.1_Missense_Mutation_p.V159L|FPGT_uc010oqv.1_Intron	NM_003838	NP_003829	O14772	FPGT_HUMAN	fucose-1-phosphate guanyltransferase	413					fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding			skin(1)	1						AAGATGTTCTGTGGCACCTGG	0.423													22	124	---	---	---	---	PASS
ACADM	34	broad.mit.edu	37	1	76198827	76198827	+	Intron	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76198827A>T	uc001dgw.3	+						ACADM_uc010orc.1_Intron|ACADM_uc010ord.1_Intron|ACADM_uc009wbp.2_Intron|ACADM_uc009wbr.2_Silent_p.L126L|ACADM_uc010ore.1_Intron|ACADM_uc010orf.1_Intron|ACADM_uc001dgx.3_Intron|ACADM_uc010org.1_Intron	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						ACTTGCACCTAAACCTTGGTA	0.378													13	67	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94654471	94654471	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94654471A>C	uc001dqj.3	-	15	1972	c.1603T>G	c.(1603-1605)TTT>GTT	p.F535V	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dqk.2_Missense_Mutation_p.F101V	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	535					Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AACATCCCAAATGTCCATGAT	0.358													19	107	---	---	---	---	PASS
FAM19A3	284467	broad.mit.edu	37	1	113264887	113264887	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113264887C>T	uc001ecv.2	+	2	101	c.32C>T	c.(31-33)ACG>ATG	p.T11M	FAM19A3_uc001ecu.2_Missense_Mutation_p.T11M|FAM19A3_uc010owk.1_RNA|FAM19A3_uc010owl.1_RNA	NM_182759	NP_877436	Q7Z5A8	F19A3_HUMAN	family with sequence similarity 19 (chemokine	11						extracellular region					0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AACTGGAGCACGGGCGGCTGG	0.642													27	141	---	---	---	---	PASS
AMPD1	270	broad.mit.edu	37	1	115222975	115222975	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115222975G>T	uc001efe.1	-	6	756	c.672C>A	c.(670-672)GTC>GTA	p.V224V	AMPD1_uc001eff.1_Silent_p.V220V	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	224					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CATCTTTGCTGACTGCTGCTT	0.443													21	139	---	---	---	---	PASS
WDR3	10885	broad.mit.edu	37	1	118497236	118497236	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118497236T>A	uc010oxe.1	+	23	2461	c.2395T>A	c.(2395-2397)TAT>AAT	p.Y799N	WDR3_uc001ehi.2_Intron|SPAG17_uc001ehk.2_Intron	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN	WD repeat-containing protein 3	799						nuclear membrane|nucleolus				upper_aerodigestive_tract(1)	1	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		CCTAATGGCTTATGGCAGTAT	0.358													23	118	---	---	---	---	PASS
PRDX6	9588	broad.mit.edu	37	1	173455423	173455423	+	Silent	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173455423G>C	uc001giy.1	+	4	480	c.429G>C	c.(427-429)CTG>CTC	p.L143L		NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6	143	Thioredoxin.				cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						ATAAGAAGCTGAAGCTGTCTA	0.448													41	258	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179604969	179604969	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179604969G>T	uc001gnf.1	+	9	1717	c.1467G>T	c.(1465-1467)CGG>CGT	p.R489R	TDRD5_uc010pnp.1_Silent_p.R489R|TDRD5_uc001gnh.1_Silent_p.R44R	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	489					DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						TCTACATCCGGATCTATAGCA	0.413													12	102	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183495814	183495814	+	Silent	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183495814A>G	uc001gqg.2	+	5	518	c.396A>G	c.(394-396)AAA>AAG	p.K132K	SMG7_uc010pob.1_Silent_p.K161K|SMG7_uc001gqf.2_Silent_p.K132K|SMG7_uc001gqh.2_Silent_p.K132K|SMG7_uc001gqi.2_Silent_p.K90K|SMG7_uc010poc.1_Silent_p.K90K	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	132					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCAGCAATAAACAGACGCATA	0.433													29	231	---	---	---	---	PASS
LMOD1	25802	broad.mit.edu	37	1	201868784	201868784	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201868784G>A	uc001gxb.2	-	2	1605	c.1357C>T	c.(1357-1359)CAT>TAT	p.H453Y	LMOD1_uc010ppu.1_Missense_Mutation_p.H402Y	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	453					muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						AGCTCAAAATGGTAGCCCAGC	0.572													6	26	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848335	215848335	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848335G>T	uc001hku.1	-	63	13305	c.12918C>A	c.(12916-12918)CTC>CTA	p.L4306L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4306	Fibronectin type-III 28.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAAAAGGATAGAGCATTTCAT	0.398										HNSCC(13;0.011)			16	107	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848336	215848336	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848336A>T	uc001hku.1	-	63	13304	c.12917T>A	c.(12916-12918)CTC>CAC	p.L4306H		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4306	Fibronectin type-III 28.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAAAGGATAGAGCATTTCATT	0.393										HNSCC(13;0.011)			16	108	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947904	237947904	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947904G>A	uc001hyl.1	+	90	13012	c.12892G>A	c.(12892-12894)GTG>ATG	p.V4298M	RYR2_uc010pya.1_Missense_Mutation_p.V713M	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4298	Helical; Name=M4; (Potential).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTGCACTTCGTGGCCAGCGT	0.463													13	51	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614352	247614352	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614352C>T	uc010pyx.1	-	1	933	c.933G>A	c.(931-933)AGG>AGA	p.R311R		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	311	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GCCTCCAGATCCTGGCCAGAA	0.453													47	294	---	---	---	---	PASS
OR6F1	343169	broad.mit.edu	37	1	247875519	247875519	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875519T>A	uc001idj.1	-	1	539	c.539A>T	c.(538-540)GAC>GTC	p.D180V		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GGGTGCAATGTCACAGAAGAA	0.567													18	94	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1691427	1691427	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1691427C>G	uc002qxa.2	-	4	457	c.393G>C	c.(391-393)AAG>AAC	p.K131N	PXDN_uc002qxb.1_Missense_Mutation_p.K131N|PXDN_uc002qxc.1_Intron	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	131	LRR 2.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGGCAAGTCCCTTAAATGCTT	0.468													4	30	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11342232	11342232	+	Silent	SNP	T	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11342232T>G	uc002rbd.1	-	21	3014	c.2565A>C	c.(2563-2565)GCA>GCC	p.A855A		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	855	Potential.				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTTGCCCATCTGCATCCTGAC	0.313													19	178	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29287726	29287726	+	3'UTR	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29287726G>A	uc002rmt.1	-	2						NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939						response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						TGGCCCCCTCGTCAGCCTGTC	0.632													5	30	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915374	48915374	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915374G>T	uc002rwu.3	-	11	1632	c.1562C>A	c.(1561-1563)ACC>AAC	p.T521N	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	521	Extracellular (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGAGAGAGTGGTTTCCACATC	0.403									Familial_Male-Limited_Precocious_Puberty				13	102	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77746099	77746099	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746099G>A	uc002snr.2	-	3	1311	c.896C>T	c.(895-897)GCG>GTG	p.A299V	LRRTM4_uc002snq.2_Missense_Mutation_p.A299V|LRRTM4_uc002sns.2_Missense_Mutation_p.A299V|LRRTM4_uc002snt.2_Missense_Mutation_p.A300V	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	299	LRR 10.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		TGATATCCACGCATTGACAGT	0.373													7	37	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79312367	79312367	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79312367G>T	uc002sny.2	-	6	588	c.476C>A	c.(475-477)TCC>TAC	p.S159Y		NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	159	C-type lectin.				cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						GCAAACAAAGGAGAACTTCTT	0.388													7	60	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79312368	79312368	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79312368A>T	uc002sny.2	-	6	587	c.475T>A	c.(475-477)TCC>ACC	p.S159T		NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	159	C-type lectin.				cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						CAAACAAAGGAGAACTTCTTC	0.388													8	60	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79350262	79350262	+	Intron	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79350262A>G	uc002snz.2	+						REG1A_uc010ysd.1_Intron	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor						positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						AACTCTTCTCATTGACTTATA	0.423													8	51	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79384834	79384834	+	Intron	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79384834A>G	uc002sod.1	-						REG3A_uc002soe.1_Intron|REG3A_uc002sof.1_Intron	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor						acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						CCTGTAGAGTAGAGGAGGTAG	0.522													12	78	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136579614	136579614	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136579614C>T	uc002tuu.1	-	5	973	c.962G>A	c.(961-963)AGT>AAT	p.S321N	uc002tuv.1_RNA	NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	321	Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGATGAACAACTCAGAAACTC	0.264													10	69	---	---	---	---	PASS
PSMD14	10213	broad.mit.edu	37	2	162242083	162242083	+	Splice_Site	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162242083G>C	uc002ubu.2	+	8	1037	c.570_splice	c.e8+1	p.Q190_splice		NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						ATCTATCCAGGTATTGCCTAT	0.318													5	48	---	---	---	---	PASS
GCG	2641	broad.mit.edu	37	2	163003990	163003990	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163003990C>T	uc002ucc.2	-	3	226	c.127G>A	c.(127-129)GAT>AAT	p.D43N		NM_002054	NP_002045	P01275	GLUC_HUMAN	glucagon preproprotein	43					cell proliferation|cellular response to glucagon stimulus|energy reserve metabolic process|feeding behavior|regulation of insulin secretion	plasma membrane|soluble fraction	hormone activity				0					Exenatide(DB01276)|Phentolamine(DB00692)	TGATCAGGATCACTGAGTGGG	0.483													51	282	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175618289	175618289	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175618289G>T	uc002ujd.2	-	7	873	c.795C>A	c.(793-795)ATC>ATA	p.I265I	uc002uiw.2_Intron|CHRNA1_uc002uje.2_Silent_p.I240I|CHRNA1_uc002ujf.3_Silent_p.I240I	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	265	Helical.				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GCAGGCAGGGGATGATGACGT	0.582													19	130	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179236930	179236930	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179236930C>T	uc002ulx.2	+	14	1743	c.1365C>T	c.(1363-1365)GTC>GTT	p.V455V	OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Silent_p.V480V|OSBPL6_uc010zfe.1_Silent_p.V424V|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Silent_p.V459V	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	455					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			ATCAGGTTGTCAGTGTAAATA	0.328													6	69	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179425376	179425376	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179425376G>T	uc010zfg.1	-	275	78003	c.77779C>A	c.(77779-77781)CAC>AAC	p.H25927N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.H19622N|TTN_uc010zfi.1_Missense_Mutation_p.H19555N|TTN_uc010zfj.1_Missense_Mutation_p.H19430N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26854							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATGCAAGGTGGCTTGTTTCA	0.423													7	68	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179576077	179576077	+	Splice_Site	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179576077C>T	uc010zfg.1	-	94	24379	c.24155_splice	c.e94-1	p.E8052_splice	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Splice_Site_p.E4713_splice	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTTTTGCTCTGTAGGAACA	0.323													16	73	---	---	---	---	PASS
TRAK2	66008	broad.mit.edu	37	2	202254231	202254231	+	Intron	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202254231C>A	uc002uyb.3	-							NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2							early endosome|plasma membrane	GABA receptor binding				0						TGGGCTCTGTCAAAAAAGGAA	0.478													4	48	---	---	---	---	PASS
SLC23A3	151295	broad.mit.edu	37	2	220034386	220034386	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220034386C>T	uc010zks.1	-	2	288	c.177G>A	c.(175-177)ATG>ATA	p.M59I	NHEJ1_uc002vjq.3_RNA|SLC23A3_uc010zkr.1_Missense_Mutation_p.M59I|SLC23A3_uc010fwb.2_Missense_Mutation_p.M59I|SLC23A3_uc002vjs.1_5'Flank|SLC23A3_uc002vjt.1_5'Flank	NM_001144889	NP_001138361	Q6PIS1	S23A3_HUMAN	solute carrier family 23 (nucleobase	59	Helical; (Potential).				transmembrane transport	integral to membrane	protein binding|transporter activity				0		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCAGAGAAGCCATGACCAAGA	0.532													8	51	---	---	---	---	PASS
SP140	11262	broad.mit.edu	37	2	231120221	231120221	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231120221C>T	uc002vql.2	+	12	1329	c.1214C>T	c.(1213-1215)TCT>TTT	p.S405F	SP140_uc010zma.1_RNA|SP140_uc002vqk.2_Missense_Mutation_p.S371F|SP140_uc002vqn.2_Missense_Mutation_p.S291F|SP140_uc002vqm.2_Missense_Mutation_p.S345F|SP140_uc010fxl.2_Intron	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	405					defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CAGGAAGCCTCTAGCTCCCTA	0.547													14	98	---	---	---	---	PASS
SRGAP3	9901	broad.mit.edu	37	3	9036126	9036126	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9036126G>A	uc003brf.1	-	19	2985	c.2309C>T	c.(2308-2310)TCG>TTG	p.S770L	SRGAP3_uc003brg.1_Missense_Mutation_p.S746L	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	770	SH3.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CAGGAGCAGCGAGGCCCCCTT	0.587			T	RAF1	pilocytic astrocytoma								15	73	---	---	---	---	PASS
TMPPE	643853	broad.mit.edu	37	3	33135655	33135655	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33135655C>T	uc003cfk.2	-	2	224	c.33G>A	c.(31-33)GCG>GCA	p.A11A	GLB1_uc003cfh.1_Intron|GLB1_uc003cfi.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron|TMPPE_uc011axl.1_Intron	NM_001039770	NP_001034859	Q6ZT21	TMPPE_HUMAN	transmembrane protein with	11	Helical; (Potential).					integral to membrane	metal ion binding				0						GGGTGGCCTTCGCGCCTAGGG	0.587													14	71	---	---	---	---	PASS
DLEC1	9940	broad.mit.edu	37	3	38138086	38138086	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38138086C>T	uc003cho.1	+	15	2219	c.2198C>T	c.(2197-2199)TCC>TTC	p.S733F	DLEC1_uc003chp.1_Missense_Mutation_p.S733F|DLEC1_uc010hgv.1_Missense_Mutation_p.S733F|DLEC1_uc003chr.1_5'UTR|DLEC1_uc010hgx.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	733					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CTGGGGCACTCCTCCTACTCT	0.532													20	118	---	---	---	---	PASS
ANO10	55129	broad.mit.edu	37	3	43621948	43621948	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43621948C>T	uc003cmv.2	-	5	660	c.489G>A	c.(487-489)ACG>ACA	p.T163T	ANO10_uc011azs.1_Silent_p.T163T|ANO10_uc003cmw.2_Silent_p.T97T|ANO10_uc010hil.2_Silent_p.T163T|ANO10_uc011azt.1_Silent_p.T52T	NM_018075	NP_060545	Q9NW15	ANO10_HUMAN	transmembrane protein 16K	163	Cytoplasmic (Potential).				cell death	chloride channel complex	chloride channel activity			ovary(2)	2						CGATGCCAGACGTGAGCAATC	0.473													8	60	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111993834	111993834	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111993834T>A	uc003dyu.2	-	6	745	c.523A>T	c.(523-525)AGT>TGT	p.S175C	SLC9A10_uc011bhu.1_Translation_Start_Site|SLC9A10_uc010hqc.2_Missense_Mutation_p.S175C	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	175	Helical; (Potential).				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						GTCATCAGACTTTCTCCATTA	0.294													15	96	---	---	---	---	PASS
