Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ATAD3A	55210	broad.mit.edu	37	1	1454326	1454326	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1454326G>A	uc001afz.1	+	5	708	c.614G>A	c.(613-615)CGG>CAG	p.R205Q	ATAD3A_uc001aga.1_Missense_Mutation_p.R157Q|ATAD3A_uc001agb.1_Missense_Mutation_p.R78Q	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	205	Potential.						ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		GAGAATTTACGGAAGCAGGAG	0.572													10	69	---	---	---	---	PASS
TRIM63	84676	broad.mit.edu	37	1	26386826	26386826	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26386826C>T	uc001bli.1	-	4	664	c.528G>A	c.(526-528)ATG>ATA	p.M176I		NM_032588	NP_115977	Q969Q1	TRI63_HUMAN	muscle specific ring finger protein 1	176	Interaction with TTN.					cytoplasm|microtubule|nucleus	ligase activity|signal transducer activity|titin binding|zinc ion binding			kidney(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCCACCAGCATGGAGATAC	0.572													7	35	---	---	---	---	PASS
PHACTR4	65979	broad.mit.edu	37	1	28800600	28800600	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28800600C>A	uc001bpw.2	+	7	1640	c.1358C>A	c.(1357-1359)TCT>TAT	p.S453Y	PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Missense_Mutation_p.S437Y|PHACTR4_uc001bpy.2_Missense_Mutation_p.S463Y	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1	453							actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GACAGCTTTTCTGAGGACAGC	0.478													16	94	---	---	---	---	PASS
PHC2	1912	broad.mit.edu	37	1	33836642	33836642	+	Silent	SNP	C	A	A	rs150111238		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33836642C>A	uc001bxg.1	-	3	441	c.387G>T	c.(385-387)GCG>GCT	p.A129A	PHC2_uc001bxh.1_Silent_p.A129A|PHC2_uc009vuh.1_Silent_p.A129A|PHC2_uc001bxi.1_Silent_p.A129A	NM_198040	NP_932157	Q8IXK0	PHC2_HUMAN	polyhomeotic-like 2 isoform a	129					multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCGGGGCCTGCGCAGACACAT	0.567													4	76	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34066583	34066583	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34066583C>T	uc001bxn.1	-	45	6773	c.6744G>A	c.(6742-6744)CGG>CGA	p.R2248R	CSMD2_uc001bxm.1_Silent_p.R2246R|CSMD2_uc001bxo.1_Silent_p.R1119R	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2248	Extracellular (Potential).|CUB 13.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGACGCCGAGCCGTGGTGCTG	0.577													15	58	---	---	---	---	PASS
MFSD2A	84879	broad.mit.edu	37	1	40434012	40434012	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40434012G>T	uc001cev.2	+	12	1435	c.1254G>T	c.(1252-1254)ATG>ATT	p.M418I	MFSD2A_uc010ojb.1_Missense_Mutation_p.M366I|MFSD2A_uc001ceu.2_Missense_Mutation_p.M405I|MFSD2A_uc010ojc.1_Missense_Mutation_p.M249I|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cex.2_Missense_Mutation_p.M69I	NM_001136493	NP_001129965	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	418					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2						GCAGGTCCATGCTGCCTGATG	0.527													11	21	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70446129	70446129	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70446129T>C	uc001dep.2	+	7	695	c.665T>C	c.(664-666)TTA>TCA	p.L222S	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	222	LRR 9.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TTACAAGTGTTACCTGGGGTA	0.343													12	69	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038518	75038518	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038518A>G	uc001dgg.2	-	14	3095	c.2876T>C	c.(2875-2877)ATG>ACG	p.M959T		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	959	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TGTGTCCTCCATGGGTCCTGT	0.527													9	40	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75693501	75693501	+	Missense_Mutation	SNP	G	T	T	rs149696907	byFrequency	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75693501G>T	uc001dgu.2	-	13	1039	c.895C>A	c.(895-897)CGC>AGC	p.R299S	SLC44A5_uc001dgt.2_Missense_Mutation_p.R299S|SLC44A5_uc001dgs.2_Missense_Mutation_p.R257S|SLC44A5_uc001dgr.2_Missense_Mutation_p.R257S|SLC44A5_uc010oqz.1_Missense_Mutation_p.R338S|SLC44A5_uc010ora.1_Missense_Mutation_p.R293S|SLC44A5_uc010orb.1_Missense_Mutation_p.R169S	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	299	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						GAACTTGGGCGTTCCTGAAGA	0.338													5	29	---	---	---	---	PASS
