Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CYP4X1	260293	broad.mit.edu	37	1	47498961	47498961	+	Missense_Mutation	SNP	G	A	A	rs116257861	by1000genomes	TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47498961G>A	uc001cqt.2	+	4	663	c.413G>A	c.(412-414)CGC>CAC	p.R138H	CYP4X1_uc001cqr.2_Missense_Mutation_p.R137H|CYP4X1_uc001cqs.2_Missense_Mutation_p.R73H	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X,	138						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2						CAGCATCGTCGCCTACTAACT	0.428																0.333333	40.082784	41.264222	16	32	KEEP	---	---	---	---	7	10	19	14	-1	capture	Missense_Mutation	SNP	47498961	47498961	CYP4X1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4153	259
CREB3L4	148327	broad.mit.edu	37	1	153941905	153941905	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153941905G>A	uc001fdn.3	+	4	783	c.517G>A	c.(517-519)GTA>ATA	p.V173I	SLC39A1_uc001fdl.2_5'Flank|CREB3L4_uc010pef.1_Missense_Mutation_p.V26I|CREB3L4_uc001fdo.3_Missense_Mutation_p.V153I|CREB3L4_uc001fdm.1_Missense_Mutation_p.V173I|CREB3L4_uc001fdp.1_Missense_Mutation_p.V153I|CREB3L4_uc010peg.1_3'UTR|CREB3L4_uc001fdr.2_Missense_Mutation_p.V173I|CREB3L4_uc001fdq.2_Missense_Mutation_p.V153I	NM_130898	NP_570968	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like	173	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGCAGGCACCGTAGCCCCAGT	0.532																0.242424	35.667239	39.66075	16	50	KEEP	---	---	---	---	9	8	24	30	-1	capture	Missense_Mutation	SNP	153941905	153941905	CREB3L4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3824	259
TOR1AIP1	26092	broad.mit.edu	37	1	179886766	179886766	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179886766C>T	uc001gnq.2	+	10	1362	c.1144C>T	c.(1144-1146)CAA>TAA	p.Q382*		NM_015602	NP_056417	Q5JTV8	TOIP1_HUMAN	lamina-associated polypeptide 1B	382	Lumenal (Potential).|Potential.					integral to membrane|nuclear inner membrane				breast(1)|central_nervous_system(1)	2						GTACCAAGGTCAAGATGAGAA	0.443																0.117647	6.660431	21.511554	12	90	KEEP	---	---	---	---	7	5	44	48	-1	capture	Nonsense_Mutation	SNP	179886766	179886766	TOR1AIP1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	16255	259
LAMC1	3915	broad.mit.edu	37	1	183087214	183087214	+	Silent	SNP	T	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183087214T>C	uc001gpy.3	+	11	2180	c.1923T>C	c.(1921-1923)CCT>CCC	p.P641P		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	641	Laminin IV type A.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTCTTACCCCTTTTGAATTTC	0.418																0.021739	-28.502034	6.757679	3	135	KEEP	---	---	---	---	2	1	70	79	-1	capture	Silent	SNP	183087214	183087214	LAMC1	1	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	8534	259
PPFIA4	8497	broad.mit.edu	37	1	203014509	203014509	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:203014509G>A	uc009xaj.2	+	11	1121	c.1121G>A	c.(1120-1122)CGG>CAG	p.R374Q	PPFIA4_uc010pqf.1_5'UTR			O75335	LIPA4_HUMAN	SubName: Full=Liprin alpha4;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						GATACGGGCCGGGTAGAGGAG	0.602																0.380952	22.810803	23.0658	8	13	KEEP	---	---	---	---	4	5	7	9	-1	capture	Missense_Mutation	SNP	203014509	203014509	PPFIA4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	495	39	1	1	12213	259
ELK4	2005	broad.mit.edu	37	1	205589407	205589407	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205589407G>A	uc001hcy.1	-	3	2017	c.767C>T	c.(766-768)TCG>TTG	p.S256L	ELK4_uc001hcz.2_Missense_Mutation_p.S256L	NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	256						cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GGGTATGGACGAAATGGGTGG	0.522					4	T	SLC45A3	prostate								0.33195	204.497724	210.538113	80	161	KEEP	---	---	---	---	45	37	95	82	-1	capture	Missense_Mutation	SNP	205589407	205589407	ELK4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5016	259
MRPL55	128308	broad.mit.edu	37	1	228294495	228294495	+	Missense_Mutation	SNP	C	T	T	rs145809265		TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228294495C>T	uc001hry.2	-	3	1097	c.353G>A	c.(352-354)CGC>CAC	p.R118H	MRPL55_uc001hrz.3_Missense_Mutation_p.R154H|MRPL55_uc009xex.2_Missense_Mutation_p.R118H|MRPL55_uc001hsa.3_Missense_Mutation_p.R118H|MRPL55_uc001hsb.3_Missense_Mutation_p.R118H|MRPL55_uc001hsc.3_Missense_Mutation_p.R118H|MRPL55_uc001hsd.3_Missense_Mutation_p.R118H|MRPL55_uc001hse.3_Missense_Mutation_p.R118H|MRPL55_uc001hsf.3_Missense_Mutation_p.R118H|MRPL55_uc001hsg.3_Missense_Mutation_p.R118H	NM_181465	NP_852130	Q7Z7F7	RM55_HUMAN	mitochondrial ribosomal protein L55 isoform a	118					translation	mitochondrial large ribosomal subunit	structural constituent of ribosome			central_nervous_system(1)	1		Prostate(94;0.0405)				CTGTCGGTAGCGCTCCACATG	0.592																0.376344	88.691046	89.942659	35	58	KEEP	---	---	---	---	20	18	33	33	-1	capture	Missense_Mutation	SNP	228294495	228294495	MRPL55	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9729	259