CCDC14	64770	broad.mit.edu	37	3	123667907	123667907	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123667907T>C	uc011bjx.1	-	6	660	c.569A>G	c.(568-570)GAG>GGG	p.E190G	CCDC14_uc003egv.3_5'UTR|CCDC14_uc003egx.3_5'UTR|CCDC14_uc010hrt.2_Missense_Mutation_p.E149G|CCDC14_uc003egy.3_5'UTR|CCDC14_uc003egz.2_5'UTR	NM_022757	NP_073594	Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	190						centrosome					0		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		CCAGTTTTGCTCTAGGTCTGA	0.388													5	28	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142177868	142177868	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142177868C>T	uc003eux.3	-	44	7557	c.7435G>A	c.(7435-7437)GAA>AAA	p.E2479K	ATR_uc003euy.1_Missense_Mutation_p.E365K	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2479	PI3K/PI4K.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						AGAATATTTTCACCATGACGG	0.373								Other_conserved_DNA_damage_response_genes					12	33	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145806480	145806480	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145806480T>C	uc003evs.1	-	9	1404	c.898A>G	c.(898-900)ATA>GTA	p.I300V	PLOD2_uc003evq.1_5'Flank|PLOD2_uc011bnm.1_Missense_Mutation_p.I245V|PLOD2_uc003evr.1_Missense_Mutation_p.I300V	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	300					protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	AAAACACCTATTGATACGTTT	0.308													6	55	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148558740	148558740	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148558740G>T	uc003ewl.2	+	5	475	c.452G>T	c.(451-453)GGA>GTA	p.G151V		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	151					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			ACATTTGAGGGACGCGCTATT	0.428													12	105	---	---	---	---	PASS
CPA3	1359	broad.mit.edu	37	3	148614388	148614388	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148614388G>T	uc003ewm.2	+	11	1200	c.1148G>T	c.(1147-1149)GGC>GTC	p.G383V		NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor	383					proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CGAGATAAAGGCAAATTTGGT	0.433													26	103	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155560403	155560403	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155560403G>A	uc003fan.3	-	2	1162	c.781C>T	c.(781-783)CTT>TTT	p.L261F	SLC33A1_uc003fao.1_Missense_Mutation_p.L261F	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	261	Helical; (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CAGAAAAAAAGGAAATCTGAA	0.184													4	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	161147011	161147011	+	IGR	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161147011G>A								C3orf57 (57140 upstream) : OTOL1 (67585 downstream)																							GAATCAGGATGTTGACCTTGG	0.438													38	125	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178916726	178916726	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178916726G>T	uc003fjk.2	+	2	270	c.113G>T	c.(112-114)CGT>CTT	p.R38L		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	38	PI3K-ABD.		R -> H (in cancer; shows an increase in lipid kinase activity; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R38H(4)|p.R38S(1)|p.R38G(1)|p.R38C(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAATGCCTCCGTGAGGCTACA	0.393		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			79	100	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179525562	179525562	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179525562C>T	uc003fki.1	-	14	1706	c.1576G>A	c.(1576-1578)GAA>AAA	p.E526K	PEX5L_uc011bqd.1_Missense_Mutation_p.E483K|PEX5L_uc011bqe.1_Missense_Mutation_p.E334K|PEX5L_uc011bqf.1_Missense_Mutation_p.E418K|PEX5L_uc003fkj.1_Missense_Mutation_p.E491K|PEX5L_uc010hxd.1_Missense_Mutation_p.E524K|PEX5L_uc011bqg.1_Missense_Mutation_p.E502K|PEX5L_uc011bqh.1_Missense_Mutation_p.E467K	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	526	TPR 4.				protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCCACGGCTTCCTCGCTGCGG	0.542													23	395	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	182937639	182937639	+	Intron	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182937639A>G	uc003fli.1	-							NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTTAATATTGAGTACCTTAGC	0.373													4	170	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46312249	46312249	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46312249G>A	uc003gxc.3	-	5	1173	c.500C>T	c.(499-501)CCA>CTA	p.P167L	GABRA2_uc010igc.2_Missense_Mutation_p.P167L|GABRA2_uc011bzc.1_Missense_Mutation_p.P112L|GABRA2_uc003gxe.2_Missense_Mutation_p.P167L	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	167	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CAAGTGCATTGGGCATTCAGC	0.368													17	68	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114158196	114158196	+	Silent	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114158196G>C	uc003ibe.3	+	6	637	c.537G>C	c.(535-537)GTG>GTC	p.V179V	ANK2_uc003ibd.3_Silent_p.V158V|ANK2_uc003ibf.3_Silent_p.V179V|ANK2_uc003ibc.2_Silent_p.V155V|ANK2_uc011cgb.1_Silent_p.V194V	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	179	ANK 5.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACCAGGCGGTGGCCATCCTCT	0.498													26	159	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114158197	114158197	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114158197G>T	uc003ibe.3	+	6	638	c.538G>T	c.(538-540)GCC>TCC	p.A180S	ANK2_uc003ibd.3_Missense_Mutation_p.A159S|ANK2_uc003ibf.3_Missense_Mutation_p.A180S|ANK2_uc003ibc.2_Missense_Mutation_p.A156S|ANK2_uc011cgb.1_Missense_Mutation_p.A195S	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	180	ANK 5.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCAGGCGGTGGCCATCCTCTT	0.498													27	158	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115858645	115858645	+	Silent	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115858645T>C	uc003ibu.2	-	5	1915	c.1236A>G	c.(1234-1236)CCA>CCG	p.P412P	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	412	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CCATGTTGATTGGTATTCCAT	0.398													8	55	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156634427	156634427	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156634427C>A	uc003iov.2	+	8	1800	c.1264C>A	c.(1264-1266)CAA>AAA	p.Q422K	GUCY1A3_uc010iqc.2_Missense_Mutation_p.Q422K|GUCY1A3_uc003iow.2_Missense_Mutation_p.Q422K|GUCY1A3_uc010iqd.2_Missense_Mutation_p.Q421K|GUCY1A3_uc003iox.2_Missense_Mutation_p.Q422K|GUCY1A3_uc003ioz.2_Missense_Mutation_p.Q187K|GUCY1A3_uc003ioy.2_Missense_Mutation_p.Q422K|GUCY1A3_uc010iqe.2_Missense_Mutation_p.Q187K|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.Q422K	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	422					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		AGCCCGAGCTCAAGATGGCCT	0.512													7	43	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162402262	162402262	+	Silent	SNP	A	T	T	rs141141092		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162402262A>T	uc003iqh.2	-	13	1954	c.1518T>A	c.(1516-1518)GCT>GCA	p.A506A	FSTL5_uc003iqi.2_Silent_p.A505A|FSTL5_uc010iqv.2_Silent_p.A496A	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	506						extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TGACATTAACAGCTGATGCCC	0.383													31	188	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166935601	166935601	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166935601G>T	uc003irh.1	+	8	1578	c.931G>T	c.(931-933)GAT>TAT	p.D311Y	TLL1_uc011cjn.1_Missense_Mutation_p.D311Y|TLL1_uc011cjo.1_Missense_Mutation_p.D135Y	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	311	Metalloprotease (By similarity).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GATGTTTCTGGATACCATTCT	0.418													41	268	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189018262	189018262	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189018262C>A	uc003izl.2	-	6	584	c.548G>T	c.(547-549)AGT>ATT	p.S183I	TRIML2_uc003izj.1_5'UTR|TRIML2_uc003izk.1_5'UTR|TRIML2_uc011cle.1_Missense_Mutation_p.S258I	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	183	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GTGGCATAAACTCAGGTCTGT	0.498													27	150	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189018263	189018263	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189018263T>A	uc003izl.2	-	6	583	c.547A>T	c.(547-549)AGT>TGT	p.S183C	TRIML2_uc003izj.1_5'UTR|TRIML2_uc003izk.1_5'UTR|TRIML2_uc011cle.1_Missense_Mutation_p.S258C	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	183	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TGGCATAAACTCAGGTCTGTG	0.498													26	150	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13776797	13776797	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13776797G>T	uc003jfd.2	-	55	9166	c.9124C>A	c.(9124-9126)CGA>AGA	p.R3042R		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3042	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ATTTCATCTCGAGCAAATAGG	0.383									Kartagener_syndrome				13	77	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36104168	36104168	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36104168C>T	uc003jkb.1	-	18	2483	c.2068G>A	c.(2068-2070)GAC>AAC	p.D690N	uc003jka.1_5'Flank	NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	690	Cytoplasmic (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTAAATATGTCACTGCGAGAC	0.383													4	26	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41201677	41201677	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41201677G>T	uc003jmk.2	-	3	493	c.283C>A	c.(283-285)CCT>ACT	p.P95T	C6_uc003jml.1_Missense_Mutation_p.P95T	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	95	TSP type-1 2.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TCAATACAAGGGTCACAGTCT	0.458													10	45	---	---	---	---	PASS
DEPDC1B	55789	broad.mit.edu	37	5	59940622	59940622	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59940622T>A	uc003jsh.2	-	5	732	c.659A>T	c.(658-660)AAT>ATT	p.N220I	DEPDC1B_uc011cqm.1_Missense_Mutation_p.N220I|DEPDC1B_uc011cqn.1_Missense_Mutation_p.N193I	NM_018369	NP_060839	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B isoform 1	220	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)	1		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				ACTATATACATTATGGATGAT	0.308													11	68	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63257089	63257089	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63257089G>T	uc011cqt.1	-	1	458	c.458C>A	c.(457-459)GCC>GAC	p.A153D		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	153	Helical; Name=4; (By similarity).			RAA -> PR (in Ref. 1; AAA36440/CAA31908).	behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	GAGCGCAGCGGCGCGCCGGGG	0.647													19	88	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89999529	89999529	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89999529A>T	uc003kju.2	+	35	8299	c.8203A>T	c.(8203-8205)AAT>TAT	p.N2735Y	GPR98_uc003kjt.2_Missense_Mutation_p.N441Y|GPR98_uc003kjv.2_Missense_Mutation_p.N335Y	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2735	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGGTCGAGGAAATGTTACTGT	0.318													4	32	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139838244	139838244	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139838244A>T	uc003lfs.1	+	8	1401	c.1277A>T	c.(1276-1278)GAT>GTT	p.D426V	ANKHD1_uc003lfq.1_Missense_Mutation_p.D426V|ANKHD1_uc003lfr.2_Missense_Mutation_p.D426V|ANKHD1_uc003lft.1_5'Flank|ANKHD1_uc003lfu.1_5'Flank|ANKHD1_uc003lfp.2_Missense_Mutation_p.D415V|ANKHD1_uc003lfo.2_Missense_Mutation_p.D426V|ANKHD1_uc010jfk.2_Missense_Mutation_p.D426V	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	426						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGCTTTTGGATAGTGGTGCT	0.408													7	51	---	---	---	---	PASS
HARS2	23438	broad.mit.edu	37	5	140073533	140073533	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140073533T>G	uc003lgx.2	+	3	413	c.197T>G	c.(196-198)CTT>CGT	p.L66R	HARS_uc003lgv.2_5'Flank|HARS_uc011czm.1_5'Flank|HARS_uc003lgw.2_5'Flank|HARS_uc011czn.1_5'Flank|HARS_uc010jfu.2_5'Flank|HARS_uc011czo.1_5'Flank|HARS_uc011czp.1_5'Flank|HARS_uc011czq.1_5'Flank|HARS2_uc010jfv.1_5'UTR|HARS2_uc011czr.1_Missense_Mutation_p.L41R|HARS2_uc011czs.1_5'UTR|HARS2_uc011czt.1_Intron|HARS2_uc011czu.1_5'Flank	NM_012208	NP_036340	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2 precursor	66					histidyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|histidine-tRNA ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCAGGGATCTTAGTCCTCAG	0.398													30	233	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140188235	140188235	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188235C>T	uc003lhi.2	+	1	1564	c.1463C>T	c.(1462-1464)GCG>GTG	p.A488V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.A488V|PCDHA4_uc011daa.1_Missense_Mutation_p.A488V	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	488	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGAGAACGCGCTGGTGTCC	0.652													12	56	---	---	---	---	PASS
ANXA6	309	broad.mit.edu	37	5	150518926	150518926	+	Silent	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150518926G>C	uc003ltl.1	-	4	344	c.192C>G	c.(190-192)TCC>TCG	p.S64S	ANXA6_uc011dcp.1_Silent_p.S32S|ANXA6_uc003ltm.1_Silent_p.S64S|ANXA6_uc003ltn.1_Silent_p.S64S|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1	64	Annexin 1.					melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCCGTAGAGGGACTTGTAGC	0.547													8	42	---	---	---	---	PASS
SLU7	10569	broad.mit.edu	37	5	159839520	159839520	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159839520G>A	uc003lyg.2	-	6	732	c.577C>T	c.(577-579)CGA>TGA	p.R193*		NM_006425	NP_006416	O95391	SLU7_HUMAN	step II splicing factor SLU7	193					alternative nuclear mRNA splicing, via spliceosome|nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|cytoplasm|nuclear speck|small nuclear ribonucleoprotein complex	pre-mRNA 3'-splice site binding|second spliceosomal transesterification activity|zinc ion binding			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCAATGTTCGTTTTGCCTTT	0.254													11	65	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178566994	178566994	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178566994G>A	uc003mjw.2	-	11	1672	c.1672C>T	c.(1672-1674)CTC>TTC	p.L558F		NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	558	Disintegrin.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TCCCGTTTGAGGATGTCAGGT	0.602													32	216	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180030235	180030235	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180030235G>T	uc003mlz.3	-	30	4128	c.4049C>A	c.(4048-4050)TCC>TAC	p.S1350Y		NM_182925	NP_891555	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 1	Error:Variant_position_missing_in_P35916_after_alignment					positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GGCAGACGGGGAGCAGTGGTC	0.662									Congenital_Hereditary_Lymphedema				10	54	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25868572	25868572	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25868572T>C	uc003nfi.3	-	2	154	c.44A>G	c.(43-45)AAG>AGG	p.K15R	SLC17A3_uc003nfk.3_Missense_Mutation_p.K15R|SLC17A3_uc011djz.1_Missense_Mutation_p.K15R|SLC17A3_uc011dka.1_Missense_Mutation_p.K15R	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),	15					glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						TTGTGCGTTCTTGCTCTCCCT	0.433													15	55	---	---	---	---	PASS
VARS	7407	broad.mit.edu	37	6	31749681	31749681	+	Missense_Mutation	SNP	G	A	A	rs55786236		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31749681G>A	uc003nxe.2	-	19	2713	c.2290C>T	c.(2290-2292)CGG>TGG	p.R764W	VARS_uc003nxf.1_5'Flank|VARS_uc011doi.1_RNA	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase	764					translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)	GCCTTCTCCCGGGCCTCCGCC	0.627													42	172	---	---	---	---	PASS
DAXX	1616	broad.mit.edu	37	6	33288240	33288240	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33288240C>T	uc003oec.2	-	4	1372	c.1168G>A	c.(1168-1170)GAG>AAG	p.E390K	ZBTB22_uc003oeb.2_5'Flank|ZBTB22_uc010juu.2_5'Flank|DAXX_uc011drd.1_Missense_Mutation_p.E315K|DAXX_uc011dre.1_Missense_Mutation_p.E402K|DAXX_uc003oed.2_Missense_Mutation_p.E390K|DAXX_uc010juw.2_Missense_Mutation_p.E315K	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	390	Potential.|Necessary for interaction with USP7.				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding			pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						TTTTTTCTCTCGCCCTCCTCA	0.557			Mis|F|N		Pancreatic neuroendocrine tumors								17	89	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36298396	36298396	+	Silent	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36298396G>C	uc003oly.2	-	2	250	c.72C>G	c.(70-72)GCC>GCG	p.A24A		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	24										skin(2)|ovary(1)|breast(1)	4						CTTTCCCGGGGGCCTGCGGCC	0.642													13	88	---	---	---	---	PASS