EPHX4	253152	broad.mit.edu	37	1	92528792	92528792	+	Silent	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92528792G>C	uc001don.2	+	7	1142	c.1038G>C	c.(1036-1038)GTG>GTC	p.V346V		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	346						integral to membrane	hydrolase activity			central_nervous_system(1)	1						CTGACATAGTGAACAAATTGA	0.318													6	45	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111862916	111862916	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111862916C>A	uc001eas.2	+	12	1362	c.1259C>A	c.(1258-1260)TCT>TAT	p.S420Y	CHIA_uc001ear.2_Missense_Mutation_p.S312Y|CHIA_uc001eaq.2_Missense_Mutation_p.S312Y|CHIA_uc009wgc.2_Missense_Mutation_p.S312Y|CHIA_uc001eat.2_Missense_Mutation_p.S259Y|CHIA_uc001eav.2_Missense_Mutation_p.S259Y|CHIA_uc001eau.2_Missense_Mutation_p.S259Y|CHIA_uc009wgd.2_Missense_Mutation_p.S259Y	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	420	Poly-Ser.				apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		AGTAGCAGCTCTGGAGGCAGC	0.577													7	34	---	---	---	---	PASS
VANGL1	81839	broad.mit.edu	37	1	116233730	116233730	+	Intron	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116233730C>G	uc001efv.1	+						VANGL1_uc009wgy.1_Intron	NM_138959	NP_620409	Q8TAA9	VANG1_HUMAN	vang-like 1						multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCTTTCTCCTCTGCTTCCAGG	0.512													3	24	---	---	---	---	PASS
TARS2	80222	broad.mit.edu	37	1	150470975	150470975	+	Intron	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150470975C>G	uc001euq.2	+						TARS2_uc010pcd.1_Intron|TARS2_uc001eur.2_Intron|TARS2_uc009wlt.2_Intron|TARS2_uc009wls.2_Intron	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial						threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	ACCCCAACCTCAGCCTGATGT	0.627													7	40	---	---	---	---	PASS
CASQ1	844	broad.mit.edu	37	1	160165289	160165289	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160165289C>A	uc010pja.1	+	5	873	c.616C>A	c.(616-618)CCC>ACC	p.P206T		NM_001231	NP_001222	P31415	CASQ1_HUMAN	calsequestrin 1	206						mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding			central_nervous_system(1)	1	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGAGTTTCATCCCTACATCCC	0.562													21	22	---	---	---	---	PASS
TOMM40L	84134	broad.mit.edu	37	1	161197498	161197498	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161197498G>A	uc001fzd.2	+	5	578	c.349G>A	c.(349-351)GAG>AAG	p.E117K	TOMM40L_uc010pkk.1_RNA|TOMM40L_uc010pkl.1_Intron|TOMM40L_uc009wue.2_Intron|TOMM40L_uc009wuf.1_RNA|TOMM40L_uc001fze.2_Missense_Mutation_p.E117K	NM_032174	NP_115550	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40	117					protein transport	mitochondrial outer membrane|pore complex	porin activity|voltage-gated anion channel activity			large_intestine(1)	1	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CCTCTTGGCAGAGCGGCTCCG	0.587											OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	21	---	---	---	---	PASS
C1orf192	257177	broad.mit.edu	37	1	161336064	161336064	+	Missense_Mutation	SNP	A	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161336064A>T	uc001gal.2	-	3	101	c.95T>A	c.(94-96)ATC>AAC	p.I32N		NM_001013625	NP_001013647	Q5VTH2	CA192_HUMAN	hypothetical protein LOC257177	32											0	all_cancers(52;4.64e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			ATGAGAAGAGATGCTCTGGGG	0.463													17	20	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175325554	175325554	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175325554G>A	uc001gkp.1	-	14	3100	c.3019C>T	c.(3019-3021)CGG>TGG	p.R1007W	TNR_uc009wwu.1_Missense_Mutation_p.R1007W	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1007	Fibronectin type-III 8.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TCAACAAGCCGAAATTCCTCA	0.473													24	40	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215933143	215933143	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215933143G>T	uc001hku.1	-	57	11477	c.11090C>A	c.(11089-11091)ACA>AAA	p.T3697K		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3697	Fibronectin type-III 22.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAATTCCACTGTTGTAGAATT	0.403										HNSCC(13;0.011)			26	62	---	---	---	---	PASS
TAF1A	9015	broad.mit.edu	37	1	222732082	222732082	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222732082C>A	uc009xdz.1	-	11	1462	c.1273G>T	c.(1273-1275)GAT>TAT	p.D425Y	TAF1A_uc009xdy.1_Missense_Mutation_p.D116Y|TAF1A_uc001hni.1_Missense_Mutation_p.D311Y|TAF1A_uc001hnj.2_Missense_Mutation_p.D425Y|TAF1A_uc001hnk.2_Missense_Mutation_p.D311Y	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2	425					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		ATTTGGTGATCTTGCTTTAAA	0.269													15	52	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237801776	237801776	+	Missense_Mutation	SNP	T	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237801776T>A	uc001hyl.1	+	45	7032	c.6912T>A	c.(6910-6912)TTT>TTA	p.F2304L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2304	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCTTAGATTTGCTGTCTTCT	0.403													30	184	---	---	---	---	PASS