RYR2	6262	broad.mit.edu	37	1	237632437	237632437	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237632437G>A	uc001hyl.1	+	17	1778	c.1658G>A	c.(1657-1659)GGC>GAC	p.G553D		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	553	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAATTTTCTGGCTCCCTCGAC	0.373																0.324675	64.745119	66.847349	25	52	KEEP	---	---	---	---	13	14	28	26	-1	capture	Missense_Mutation	SNP	237632437	237632437	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13661	259
OR2T11	127077	broad.mit.edu	37	1	248789661	248789661	+	Missense_Mutation	SNP	C	T	T	rs139227153	byFrequency	TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248789661C>T	uc001ier.1	-	1	769	c.769G>A	c.(769-771)GTG>ATG	p.V257M		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	257	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGGGCAGCACGTATGTGTAG	0.532																0.62963	49.778735	50.177315	17	10	KEEP	---	---	---	---	6	13	8	2	-1	capture	Missense_Mutation	SNP	248789661	248789661	OR2T11	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10922	259
NEBL	10529	broad.mit.edu	37	10	21185902	21185902	+	Silent	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21185902C>T	uc001iqi.2	-	2	535	c.138G>A	c.(136-138)ACG>ACA	p.T46T	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	46	Nebulin 1.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TAATGAGTTCCGTGCATTTTC	0.294																0.505618	139.073778	139.076213	45	44	KEEP	---	---	---	---	24	27	20	31	-1	capture	Silent	SNP	21185902	21185902	NEBL	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10210	259
OR52E2	119678	broad.mit.edu	37	11	5080175	5080175	+	Missense_Mutation	SNP	C	T	T	rs141087990		TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5080175C>T	uc010qyw.1	-	1	683	c.683G>A	c.(682-684)CGT>CAT	p.R228H		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	228	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		AGTAGGAAGACGGAAAACAGC	0.398																0.212121	28.713501	33.770903	14	52	KEEP	---	---	---	---	8	8	27	26	-1	capture	Missense_Mutation	SNP	5080175	5080175	OR52E2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11019	259
OR5W2	390148	broad.mit.edu	37	11	55681607	55681607	+	Missense_Mutation	SNP	A	G	G			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681607A>G	uc010rir.1	-	1	452	c.452T>C	c.(451-453)GTG>GCG	p.V151A		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGCTATTCCCACCAGATAAAC	0.458	Melanoma(48;171 1190 15239 43886 49348)															0.296875	49.232694	51.643018	19	45	KEEP	---	---	---	---	13	6	29	17	-1	capture	Missense_Mutation	SNP	55681607	55681607	OR5W2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	11089	259
GLYATL1	92292	broad.mit.edu	37	11	58722269	58722269	+	Nonsense_Mutation	SNP	C	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58722269C>A	uc001nnf.2	+	6	589	c.213C>A	c.(211-213)TAC>TAA	p.Y71*	uc001nng.1_Intron|GLYATL1_uc001nnh.1_Nonsense_Mutation_p.Y102*|GLYATL1_uc001nni.1_Nonsense_Mutation_p.Y71*|GLYATL1_uc001nnj.1_Nonsense_Mutation_p.Y71*			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	71						mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	TGGATTCATACACAAACGTAT	0.373																0.297872	36.027689	37.746786	14	33	KEEP	---	---	---	---	8	8	19	17	0.5	capture	Nonsense_Mutation	SNP	58722269	58722269	GLYATL1	11	C	A	A	A	1	0	0	0	0	0	1	0	0	220	17	5	4	6416	259
NPAS4	266743	broad.mit.edu	37	11	66192332	66192332	+	Silent	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66192332C>T	uc001ohx.1	+	7	2147	c.1971C>T	c.(1969-1971)GGC>GGT	p.G657G	NPAS4_uc010rpc.1_Silent_p.G447G	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	657					transcription, DNA-dependent		DNA binding|signal transducer activity				0						CTGGCACTGGCGGACTAGAGC	0.582																0.275281	110.236862	118.311881	49	129	KEEP	---	---	---	---	31	21	82	60	-1	capture	Silent	SNP	66192332	66192332	NPAS4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10472	259
ARHGEF17	9828	broad.mit.edu	37	11	73020926	73020926	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:73020926G>A	uc001otu.2	+	1	1264	c.1243G>A	c.(1243-1245)GTG>ATG	p.V415M		NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	415					actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						GGGCTGGGGCGTGTACCGCTC	0.657																0.388889	56.159909	56.744771	21	33	KEEP	---	---	---	---	13	12	23	14	-1	capture	Missense_Mutation	SNP	73020926	73020926	ARHGEF17	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	893	259