PAQR8	85315	broad.mit.edu	37	6	52268702	52268702	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52268702C>T	uc003pao.3	+	2	865	c.691C>T	c.(691-693)CGT>TGT	p.R231C		NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member	231	Helical; Name=4; (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)					TGTGGCACACCGTGTGGCGCT	0.547													12	55	---	---	---	---	PASS
PRDM1	639	broad.mit.edu	37	6	106554352	106554352	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106554352G>A	uc003prd.2	+	6	2114	c.1880G>A	c.(1879-1881)GGA>GAA	p.G627E	PRDM1_uc003pre.2_Missense_Mutation_p.G493E	NM_001198	NP_001189	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain isoform	627					negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		GTACACACGGGAGAAAAGCCA	0.498			D|N|Mis|F|S		DLBCL								13	61	---	---	---	---	PASS
SLC22A16	85413	broad.mit.edu	37	6	110746252	110746252	+	Silent	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110746252A>G	uc003puf.2	-	8	1625	c.1558T>C	c.(1558-1560)TTA>CTA	p.L520L	SLC22A16_uc003pue.2_Silent_p.L501L	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16	520	Helical; (Potential).				acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		TTTAGTGTTAACACTCCACTC	0.428													16	107	---	---	---	---	PASS
FRK	2444	broad.mit.edu	37	6	116263644	116263644	+	Missense_Mutation	SNP	C	A	A	rs141525046	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116263644C>A	uc003pwi.1	-	8	1898	c.1451G>T	c.(1450-1452)CGT>CTT	p.R484L		NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase	484	Protein kinase.				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.R484C(1)		ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)		AAGTTTCCAACGCAGTGTCTC	0.388													10	104	---	---	---	---	PASS
RPA3	6119	broad.mit.edu	37	7	7678778	7678778	+	Intron	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7678778A>G	uc003sri.2	-						RPA3_uc003srh.2_Intron	NM_002947	NP_002938	P35244	RFA3_HUMAN	replication protein A3, 14kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	cytoplasm|DNA replication factor A complex|nucleoplasm	protein binding|single-stranded DNA binding			large_intestine(1)	1		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)		GGATGAATCTAAAAACGAAAC	0.328								Direct_reversal_of_damage|NER					5	43	---	---	---	---	PASS
C7orf31	136895	broad.mit.edu	37	7	25218815	25218815	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25218815C>T	uc003sxn.1	-	2	674	c.113G>A	c.(112-114)CGC>CAC	p.R38H		NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895	38											0						GGCAGTTGGGCGAGTAACCGT	0.428													11	72	---	---	---	---	PASS
INMT	11185	broad.mit.edu	37	7	30795128	30795128	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30795128G>A	uc003tbs.1	+	3	469	c.453G>A	c.(451-453)CCG>CCA	p.P151P	FAM188B_uc010kwe.2_Intron|INMT_uc010kwc.1_RNA|INMT_uc010kwd.1_Silent_p.P150P	NM_006774	NP_006765	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	151						cytoplasm	amine N-methyltransferase activity				0						CGCTGGCCCCGGCTGTGTTGC	0.657													15	42	---	---	---	---	PASS
GHRHR	2692	broad.mit.edu	37	7	31018861	31018861	+	3'UTR	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31018861C>G	uc003tbx.2	+	13					GHRHR_uc003tby.2_3'UTR|GHRHR_uc003tbz.2_3'UTR	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor						activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	ATGTGCTAGGCTGCCTCATCA	0.622													5	40	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31855568	31855568	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31855568C>T	uc003tcm.1	-	15	2252	c.1783G>A	c.(1783-1785)GAG>AAG	p.E595K	PDE1C_uc003tcn.1_Missense_Mutation_p.E595K|PDE1C_uc003tco.1_Missense_Mutation_p.E655K|PDE1C_uc003tcr.2_Missense_Mutation_p.E595K|PDE1C_uc003tcs.2_Missense_Mutation_p.E595K	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	595					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GATGACTTCTCGGCTTTGGAG	0.443													28	253	---	---	---	---	PASS
VOPP1	81552	broad.mit.edu	37	7	55559980	55559980	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55559980C>A	uc003tqs.2	-	4	506	c.323G>T	c.(322-324)GGC>GTC	p.G108V	VOPP1_uc003tqq.2_Missense_Mutation_p.G99V|VOPP1_uc010kzh.2_Missense_Mutation_p.G105V|VOPP1_uc010kzi.2_Missense_Mutation_p.G91V|VOPP1_uc011kcr.1_Missense_Mutation_p.G40V	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN	EGFR-coamplified and overexpressed protein	108	Pro-rich.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0						CTGACCTGGGCCGGGATTTGG	0.602													3	25	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71175877	71175877	+	Silent	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71175877C>A	uc003tvy.2	+	10	1632	c.1632C>A	c.(1630-1632)GTC>GTA	p.V544V	WBSCR17_uc003tvz.2_Silent_p.V243V	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	544	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GCGACAAGGTCAAGAGCAGCC	0.612													8	52	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94055374	94055374	+	Intron	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94055374G>T	uc003ung.1	+						COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GTATGTACATGCTGAAGATTT	0.368										HNSCC(75;0.22)			13	110	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95442571	95442571	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95442571T>C	uc003uoc.3	+	4	564	c.287T>C	c.(286-288)ATG>ACG	p.M96T	DYNC1I1_uc003uod.3_Missense_Mutation_p.M79T|DYNC1I1_uc003uob.2_Missense_Mutation_p.M79T|DYNC1I1_uc003uoe.3_Missense_Mutation_p.M96T|DYNC1I1_uc010lfl.2_Missense_Mutation_p.M85T	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	96	Interaction with DCTN1 (By similarity).				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CCAACCCCTATGTCTCCCTCC	0.448													12	100	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98488019	98488019	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98488019C>T	uc003upp.2	+	4	421	c.212C>T	c.(211-213)ACA>ATA	p.T71I	TRRAP_uc011kis.1_Missense_Mutation_p.T71I	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	71					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CGATTCCTTACATTTCTCCAA	0.393													9	49	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100361426	100361426	+	Intron	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100361426C>G	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGGTCTCTTGCAGGTGTCAGA	0.592													14	107	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101877531	101877531	+	Intron	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101877531C>T	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						GTAAGTCTCCCTGCCCCGCCC	0.552													6	35	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508642	106508642	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508642G>T	uc003vdv.3	+	2	721	c.636G>T	c.(634-636)TGG>TGT	p.W212C	PIK3CG_uc003vdu.2_Missense_Mutation_p.W212C|PIK3CG_uc003vdw.2_Missense_Mutation_p.W212C	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	212					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						AGTACCTGTGGAAGAAGATTG	0.637													10	78	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142013242	142013242	+	Intron	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013242G>A	uc011kro.1	+						uc011krp.1_Intron|uc003vxg.2_Missense_Mutation_p.G33R|uc003vxh.1_Missense_Mutation_p.G30R					SubName: Full=V_segment translation product; Flags: Fragment;																		CCTGGTCATGGGAATGACAAA	0.463													17	82	---	---	---	---	PASS
C7orf34	135927	broad.mit.edu	37	7	142637536	142637536	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142637536G>A	uc003wca.2	+	2	347	c.306G>A	c.(304-306)TCG>TCA	p.S102S		NM_178829	NP_849151	Q96L11	CG034_HUMAN	hypothetical protein LOC135927	77						extracellular region					0	Melanoma(164;0.059)					AAGACCAGTCGTCCAAGACGG	0.542													25	127	---	---	---	---	PASS
OR2F1	26211	broad.mit.edu	37	7	143657764	143657764	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657764G>C	uc003wds.1	+	1	745	c.701G>C	c.(700-702)AGA>ACA	p.R234T		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					AGAGAAGGAAGAAAGAAAGCT	0.498													14	103	---	---	---	---	PASS
GIMAP6	474344	broad.mit.edu	37	7	150324980	150324980	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150324980A>G	uc003whn.2	-	3	1130	c.706T>C	c.(706-708)TAC>CAC	p.Y236H	GIMAP6_uc003whm.2_Missense_Mutation_p.Y156H	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	236							GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTATATTGGTAAGCCTTGTTG	0.517													31	164	---	---	---	---	PASS
MFHAS1	9258	broad.mit.edu	37	8	8747574	8747574	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8747574G>C	uc003wsj.1	-	1	3558	c.2995C>G	c.(2995-2997)CCA>GCA	p.P999A		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	999											0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CACTTACCTGGAAAAGCATGT	0.438													3	95	---	---	---	---	PASS
ADAMDEC1	27299	broad.mit.edu	37	8	24250859	24250859	+	Intron	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24250859G>T	uc003xdz.2	+						ADAMDEC1_uc010lub.2_Intron|ADAMDEC1_uc011lab.1_Intron	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1						integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		CAAGTAAGTTGTACCTCCTAA	0.353													20	98	---	---	---	---	PASS
GSR	2936	broad.mit.edu	37	8	30557630	30557630	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30557630G>A	uc003xih.1	-	6	754	c.663C>T	c.(661-663)AGC>AGT	p.S221S		NM_000637	NP_000628	P00390	GSHR_HUMAN	glutathione reductase precursor	221					cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity			ovary(2)|pancreas(2)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Glutathione(DB00143)|NADH(DB00157)	AAAATCCATCGCTGGTTATTC	0.428													25	101	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35631953	35631953	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35631953G>T	uc003xjr.1	+	16	2943	c.2615G>T	c.(2614-2616)GGC>GTC	p.G872V	UNC5D_uc003xjs.1_Missense_Mutation_p.G867V|UNC5D_uc003xju.1_Missense_Mutation_p.G448V	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	872	Death.|Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		AATGCCAAAGGCAAGGACTGG	0.463													28	62	---	---	---	---	PASS
TGS1	96764	broad.mit.edu	37	8	56711626	56711626	+	Missense_Mutation	SNP	A	T	T	rs140316366		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56711626A>T	uc003xsj.3	+	8	2083	c.1696A>T	c.(1696-1698)AAT>TAT	p.N566Y	TGS1_uc010lyh.2_Missense_Mutation_p.N470Y	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog	566				Missing (in Ref. 1; AAK27730).	cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			ACTGGAGACTAATAATCCAGA	0.418													13	93	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69000007	69000007	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69000007G>A	uc003xxv.1	+	19	2103	c.2076G>A	c.(2074-2076)CGG>CGA	p.R692R	PREX2_uc003xxu.1_Silent_p.R692R|PREX2_uc011lez.1_Silent_p.R627R	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	692	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TCCAGATCCGGGGATTTGGCC	0.453													20	180	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77765739	77765739	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77765739C>G	uc003yav.2	+	10	6834	c.6447C>G	c.(6445-6447)AAC>AAG	p.N2149K	ZFHX4_uc003yau.1_Missense_Mutation_p.N2194K|ZFHX4_uc003yaw.1_Missense_Mutation_p.N2149K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2149						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CACCATACAACTTCAGTAACC	0.368										HNSCC(33;0.089)			24	194	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113331091	113331091	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113331091C>T	uc003ynu.2	-	47	7494	c.7335G>A	c.(7333-7335)ATG>ATA	p.M2445I	CSMD3_uc003yns.2_Missense_Mutation_p.M1647I|CSMD3_uc003ynt.2_Missense_Mutation_p.M2405I|CSMD3_uc011lhx.1_Missense_Mutation_p.M2341I|CSMD3_uc003ynw.1_Missense_Mutation_p.M156I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2445	Extracellular (Potential).|Sushi 13.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTGCTCCATCCATCTGCAGTC	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			26	79	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113585850	113585850	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113585850C>A	uc003ynu.2	-	24	4081	c.3922G>T	c.(3922-3924)GGT>TGT	p.G1308C	CSMD3_uc003yns.2_Missense_Mutation_p.G580C|CSMD3_uc003ynt.2_Missense_Mutation_p.G1268C|CSMD3_uc011lhx.1_Missense_Mutation_p.G1204C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1308	Extracellular (Potential).|CUB 7.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTAAAAGCACCTAGTAGATGA	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			18	111	---	---	---	---	PASS
TAF2	6873	broad.mit.edu	37	8	120754867	120754867	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120754867G>A	uc003you.2	-	25	3514	c.3244C>T	c.(3244-3246)CGA>TGA	p.R1082*		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	1082					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AAAGCAGATCGGGAGCTAGCT	0.453													4	55	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143412282	143412282	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143412282C>T	uc003ywk.2	-	6	991	c.873G>A	c.(871-873)ACG>ACA	p.T291T	TSNARE1_uc011lju.1_Silent_p.T291T|TSNARE1_uc003ywj.2_Silent_p.T291T|TSNARE1_uc003ywl.3_Silent_p.T72T	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	291					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GAAGCTCCTGCGTGTCACTCG	0.637													9	70	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144941397	144941397	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144941397C>G	uc003zaa.1	-	1	6038	c.6025G>C	c.(6025-6027)GTG>CTG	p.V2009L		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	2009	Plectin 34.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCACCTGCACCTCCAGCAGC	0.637													6	36	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144993462	144993462	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144993462G>A	uc003zaf.1	-	32	11108	c.10938C>T	c.(10936-10938)ACC>ACT	p.T3646T	PLEC_uc003zab.1_Silent_p.T3509T|PLEC_uc003zac.1_Silent_p.T3513T|PLEC_uc003zad.2_Silent_p.T3509T|PLEC_uc003zae.1_Silent_p.T3477T|PLEC_uc003zag.1_Silent_p.T3487T|PLEC_uc003zah.2_Silent_p.T3495T|PLEC_uc003zaj.2_Silent_p.T3536T	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3646	Globular 2.|Plectin 16.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						AGAAGCCCTTGGTGTCGTCGC	0.657													17	149	---	---	---	---	PASS
IFNA14	3448	broad.mit.edu	37	9	21239830	21239830	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21239830C>A	uc010mis.2	-	1	149	c.105G>T	c.(103-105)AGG>AGT	p.R35S	IFNA14_uc003zoo.1_RNA	NM_002172	NP_002163	P01570	IFN14_HUMAN	interferon, alpha 14 precursor	35					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCAAAGTCCTCCTGTTATTCA	0.488													34	117	---	---	---	---	PASS
KIAA1161	57462	broad.mit.edu	37	9	34371052	34371052	+	Silent	SNP	A	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34371052A>C	uc003zue.3	-	3	2057	c.1890T>G	c.(1888-1890)GGT>GGG	p.G630G		NM_020702	NP_065753	Q6NSJ0	K1161_HUMAN	hypothetical protein LOC57462	630	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane	hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|breast(1)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		CGATAGGGTCACCCGTGTCGG	0.662													4	16	---	---	---	---	PASS
FAM74A3	728495	broad.mit.edu	37	9	40716029	40716029	+	RNA	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40716029G>A	uc010mmk.2	+	1		c.506G>A				NR_026801				Homo sapiens family with sequence similarity 74, member A3 (FAM74A3), non-coding RNA.											skin(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGAGTTCAGAGGCTGTCCCGG	0.547													7	36	---	---	---	---	PASS
TMEM2	23670	broad.mit.edu	37	9	74319524	74319524	+	Missense_Mutation	SNP	C	T	T	rs138339130		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74319524C>T	uc011lsa.1	-	18	3721	c.3181G>A	c.(3181-3183)GTC>ATC	p.V1061I	TMEM2_uc011lrz.1_Missense_Mutation_p.V54I|TMEM2_uc010mos.2_Missense_Mutation_p.V998I|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	1061						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TTGAAGTTGACGAGGTATAGA	0.428													14	89	---	---	---	---	PASS