OR2T34	127068	broad.mit.edu	37	1	248737347	248737347	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248737347C>T	uc001iep.1	-	1	712	c.712G>A	c.(712-714)GGC>AGC	p.G238S		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	238	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCCTGCGGCCGGCGGCAGAA	0.562													53	85	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1926881	1926881	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1926881C>A	uc002qxe.2	-	10	1487	c.660G>T	c.(658-660)AGG>AGT	p.R220S	MYT1L_uc002qxd.2_Missense_Mutation_p.R220S|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	220					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CTGACTCAGTCCTGGCCCGGT	0.433													15	41	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11341532	11341532	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11341532T>C	uc002rbd.1	-	22	3076	c.2627A>G	c.(2626-2628)TAT>TGT	p.Y876C		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	876	Potential.				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTGTGTTTTATAAAGGGTCTA	0.333													10	23	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21236225	21236225	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21236225G>T	uc002red.2	-	25	4151	c.4023C>A	c.(4021-4023)ACC>ACA	p.T1341T		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1341					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACTTGGGAATGGTAAAAGTAG	0.488													27	68	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39285891	39285891	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39285891C>T	uc002rrk.3	-	3	309	c.268G>A	c.(268-270)GCC>ACC	p.A90T	SOS1_uc010ynr.1_RNA	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	90					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				GCTGATTGGGCATCAGCTATT	0.338									Noonan_syndrome				24	61	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44036917	44036917	+	3'UTR	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44036917A>G	uc002rtk.2	+	13					DYNC2LI1_uc002rtl.2_3'UTR|DYNC2LI1_uc010ynz.1_3'UTR	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ACCTATTTCAATTATTGTATA	0.269													7	20	---	---	---	---	PASS
C2orf63	130162	broad.mit.edu	37	2	55436584	55436584	+	Missense_Mutation	SNP	A	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55436584A>C	uc002ryi.2	-	7	1116	c.770T>G	c.(769-771)TTT>TGT	p.F257C	C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Missense_Mutation_p.F135C	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	257							binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			AAAGTCTTGAAATGGGCTGCT	0.313													28	76	---	---	---	---	PASS
UGP2	7360	broad.mit.edu	37	2	64112824	64112824	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64112824T>C	uc002scm.2	+	6	983	c.677T>C	c.(676-678)ATT>ACT	p.I226T	UGP2_uc002scl.2_Missense_Mutation_p.I215T|UGP2_uc010ypx.1_Missense_Mutation_p.I235T	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a	226					glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						CATGGTGATATTTACGCCAGT	0.408													23	166	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71891467	71891467	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71891467C>T	uc002sie.2	+	45	5332	c.4956C>T	c.(4954-4956)CTC>CTT	p.L1652L	DYSF_uc010feg.2_Silent_p.L1683L|DYSF_uc010feh.2_Silent_p.L1659L|DYSF_uc002sig.3_Silent_p.L1638L|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.L1673L|DYSF_uc010fef.2_Silent_p.L1690L|DYSF_uc010fei.2_Silent_p.L1669L|DYSF_uc010fek.2_Silent_p.L1670L|DYSF_uc010fej.2_Silent_p.L1660L|DYSF_uc010fel.2_Silent_p.L1639L|DYSF_uc010feo.2_Silent_p.L1684L|DYSF_uc010fem.2_Silent_p.L1674L|DYSF_uc010fen.2_Silent_p.L1691L|DYSF_uc002sif.2_Silent_p.L1653L|DYSF_uc010yqy.1_Silent_p.L533L|DYSF_uc010yqz.1_Silent_p.L413L	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1652	Cytoplasmic (Potential).|C2 5.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						ACTATGACCTCCTCTCCAAGG	0.562													12	48	---	---	---	---	PASS
PCGF1	84759	broad.mit.edu	37	2	74732906	74732906	+	Intron	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74732906A>G	uc002slz.2	-						LBX2_uc002slw.2_5'Flank|PCGF1_uc002sly.2_Intron	NM_032673	NP_116062	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1						histone H2A monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PcG protein complex	protein C-terminus binding|zinc ion binding			ovary(1)	1						AACTGGGGGGAAATAGACACA	0.537													15	186	---	---	---	---	PASS