RECQL	5965	broad.mit.edu	37	12	21643134	21643134	+	Silent	SNP	A	G	G			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21643134A>G	uc001rex.2	-	5	741	c.393T>C	c.(391-393)GAT>GAC	p.D131D	RECQL_uc001rey.2_Silent_p.D131D	NM_032941	NP_116559	P46063	RECQ1_HUMAN	RecQ protein-like	131	Helicase ATP-binding.				DNA recombination|DNA repair|DNA replication	nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|DNA strand annealing activity|protein binding			ovary(1)|lung(1)	2						AGTACATACCATCTGAACATA	0.274											Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					0.296296	60.16662	63.174287	24	57	KEEP	---	---	---	---	15	10	33	25	-1	capture	Silent	SNP	21643134	21643134	RECQL	12	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	13096	259
MPHOSPH9	10198	broad.mit.edu	37	12	123661241	123661241	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123661241C>T	uc001uel.2	-	12	2101	c.1994G>A	c.(1993-1995)CGT>CAT	p.R665H	MPHOSPH9_uc010tal.1_Missense_Mutation_p.R119H|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_Missense_Mutation_p.R119H	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	665					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		TTACTTGGCACGCGAGGGTCT	0.353																0.371429	34.863883	35.372962	13	22	KEEP	---	---	---	---	6	8	11	15	-1	capture	Missense_Mutation	SNP	123661241	123661241	MPHOSPH9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9640	259
UGGT2	55757	broad.mit.edu	37	13	96578002	96578002	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:96578002G>A	uc001vmt.2	-	20	2397	c.2227C>T	c.(2227-2229)CTC>TTC	p.L743F		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	743					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						ATAATCCAGAGAGTGACTGCA	0.303																0.657895	80.684142	81.520457	25	13	KEEP	---	---	---	---	21	6	6	10	-1	capture	Missense_Mutation	SNP	96578002	96578002	UGGT2	13	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16824	259
SERPINA11	256394	broad.mit.edu	37	14	94912695	94912695	+	Missense_Mutation	SNP	C	G	G	rs148183767		TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94912695C>G	uc001ydd.1	-	3	950	c.890G>C	c.(889-891)AGA>ACA	p.R297T		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	297					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		GCCCCATTTTCTCAGGGTCTG	0.562																0.417266	198.713522	199.546772	58	81	KEEP	---	---	---	---	35	27	41	47	-1	capture	Missense_Mutation	SNP	94912695	94912695	SERPINA11	14	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	13981	259
TRPM1	4308	broad.mit.edu	37	15	31360288	31360288	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:31360288C>T	uc001zfm.2	-	4	349	c.221G>A	c.(220-222)CGT>CAT	p.R74H	TRPM1_uc010azy.2_Translation_Start_Site|TRPM1_uc001zfl.2_RNA|uc010ubm.1_5'Flank|MIR211_hsa-mir-211|MI0000287_5'Flank|uc010ubn.1_5'Flank	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	74	Extracellular (Potential).		R -> C (in CSNB1C).		cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		ATAGGATACACGGATATACTG	0.493																0.467153	176.345541	176.466528	64	73	KEEP	---	---	---	---	32	35	39	38	-1	capture	Missense_Mutation	SNP	31360288	31360288	TRPM1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16468	259
COX10	1352	broad.mit.edu	37	17	14110443	14110443	+	Missense_Mutation	SNP	C	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:14110443C>A	uc002gof.3	+	7	1449	c.1245C>A	c.(1243-1245)AGC>AGA	p.S415R	COX10_uc010vvs.1_Missense_Mutation_p.S198R|COX10_uc010vvt.1_Missense_Mutation_p.S223R	NM_001303	NP_001294	Q12887	COX10_HUMAN	heme A:farnesyltransferase precursor	415	Helical; (Potential).				heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TCTTCTGCAGCCTGTGGCACC	0.657																0.393939	33.656569	33.984609	13	20	KEEP	---	---	---	---	9	6	18	12	0.4	capture	Missense_Mutation	SNP	14110443	14110443	COX10	17	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	3727	259
NF1	4763	broad.mit.edu	37	17	29654691	29654691	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29654691C>T	uc002hgg.2	+	38	5776	c.5443C>T	c.(5443-5445)CAG>TAG	p.Q1815*	NF1_uc002hgh.2_Nonsense_Mutation_p.Q1794*|NF1_uc002hgi.1_Nonsense_Mutation_p.Q827*|NF1_uc010cso.2_Nonsense_Mutation_p.Q3*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1815					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.Q1815*(1)|p.H1814fs*43(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTTCATGCACCAGGAGTGTGA	0.493					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.570248	205.276256	205.795852	69	52	KEEP	---	---	---	---	38	40	30	28	-1	capture	Nonsense_Mutation	SNP	29654691	29654691	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	10263	259
ABHD3	171586	broad.mit.edu	37	18	19283692	19283692	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19283692G>A	uc002ktl.2	-	2	319	c.179C>T	c.(178-180)ACC>ATC	p.T60I	ABHD3_uc002ktm.2_Missense_Mutation_p.T60I|ABHD3_uc010xao.1_Intron|MIB1_uc002ktp.2_5'Flank|ABHD3_uc002kto.2_Missense_Mutation_p.T60I	NM_138340	NP_612213	Q8WU67	ABHD3_HUMAN	alpha/beta hydrolase domain containing protein	60						integral to membrane	carboxylesterase activity			central_nervous_system(1)	1						CTCACCCCCGGTCACTAACTG	0.547																0.353846	56.866572	58.107087	23	42	KEEP	---	---	---	---	20	8	24	22	-1	capture	Missense_Mutation	SNP	19283692	19283692	ABHD3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	83	259