GOLM1	51280	broad.mit.edu	37	9	88655648	88655648	+	Intron	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88655648A>T	uc004aol.2	-						GOLM1_uc004aom.2_Intron	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0						AAAATTCCCCAGTTACCTGCT	0.468													8	78	---	---	---	---	PASS
ZNF510	22869	broad.mit.edu	37	9	99525824	99525824	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99525824C>T	uc004awn.1	-	4	409	c.220G>A	c.(220-222)GTG>ATG	p.V74M	ZNF510_uc004awo.1_Missense_Mutation_p.V74M	NM_014930	NP_055745	Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	74	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				TCCAGCATCACATCTCTGTAC	0.438													4	84	---	---	---	---	PASS
C9orf84	158401	broad.mit.edu	37	9	114490198	114490198	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114490198C>T	uc004bfr.2	-	11	1492	c.1357G>A	c.(1357-1359)GAC>AAC	p.D453N	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Missense_Mutation_p.D414N|C9orf84_uc010mug.2_Missense_Mutation_p.D399N	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	453										ovary(2)	2						GAGAAATAGTCATCAGAAAAA	0.328													14	68	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120470927	120470927	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120470927C>G	uc004bjz.2	+	2	471	c.180C>G	c.(178-180)GAC>GAG	p.D60E	TLR4_uc004bka.2_Missense_Mutation_p.D20E|TLR4_uc004bkb.2_Intron	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	60	LRR 1.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						AGAACCTGGACCTGAGCTTTA	0.433													38	192	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123287340	123287340	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123287340G>A	uc004bkf.2	-	11	1197	c.1016C>T	c.(1015-1017)TCT>TTT	p.S339F	CDK5RAP2_uc004bkg.2_Missense_Mutation_p.S339F|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.S339F|CDK5RAP2_uc004bki.2_Missense_Mutation_p.S138F	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	339					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						TTCAATTTCAGAGTTAAGTTC	0.453													7	63	---	---	---	---	PASS
OR5C1	392391	broad.mit.edu	37	9	125551578	125551578	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125551578G>C	uc011lzd.1	+	1	367	c.367G>C	c.(367-369)GCC>CCC	p.A123P		NM_001001923	NP_001001923	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C,	123	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.A123D(1)		pancreas(1)	1						GGCAGCCATGGCCTATGACCG	0.577													15	113	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26559562	26559562	+	Intron	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26559562C>A	uc001isp.2	+						GAD2_uc001isq.2_Intron	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	CTTTCTCGTTCGCACAGGGGT	0.463													21	211	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38299568	38299568	+	5'Flank	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38299568G>T	uc001izh.2	+						ZNF33A_uc001izg.2_5'Flank|ZNF33A_uc010qev.1_5'Flank|ZNF33A_uc001izi.1_5'Flank	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						GTGCGCGTGGGCTCTGCGCAT	0.612													6	36	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50724810	50724810	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50724810G>A	uc001jht.2	-	2	606	c.351C>T	c.(349-351)GCC>GCT	p.A117A	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Silent_p.A585A|PGBD3_uc001jhu.2_Silent_p.A585A	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	117										pancreas(1)|breast(1)|skin(1)	3						CAGTTAGGTCGGCTTTTTTCC	0.423													15	85	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68687171	68687171	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687171C>A	uc001jmz.1	+	2	1047	c.497C>A	c.(496-498)TCT>TAT	p.S166Y	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.S166Y	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	166	Extracellular (Potential).|LRR 5.					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						CATTTACGGTCTAACTCCCTG	0.473													22	147	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69959266	69959266	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69959266A>G	uc001jnm.3	+	18	3612	c.3427A>G	c.(3427-3429)ACC>GCC	p.T1143A	MYPN_uc001jnn.3_Missense_Mutation_p.T868A|MYPN_uc001jno.3_Missense_Mutation_p.T1143A|MYPN_uc009xpt.2_Missense_Mutation_p.T1143A|MYPN_uc010qit.1_Missense_Mutation_p.T849A|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	1143	Ig-like 4.|Interaction with ACTN.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						CGACGCAGGGACCTATAAGTG	0.537													12	61	---	---	---	---	PASS
PRF1	5551	broad.mit.edu	37	10	72360182	72360182	+	Silent	SNP	G	T	T	rs139175805		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72360182G>T	uc009xqg.2	-	2	638	c.477C>A	c.(475-477)GCC>GCA	p.A159A	PRF1_uc001jrf.3_Silent_p.A159A	NM_001083116	NP_001076585	P14222	PERF_HUMAN	perforin 1 precursor	159	MACPF.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						GGGTCTTCTGGGCTGCAAAGT	0.612			M			various leukaemia|lymphoma	Type 2 familial hemophagocytic lymphohistiocytosis		Familial_Hemophagocytic_Lymphohistiocytosis				5	62	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134896348	134896348	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134896348C>T	uc001llw.2	+	7	1360	c.1360C>T	c.(1360-1362)CGC>TGC	p.R454C				Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;	207	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GCACCCTGGACGCAGGCCCTG	0.662													3	12	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22363155	22363155	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22363155G>A	uc001mqk.2	+	2	581	c.168G>A	c.(166-168)AAG>AAA	p.K56K		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	56	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						CCGAGAGGAAGGCGCCGCTGT	0.647													4	31	---	---	---	---	PASS
WT1	7490	broad.mit.edu	37	11	32450095	32450095	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32450095G>A	uc001mtn.1	-	2	913	c.717C>T	c.(715-717)TTC>TTT	p.F239F	WT1_uc001mtl.1_Silent_p.F27F|WT1_uc001mtm.1_Silent_p.F27F|WT1_uc001mto.1_Silent_p.F239F|WT1_uc001mtp.1_Silent_p.F239F|WT1_uc001mtq.1_Silent_p.F239F|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	171					adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			AGTGGTTGGGGAACTGCGCCG	0.627			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				8	43	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55032408	55032408	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55032408A>T	uc010rid.1	+	2	163	c.77A>T	c.(76-78)CAG>CTG	p.Q26L		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	10						intracellular	zinc ion binding				0						CAAGTCTTCCAGAGGGAACTC	0.488													91	258	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62297253	62297253	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62297253C>T	uc001ntl.2	-	5	4936	c.4636G>A	c.(4636-4638)GTG>ATG	p.V1546M	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1546					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TCAATGTCCACCTTGGGTCCT	0.478													40	184	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64402790	64402790	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64402790G>T	uc001oap.2	-	3	911	c.400C>A	c.(400-402)CGG>AGG	p.R134R	NRXN2_uc001oar.2_Silent_p.R1180R|NRXN2_uc001oas.2_Silent_p.R1140R|NRXN2_uc001oaq.2_Silent_p.R847R	NM_138734	NP_620063	P58401	NRX2B_HUMAN	neurexin 2 isoform beta precursor	134	Extracellular (Potential).|Laminin G-like.				cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CTGTCCACCCGCACCAGCACA	0.642													7	39	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64418907	64418907	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64418907C>A	uc001oar.2	-	15	3177	c.2738G>T	c.(2737-2739)CGT>CTT	p.R913L	NRXN2_uc001oas.2_Missense_Mutation_p.R873L|NRXN2_uc001oaq.2_Missense_Mutation_p.R580L	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:Variant_position_missing_in_P58401_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CACGATGGCACGCAGGCCAAA	0.582											OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	36	---	---	---	---	PASS
SSH3	54961	broad.mit.edu	37	11	67079325	67079325	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67079325C>T	uc001okj.2	+	14	2125	c.1947C>T	c.(1945-1947)AGC>AGT	p.S649S	SSH3_uc001okk.2_RNA|SSH3_uc001okl.2_Silent_p.S503S	NM_017857	NP_060327	Q8TE77	SSH3_HUMAN	slingshot homolog 3	649					regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton|nucleus	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GACAGGCCAGCGTGCATGACA	0.507													8	98	---	---	---	---	PASS
RSF1	51773	broad.mit.edu	37	11	77412282	77412282	+	Silent	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77412282T>C	uc001oyn.2	-	6	2112	c.1992A>G	c.(1990-1992)GTA>GTG	p.V664V	RSF1_uc001oym.2_Silent_p.V412V	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	664					CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TTTCTAGGTCTACTTTTTTCA	0.428													27	154	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122929458	122929458	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122929458G>A	uc001pyo.2	-	7	1482	c.1404C>T	c.(1402-1404)CCC>CCT	p.P468P	HSPA8_uc009zbc.2_Silent_p.P232P|HSPA8_uc001pyp.2_Intron|HSPA8_uc010rzu.1_Silent_p.P391P	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	468					cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GAACACCTCGGGGTGCAGGAG	0.443													12	70	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134037997	134037997	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037997A>T	uc001qhd.1	-	27	4073	c.3467T>A	c.(3466-3468)CTT>CAT	p.L1156H	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA|NCAPD3_uc001qhc.1_Missense_Mutation_p.L106H	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1156					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CATTGCCAAAAGCTTGATCTC	0.493													24	88	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134038096	134038096	+	Intron	SNP	A	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134038096A>C	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GCACGCTGAGAGACAGAGAGA	0.542													10	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31301044	31301044	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31301044G>T	uc010sjy.1	-	11	1216	c.1216C>A	c.(1216-1218)CGA>AGA	p.R406R						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CTCTTAGGTCGAACATATGTG	0.468													13	117	---	---	---	---	PASS
WNT10B	7480	broad.mit.edu	37	12	49361766	49361766	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49361766G>A	uc001rss.2	-	4	1020	c.674C>T	c.(673-675)GCA>GTA	p.A225V	WNT10B_uc001rst.2_Missense_Mutation_p.H178Y	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	225					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						TCGCATTCGTGCCTGGATGTC	0.542													11	58	---	---	---	---	PASS
KRT84	3890	broad.mit.edu	37	12	52774341	52774341	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52774341G>A	uc001sah.1	-	7	1278	c.1230C>T	c.(1228-1230)GCC>GCT	p.A410A		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	410	Rod.|Coil 2.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GCTCGGCCTCGGCCACTGCAG	0.647											OREG0021848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	27	---	---	---	---	PASS
KRT72	140807	broad.mit.edu	37	12	52979817	52979817	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52979817G>A	uc001sar.2	-	9	1571	c.1485C>T	c.(1483-1485)CCC>CCT	p.P495P	KRT72_uc001saq.2_Silent_p.P495P|KRT72_uc010sns.1_Silent_p.P453P|KRT72_uc010snt.1_Silent_p.P307P	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1	495	Tail.					keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)		TTTTGGCAAGGGGATCCTTGA	0.557													39	176	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101576588	101576588	+	Silent	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101576588T>C	uc001thz.3	-	9	1548	c.1158A>G	c.(1156-1158)CAA>CAG	p.Q386Q		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	386	Cytoplasmic (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						TACTCATTCCTTGGGAAATCC	0.383													12	64	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102036228	102036228	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102036228G>T	uc001tii.2	+	9	724	c.622G>T	c.(622-624)GTG>TTG	p.V208L	MYBPC1_uc001tif.1_Missense_Mutation_p.V221L|MYBPC1_uc001tig.2_Missense_Mutation_p.V233L|MYBPC1_uc010svq.1_Missense_Mutation_p.V195L|MYBPC1_uc001tih.2_Missense_Mutation_p.V233L|MYBPC1_uc001tij.2_Missense_Mutation_p.V208L|MYBPC1_uc010svr.1_Missense_Mutation_p.V208L|MYBPC1_uc010svs.1_Missense_Mutation_p.V208L|MYBPC1_uc010svt.1_Missense_Mutation_p.V196L|MYBPC1_uc010svu.1_Missense_Mutation_p.V189L|MYBPC1_uc001tik.2_Missense_Mutation_p.V182L	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	208					cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						AGAACCCCAGGTGGACGTATG	0.552													8	71	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102057289	102057289	+	Silent	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102057289T>A	uc001tii.2	+	20	2334	c.2232T>A	c.(2230-2232)ATT>ATA	p.I744I	MYBPC1_uc001tig.2_Silent_p.I769I|MYBPC1_uc010svq.1_Silent_p.I731I|MYBPC1_uc001tih.2_Silent_p.I769I|MYBPC1_uc001tij.2_Silent_p.I744I|MYBPC1_uc010svr.1_Silent_p.I744I|MYBPC1_uc010svs.1_Silent_p.I744I|MYBPC1_uc010svt.1_Silent_p.I732I|MYBPC1_uc010svu.1_Silent_p.I725I|MYBPC1_uc001tik.2_Silent_p.I718I|MYBPC1_uc001til.2_5'Flank|MYBPC1_uc001tim.2_5'Flank	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	744	Fibronectin type-III 2.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						CAGACCACATTGGTGCAGCAG	0.443													20	57	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105527544	105527544	+	Intron	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105527544T>A	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_Intron	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						TTTTCCTTTGTTAGAGATGTA	0.348													17	91	---	---	---	---	PASS
MLXIP	22877	broad.mit.edu	37	12	122613736	122613736	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122613736G>A	uc001ubq.2	+	4	659	c.659G>A	c.(658-660)CGG>CAG	p.R220Q	MLXIP_uc001ubr.2_5'UTR|MLXIP_uc001ubs.1_5'Flank	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein	220	Required for cytoplasmic localization.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		ATTGTGATCCGGGAGTATCAC	0.557													3	14	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132404121	132404121	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132404121C>T	uc001uje.2	+	25	3057	c.2789C>T	c.(2788-2790)TCC>TTC	p.S930F		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	930					autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		TGCCTGTCGTCCACTGTGAAG	0.647													9	94	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132404132	132404132	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132404132C>T	uc001uje.2	+	25	3068	c.2800C>T	c.(2800-2802)CAG>TAG	p.Q934*		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	934					autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CACTGTGAAGCAGGGTGAGGG	0.637													9	89	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39435583	39435583	+	Missense_Mutation	SNP	G	T	T	rs61978626	byFrequency	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39435583G>T	uc001uwv.2	+	15	7844	c.7535G>T	c.(7534-7536)CGT>CTT	p.R2512L	FREM2_uc001uww.2_Missense_Mutation_p.R598L	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2512	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGTCAGCCCCGTGTACCTGGG	0.408													18	74	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67800644	67800644	+	Silent	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67800644A>G	uc001vik.2	-	2	2621	c.1929T>C	c.(1927-1929)TTT>TTC	p.F643F	PCDH9_uc001vil.2_Silent_p.F643F|PCDH9_uc010thl.1_Silent_p.F643F|PCDH9_uc001vin.3_Silent_p.F643F	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	643	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CTTTGACATCAAAAGTGTAGG	0.403													15	79	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70681632	70681632	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70681632G>A	uc001vip.2	-	1	994	c.200C>T	c.(199-201)ACT>ATT	p.T67I	KLHL1_uc010thm.1_Missense_Mutation_p.T67I|ATXN8OS_uc010aej.1_RNA	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	67	Ser-rich.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTTCCAGAAAGTGCTCACACC	0.448													16	65	---	---	---	---	PASS
FAM155A	728215	broad.mit.edu	37	13	108518929	108518929	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108518929A>G	uc001vql.2	-	1	532	c.16T>C	c.(16-18)TGG>CGG	p.W6R		NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	6						integral to membrane	binding			skin(1)	1						CGACACATCCAAGCACCCCTG	0.552													25	106	---	---	---	---	PASS