SMYD1	150572	broad.mit.edu	37	2	88367391	88367391	+	Missense_Mutation	SNP	T	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88367391T>G	uc002ssr.2	+	1	10	c.8T>G	c.(7-9)ATA>AGA	p.I3R	SMYD1_uc002ssq.1_5'UTR	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	3					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						GAGATGACAATAGGGAGAATG	0.512													29	105	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125530522	125530522	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125530522C>T	uc002tno.2	+	17	3041	c.2677C>T	c.(2677-2679)CTT>TTT	p.L893F	CNTNAP5_uc010flu.2_Missense_Mutation_p.L894F	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	893	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGTGGACAACCTTCCAAGGAG	0.537													33	88	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128922352	128922352	+	Silent	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128922352A>G	uc002tps.2	+	26	3052	c.2874A>G	c.(2872-2874)CCA>CCG	p.P958P	UGGT1_uc010fme.1_Silent_p.P833P|UGGT1_uc002tpr.2_Silent_p.P934P	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	958					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						CAGCGCAACCAAAAGGAGATC	0.368													14	35	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135911411	135911411	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135911411A>G	uc002tuj.2	+	19	2279	c.2254A>G	c.(2254-2256)AGG>GGG	p.R752G	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.R752G|RAB3GAP1_uc010fng.2_Missense_Mutation_p.R577G|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	752						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		TAGAAGGCAAAGGAGACTCTT	0.428													19	41	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138033483	138033483	+	Intron	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138033483G>T	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATCGTTTTTGGTAATCACAGG	0.413													7	16	---	---	---	---	PASS
RBM45	129831	broad.mit.edu	37	2	178988582	178988582	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178988582G>C	uc002ulv.2	+	7	1103	c.1011G>C	c.(1009-1011)ATG>ATC	p.M337I		NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	339					cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			CAACACAGATGGTAGCTGCAC	0.323													19	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179446770	179446770	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179446770G>T	uc010zfg.1	-	264	58846	c.58622C>A	c.(58621-58623)CCT>CAT	p.P19541H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P13236H|TTN_uc010zfi.1_Missense_Mutation_p.P13169H|TTN_uc010zfj.1_Missense_Mutation_p.P13044H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20468							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTATAATAGGTTTTCTGTT	0.448													33	151	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179446771	179446771	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179446771G>T	uc010zfg.1	-	264	58845	c.58621C>A	c.(58621-58623)CCT>ACT	p.P19541T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P13236T|TTN_uc010zfi.1_Missense_Mutation_p.P13169T|TTN_uc010zfj.1_Missense_Mutation_p.P13044T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20468							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTATAATAGGTTTTCTGTTG	0.453													34	157	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179596203	179596203	+	Silent	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596203G>A	uc010zfg.1	-	56	13782	c.13558C>T	c.(13558-13560)CTA>TTA	p.L4520L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.L1181L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5447							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCTTTTAGCCAAGTCACC	0.478													8	42	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210561312	210561312	+	Silent	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210561312A>G	uc002vde.1	+	8	4475	c.4227A>G	c.(4225-4227)AAA>AAG	p.K1409K	MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.K1405K	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1409					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	CTATTCCTAAAGAGGAGAAAG	0.383													16	56	---	---	---	---	PASS
KAT2B	8850	broad.mit.edu	37	3	20142869	20142869	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20142869C>T	uc003cbq.2	+	5	1206	c.760C>T	c.(760-762)CGC>TGC	p.R254C		NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	254					cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GTTCCTAAACCGCATCAACTA	0.398													8	45	---	---	---	---	PASS