PIK3R2	5296	broad.mit.edu	37	19	18280055	18280055	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18280055C>T	uc002nia.1	+	16	2650	c.2138C>T	c.(2137-2139)GCG>GTG	p.A713V	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	713	SH2 2.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						GTCACCCTGGCGCACCCAGTg	0.572					186											0.375	7.623137	7.732784	3	5	KEEP	---	---	---	---	0	3	1	4	-1	capture	Missense_Mutation	SNP	18280055	18280055	PIK3R2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11822	259
DHX34	9704	broad.mit.edu	37	19	47876058	47876058	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47876058G>A	uc010xyn.1	+	8	2181	c.1840G>A	c.(1840-1842)GTC>ATC	p.V614I	DHX34_uc010elc.1_Missense_Mutation_p.V529I	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	614						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CGCACTTAGCGTCCAGTCGCC	0.672																0.40625	34.166697	34.412887	13	19	KEEP	---	---	---	---	10	5	5	15	-1	capture	Missense_Mutation	SNP	47876058	47876058	DHX34	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4465	259
SIGLEC12	89858	broad.mit.edu	37	19	52004890	52004890	+	Missense_Mutation	SNP	G	A	A	rs141817270		TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52004890G>A	uc002pwx.1	-	1	154	c.98C>T	c.(97-99)ACG>ATG	p.T33M	SIGLEC12_uc002pww.1_5'Flank|SIGLEC12_uc010eoy.1_Translation_Start_Site	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like	33	Ig-like V-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CTCCTGCACCGTCACGGACTT	0.473																0.279412	45.492669	48.470636	19	49	KEEP	---	---	---	---	8	15	27	25	-1	capture	Missense_Mutation	SNP	52004890	52004890	SIGLEC12	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14201	259
ZNF761	388561	broad.mit.edu	37	19	53958627	53958627	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53958627G>A	uc010eqp.2	+	7	1324	c.866G>A	c.(865-867)CGT>CAT	p.R289H	ZNF761_uc010ydy.1_Missense_Mutation_p.R235H|ZNF761_uc002qbt.1_Missense_Mutation_p.R235H	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	289	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		ACATGCCATCGTAGACTTCAT	0.398																0.04142	-26.814406	11.408446	7	162	KEEP	---	---	---	---	3	5	90	82	-1	capture	Missense_Mutation	SNP	53958627	53958627	ZNF761	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18013	259
EPS8L1	54869	broad.mit.edu	37	19	55597484	55597484	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55597484G>A	uc002qis.3	+	16	1678	c.1574G>A	c.(1573-1575)GGA>GAA	p.G525E	EPS8L1_uc010ess.1_Missense_Mutation_p.G539E|EPS8L1_uc010yfr.1_Missense_Mutation_p.G461E|EPS8L1_uc002qiu.2_Missense_Mutation_p.G398E|EPS8L1_uc002qiv.2_Missense_Mutation_p.G203E|EPS8L1_uc002qiw.2_Missense_Mutation_p.G304E	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway	525	SH3.					cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGGCAGGAGGGATATGTGCCC	0.622	Ovarian(149;255 1863 3636 27051 29647)															0.387097	65.788173	66.479624	24	38	KEEP	---	---	---	---	7	18	20	23	-1	capture	Missense_Mutation	SNP	55597484	55597484	EPS8L1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5150	259
NPHP1	4867	broad.mit.edu	37	2	110922207	110922207	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:110922207G>A	uc002tfn.3	-	8	923	c.829C>T	c.(829-831)CGA>TGA	p.R277*	NPHP1_uc002tfm.3_Intron|NPHP1_uc002tfl.3_Nonsense_Mutation_p.R277*|NPHP1_uc002tfo.3_Intron|NPHP1_uc010ywx.1_Intron|NPHP1_uc010fjv.1_Intron	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2	277					actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						ATCCTATTTCGCATCAGAACT	0.458																0.305419	146.463067	153.32624	62	141	KEEP	---	---	---	---	27	38	58	86	-1	capture	Nonsense_Mutation	SNP	110922207	110922207	NPHP1	2	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	10486	259
NCKAP5	344148	broad.mit.edu	37	2	133547632	133547632	+	Silent	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:133547632G>A	uc002ttp.2	-	13	1430	c.1056C>T	c.(1054-1056)TCC>TCT	p.S352S	NCKAP5_uc002ttq.2_Silent_p.S352S	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	352	Ser-rich.						protein binding				0						GCCACGTGTAGGAGGAGCCAC	0.522																0.25	19.011048	20.601976	7	21	KEEP	---	---	---	---	7	2	12	11	-1	capture	Silent	SNP	133547632	133547632	NCKAP5	2	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	10130	259
ITGA6	3655	broad.mit.edu	37	2	173356005	173356005	+	Silent	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:173356005C>T	uc002uhp.1	+	22	3038	c.2835C>T	c.(2833-2835)GAC>GAT	p.D945D	ITGA6_uc010zdy.1_Silent_p.D826D|ITGA6_uc002uho.1_Silent_p.D945D|ITGA6_uc010fqm.1_Silent_p.D576D	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	984	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GGGGGCTGGACAGCAAGGCGT	0.473																0.09434	1.412894	27.707466	15	144	KEEP	---	---	---	---	6	11	102	69	-1	capture	Silent	SNP	173356005	173356005	ITGA6	2	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	7803	259