RNASE11	122651	broad.mit.edu	37	14	21052206	21052206	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21052206G>T	uc010ahv.2	-	2	613	c.428C>A	c.(427-429)CCT>CAT	p.P143H	RNASE11_uc010ahx.2_Missense_Mutation_p.P143H|RNASE11_uc010ahw.2_Missense_Mutation_p.P143H|RNASE11_uc001vxs.2_Missense_Mutation_p.P143H	NM_145250	NP_660293	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	143						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			ovary(3)	3	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		GCTTATGCCAGGATTCTGTAC	0.512													9	52	---	---	---	---	PASS
TRIM9	114088	broad.mit.edu	37	14	51467493	51467493	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51467493C>A	uc001wyx.3	-	6	2137	c.1372G>T	c.(1372-1374)GCT>TCT	p.A458S	TRIM9_uc001wyy.2_Missense_Mutation_p.A454S|TRIM9_uc001wyz.3_Missense_Mutation_p.A458S	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	458	Fibronectin type-III.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)					GACAACGTAGCGCTGTTGTTG	0.522													12	65	---	---	---	---	PASS
ABCD4	5826	broad.mit.edu	37	14	74764641	74764641	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74764641G>A	uc001xpr.2	-	4	569	c.417C>T	c.(415-417)ATC>ATT	p.I139I	ABCD4_uc001xps.2_5'UTR|ABCD4_uc001xpt.2_5'UTR|ABCD4_uc010tur.1_Silent_p.I52I|ABCD4_uc001xpu.2_Intron|ABCD4_uc001xpv.2_RNA	NM_005050	NP_005041	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D, member 4	139	ABC transmembrane type-1.					ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00153)		ACGGGTTATCGATGTCATCCC	0.582													15	64	---	---	---	---	PASS
ZNF839	55778	broad.mit.edu	37	14	102792497	102792497	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102792497C>T	uc001ylo.2	+	2	466	c.116C>T	c.(115-117)CCG>CTG	p.P39L	ZNF839_uc010awk.1_Missense_Mutation_p.P155L|ZNF839_uc001ylp.2_RNA|ZNF839_uc001ylq.1_Missense_Mutation_p.P39L|ZNF839_uc001ylr.2_Missense_Mutation_p.P39L	NM_018335	NP_060805	A8K0R7	ZN839_HUMAN	zinc finger protein 839	39						intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						AGGGTACAGCCGCTTGTGAGA	0.597													4	33	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	29997906	29997906	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29997906C>G	uc001zcr.2	-	26	5369	c.4894G>C	c.(4894-4896)GTG>CTG	p.V1632L	TJP1_uc010azl.2_Missense_Mutation_p.V1620L|TJP1_uc001zcq.2_Missense_Mutation_p.V1556L|TJP1_uc001zcs.2_Missense_Mutation_p.V1552L	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	1632	ZU5.				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GTGGCCACCACAGTATGACCA	0.458													13	97	---	---	---	---	PASS
NOP10	55505	broad.mit.edu	37	15	34634212	34634212	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34634212C>G	uc001zie.1	-	2	240	c.152G>C	c.(151-153)CGC>CCC	p.R51P	C15orf55_uc010ucc.1_5'Flank|C15orf55_uc010ucd.1_5'Flank	NM_018648	NP_061118	Q9NPE3	NOP10_HUMAN	nucleolar protein family A, member 3	51					pseudouridine synthesis|rRNA processing	Cajal body|nucleolus|small nucleolar ribonucleoprotein complex	protein binding				0						CACCTTGAAGCGTTTCTTGAT	0.537													8	56	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62201244	62201244	+	Silent	SNP	T	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62201244T>G	uc002agz.2	-	65	8999	c.8925A>C	c.(8923-8925)GCA>GCC	p.A2975A	VPS13C_uc002aha.2_Silent_p.A2932A|VPS13C_uc002ahb.1_Silent_p.A2975A|VPS13C_uc002ahc.1_Silent_p.A2932A|VPS13C_uc002ahd.1_Silent_p.A352A	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	2975					protein localization					ovary(2)	2						TCAAGGCAGGTGCAGATCCCT	0.373													9	72	---	---	---	---	PASS
ARID3B	10620	broad.mit.edu	37	15	74865553	74865553	+	Intron	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74865553T>C	uc002aye.2	+						ARID3B_uc002ayc.2_Silent_p.C235C|ARID3B_uc002ayd.2_Intron	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						GGGGTGAGTGTGCATCTACTC	0.368													18	153	---	---	---	---	PASS
SNX33	257364	broad.mit.edu	37	15	75941618	75941618	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75941618G>A	uc002bau.2	+	1	271	c.175G>A	c.(175-177)GTC>ATC	p.V59I	IMP3_uc002bat.2_5'Flank|SNX33_uc002bav.2_5'Flank	NM_153271	NP_695003	Q8WV41	SNX33_HUMAN	sorting nexin 33	59	SH3.				cell communication		phosphatidylinositol binding|protein binding			ovary(1)	1						TGTGGAGATCGTCCGTTCTGG	0.607													12	63	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77020994	77020994	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77020994C>T	uc002bby.2	-	16	2166	c.2107G>A	c.(2107-2109)GAA>AAA	p.E703K	SCAPER_uc010bkr.2_Missense_Mutation_p.E11K|SCAPER_uc002bbx.2_Missense_Mutation_p.E457K|SCAPER_uc002bbz.1_Missense_Mutation_p.E574K|SCAPER_uc002bca.1_Missense_Mutation_p.E568K|SCAPER_uc002bcb.1_Missense_Mutation_p.E709K	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	702	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						CTCTGTTGTTCAATTCGGGCT	0.448													34	140	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79064110	79064110	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79064110G>A	uc002bej.3	-	15	2404	c.2193C>T	c.(2191-2193)GCC>GCT	p.A731A	ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Silent_p.A731A	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	731	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						TGGCAGCCTCGGCAACCTCTT	0.622													11	52	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81593686	81593686	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81593686C>T	uc002bgh.3	+	15	3527	c.3151C>T	c.(3151-3153)CTT>TTT	p.L1051F	IL16_uc010blq.1_Missense_Mutation_p.L1005F|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.L1093F|IL16_uc002bgg.2_Missense_Mutation_p.L1051F|IL16_uc002bgi.1_Missense_Mutation_p.L441F|IL16_uc002bgj.2_Missense_Mutation_p.L545F|IL16_uc002bgk.2_Missense_Mutation_p.L350F|IL16_uc002bgl.1_Missense_Mutation_p.L350F|IL16_uc010unq.1_Missense_Mutation_p.L350F	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	1051	Interaction with HTLV-1 tax.				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						TTATGAAAGCCTTTCAGAGCT	0.343													13	39	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85476424	85476424	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85476424G>C	uc002blg.2	+	13	1334	c.1132G>C	c.(1132-1134)GCC>CCC	p.A378P	SLC28A1_uc010bnb.2_Missense_Mutation_p.A378P|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Missense_Mutation_p.A378P|SLC28A1_uc010upg.1_Missense_Mutation_p.A378P	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	378	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGCCCCTTGTGCCTTGGCCCT	0.562													32	171	---	---	---	---	PASS
UNC45A	55898	broad.mit.edu	37	15	91483669	91483669	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91483669C>T	uc002bqg.2	+	6	993	c.653C>T	c.(652-654)ACG>ATG	p.T218M	UNC45A_uc002bqd.2_Missense_Mutation_p.T203M|UNC45A_uc010uqo.1_Missense_Mutation_p.T210M|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Missense_Mutation_p.T218M	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	218					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCTCTGCGTACGCTGGTTGGC	0.507													12	85	---	---	---	---	PASS
ASB7	140460	broad.mit.edu	37	15	101169983	101169983	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101169983C>T	uc002bwk.2	+	5	1322	c.553C>T	c.(553-555)CGA>TGA	p.R185*	ASB7_uc002bwj.2_Nonsense_Mutation_p.R185*	NM_198243	NP_937886	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box-containing protein 7	185	ANK 6.				intracellular signal transduction					skin(1)	1	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TTTCCTGTTGCGATACGCCGT	0.493													7	52	---	---	---	---	PASS
RPUSD1	113000	broad.mit.edu	37	16	837656	837656	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:837656G>C	uc002cka.2	-	1	316	c.82C>G	c.(82-84)CGC>GGC	p.R28G	RPUSD1_uc002ckb.2_Missense_Mutation_p.R28G|RPUSD1_uc002ckc.2_Intron|RPUSD1_uc002ckd.2_Missense_Mutation_p.R28G|CHTF18_uc010uus.1_5'Flank|CHTF18_uc010bre.1_5'Flank|CHTF18_uc002cke.3_5'Flank|CHTF18_uc002ckf.3_5'Flank|CHTF18_uc010brf.2_5'Flank|CHTF18_uc002ckg.3_5'Flank	NM_058192	NP_478072	Q9UJJ7	RUSD1_HUMAN	RNA pseudouridylate synthase domain containing	28					pseudouridine synthesis		pseudouridine synthase activity|RNA binding				0		Hepatocellular(780;0.00335)				CTGTCAATGCGAACGTCCCAG	0.647													10	67	---	---	---	---	PASS
E4F1	1877	broad.mit.edu	37	16	2278471	2278471	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2278471C>T	uc002cpm.2	+	2	304	c.256C>T	c.(256-258)CCT>TCT	p.P86S	E4F1_uc010bsi.2_Missense_Mutation_p.P86S|E4F1_uc010bsj.2_Missense_Mutation_p.P86S	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F	86					cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						CCAGCGGGCCCCTCCGGAGGC	0.652													4	33	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31896502	31896502	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31896502G>T	uc002ecs.3	+	3	360	c.151G>T	c.(151-153)GAC>TAC	p.D51Y		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	51	KRAB.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						CTCTAAGCCGGACCTGATCAC	0.398													8	51	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66943978	66943978	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66943978G>T	uc002eql.2	-	16	2259	c.2186C>A	c.(2185-2187)ACC>AAC	p.T729N	CDH16_uc010cdy.2_Missense_Mutation_p.T707N|CDH16_uc002eqm.2_Missense_Mutation_p.T632N	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	729	Extracellular (Potential).|Ectodomain G.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		CAGGGCCAAGGTGAGGTAGGC	0.622													17	70	---	---	---	---	PASS
TXNL4B	54957	broad.mit.edu	37	16	72123048	72123048	+	Intron	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72123048C>T	uc002fca.2	-						TXNL4B_uc010cgl.2_Intron|TXNL4B_uc010vmn.1_Intron|TXNL4B_uc010vmo.1_Intron	NM_017853	NP_060323	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B						mitosis|mRNA processing|RNA splicing	spliceosomal complex				ovary(1)	1						CTGCAAATGACGAGAGAGACA	0.383													7	40	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72992281	72992281	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72992281C>T	uc002fck.2	-	2	2437	c.1764G>A	c.(1762-1764)CTG>CTA	p.L588L	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	588					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				CAGCGAAGTCCAGCCTCCTGC	0.532													11	53	---	---	---	---	PASS
KIAA1609	57707	broad.mit.edu	37	16	84516199	84516199	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84516199A>G	uc002fib.2	-	6	1183	c.1076T>C	c.(1075-1077)CTG>CCG	p.L359P	KIAA1609_uc010vod.1_Missense_Mutation_p.L332P|KIAA1609_uc002fic.2_RNA	NM_020947	NP_065998	Q6P9B6	K1609_HUMAN	hypothetical protein LOC57707	359	TLD.						protein binding			ovary(2)	2						CGGGCTCACCAGTCCGTTCGG	0.602													5	54	---	---	---	---	PASS
ZNF778	197320	broad.mit.edu	37	16	89289672	89289672	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89289672C>T	uc002fmv.2	+	4	564	c.225C>T	c.(223-225)TAC>TAT	p.Y75Y	ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Silent_p.Y5Y|ZNF778_uc010vpg.1_Intron	NM_182531	NP_872337	Q96MU6	ZN778_HUMAN	zinc finger protein 778	75	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0269)		TGGAAAACTACGAGAACCTGG	0.522													10	119	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2598546	2598546	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2598546C>A	uc002fuy.1	-	15	2542	c.2456G>T	c.(2455-2457)CGC>CTC	p.R819L	KIAA0664_uc002fux.1_Missense_Mutation_p.R752L|KIAA0664_uc010ckc.1_5'Flank	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	819							binding			breast(2)	2						CTTGGCCGAGCGGGTGATGAG	0.627													16	90	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577097	7577097	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577097C>A	uc002gim.2	-	8	1035	c.841G>T	c.(841-843)GAC>TAC	p.D281Y	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.D281Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149Y|TP53_uc010cng.1_Missense_Mutation_p.D149Y|TP53_uc002gii.1_Missense_Mutation_p.D149Y|TP53_uc010cnh.1_Missense_Mutation_p.D281Y|TP53_uc010cni.1_Missense_Mutation_p.D281Y|TP53_uc002gij.2_Missense_Mutation_p.D281Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	281	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D281E(25)|p.D281H(19)|p.D281N(18)|p.D281G(10)|p.0?(7)|p.D281Y(6)|p.D281D(5)|p.D281V(3)|p.D281fs*63(2)|p.?(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.D281R(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGCGCCGGTCTCTCCCAGGA	0.547		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			4	35	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10408585	10408585	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10408585A>G	uc002gmo.2	-	21	2424	c.2330T>C	c.(2329-2331)CTA>CCA	p.L777P	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	777	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CATCTCCTCTAGGAGCCCCAG	0.473													17	50	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12656471	12656471	+	Missense_Mutation	SNP	T	A	A	rs113274254	byFrequency	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12656471T>A	uc002gnn.2	+	10	2165	c.1866T>A	c.(1864-1866)AAT>AAA	p.N622K	MYOCD_uc002gno.2_Missense_Mutation_p.N622K|MYOCD_uc002gnp.1_Missense_Mutation_p.N526K|MYOCD_uc002gnq.2_Missense_Mutation_p.N341K	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	622					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		ATCAAACCAATGTACTTTCTT	0.537													37	143	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17707167	17707167	+	Intron	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17707167C>T	uc002grm.2	+							NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		GATGCAGGTACGAGCCCGCCC	0.632													4	31	---	---	---	---	PASS
PSMD3	5709	broad.mit.edu	37	17	38142893	38142893	+	Silent	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38142893C>G	uc002htn.1	+	3	641	c.477C>G	c.(475-477)CTC>CTG	p.L159L	PSMD3_uc010wen.1_RNA|PSMD3_uc010weo.1_Silent_p.L60L	NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3	159					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					CGACACCCCTCCTGCCTGAAG	0.527													27	167	---	---	---	---	PASS
MED24	9862	broad.mit.edu	37	17	38179470	38179470	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38179470C>A	uc002htt.2	-	20	2477	c.2164G>T	c.(2164-2166)GGC>TGC	p.G722C	MED24_uc010weq.1_5'Flank|MED24_uc002htr.2_5'Flank|MED24_uc010wer.1_Missense_Mutation_p.G57C|MED24_uc010wes.1_Missense_Mutation_p.G582C|MED24_uc010wet.1_Intron|MED24_uc002hts.2_Missense_Mutation_p.G747C|MED24_uc002htu.2_Missense_Mutation_p.G709C|MED24_uc010cwn.2_Missense_Mutation_p.G709C|MED24_uc010weu.1_Missense_Mutation_p.G632C|MED24_uc010wev.1_Missense_Mutation_p.G672C|MED24_uc010wew.1_Missense_Mutation_p.G663C	NM_014815	NP_055630	O75448	MED24_HUMAN	mediator complex subunit 24 isoform 1	722					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)					TCCACCCAGCCCTTCTCCAGC	0.587													7	43	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42337271	42337271	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42337271C>A	uc002igf.3	-	7	664	c.515G>T	c.(514-516)GGT>GTT	p.G172V	SLC4A1_uc002igg.3_Missense_Mutation_p.G172V	NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	172	Cytoplasmic.				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		AGGCTTCACACCCCCCAGGGC	0.602													13	85	---	---	---	---	PASS
IGF2BP1	10642	broad.mit.edu	37	17	47122358	47122358	+	Silent	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47122358A>T	uc002iom.2	+	12	1660	c.1326A>T	c.(1324-1326)GCA>GCT	p.A442A	IGF2BP1_uc010dbj.2_Silent_p.A303A	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding	442	KH 3.|Necessary for interaction with ELAVL4 and binding to TAU mRNA (By similarity).				CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						TTTAGATTGCACCACCCGAAA	0.483													18	127	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58257998	58257998	+	Missense_Mutation	SNP	A	G	G	rs1142734		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58257998A>G	uc002iyo.1	-	33	4835	c.4549T>C	c.(4549-4551)TGC>CGC	p.C1517R	USP32_uc002iyn.1_Missense_Mutation_p.C1187R	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	1517					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CCTGAATGGCACTGTAAGAGA	0.443													4	89	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74011538	74011538	+	Missense_Mutation	SNP	C	G	G	rs149246710		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74011538C>G	uc002jqi.2	-	15	2110	c.1882G>C	c.(1882-1884)GGG>CGG	p.G628R	EVPL_uc010wss.1_Missense_Mutation_p.G650R|EVPL_uc010wst.1_Missense_Mutation_p.G98R	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	628	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						CACTTCTCCCCGTAGAGGCTG	0.667													14	67	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32395984	32395984	+	Intron	SNP	T	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32395984T>G	uc010dmn.1	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron|DTNA_uc010dmm.2_Intron|DTNA_uc010xby.1_5'Flank|DTNA_uc010dmo.2_5'Flank|DTNA_uc002kyd.3_5'Flank|DTNA_uc010xbz.1_5'Flank|DTNA_uc010xca.1_5'Flank|DTNA_uc002kye.2_5'Flank	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						AAATGGTGAGTAGTTACTAAG	0.418													22	197	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43217030	43217030	+	Silent	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43217030T>C	uc010dnj.2	+	7	1047	c.726T>C	c.(724-726)ATT>ATC	p.I242I	SLC14A2_uc002lbb.2_Silent_p.I242I|SLC14A2_uc002lbe.2_Silent_p.I242I	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	242	Helical; (Potential).					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						CCTTCAACATTGCAGTCACCT	0.517													31	187	---	---	---	---	PASS