CRYBG3	131544	broad.mit.edu	37	3	97596183	97596183	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97596183G>T	uc003drx.2	+	1	365	c.301G>T	c.(301-303)GTC>TTC	p.V101F		NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						AACTGACCTTGTCCATCACTT	0.413													18	57	---	---	---	---	PASS
CD47	961	broad.mit.edu	37	3	107776416	107776416	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107776416G>A	uc003dwt.1	-	7	965	c.785C>T	c.(784-786)GCG>GTG	p.A262V	CD47_uc003dwu.1_Missense_Mutation_p.A262V|CD47_uc003dwv.1_Missense_Mutation_p.A262V|CD47_uc003dww.1_Missense_Mutation_p.A262V	NM_001777	NP_001768	Q08722	CD47_HUMAN	CD47 antigen isoform 1 precursor	262	Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			TGGTATACACGCTGTAAAAAC	0.313													16	24	---	---	---	---	PASS
TRH	7200	broad.mit.edu	37	3	129695813	129695813	+	Silent	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129695813C>A	uc003enc.2	+	3	1044	c.483C>A	c.(481-483)CCC>CCA	p.P161P		NM_007117	NP_009048	P20396	TRH_HUMAN	thyrotropin-releasing hormone	161					cell-cell signaling|hormone-mediated signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|thyrotropin-releasing hormone activity			ovary(1)	1						TGGCAGATCCCAAGGCTCAAA	0.522													12	38	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132363689	132363689	+	Silent	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132363689A>G	uc003eov.3	-	2	581	c.201T>C	c.(199-201)TAT>TAC	p.Y67Y	NPHP3_uc003eoz.1_Silent_p.Y226Y|ACAD11_uc003eoy.2_Silent_p.Y67Y	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	67						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						TCCTGAGCACATATGTTTGAA	0.328													25	59	---	---	---	---	PASS
TMEM108	66000	broad.mit.edu	37	3	133109124	133109124	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133109124C>T	uc003eph.2	+	5	1825	c.1551C>T	c.(1549-1551)TTC>TTT	p.F517F	TMEM108_uc003epi.2_Silent_p.F517F|TMEM108_uc003epk.2_Silent_p.F47F|TMEM108_uc003epm.2_Silent_p.F468F	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	517	Cytoplasmic (Potential).					integral to membrane				ovary(2)|skin(2)	4						TGGACTACTTCAACAGGCATG	0.552													33	220	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134851865	134851865	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134851865C>T	uc003eqt.2	+	5	1491	c.1271C>T	c.(1270-1272)TCT>TTT	p.S424F	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_3'UTR|EPHB1_uc003equ.2_5'UTR	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	424	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						CAGCACGTCTCTGTCAACATC	0.572													6	9	---	---	---	---	PASS
MRAS	22808	broad.mit.edu	37	3	138091773	138091773	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138091773G>T	uc003esh.3	+	2	609	c.48G>T	c.(46-48)CTG>CTT	p.L16L	MRAS_uc011bmi.1_Intron|MRAS_uc003esi.3_Silent_p.L16L|MRAS_uc011bmj.1_Intron	NM_012219	NP_036351	O14807	RASM_HUMAN	muscle RAS oncogene homolog precursor	16					actin cytoskeleton organization|muscle organ development|Ras protein signal transduction	intracellular|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity			lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						CATACAAGCTGGTGGTGGTGG	0.557													26	76	---	---	---	---	PASS
ARL14	80117	broad.mit.edu	37	3	160395290	160395290	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160395290C>T	uc003fdq.2	+	1	343	c.156C>T	c.(154-156)ATC>ATT	p.I52I		NM_025047	NP_079323	Q8N4G2	ARL14_HUMAN	ADP-ribosylation factor-like 14	52					small GTPase mediated signal transduction	intracellular	GTP binding				0			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)			TGGAAATGATCGAGTTGGAAA	0.438													22	102	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	182897372	182897372	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182897372C>T	uc003fli.1	-	29	3304	c.3214G>A	c.(3214-3216)GAG>AAG	p.E1072K		NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	1072					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CACGTTTCCTCCTCATCGCGT	0.557													32	889	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	182897440	182897440	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182897440C>T	uc003fli.1	-	29	3236	c.3146G>A	c.(3145-3147)TGT>TAT	p.C1049Y		NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	1049					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTTGGAGGAACAGGTTTCGTG	0.567													29	870	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184005696	184005696	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184005696C>T	uc003fni.3	+	11	1727	c.1689C>T	c.(1687-1689)CTC>CTT	p.L563L	ECE2_uc011brh.1_Silent_p.L416L|ECE2_uc003fnl.3_Silent_p.L491L|ECE2_uc003fnm.3_Silent_p.L445L|ECE2_uc003fnk.3_Silent_p.L416L|ECE2_uc011bri.1_Silent_p.L478L|ECE2_uc010hxv.2_Silent_p.L207L	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	563	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGGGGTCCCTCTTCGTGAAGG	0.498													458	52	---	---	---	---	PASS