PLCL1	5334	broad.mit.edu	37	2	198950624	198950624	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198950624C>T	uc010fsp.2	+	2	2674	c.2383C>T	c.(2383-2385)CGT>TGT	p.R795C	PLCL1_uc002uuv.3_Missense_Mutation_p.R716C	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	795	C2.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	GGCCATGATCCGTTTTGTTGT	0.398																0.297297	86.431583	90.509797	33	78	KEEP	---	---	---	---	21	14	46	39	-1	capture	Missense_Mutation	SNP	198950624	198950624	PLCL1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11942	259
ZNF831	128611	broad.mit.edu	37	20	57767405	57767405	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57767405C>T	uc002yan.2	+	1	1331	c.1331C>T	c.(1330-1332)ACG>ATG	p.T444M		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	444						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					GACCTGCCCACGCCCTACACC	0.682																0.296296	19.087517	20.090812	8	19	KEEP	---	---	---	---	2	6	9	10	-1	capture	Missense_Mutation	SNP	57767405	57767405	ZNF831	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18061	259
TMPRSS15	5651	broad.mit.edu	37	21	19687506	19687506	+	Silent	SNP	G	A	A	rs148711749	byFrequency;by1000genomes	TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19687506G>A	uc002ykw.2	-	17	2020	c.1989C>T	c.(1987-1989)GAC>GAT	p.D663D		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	663	Extracellular (Potential).|LDL-receptor class A 2.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						GCAGATGACCGTCACAGAGAT	0.398																0.369863	72.203214	73.290638	27	46	KEEP	---	---	---	---	15	15	28	32	-1	capture	Silent	SNP	19687506	19687506	TMPRSS15	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16129	259
SLC5A1	6523	broad.mit.edu	37	22	32445981	32445981	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32445981C>T	uc003amc.2	+	2	419	c.187C>T	c.(187-189)CGA>TGA	p.R63*		NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	63	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						CCTGGCAGGCCGAAGTATGGT	0.448																0.570423	237.876084	238.488759	81	61	KEEP	---	---	---	---	45	43	30	36	-1	capture	Nonsense_Mutation	SNP	32445981	32445981	SLC5A1	22	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	14553	259
CARD10	29775	broad.mit.edu	37	22	37906263	37906263	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37906263G>A	uc003asx.1	-	4	868	c.865C>T	c.(865-867)CGG>TGG	p.R289W	CARD10_uc003ast.1_RNA|CARD10_uc003asw.1_5'Flank|CARD10_uc003asy.1_Missense_Mutation_p.R289W	NM_014550	NP_055365	Q9BWT7	CAR10_HUMAN	caspase recruitment domain protein 10	289	Potential.				activation of NF-kappaB-inducing kinase activity|protein complex assembly|regulation of apoptosis	CBM complex	receptor signaling complex scaffold activity			upper_aerodigestive_tract(1)|lung(1)|breast(1)|ovary(1)|prostate(1)|kidney(1)	6	Melanoma(58;0.0574)					GCCGTCAGCCGCTGGTTCTCA	0.572					672											0.515152	45.667989	45.674342	17	16	KEEP	---	---	---	---	8	10	6	13	-1	capture	Missense_Mutation	SNP	37906263	37906263	CARD10	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2620	259
EFCAB6	64800	broad.mit.edu	37	22	44083357	44083357	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44083357C>T	uc003bdy.1	-	11	1351	c.1136G>A	c.(1135-1137)AGA>AAA	p.R379K	EFCAB6_uc003bdz.1_Missense_Mutation_p.R227K|EFCAB6_uc010gzi.1_Missense_Mutation_p.R227K|EFCAB6_uc010gzk.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Missense_Mutation_p.R376K	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	379					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				ATACCTATTTCTTTTTGTCAG	0.308																0.37037	9.834687	10.345889	10	17	KEEP	---	---	---	---	8	4	10	9	-1	capture	Missense_Mutation	SNP	44083357	44083357	EFCAB6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4894	259
EPHA3	2042	broad.mit.edu	37	3	89478302	89478302	+	Silent	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:89478302G>A	uc003dqy.2	+	12	2346	c.2121G>A	c.(2119-2121)TTG>TTA	p.L707L	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	707	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		ATGGTTCCTTGGATAGTTTCC	0.323					416								TSP Lung(6;0.00050)			0.367347	102.176819	103.691704	36	62	KEEP	---	---	---	---	22	17	44	35	-1	capture	Silent	SNP	89478302	89478302	EPHA3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	5123	259