MALT1	10892	broad.mit.edu	37	18	56348415	56348415	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56348415G>T	uc002lhm.1	+	2	481	c.223G>T	c.(223-225)GAG>TAG	p.E75*	MALT1_uc002lhn.1_Nonsense_Mutation_p.E75*	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	75	Death.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						CCTAGACCTGGAGCAGTGTTC	0.468			T	BIRC3	MALT								12	134	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67794916	67794916	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67794916C>A	uc002lkp.2	-	25	3273	c.3205G>T	c.(3205-3207)GCT>TCT	p.A1069S	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.A157S	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1069							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AGCCCACTAGCCATGTGTGTT	0.428													11	75	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67794917	67794917	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67794917C>A	uc002lkp.2	-	25	3272	c.3204G>T	c.(3202-3204)ATG>ATT	p.M1068I	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.M156I	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1068							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				GCCCACTAGCCATGTGTGTTA	0.428													12	74	---	---	---	---	PASS
NETO1	81832	broad.mit.edu	37	18	70417577	70417577	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70417577G>T	uc002lkw.2	-	9	1545	c.1261C>A	c.(1261-1263)CGG>AGG	p.R421R	NETO1_uc002lkx.1_Silent_p.R420R|NETO1_uc002lky.1_Silent_p.R421R	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3	421	Cytoplasmic (Potential).				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GATGACCTCCGCAGTTTATGG	0.458													6	47	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9012465	9012465	+	Intron	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9012465C>T	uc002mkp.2	-						MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTAAGGTCTCACCTGAGCAA	0.527													17	124	---	---	---	---	PASS
ZNF442	79973	broad.mit.edu	37	19	12461632	12461632	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12461632T>C	uc002mtr.1	-	6	1378	c.767A>G	c.(766-768)GAA>GGA	p.E256G	ZNF442_uc010xmk.1_Missense_Mutation_p.E187G	NM_030824	NP_110451	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	256	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(2)|breast(1)|kidney(1)	4						GTGTGTTCTTTCATGTCTTAG	0.403													39	181	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13470527	13470527	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13470527A>G	uc010dze.2	-	6	1107	c.871T>C	c.(871-873)TGG>CGG	p.W291R	CACNA1A_uc002mwy.3_Missense_Mutation_p.W291R	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	291	I.|Extracellular (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GGCCCTTCCCAGTAGGGCTGA	0.547													5	11	---	---	---	---	PASS
MAST3	23031	broad.mit.edu	37	19	18233561	18233561	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18233561G>A	uc002nhz.3	+	5	312	c.312G>A	c.(310-312)TCG>TCA	p.S104S		NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase	104	Poly-Ser.						ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						CCACCCTCTCGGTACCCATAG	0.547													4	18	---	---	---	---	PASS
PIK3R2	5296	broad.mit.edu	37	19	18277949	18277949	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18277949G>T	uc002nia.1	+	13	2081	c.1569G>T	c.(1567-1569)CTG>CTT	p.L523L	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	523					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						GGATCCTGCTGAACTCCGAGC	0.478													3	37	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807460	20807460	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807460T>C	uc002npb.1	-	4	1373	c.1223A>G	c.(1222-1224)TAC>TGC	p.Y408C	ZNF626_uc002npc.1_Missense_Mutation_p.Y332C	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	408	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						GTTAGAGGAGTACTTAAAAGC	0.408													3	103	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363491	22363491	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363491C>G	uc002nqs.1	-	3	1346	c.1028G>C	c.(1027-1029)GGG>GCG	p.G343A		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	343	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AAAAGCTTTCCCGCATTCTTC	0.408													11	92	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934833	30934833	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934833G>T	uc002nsu.1	+	2	502	c.364G>T	c.(364-366)GAC>TAC	p.D122Y	ZNF536_uc010edd.1_Missense_Mutation_p.D122Y	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	122					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CGACATCGAGGACGACGCCCG	0.642													7	20	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31040279	31040279	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31040279G>A	uc002nsu.1	+	4	3891	c.3753G>A	c.(3751-3753)CCG>CCA	p.P1251P	ZNF536_uc010edd.1_Silent_p.P1251P	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1251					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TGCCAAAGCCGGAGCGGGGGC	0.607													7	33	---	---	---	---	PASS
DMKN	93099	broad.mit.edu	37	19	36004032	36004032	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36004032G>T	uc002nzm.3	-	1	529	c.346C>A	c.(346-348)CAG>AAG	p.Q116K	DMKN_uc002nzj.2_5'Flank|DMKN_uc002nzk.3_5'Flank|DMKN_uc002nzl.3_5'Flank|DMKN_uc002nzo.3_Missense_Mutation_p.Q116K|DMKN_uc002nzn.3_Missense_Mutation_p.Q116K|DMKN_uc002nzw.2_5'Flank|DMKN_uc002nzr.2_5'Flank|DMKN_uc002nzp.2_5'Flank|DMKN_uc002nzq.2_5'Flank|DMKN_uc002nzt.2_5'Flank|DMKN_uc002nzs.2_5'Flank|DMKN_uc002nzu.2_5'Flank|DMKN_uc002nzv.2_5'Flank|DMKN_uc010xsv.1_5'Flank|DMKN_uc010xsw.1_5'Flank|DMKN_uc002nzx.3_5'Flank|DMKN_uc002nzy.3_5'Flank|DMKN_uc002nzz.2_5'Flank|DMKN_uc002oac.3_Missense_Mutation_p.Q116K|DMKN_uc010eeb.2_Missense_Mutation_p.Q116K|DMKN_uc002oaa.3_Missense_Mutation_p.Q116K|DMKN_uc002oab.3_Missense_Mutation_p.Q116K	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine isoform 2 precursor	116	Gly-rich.					extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TCTTCTGCCTGTCTGCCAATC	0.617													8	52	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36050049	36050049	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36050049G>A	uc002oal.1	-	8	1130	c.1101C>T	c.(1099-1101)TGC>TGT	p.C367C	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	367	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	TCTTGACCACGCAGTTCTTAC	0.617													24	205	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37129641	37129641	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37129641G>C	uc002oem.2	-	6	1834	c.1606C>G	c.(1606-1608)CAA>GAA	p.Q536E	ZNF461_uc002oen.2_Missense_Mutation_p.Q505E|ZNF461_uc010xtj.1_Missense_Mutation_p.Q513E	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	536	C2H2-type 12; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AAGTTAAGTTGTAATCTATGA	0.428													8	54	---	---	---	---	PASS
EID2	163126	broad.mit.edu	37	19	40030304	40030304	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40030304T>A	uc002oma.2	-	1	535	c.416A>T	c.(415-417)TAT>TTT	p.Y139F		NM_153232	NP_694964	Q8N6I1	EID2_HUMAN	CREBBP/EP300 inhibitor 2	139					cell differentiation|muscle organ development|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|regulation of cell proliferation|SMAD protein complex assembly|transcription, DNA-dependent|transforming growth factor beta receptor complex assembly	nucleus	SMAD binding				0	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;3.2e-25)|all cancers(26;8.83e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			GAGACGGAGATAGGGCAACGC	0.607													21	134	---	---	---	---	PASS
CEACAM5	1048	broad.mit.edu	37	19	42219050	42219050	+	Silent	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42219050T>C	uc002ork.2	+	3	706	c.585T>C	c.(583-585)AAT>AAC	p.N195N	CEACAM5_uc010ehz.1_Silent_p.N195N|CEACAM5_uc002orj.1_Silent_p.N195N|CEACAM5_uc002orl.2_Silent_p.N195N	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	195	Ig-like 2.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		AGCTGTCCAATGGCAACAGGA	0.532													25	202	---	---	---	---	PASS
PSG4	5672	broad.mit.edu	37	19	43698611	43698611	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43698611G>C	uc002ovy.2	-	5	1226	c.1124C>G	c.(1123-1125)TCA>TGA	p.S375*	PSG6_uc010xwk.1_Intron|PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Nonsense_Mutation_p.S282*|PSG4_uc002ovz.2_Nonsense_Mutation_p.S282*	NM_002780	NP_002771	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4 isoform	375	Ig-like C2-type 3.				defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)				CTTTTGTCCTGATAGCTGAAA	0.463													39	271	---	---	---	---	PASS
LIG1	3978	broad.mit.edu	37	19	48619186	48619186	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48619186G>A	uc002pia.1	-	27	2740	c.2620C>T	c.(2620-2622)CGG>TGG	p.R874W	LIG1_uc010xze.1_Missense_Mutation_p.R567W|LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Missense_Mutation_p.R806W|LIG1_uc010xzg.1_Missense_Mutation_p.R843W	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	874					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CGAATAAACCGAGGGAAGCGA	0.652								NER					3	31	---	---	---	---	PASS
ZNF175	7728	broad.mit.edu	37	19	52076664	52076664	+	Intron	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52076664G>A	uc002pxb.2	+							NM_007147	NP_009078	Q9Y473	ZN175_HUMAN	zinc finger protein 175						response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		GGTAAACAGGGGCAGCCCTGG	0.572													7	70	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53384206	53384206	+	Silent	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53384206G>C	uc002qag.2	-	4	1364	c.1173C>G	c.(1171-1173)GGC>GGG	p.G391G	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Silent_p.G337G|ZNF320_uc002qai.2_Silent_p.G391G	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	391	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		TAAAAACCTTGCCACATTCAT	0.398													13	98	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54410154	54410154	+	3'UTR	SNP	A	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54410154A>C	uc002qcq.1	+	18					PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_3'UTR	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		ATGTAATCTCACCCGCCGCCA	0.662											OREG0025667	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	28	---	---	---	---	PASS
RPS9	6203	broad.mit.edu	37	19	54711428	54711428	+	Silent	SNP	C	T	T	rs142681896		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54711428C>T	uc002qdx.2	+	5	626	c.570C>T	c.(568-570)GAC>GAT	p.D190D	RPS9_uc002qdy.2_3'UTR|RPS9_uc002qdz.2_Silent_p.D190D|RPS9_uc002qea.2_Silent_p.D190D|RPS9_uc002qeb.2_3'UTR|RPS9_uc002qec.2_RNA|RPS9_uc002qed.1_3'UTR	NM_001013	NP_001004	P46781	RS9_HUMAN	ribosomal protein S9	190					endocrine pancreas development|positive regulation of cell proliferation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|rRNA binding|structural constituent of ribosome|translation regulator activity			breast(1)	1	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.18)		CTGGAGACGACGAGGAGGAGG	0.602													4	18	---	---	---	---	PASS
LILRA4	23547	broad.mit.edu	37	19	54849409	54849409	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54849409C>T	uc002qfj.2	-	4	510	c.453G>A	c.(451-453)AGG>AGA	p.R151R	LILRA4_uc002qfi.2_Silent_p.R85R	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	151	Extracellular (Potential).|Ig-like C2-type 2.					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TCAGAGTGAACCTGCCCAGTC	0.612													8	59	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56485014	56485014	+	Intron	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56485014A>G	uc002qmh.2	+						NLRP8_uc010etg.2_Intron	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8							cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTTCTCTCCCATAGGATAGAG	0.507													6	358	---	---	---	---	PASS
ZNF71	58491	broad.mit.edu	37	19	57133945	57133945	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57133945G>T	uc002qnm.3	+	3	1528	c.1290G>T	c.(1288-1290)CGG>CGT	p.R430R		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	430	C2H2-type 11.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		AGCACCAGCGGATCCACACCG	0.637													7	59	---	---	---	---	PASS
TRMT6	51605	broad.mit.edu	37	20	5922668	5922668	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5922668C>G	uc002wmh.1	-	8	1163	c.1041G>C	c.(1039-1041)CAG>CAC	p.Q347H	TRMT6_uc010zra.1_Missense_Mutation_p.Q177H|TRMT6_uc010gbn.1_3'UTR	NM_015939	NP_057023	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6	347					regulation of translational initiation|tRNA processing	nucleus	protein binding|translation initiation factor activity			pancreas(1)	1						CTTGTCTCCTCTGTTTTTCCT	0.423													35	180	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21689949	21689949	+	Silent	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21689949C>A	uc002wsj.2	+	4	1203	c.1149C>A	c.(1147-1149)GGC>GGA	p.G383G	PAX1_uc010zsl.1_Silent_p.G383G|PAX1_uc010zsm.1_Silent_p.G359G	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	383					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.A383A(1)		upper_aerodigestive_tract(1)|kidney(1)	2						GCGCCCCGGGCGGCGGCTACC	0.761													9	49	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31024148	31024148	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31024148C>A	uc002wxs.2	+	12	4059	c.3633C>A	c.(3631-3633)GAC>GAA	p.D1211E	ASXL1_uc010geb.2_Missense_Mutation_p.D1102E	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	1211					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						CAAGTTTTGACTCCCTCCATC	0.488			F|N|Mis		MDS|CMML								3	103	---	---	---	---	PASS
CEP250	11190	broad.mit.edu	37	20	34099248	34099248	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34099248C>T	uc002xcm.2	+	36	7793	c.7122C>T	c.(7120-7122)ATC>ATT	p.I2374I	CEP250_uc010zve.1_Silent_p.I1742I	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	2374	Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGGACTACATCACCCGCTCAG	0.597													10	44	---	---	---	---	PASS
EDN3	1908	broad.mit.edu	37	20	57876615	57876615	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57876615C>T	uc002yap.2	+	2	572	c.203C>T	c.(202-204)CCG>CTG	p.P68L	EDN3_uc002yao.1_Missense_Mutation_p.P68L|EDN3_uc002yaq.2_Missense_Mutation_p.P68L|EDN3_uc002yar.2_Missense_Mutation_p.P68L|EDN3_uc002yas.2_Missense_Mutation_p.P68L	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein	68					cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					ACTGTGGCCCCGACAGCACTG	0.701													11	53	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19716282	19716282	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19716282G>T	uc002ykw.2	-	11	1298	c.1267C>A	c.(1267-1269)CTT>ATT	p.L423I		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	423	Extracellular (Potential).|MAM.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						CAGAAACTAAGGCAAGCTGGC	0.463													28	172	---	---	---	---	PASS