ADIPOQ	9370	broad.mit.edu	37	3	186572371	186572371	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186572371C>A	uc003fra.2	+	3	697	c.613C>A	c.(613-615)CTG>ATG	p.L205M	ADIPOQ_uc010hyy.2_Missense_Mutation_p.L205M	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	adiponectin precursor	205	C1q.				brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		GCTCCTGCATCTGGAGGTGGG	0.517													22	85	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196387871	196387871	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196387871C>T	uc003fwv.2	+	3	1461	c.1357C>T	c.(1357-1359)CCT>TCT	p.P453S		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	453	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GGTGGGCCCCCCTAGCTGTGT	0.572													35	122	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146064527	146064527	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146064527G>A	uc003ika.3	-	17	1616	c.1478C>T	c.(1477-1479)CCT>CTT	p.P493L	OTUD4_uc003ijz.3_Missense_Mutation_p.P492L	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	557							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					TTGTTCCGCAGGAGAAGGGCA	0.358													4	29	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151509335	151509335	+	Silent	SNP	A	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151509335A>C	uc010ipj.2	-	41	6702	c.6228T>G	c.(6226-6228)GGT>GGG	p.G2076G	LRBA_uc003ilt.3_Silent_p.G724G|LRBA_uc003ilu.3_Silent_p.G2065G	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2076						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					GGCTAACAGGACCTGCCAAAA	0.433													5	23	---	---	---	---	PASS
LRP2BP	55805	broad.mit.edu	37	4	186294028	186294028	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186294028C>A	uc003ixj.1	-	6	1597	c.785G>T	c.(784-786)TGT>TTT	p.C262F	LRP2BP_uc003ixk.1_Missense_Mutation_p.C236F|LRP2BP_uc011ckr.1_Missense_Mutation_p.C262F	NM_018409	NP_060879	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	262	Sel1-like 5.					cytoplasm	protein binding				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		AAATGCAACACACTTTGTAAA	0.259													29	42	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1416275	1416275	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1416275G>T	uc003jck.2	-	7	1090	c.969C>A	c.(967-969)GGC>GGA	p.G323G		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	323	Helical; Name=6; (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CGAACCCCACGCCCAGGGAGA	0.622													7	33	---	---	---	---	PASS
CMBL	134147	broad.mit.edu	37	5	10290841	10290841	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10290841T>C	uc003jes.2	-	2	485	c.34A>G	c.(34-36)ATT>GTT	p.I12V		NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase	12						cytosol	hydrolase activity|protein binding			skin(1)	1						CTGTGGCCAATGTCACACGGA	0.468													25	77	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32090630	32090630	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32090630C>T	uc003jhl.2	+	20	7464	c.7076C>T	c.(7075-7077)CCA>CTA	p.P2359L	PDZD2_uc003jhm.2_Missense_Mutation_p.P2359L	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2359					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GGGGCTTCCCCATTTTTGTCG	0.577													6	44	---	---	---	---	PASS
GDNF	2668	broad.mit.edu	37	5	37816091	37816091	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37816091G>T	uc011cpi.1	-	3	498	c.298C>A	c.(298-300)CCA>ACA	p.P100T	GDNF_uc011cpc.1_Missense_Mutation_p.P22T|GDNF_uc011cpd.1_Missense_Mutation_p.P48T|GDNF_uc011cpe.1_Missense_Mutation_p.P74T|GDNF_uc011cpf.1_Missense_Mutation_p.P74T|GDNF_uc011cpg.1_Missense_Mutation_p.P117T|GDNF_uc011cph.1_Missense_Mutation_p.P91T	NM_000514	NP_000505	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor isoform 1	100					adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity				0	all_lung(31;0.00118)					GAATTCTCTGGGTTGGCAGCT	0.478													21	74	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38352408	38352408	+	Nonsense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38352408C>T	uc003jlc.1	+	5	844	c.520C>T	c.(520-522)CAG>TAG	p.Q174*	EGFLAM_uc003jlb.1_Nonsense_Mutation_p.Q174*	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	174	Fibronectin type-III 2.