PTTG2	10744	broad.mit.edu	37	4	37962337	37962337	+	Silent	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:37962337C>T	uc011bye.1	+	1	282	c.282C>T	c.(280-282)ACC>ACT	p.T94T	TBC1D1_uc003gtb.2_Intron|TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_006607	NP_006598	Q9NZH5	PTTG2_HUMAN	pituitary tumor-transforming 2	94					chromosome organization|DNA metabolic process	cytoplasm|nucleus	SH3 domain binding				0						AAAAGATGACCGAGAAGACTG	0.403																0.062016	-8.180746	17.602136	8	121	KEEP	---	---	---	---	6	5	72	69	-1	capture	Silent	SNP	37962337	37962337	PTTG2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12716	259
SHROOM3	57619	broad.mit.edu	37	4	77661478	77661478	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77661478C>T	uc011cbx.1	+	5	3105	c.2152C>T	c.(2152-2154)CGG>TGG	p.R718W	SHROOM3_uc011cbz.1_Missense_Mutation_p.R542W|SHROOM3_uc003hkf.1_Missense_Mutation_p.R593W|SHROOM3_uc003hkg.2_Missense_Mutation_p.R496W	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	718					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			CCATCTGGACCGGCAGGTTTC	0.677																0.429907	128.235768	128.693026	46	61	KEEP	---	---	---	---	28	23	38	34	-1	capture	Missense_Mutation	SNP	77661478	77661478	SHROOM3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	14188	259
HNRPDL	9987	broad.mit.edu	37	4	83348672	83348672	+	Missense_Mutation	SNP	T	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83348672T>C	uc003hmr.2	-	4	1355	c.820A>G	c.(820-822)AGA>GGA	p.R274G	HNRPDL_uc003hmq.2_RNA|HNRPDL_uc003hms.2_RNA|HNRPDL_uc003hmt.2_Missense_Mutation_p.R274G	NM_031372	NP_112740	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	274	RRM 2.				regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|heterogeneous nuclear ribonucleoprotein complex	double-stranded DNA binding|nucleotide binding|poly(A) RNA binding|protein binding|single-stranded DNA binding			skin(1)	1		Hepatocellular(203;0.114)				CAAAATCCTCTTCTTTCATTT	0.333																0.285714	56.325997	58.920446	18	45	KEEP	---	---	---	---	8	12	22	27	-1	capture	Missense_Mutation	SNP	83348672	83348672	HNRPDL	4	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	7201	259
FGG	2266	broad.mit.edu	37	4	155533209	155533209	+	Missense_Mutation	SNP	T	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155533209T>C	uc003ioj.2	-	3	409	c.268A>G	c.(268-270)ATC>GTC	p.I90V	FGG_uc003iog.2_Missense_Mutation_p.I90V|FGG_uc003ioh.2_Missense_Mutation_p.I90V|FGG_uc010ipx.2_5'UTR|FGG_uc010ipy.2_Intron|FGG_uc003ioi.2_5'Flank|FGG_uc003iok.2_Missense_Mutation_p.I90V	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	90					platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GTGAGTTGGATTGCTTTTATC	0.313																0.217391	41.590951	46.668954	15	54	KEEP	---	---	---	---	9	8	30	33	-1	capture	Missense_Mutation	SNP	155533209	155533209	FGG	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5816	259
SPOCK3	50859	broad.mit.edu	37	4	168155201	168155201	+	Nonsense_Mutation	SNP	T	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:168155201T>A	uc003iri.1	-	2	265	c.124A>T	c.(124-126)AAA>TAA	p.K42*	SPOCK3_uc011cjp.1_Nonsense_Mutation_p.K42*|SPOCK3_uc011cjq.1_Nonsense_Mutation_p.K54*|SPOCK3_uc011cjr.1_5'UTR|SPOCK3_uc003irj.1_Nonsense_Mutation_p.K42*|SPOCK3_uc011cjs.1_5'UTR|SPOCK3_uc011cjt.1_5'UTR|SPOCK3_uc011cju.1_5'UTR|SPOCK3_uc011cjv.1_Nonsense_Mutation_p.K42*|SPOCK3_uc003irk.3_Nonsense_Mutation_p.K42*|SPOCK3_uc011cjw.1_RNA	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	42					signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AGCCATTGTTTATCATCCAGA	0.597																0.485714	95.864511	95.875813	34	36	KEEP	---	---	---	---	16	20	31	11	-1	capture	Nonsense_Mutation	SNP	168155201	168155201	SPOCK3	4	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	14973	259
ATOX1	475	broad.mit.edu	37	5	151131276	151131276	+	Missense_Mutation	SNP	T	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151131276T>C	uc003luk.2	-	2	169	c.71A>G	c.(70-72)AAT>AGT	p.N24S		NM_004045	NP_004036	O00244	ATOX1_HUMAN	antioxidant protein 1	24	HMA.				cellular copper ion homeostasis|copper ion transport|response to oxidative stress	cytosol	copper chaperone activity|copper-dependent protein binding				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			TCCAAGCTTATTGAGGACCCG	0.527																0.272727	9.220674	9.732406	3	8	KEEP	---	---	---	---	4	0	4	6	-1	capture	Missense_Mutation	SNP	151131276	151131276	ATOX1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	1106	259
CSNK2B	1460	broad.mit.edu	37	6	31637272	31637272	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31637272C>T	uc003nvr.1	+	6	884	c.544C>T	c.(544-546)CAG>TAG	p.Q182*	CSNK2B_uc003nvs.1_Nonsense_Mutation_p.Q182*|LY6G5B_uc003nvt.1_5'Flank	NM_001320	NP_001311	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	182					adiponectin-mediated signaling pathway|axon guidance|cellular protein complex assembly|negative regulation of cell proliferation|regulation of DNA binding|Wnt receptor signaling pathway	cytosol|nucleus|protein kinase CK2 complex	identical protein binding|protein domain specific binding|protein kinase regulator activity|receptor binding|transcription factor binding				0						ACCTGCCAACCAGTTTGTGCC	0.572																0.038095	-16.696703	7.537441	4	101	KEEP	---	---	---	---	5	0	61	60	-1	capture	Nonsense_Mutation	SNP	31637272	31637272	CSNK2B	6	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	3924	259