HUNK	30811	broad.mit.edu	37	21	33370927	33370927	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33370927G>T	uc002yph.2	+	11	1935	c.1575G>T	c.(1573-1575)CCG>CCT	p.P525P		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	525					multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						CCGTGCCACCGCCCAGGACCC	0.572													16	80	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37618828	37618828	+	Missense_Mutation	SNP	C	T	T	rs146690528		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37618828C>T	uc002yvg.2	+	19	4629	c.4550C>T	c.(4549-4551)CCG>CTG	p.P1517L	DOPEY2_uc011aeb.1_Missense_Mutation_p.P1466L|DOPEY2_uc002yvh.2_Missense_Mutation_p.P368L	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	1517					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						GGCATGCATCCGGCCTGGGTG	0.607													10	52	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38512875	38512875	+	Silent	SNP	C	T	T	rs139032014	byFrequency	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38512875C>T	uc002yvz.2	+	20	1779	c.1674C>T	c.(1672-1674)GCC>GCT	p.A558A	TTC3_uc011aee.1_Silent_p.A248A|TTC3_uc002ywa.2_Silent_p.A558A|TTC3_uc002ywb.2_Silent_p.A558A|TTC3_uc010gnf.2_Silent_p.A323A|TTC3_uc002ywc.2_Silent_p.A248A|TTC3_uc011aed.1_Silent_p.A248A|TTC3_uc010gne.1_Silent_p.A558A	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	558	TPR 3.				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				TATCTGAAGCCGAAAACCAGT	0.323													20	187	---	---	---	---	PASS
RIPK4	54101	broad.mit.edu	37	21	43161931	43161931	+	Silent	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43161931C>A	uc002yzn.1	-	8	1470	c.1422G>T	c.(1420-1422)CCG>CCT	p.P474P		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	474						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	p.P474P(1)		ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						CCATGTGCAACGGGGTGGAGC	0.652													21	96	---	---	---	---	PASS
KRTAP10-7	386675	broad.mit.edu	37	21	46021214	46021214	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46021214G>C	uc002zfn.3	+	2	703	c.678G>C	c.(676-678)CAG>CAC	p.Q226H	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	231	30 X 5 AA repeats of C-C-X(3).					keratin filament					0						CCTGCCAGCAGGCCTGCTGTG	0.657													5	193	---	---	---	---	PASS
LSS	4047	broad.mit.edu	37	21	47633740	47633740	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47633740T>C	uc002zij.2	-	10	1100	c.1021A>G	c.(1021-1023)ACC>GCC	p.T341A	LSS_uc011afv.1_Missense_Mutation_p.T330A|LSS_uc002zil.2_Missense_Mutation_p.T341A|LSS_uc002zik.2_Missense_Mutation_p.T261A	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1	341					cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					ATGTTGATGGTTTTCGAGATC	0.602													5	20	---	---	---	---	PASS
MAPK12	6300	broad.mit.edu	37	22	50694044	50694044	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50694044C>T	uc003bkm.1	-	9	922	c.771G>A	c.(769-771)GAG>GAA	p.E257E	MAPK12_uc003bkn.2_Silent_p.E76E|MAPK12_uc003bko.2_Silent_p.E167E|MAPK12_uc003bkl.1_Silent_p.E247E|MAPK12_uc003bkp.2_Silent_p.E42E|MAPK12_uc003bkq.2_Silent_p.E76E	NM_002969	NP_002960	P53778	MK12_HUMAN	mitogen-activated protein kinase 12	257	Protein kinase.				cell cycle arrest|DNA damage induced protein phosphorylation|muscle organ development|myoblast differentiation|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction	mitochondrion|nucleoplasm	ATP binding|magnesium ion binding|MAP kinase activity|protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CACCCCTTACCTCATCGCTCT	0.622													14	105	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50885628	50885628	+	Silent	SNP	G	A	A	rs146489206	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50885628G>A	uc003blh.2	-	41	5820	c.5625C>T	c.(5623-5625)GAC>GAT	p.D1875D	SBF1_uc003ble.2_Silent_p.D339D|SBF1_uc003blf.2_Silent_p.D351D|SBF1_uc011arx.1_Silent_p.D1513D	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1849	PH.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CCGAGGGCACGTCCTGGGCAC	0.677													10	39	---	---	---	---	PASS
NR0B1	190	broad.mit.edu	37	X	30327353	30327353	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30327353C>A	uc004dcf.3	-	1	143	c.128G>T	c.(127-129)TGC>TTC	p.C43F		NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	43	4 X 67 AA tandem repeats.|1.				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	CTCATCGCCGCACGAACAGCC	0.662													4	23	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32429861	32429861	+	Intron	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32429861G>T	uc004dda.1	-						DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATTCCCAGATGTACTTGCCTG	0.403													21	90	---	---	---	---	PASS
ATP6AP2	10159	broad.mit.edu	37	X	40450618	40450618	+	Splice_Site	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40450618G>T	uc004det.2	+	3	402	c.300_splice	c.e3+1	p.N100_splice	ATP6AP2_uc010nhc.2_Splice_Site|ATP6AP2_uc011mkl.1_Splice_Site_p.N24_splice|ATP6AP2_uc011mkm.1_Splice_Site_p.N100_splice|ATP6AP2_uc011mkn.1_Splice_Site_p.N100_splice	NM_005765	NP_005756	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory						angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity				0						TTTGGAGAATGTGAGtattta	0.403													8	36	---	---	---	---	PASS
SSX5	6758	broad.mit.edu	37	X	48047124	48047124	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48047124C>A	uc004dja.1	-	7	563	c.510G>T	c.(508-510)GAG>GAT	p.E170D	SSX5_uc004diz.1_Missense_Mutation_p.E211D	NM_175723	NP_783729	O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5 isoform b	170					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						GTTGCTTTCTCTCACGCACTC	0.502													74	440	---	---	---	---	PASS
OTUD5	55593	broad.mit.edu	37	X	48801472	48801472	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48801472C>T	uc004dlu.2	-	2	728	c.667G>A	c.(667-669)GCC>ACC	p.A223T	OTUD5_uc004dlt.3_Missense_Mutation_p.A223T|OTUD5_uc004dlv.2_Missense_Mutation_p.A223T|OTUD5_uc011mmp.1_Missense_Mutation_p.A6T	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN	OTU domain containing 5 isoform a	223	OTU.				negative regulation of type I interferon production		cysteine-type peptidase activity			pancreas(1)	1						AAGAGACAGGCGCCATCCTCC	0.557													4	27	---	---	---	---	PASS
KCND1	3750	broad.mit.edu	37	X	48825896	48825896	+	Silent	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48825896C>A	uc004dlx.1	-	1	2356	c.783G>T	c.(781-783)CGG>CGT	p.R261R	KCND1_uc004dlw.1_5'Flank	NM_004979	NP_004970	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related	261	Cytoplasmic (Potential).					voltage-gated potassium channel complex	metal ion binding|voltage-gated potassium channel activity			ovary(2)|lung(1)	3						TCATGACACTCCGCAGGAAGC	0.577													3	28	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53611204	53611204	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53611204C>A	uc004dsp.2	-	41	5505	c.5103G>T	c.(5101-5103)GAG>GAT	p.E1701D	HUWE1_uc004dsn.2_Missense_Mutation_p.E526D	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1701					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CCAGCGTCTTCTCTAGTTCCT	0.413													19	145	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54948716	54948716	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54948716C>G	uc004dtq.2	+	2	144	c.37C>G	c.(37-39)CTA>GTA	p.L13V	TRO_uc011moj.1_Intron|TRO_uc004dts.2_Missense_Mutation_p.L13V|TRO_uc004dtr.2_Missense_Mutation_p.L13V|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_Missense_Mutation_p.L13V|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Missense_Mutation_p.L13V|TRO_uc004dtx.2_5'Flank	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	13					embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						TAGGGTGCCTCTATTTCAGGT	0.507													10	29	---	---	---	---	PASS
EFNB1	1947	broad.mit.edu	37	X	68060180	68060180	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68060180G>A	uc004dxd.3	+	5	1504	c.724G>A	c.(724-726)GCG>ACG	p.A242T	EFNB1_uc004dxe.2_Missense_Mutation_p.A242T	NM_004429	NP_004420	P98172	EFNB1_HUMAN	ephrin-B1 precursor	242	Helical; (Potential).				cell adhesion|cell-cell signaling	integral to plasma membrane|soluble fraction|synapse	ephrin receptor binding				0						GGCATTGTTCGCGGCTGTCGG	0.582													5	44	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433953	72433953	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433953C>T	uc004ebi.2	-	1	732	c.376G>A	c.(376-378)GAA>AAA	p.E126K	NAP1L2_uc011mqj.1_5'UTR	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	126					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					AATTTGGATTCTAAATTGGCC	0.373													13	132	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73960441	73960441	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73960441G>T	uc004eby.2	-	3	4568	c.3951C>A	c.(3949-3951)TCC>TCA	p.S1317S		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	1317					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						ACAAGATATAGGAAGGCTCCT	0.537													31	130	---	---	---	---	PASS
ZDHHC15	158866	broad.mit.edu	37	X	74649009	74649009	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74649009G>T	uc004ecg.2	-	7	985	c.507C>A	c.(505-507)TCC>TCA	p.S169S	ZDHHC15_uc004ech.2_Silent_p.S160S|ZDHHC15_uc011mqo.1_Intron	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1	169	DHHC-type.					integral to membrane	zinc ion binding			ovary(2)	2						ATTTGTAGTTGGAAAATCCAA	0.353													6	48	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83352800	83352800	+	Silent	SNP	A	G	G			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83352800A>G	uc004eej.1	-	19	1910	c.1833T>C	c.(1831-1833)CTT>CTC	p.L611L	RPS6KA6_uc011mqt.1_Silent_p.L611L|RPS6KA6_uc011mqu.1_Silent_p.L508L	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	611	Protein kinase 2.				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						TTGTGTAAAAAAGGACTCCTA	0.308													43	257	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91132779	91132779	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91132779A>T	uc004efk.1	+	2	2385	c.1540A>T	c.(1540-1542)AGC>TGC	p.S514C	PCDH11X_uc004efl.1_Missense_Mutation_p.S514C|PCDH11X_uc004efo.1_Missense_Mutation_p.S514C|PCDH11X_uc010nmv.1_Missense_Mutation_p.S514C|PCDH11X_uc004efm.1_Missense_Mutation_p.S514C|PCDH11X_uc004efn.1_Missense_Mutation_p.S514C|PCDH11X_uc004efh.1_Missense_Mutation_p.S514C|PCDH11X_uc004efj.1_Missense_Mutation_p.S514C	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	514	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ACCTGAATTCAGCCTGGATTG	0.438													8	59	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99662031	99662031	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99662031T>A	uc010nmz.2	-	1	3241	c.1565A>T	c.(1564-1566)AAC>ATC	p.N522I	PCDH19_uc004efw.3_Missense_Mutation_p.N522I|PCDH19_uc004efx.3_Missense_Mutation_p.N522I	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	522	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						CTGCTCGTGGTTAAAGGATCG	0.582													19	159	---	---	---	---	PASS
RAB40AL	282808	broad.mit.edu	37	X	102192749	102192749	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102192749C>T	uc004ejs.2	+	1	550	c.503C>T	c.(502-504)ACG>ATG	p.T168M		NM_001031834	NP_001027004	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	168					protein transport|small GTPase mediated signal transduction	mitochondrion|plasma membrane	GTP binding			ovary(2)	2						GAGTCTTTCACGGAGCTGGCC	0.612													8	39	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105187985	105187985	+	Silent	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105187985C>T	uc004emd.2	+	24	4314	c.4011C>T	c.(4009-4011)CAC>CAT	p.H1337H		NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1337	CNH.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CATCAATTCACCTTTATGCAT	0.318										HNSCC(51;0.14)			3	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	106843775	106843775	+	IGR	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106843775C>A								CXorf41 (356303 upstream) : PRPS1 (27879 downstream)																							TCTTGGGCGCCCGGATCCCAA	0.657													4	38	---	---	---	---	PASS
ANKRD58	347454	broad.mit.edu	37	X	118893503	118893503	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118893503G>T	uc010nql.2	+	1	928	c.873G>T	c.(871-873)AAG>AAT	p.K291N		NM_001105576	NP_001099046	A6NJG2	ANR58_HUMAN	ankyrin repeat domain 58	291											0						CCAAGGCGAAGGACACCGCGG	0.647													7	40	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129055540	129055540	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129055540C>A	uc004euz.2	+	11	1353	c.1325C>A	c.(1324-1326)CCA>CAA	p.P442Q	UTP14A_uc011mup.1_Missense_Mutation_p.P390Q|UTP14A_uc011muq.1_Missense_Mutation_p.P388Q|UTP14A_uc004eva.1_Missense_Mutation_p.P148Q	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	442					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						GATGCTGAGCCAGCAGGCAGT	0.438													4	58	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136648937	136648937	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136648937C>A	uc004fak.2	+	1	592	c.87C>A	c.(85-87)AAC>AAA	p.N29K		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	29					cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					AGATGCCCAACCGTGAGCCGG	0.577													4	12	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142718580	142718580	+	Silent	SNP	G	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142718580G>A	uc004fbx.2	-	2	721	c.345C>T	c.(343-345)AAC>AAT	p.N115N	SLITRK4_uc004fby.2_Silent_p.N115N	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	115	Extracellular (Potential).|LRR 3.					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					ATTCATTGTTGTTCAAGTGCA	0.423													18	116	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144329162	144329162	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144329162C>T	uc004fcb.2	+	1	56	c.56C>T	c.(55-57)TCC>TTC	p.S19F		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	19											0	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGTGAATCCAACAATGAA	0.274													18	151	---	---	---	---	PASS
MAGEA11	4110	broad.mit.edu	37	X	148797858	148797858	+	Silent	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148797858C>A	uc004fdq.2	+	5	814	c.712C>A	c.(712-714)CGA>AGA	p.R238R	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Silent_p.R209R	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	238	MAGE.					cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CCGCAAGTATCGAGTCAAGGG	0.433													32	183	---	---	---	---	PASS
CD99L2	83692	broad.mit.edu	37	X	149963707	149963707	+	Silent	SNP	G	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149963707G>T	uc004fel.2	-	6	520	c.402C>A	c.(400-402)GGC>GGA	p.G134G	CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Silent_p.G85G|CD99L2_uc004fen.2_Silent_p.G62G|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4	134	Extracellular (Potential).				cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GTTTCCTGCGGCCATCATCTC	0.473													11	189	---	---	---	---	PASS
PRRG3	79057	broad.mit.edu	37	X	150868563	150868563	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150868563G>C	uc004few.1	+	3	493	c.103G>C	c.(103-105)GAG>CAG	p.E35Q		NM_024082	NP_076987	Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3	35	Gla.|Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CATCGAGCGAGAGTGCATGGA	0.562													13	94	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151869605	151869605	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151869605C>T	uc004ffq.1	+	3	489	c.295C>T	c.(295-297)CCT>TCT	p.P99S	MAGEA6_uc004ffr.1_Missense_Mutation_p.P99S|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	99							protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCACCTTCCCTGACCTGGA	0.557													19	152	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153580245	153580245	+	Intron	SNP	C	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153580245C>A	uc004fkk.2	-						FLNA_uc004fki.2_Intron|FLNA_uc011mzn.1_Intron|FLNA_uc010nuu.1_Intron	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2						actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCCGGGTTCCCAGTACCTGG	0.612													4	25	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156530966	156530966	+	Intron	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156530966delT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTATTAACCGttttttttttt	0.274													8	4	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203225510	203225511	+	Intron	INS	-	AA	AA			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203225510_203225511insAA	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			AAGAATCCTTCaaaaaaaaaaa	0.312													9	4	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237819091	237819091	+	Intron	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237819091delT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATATAGTAATTTTTTTTTTT	0.418													8	5	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86701787	86701788	+	Intron	DEL	AA	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86701787_86701788delAA	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						actccatcccaaaaaaaaaaaa	0.064													4	2	---	---	---	---	