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					CGCCCCTATTCAGTACTATTC	0.403													13	90	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38352440	38352440	+	Intron	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38352440C>A	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					TCAGGTAAGTCTGTATGTCAC	0.299													11	66	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40981635	40981635	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40981635C>A	uc003jmh.2	+	18	2606	c.2492C>A	c.(2491-2493)TCT>TAT	p.S831Y		NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	831	Complement control factor I module 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				CAGAGCATCTCTGTCACCAGC	0.572													3	9	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75469965	75469965	+	Intron	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75469965C>A	uc003kei.1	+						uc003kej.2_RNA	NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		AGCAGACTTTCCAACGCCTCG	0.428													20	53	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82868261	82868261	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82868261G>T	uc003kii.3	+	13	10118	c.9762G>T	c.(9760-9762)CAG>CAT	p.Q3254H	VCAN_uc003kij.3_Missense_Mutation_p.Q2267H|VCAN_uc010jau.2_Missense_Mutation_p.Q1500H|VCAN_uc003kik.3_Missense_Mutation_p.Q513H|VCAN_uc003kil.3_Missense_Mutation_p.Q1918H	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3254	C-type lectin.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		GACCCAACCAGCCAGACAGCT	0.423													29	60	---	---	---	---	PASS
HSPA4	3308	broad.mit.edu	37	5	132408918	132408918	+	Intron	SNP	G	T	T	rs111333016		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132408918G>T	uc003kyj.2	+							NM_002154	NP_002145	P34932	HSP74_HUMAN	heat shock 70kDa protein 4						cellular chaperone-mediated protein complex assembly|protein import into mitochondrial outer membrane|response to unfolded protein	cytoplasm|nucleus	ATP binding			lung(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTTTTTTTTGTAGGTTCCTT	0.328													5	13	---	---	---	---	PASS
CDC23	8697	broad.mit.edu	37	5	137524751	137524751	+	Silent	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137524751G>C	uc003lcl.2	-	16	1741	c.1710C>G	c.(1708-1710)CCC>CCG	p.P570P		NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23	570					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GTAGGAAAAAGGGAGCAGGCA	0.527													6	22	---	---	---	---	PASS
GRPEL2	134266	broad.mit.edu	37	5	148730726	148730726	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148730726G>T	uc003lqj.2	+	4	685	c.559G>T	c.(559-561)GGT>TGT	p.G187C	GRPEL2_uc011dca.1_3'UTR	NM_152407	NP_689620	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial precursor	187					protein folding	mitochondrial matrix	adenyl-nucleotide exchange factor activity|chaperone binding|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGCCAGCTGGTGTTGGGGT	0.527													23	62	---	---	---	---	PASS
MYOZ3	91977	broad.mit.edu	37	5	150042512	150042512	+	Silent	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150042512C>A	uc003lss.2	+	2	596	c.9C>A	c.(7-9)CCC>CCA	p.P3P	MYOZ3_uc003lsr.2_Silent_p.P3P	NM_001122853	NP_001116325	Q8TDC0	MYOZ3_HUMAN	myozenin 3	3						sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGATGATCCCCAAGGAGCAGA	0.572													14	19	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150885463	150885463	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150885463G>C	uc003lue.3	-	23	12726	c.12713C>G	c.(12712-12714)CCT>CGT	p.P4238R	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.P845R	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	4238	Cytoplasmic (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGTGGGAGAGGTGCCCGCTT	0.627													30	97	---	---	---	---	PASS
PROP1	5626	broad.mit.edu	37	5	177422884	177422884	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177422884G>T	uc003mif.1	-	1	360	c.51C>A	c.(49-51)GTC>GTA	p.V17V		NM_006261	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	17					central nervous system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTTGCTGCCGACTCGCCCCT	0.632													9	24	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179193310	179193310	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179193310G>T	uc003mkm.2	+	2	1562	c.1299G>T	c.(1297-1299)ACG>ACT	p.T433T	MAML1_uc003mkn.1_Silent_p.T433T	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	433					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCAGCAGACGGGGCCCTCCC	0.602													21	61	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179193311	179193311	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179193311G>T	uc003mkm.2	+	2	1563	c.1300G>T	c.(1300-1302)GGG>TGG	p.G434W	MAML1_uc003mkn.1_Missense_Mutation_p.G434W	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	434					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCAGACGGGGCCCTCCCA	0.602													21	62	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180432609	180432609	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180432609C>A	uc003mmr.2	+	8	1266	c.1138C>A	c.(1138-1140)CTC>ATC	p.L380I	BTNL3_uc010jlp.2_Missense_Mutation_p.L165I	NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	380	B30.2/SPRY.|Cytoplasmic (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			GTATTGGGTCCTCAGACTGAC	0.502													8	33	---	---	---	---	PASS