UNC5CL	222643	broad.mit.edu	37	6	40996200	40996200	+	Missense_Mutation	SNP	T	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:40996200T>C	uc003opi.2	-	9	1558	c.1469A>G	c.(1468-1470)TAC>TGC	p.Y490C		NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like	490	Death.|Cytoplasmic (Potential).				signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCCACTCAGGTAGTTCTGGAT	0.667														OREG0017423	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.06	-3.592266	6.514331	3	47	KEEP	---	---	---	---	1	2	30	22	-1	capture	Missense_Mutation	SNP	40996200	40996200	UNC5CL	6	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	16876	259
TRERF1	55809	broad.mit.edu	37	6	42231242	42231242	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:42231242G>A	uc003osd.2	-	8	2263	c.1700C>T	c.(1699-1701)CCG>CTG	p.P567L	TRERF1_uc011duq.1_Intron|TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Missense_Mutation_p.P567L	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	567	Pro-rich.|Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	p.P567P(1)		ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			tggtggcggcggaggcggagg	0.383																0.287879	48.99762	51.661306	19	47	KEEP	---	---	---	---	13	8	28	23	-1	capture	Missense_Mutation	SNP	42231242	42231242	TRERF1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16358	259
EIF3B	8662	broad.mit.edu	37	7	2412424	2412424	+	Missense_Mutation	SNP	C	G	G			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2412424C>G	uc003slx.2	+	12	1887	c.1804C>G	c.(1804-1806)CTC>GTC	p.L602V	EIF3B_uc003sly.2_Missense_Mutation_p.L602V|EIF3B_uc003sma.2_Missense_Mutation_p.L330V	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,	602					regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GAAGATTGAACTCATCAGTAA	0.507																0.333333	97.38124	99.675541	31	62	KEEP	---	---	---	---	19	14	30	40	-1	capture	Missense_Mutation	SNP	2412424	2412424	EIF3B	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	4968	259
GAL3ST4	79690	broad.mit.edu	37	7	99764391	99764391	+	Missense_Mutation	SNP	A	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99764391A>T	uc003utt.2	-	2	1180	c.163T>A	c.(163-165)TCC>ACC	p.S55T	GAL3ST4_uc003utu.2_Missense_Mutation_p.S55T|GAL3ST4_uc010lgq.2_Intron	NM_024637	NP_078913	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	55	Lumenal (Potential).				cell-cell signaling|oligosaccharide metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane|membrane fraction	3'-phosphoadenosine 5'-phosphosulfate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(3)	3	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGTCGTAGGGATGGGGCCGAG	0.622																0.30303	28.839673	29.981173	10	23	KEEP	---	---	---	---	8	2	17	8	-1	capture	Missense_Mutation	SNP	99764391	99764391	GAL3ST4	7	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	6140	259
DOCK4	9732	broad.mit.edu	37	7	111540437	111540437	+	Missense_Mutation	SNP	A	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:111540437A>C	uc003vfx.2	-	15	1742	c.1473T>G	c.(1471-1473)CAT>CAG	p.H491Q	DOCK4_uc003vfy.2_Missense_Mutation_p.H491Q|DOCK4_uc003vga.1_Missense_Mutation_p.H96Q	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	491	DHR-1.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				TACTGGAACAATGCCGAAACT	0.473																0.214286	16.436589	18.545522	6	22	KEEP	---	---	---	---	2	5	15	9	-1	capture	Missense_Mutation	SNP	111540437	111540437	DOCK4	7	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	4645	259
DLGAP2	9228	broad.mit.edu	37	8	1581155	1581155	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1581155G>A	uc003wpl.2	+	5	1610	c.1513G>A	c.(1513-1515)GAA>AAA	p.E505K	DLGAP2_uc003wpm.2_Missense_Mutation_p.E505K	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	584					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCAAGATGACGAATGTATTCC	0.547																0.290323	44.428477	46.869087	18	44	KEEP	---	---	---	---	10	9	27	25	-1	capture	Missense_Mutation	SNP	1581155	1581155	DLGAP2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4518	259
NUDCD1	84955	broad.mit.edu	37	8	110308796	110308796	+	Missense_Mutation	SNP	G	C	C			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110308796G>C	uc003ynb.3	-	3	387	c.276C>G	c.(274-276)GAC>GAG	p.D92E	NUDCD1_uc003yna.2_Missense_Mutation_p.D63E|NUDCD1_uc010mcl.2_Missense_Mutation_p.D5E|NUDCD1_uc010mcm.1_Missense_Mutation_p.D5E	NM_032869	NP_116258	Q96RS6	NUDC1_HUMAN	NudC domain containing 1 isoform 1	92										ovary(1)|breast(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			CTAAGGCAGTGTCCTAAAAAG	0.378																0.357143	67.183949	68.190854	20	36	KEEP	---	---	---	---	9	11	22	16	-1	capture	Missense_Mutation	SNP	110308796	110308796	NUDCD1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	10629	259