IL1R2	7850	broad.mit.edu	37	2	102632610	102632611	+	Intron	DEL	CA	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102632610_102632611delCA	uc002tbm.2	+						IL1R2_uc002tbn.2_Intron|IL1R2_uc002tbo.1_Intron	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor						immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	GAAGACAGTGcacacacacaca	0.153													4	2	---	---	---	---	
RIF1	55183	broad.mit.edu	37	2	152302071	152302071	+	Intron	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152302071delT	uc002txm.2	+						RIF1_uc002txl.2_Intron|RIF1_uc010fnv.1_Intron|RIF1_uc002txn.2_Intron|RIF1_uc002txo.2_Intron	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		tctttttctcttttttttttg	0.114													6	3	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866695	224866695	+	Intron	DEL	T	-	-	rs10706128		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866695delT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ACTTTACTACttttttttttt	0.184													6	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225661983	225661983	+	Intron	DEL	T	-	-	rs113535092		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225661983delT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ACTTGGTCTATTTTTTTTTTT	0.308													5	4	---	---	---	---	
D2HGDH	728294	broad.mit.edu	37	2	242680356	242680356	+	Intron	DEL	A	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242680356delA	uc002wce.1	+						D2HGDH_uc010zpc.1_Intron|D2HGDH_uc010fzq.1_Intron|D2HGDH_uc002wcg.1_Intron	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor						2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		gtccgtctccaaaaaaaaaaa	0.264													4	2	---	---	---	---	
PRSS45	377047	broad.mit.edu	37	3	46783664	46783665	+	3'UTR	INS	-	CCAAGG	CCAAGG	rs139246885	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46783664_46783665insCCAAGG	uc010hjl.2	-	4					PRSS45_uc011bam.1_RNA	NM_199183	NP_954652	Q7RTY3	PRS45_HUMAN	testis serine protease 5						proteolysis		serine-type endopeptidase activity				0						CTCCTGCTCACCCAAGGCCTAG	0.515													4	3	---	---	---	---	
SUCNR1	56670	broad.mit.edu	37	3	151598195	151598196	+	Intron	INS	-	AT	AT	rs149287057	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151598195_151598196insAT	uc003ezf.1	+							NM_033050	NP_149039	Q9BXA5	SUCR1_HUMAN	succinate receptor 1							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	ACATTAATGACATATATATATG	0.163													6	4	---	---	---	---	
EXOC1	55763	broad.mit.edu	37	4	56730644	56730648	+	Intron	DEL	TTATC	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56730644_56730648delTTATC	uc003hbe.1	+						EXOC1_uc003hbf.1_Intron|EXOC1_uc003hbg.1_Intron	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1						exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					GAATACTGAATTATCTTATCGTAAA	0.112													9	4	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531131	68531132	+	Intron	INS	-	T	T	rs72340884		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531131_68531132insT	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						CCAGCATAGTGtttttttttgt	0.243													11	5	---	---	---	---	
FHDC1	85462	broad.mit.edu	37	4	153895656	153895657	+	Intron	DEL	AC	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153895656_153895657delAC	uc003inf.2	+							NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1						actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					acacatgcgtacacacacacac	0.401													4	2	---	---	---	---	
LRAT	9227	broad.mit.edu	37	4	155666144	155666145	+	Intron	INS	-	CTTTTT	CTTTTT	rs146204691	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155666144_155666145insCTTTTT	uc003iom.1	+						uc003iol.2_Intron|LRAT_uc003ion.1_Intron	NM_004744	NP_004735	O95237	LRAT_HUMAN	lecithin retinol acyltransferase						response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	TCCATACCAtcctttttctttt	0.292													6	4	---	---	---	---	
TLL1	7092	broad.mit.edu	37	4	166910815	166910816	+	Intron	INS	-	T	T	rs71604415		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166910815_166910816insT	uc003irh.1	+						TLL1_uc011cjn.1_Intron|TLL1_uc011cjo.1_Intron	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		Cattttattaattttttttttt	0.163													3	3	---	---	---	---	
ZDHHC11	79844	broad.mit.edu	37	5	847521	847522	+	Intron	INS	-	A	A			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:847521_847522insA	uc011cma.1	-						ZDHHC11_uc003jbj.2_Intron	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GACGCGGCCCCAAGAGGACCCT	0.678													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165983	180165983	+	IGR	DEL	G	-	-	rs2054696	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165983delG								FLT4 (89359 upstream) : OR2Y1 (140 downstream)																							tgttccccccgccaccaaaaa	0.189													4	2	---	---	---	---	
FAM135A	57579	broad.mit.edu	37	6	71236468	71236469	+	Intron	DEL	AT	-	-	rs111717563		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71236468_71236469delAT	uc003pfj.2	+						FAM135A_uc003pfi.2_Intron|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfl.2_Intron|FAM135A_uc003pfn.2_Intron|FAM135A_uc003pfo.1_Intron|FAM135A_uc010kan.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c											central_nervous_system(1)	1						acacacacacatacacacacac	0.218													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1458978	1458980	+	IGR	DEL	CTC	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1458978_1458980delCTC								UNCX (182366 upstream) : MICALL2 (15016 downstream)																							ATAACCCCGTctcctcctcctcc	0.532													4	2	---	---	---	---	
PMS2CL	441194	broad.mit.edu	37	7	6775132	6775133	+	Intron	INS	-	T	T	rs71539975		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6775132_6775133insT	uc011jxb.1	+						PMS2CL_uc003squ.2_Intron|PMS2CL_uc003sqv.1_Intron					SubName: Full=cDNA FLJ60281, highly similar to PMS1 protein homolog 2;												0						GGTCATGTAAGTTTTTTTTTTT	0.267													9	4	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36466798	36466799	+	Intron	INS	-	T	T	rs34986676		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36466798_36466799insT	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						GTACCTAAATGTTTTTTTTTTT	0.317													6	3	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133876636	133876637	+	Intron	INS	-	T	T	rs111830556		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133876636_133876637insT	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						TTTTTATGGGGTTTTTTTTTTT	0.262													4	2	---	---	---	---	
AGPAT6	137964	broad.mit.edu	37	8	41479805	41479806	+	3'UTR	INS	-	GGAACAG	GGAACAG	rs150638711	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41479805_41479806insGGAACAG	uc003xnz.2	+	13						NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta						acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			TCTGCAGGGGAGGGACAGGGGA	0.688													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98910245	98910246	+	IGR	INS	-	A	A	rs139074595		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98910245_98910246insA								NCRNA00092 (126208 upstream) : HSD17B3 (87343 downstream)																							ACCATCTCCTGAAAAAAAAAAA	0.312													3	3	---	---	---	---	
SLC25A16	8034	broad.mit.edu	37	10	70266207	70266207	+	Intron	DEL	A	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70266207delA	uc001joi.2	-						SLC25A16_uc010qix.1_Intron|SLC25A16_uc010qiy.1_Intron|SLC25A16_uc001joj.2_Intron	NM_152707	NP_689920	P16260	GDC_HUMAN	solute carrier family 25, member 16						coenzyme biosynthetic process|pantothenate metabolic process	integral to membrane|mitochondrial inner membrane	binding|solute:solute antiporter activity				0						ctcaaaaattaaaaaaaaaaa	0.114													4	2	---	---	---	---	
OR51G2	81282	broad.mit.edu	37	11	4936985	4936986	+	5'Flank	INS	-	A	A	rs141722956	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4936985_4936986insA	uc001lzr.1	-							NM_001005238	NP_001005238	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAAATTAAAGAAAAAAAATAG	0.416													4	3	---	---	---	---	
AGBL2	79841	broad.mit.edu	37	11	47727193	47727194	+	Intron	INS	-	A	A	rs76492621		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47727193_47727194insA	uc001ngg.2	-						AGBL2_uc010rhq.1_Intron|AGBL2_uc001ngh.1_Intron	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2						aagtctgtgtcaaaaaaaaaaa	0.104													5	3	---	---	---	---	
CRTAM	56253	broad.mit.edu	37	11	122738897	122738904	+	Intron	DEL	TGTGTGTG	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122738897_122738904delTGTGTGTG	uc001pyj.2	+						CRTAM_uc001pyk.2_Intron	NM_019604	NP_062550	O95727	CRTAM_HUMAN	class-I MHC-restricted T cell associated						cell recognition|detection of tumor cell|positive regulation of cytokine secretion|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	integral to membrane|plasma membrane	receptor binding			ovary(1)	1		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		caacagaatatgtgtgtgtgtgtgtgtg	0.101													6	4	---	---	---	---	
ARPC3	10094	broad.mit.edu	37	12	110873128	110873128	+	Intron	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110873128delT	uc001tqq.2	-							NM_005719	NP_005710	O15145	ARPC3_HUMAN	actin related protein 2/3 complex subunit 3						cellular component movement|regulation of actin filament polymerization	Arp2/3 protein complex|cytoplasm	actin binding|structural constituent of cytoskeleton			ovary(1)	1						TCTTATAAACttttttttttt	0.144													6	3	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123075015	123075016	+	Intron	INS	-	T	T			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123075015_123075016insT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ACTGAATTCTGtttttttttct	0.233													7	4	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96512945	96512945	+	Intron	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96512945delT	uc001vmt.2	-							NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						GAGGTGGGAGTTTTTTTTTTC	0.294													4	2	---	---	---	---	
STK24	8428	broad.mit.edu	37	13	99134371	99134371	+	Intron	DEL	A	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99134371delA	uc001vnm.1	-						STK24_uc001vnn.1_Intron|STK24_uc010tim.1_Intron	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TATAAGAAGCAAAAAAACACG	0.199													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64448080	64448081	+	Intron	INS	-	TA	TA	rs149771149	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64448080_64448081insTA	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTCCACTGGTTTATATATACAT	0.381													6	5	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92176033	92176034	+	Intron	INS	-	A	A	rs143282961	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92176033_92176034insA	uc001xzs.1	-							NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				gactccatctcaaaaaaacaaa	0.134													4	2	---	---	---	---	
RCOR1	23186	broad.mit.edu	37	14	103192682	103192682	+	Intron	DEL	G	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103192682delG	uc001ymb.2	+							NM_015156	NP_055971	Q9UKL0	RCOR1_HUMAN	REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1						aaaaaaaaaagaaCTCGGTGT	0.204													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106877447	106877448	+	Intron	INS	-	TGATCT	TGATCT	rs144817208	by1000genomes	TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877447_106877448insTGATCT	uc010tyt.1	-						uc010tyu.1_In_Frame_Ins_p.168_169insRS					Parts of antibodies, mostly variable regions.												0						GAGGGAGACGACTGAGAAGATG	0.584													5	3	---	---	---	---	
C16orf46	123775	broad.mit.edu	37	16	81095915	81095915	+	Intron	DEL	A	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81095915delA	uc002fgc.3	-						C16orf46_uc010chf.2_Intron|C16orf46_uc010vno.1_Intron	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2												0						TCATTCACTTAAAAAAAAAAT	0.274													4	2	---	---	---	---	
SPNS3	201305	broad.mit.edu	37	17	4350375	4350375	+	Intron	DEL	T	-	-	rs3055435		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4350375delT	uc002fxt.2	+						SPNS3_uc002fxu.2_Intron	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3						lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						GGACGGGGGGTGGTGGTCAGG	0.453													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21977704	21977704	+	IGR	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21977704delT								FLJ36000 (64634 upstream) : None (None downstream)																							gcaaaacagctttggtattct	0.005													4	2	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTT	0.184													6	3	---	---	---	---	
GH1	2688	broad.mit.edu	37	17	61996251	61996252	+	5'Flank	INS	-	C	C			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61996251_61996252insC	uc002jdj.2	-						GH1_uc002jdi.2_5'Flank|GH1_uc002jdk.2_5'Flank|GH1_uc002jdl.2_5'Flank|GH1_uc002jdm.2_5'Flank|GH1_uc002jdn.2_5'Flank	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1						glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						CTCTCCCACTGTTGACCCCACC	0.545													12	6	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50554196	50554196	+	Intron	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50554196delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGAGCAGTTATTTTTTTTTTC	0.383													4	2	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67818117	67818120	+	Intron	DEL	CTGT	-	-	rs146554691		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67818117_67818120delCTGT	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AAAGATTCTCCTGTCTAACAGTTT	0.294													7	7	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	8969553	8969554	+	Intron	INS	-	TT	TT	rs36058947		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8969553_8969554insTT	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						tttttcttttcttttttttttt	0.178													5	3	---	---	---	---	
ZNF430	80264	broad.mit.edu	37	19	21239294	21239294	+	Intron	DEL	A	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21239294delA	uc002npj.2	+						ZNF430_uc002npk.2_Intron	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						gactctgtctaaaaaaaaaaa	0.124													4	2	---	---	---	---	
PLUNC	51297	broad.mit.edu	37	20	31828337	31828340	+	Intron	DEL	GATG	-	-	rs10677320		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31828337_31828340delGATG	uc002wyv.2	+						PLUNC_uc002wyt.3_Intron|PLUNC_uc002wyu.3_Intron	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated						innate immune response	extracellular region	lipid binding				0						AGCGTGGAAAgatggatggatgga	0.240													4	2	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47870567	47870567	+	Intron	DEL	T	-	-	rs11353174		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47870567delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ttcttttttcttttttttttt	0.194													3	3	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GTGTCTCtgtgtgcgtgcgtgcgt	0.270													6	5	---	---	---	---	
APOBEC3A	200315	broad.mit.edu	37	22	39378243	39378244	+	Intron	INS	-	CCAGAG	CCAGAG			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39378243_39378244insCCAGAG	uc011aoc.1	+						APOBEC3B_uc003awo.1_5'Flank|APOBEC3B_uc003awp.1_5'Flank|APOBEC3B_uc003awq.1_5'Flank|APOBEC3D_uc011aod.1_5'Flank|APOBEC3D_uc011aoe.1_5'Flank|APOBEC3D_uc011aof.1_5'Flank	NM_145699	NP_663745	P31941	ABC3A_HUMAN	phorbolin 1						cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					TCCGGGGAAAACCAGAGCCAGA	0.579													4	2	---	---	---	---	
ARSH	347527	broad.mit.edu	37	X	2942330	2942330	+	Intron	DEL	A	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2942330delA	uc011mhj.1	+							NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H							integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGCTAGACCGAAAAAAAAAAA	0.373													8	4	---	---	---	---	
TSIX	9383	broad.mit.edu	37	X	73043145	73043145	+	RNA	DEL	T	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73043145delT	uc004ebn.2	+	1		c.31106delT			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						tttttctttcttttttttttt	0.338													3	4	---	---	---	---	
CD40LG	959	broad.mit.edu	37	X	135730223	135730223	+	5'Flank	DEL	C	-	-			TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135730223delC	uc004faa.2	+						CD40LG_uc010nsd.2_5'Flank|CD40LG_uc010nse.1_5'Flank	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand						anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)	aaaaaaaaaacaaaaaaCCTT	0.343									Immune_Deficiency_with_Hyper-IgM				3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	152871884	152871904	+	IGR	DEL	GTAAAGGGATTTTGTTCACCA	-	-	rs139494223		TCGA-34-5232-01A-21D-1817-08	TCGA-34-5232-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152871884_152871904delGTAAAGGGATTTTGTTCACCA								FAM58A (7252 upstream) : DUSP9 (35993 downstream)																							ttaaaattaggtaaagggatttTGTTCACCAGTAAAGGGAT	0.271													3	3	---	---	---	---	