C9orf103	414328	broad.mit.edu	37	9	86258531	86258531	+	Missense_Mutation	SNP	C	T	T			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86258531C>T	uc004amu.1	+	5	414	c.400C>T	c.(400-402)CGC>TGC	p.R134C	C9orf103_uc004amt.1_Missense_Mutation_p.R88C|C9orf103_uc010mpv.1_Missense_Mutation_p.R88C	NM_001001551	NP_001001551	Q5T6J7	GNTK_HUMAN	gluconokinase-like protein	134					carbohydrate metabolic process	cytoplasm	ATP binding|gluconokinase activity|shikimate kinase activity				0						CATCTCTGGACGCTTACTCAA	0.507																0.3125	58.630401	61.143446	25	55	KEEP	---	---	---	---	11	14	33	25	-1	capture	Missense_Mutation	SNP	86258531	86258531	C9orf103	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2423	259
C9orf5	23731	broad.mit.edu	37	9	111822726	111822726	+	Nonsense_Mutation	SNP	T	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:111822726T>A	uc004bdt.3	-	11	1662	c.1630A>T	c.(1630-1632)AAA>TAA	p.K544*	C9orf5_uc004bds.3_RNA|C9orf5_uc004bdr.3_Nonsense_Mutation_p.K536*	NM_032012	NP_114401	Q9H330	CI005_HUMAN	hypothetical protein LOC23731	544						integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)		CCTAGAATTTTATGGAGCTAG	0.343																0.367647	68.159146	69.205356	25	43	KEEP	---	---	---	---	14	12	21	26	-1	capture	Nonsense_Mutation	SNP	111822726	111822726	C9orf5	9	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	2462	259
CXorf22	170063	broad.mit.edu	37	X	35985796	35985796	+	Missense_Mutation	SNP	G	A	A			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35985796G>A	uc004ddj.2	+	10	1720	c.1661G>A	c.(1660-1662)CGC>CAC	p.R554H	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	554								p.R554R(1)		large_intestine(1)|lung(1)|ovary(1)	3						TTGGCAAAACGCAAGAATTAT	0.393																0.564103	62.9762	63.122968	22	17	KEEP	---	---	---	---	14	11	12	8	-1	capture	Missense_Mutation	SNP	35985796	35985796	CXorf22	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4062	259
SLC38A6	145389	broad.mit.edu	37	14	61518523	61518525	+	In_Frame_Del	DEL	ATG	-	-			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:61518523_61518525delATG	uc001xfg.1	+	14	1185_1187	c.1069_1071delATG	c.(1069-1071)ATGdel	p.M358del	SLC38A6_uc001xfh.1_In_Frame_Del_p.M358del|SLC38A6_uc001xfi.2_RNA|SLC38A6_uc001xfj.1_RNA|SLC38A6_uc001xfk.2_RNA|SLC38A6_uc010trz.1_In_Frame_Del_p.M335del	NM_153811	NP_722518	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	358					amino acid transport|sodium ion transport	integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		AGCTGTAACAATGATGTTTTTCT	0.340																0.32			28	60		---	---	---	---						capture_indel	In_Frame_Del	DEL	61518523	61518525	SLC38A6	14	ATG	-	-	-	1	0	1	0	1	0	0	0	0	52	4	5	5	14500	259
CLGN	1047	broad.mit.edu	37	4	141313760	141313760	+	Frame_Shift_Del	DEL	A	-	-			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:141313760delA	uc011chi.1	-	13	1689	c.1471delT	c.(1471-1473)TGTfs	p.C491fs	CLGN_uc003iii.2_Frame_Shift_Del_p.C491fs	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor	491	Helical; (Potential).				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					CTTGGCCAACAAAATGAAGTA	0.348																0.34			29	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	141313760	141313760	CLGN	4	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	3489	259
C5orf33	133686	broad.mit.edu	37	5	36195277	36195279	+	In_Frame_Del	DEL	TCT	-	-			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36195277_36195279delTCT	uc003jkf.3	-	12	1296_1298	c.1296_1298delAGA	c.(1294-1299)GAAGAT>GAT	p.E432del	C5orf33_uc003jke.3_RNA|C5orf33_uc010iux.2_In_Frame_Del_p.E237del|C5orf33_uc003jkg.3_In_Frame_Del_p.E269del|C5orf33_uc011cov.1_In_Frame_Del_p.E291del	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1	432							NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCGAAGCTCATCTTCTTTATTGA	0.399																0.22			18	64		---	---	---	---						capture_indel	In_Frame_Del	DEL	36195277	36195279	C5orf33	5	TCT	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	2270	259
PCDH19	57526	broad.mit.edu	37	X	99662130	99662131	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-41-6646-01	TCGA-41-6646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99662130_99662131delGA	uc010nmz.2	-	1	3141_3142	c.1465_1466delTC	c.(1465-1467)TCCfs	p.S489fs	PCDH19_uc004efw.3_Frame_Shift_Del_p.S489fs|PCDH19_uc004efx.3_Frame_Shift_Del_p.S489fs	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	489	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GATCTGGTAGGAGACACTGCCG	0.584																0.47			40	45		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	99662130	99662131	PCDH19	23	GA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	11417	259