NFYA	4800	broad.mit.edu	37	6	41060639	41060639	+	Intron	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41060639C>G	uc003opo.2	+						NFYA_uc003opp.2_Intron|NFYA_uc003opq.2_Intron	NM_002505	NP_002496	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha isoform 1						transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTCTGGTTTCCTGTTCACACA	0.433													18	55	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43111361	43111361	+	Intron	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43111361G>T	uc003oub.1	+						PTK7_uc003ouc.1_Intron|PTK7_uc003oud.1_Intron|PTK7_uc003oue.1_Intron|PTK7_uc003ouf.1_Intron|PTK7_uc003oug.1_Intron|PTK7_uc011dve.1_Intron|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a						actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CCTCAACGGTGAGGGGCCCTG	0.682											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	19	---	---	---	---	PASS
C6orf138	442213	broad.mit.edu	37	6	47846462	47846462	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47846462C>A	uc011dwm.1	-	3	2152	c.2067G>T	c.(2065-2067)TGG>TGT	p.W689C	C6orf138_uc011dwn.1_Missense_Mutation_p.W453C	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	706	Helical; (Potential).					integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						TGTCGACGTTCCATAATGTCA	0.438													8	25	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51897971	51897971	+	Intron	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51897971A>G	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCCCTGAAAAATCAATTTTAA	0.323													12	48	---	---	---	---	PASS
TRAM2	9697	broad.mit.edu	37	6	52370454	52370454	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52370454C>T	uc003paq.2	-	9	967	c.818G>A	c.(817-819)CGC>CAC	p.R273H	EFHC1_uc011dwv.1_Intron|TRAM2_uc003par.1_RNA	NM_012288	NP_036420	Q15035	TRAM2_HUMAN	translocation-associated membrane protein 2	273	TLC.				collagen biosynthetic process|protein transport|transmembrane transport	integral to membrane	protein binding				0	Lung NSC(77;0.109)					GTTTTCCATGCGAGCCAGTCC	0.552													17	63	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56480537	56480537	+	Intron	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56480537T>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Missense_Mutation_p.I2576M	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAGCCTCTTCTATTGATAACC	0.368													32	97	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57512544	57512544	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512544G>C	uc003pdx.2	+	15	1459	c.1372G>C	c.(1372-1374)GGT>CGT	p.G458R		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	458					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCTAAATGGTGGTAAAGACAT	0.388													13	147	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66044997	66044997	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66044997G>A	uc011dxu.1	-	11	2180	c.1642C>T	c.(1642-1644)CAG>TAG	p.Q548*	EYS_uc003peq.2_Nonsense_Mutation_p.Q548*|EYS_uc003per.1_Nonsense_Mutation_p.Q548*	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	548					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						CGATATTCCTGACTGTCTTCT	0.358													10	43	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66115197	66115197	+	Missense_Mutation	SNP	C	A	A	rs139115734	by1000genomes	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66115197C>A	uc011dxu.1	-	6	1464	c.926G>T	c.(925-927)TGC>TTC	p.C309F	EYS_uc003peq.2_Missense_Mutation_p.C309F|EYS_uc003per.1_Missense_Mutation_p.C309F	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	309					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						GCTATTTGGGCAAATTCCTCT	0.373													13	132	---	---	---	---	PASS
TTK	7272	broad.mit.edu	37	6	80745093	80745093	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80745093G>T	uc003pjc.2	+	16	1957	c.1883G>T	c.(1882-1884)TGG>TTG	p.W628L	TTK_uc003pjb.3_Missense_Mutation_p.W627L	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	628	Protein kinase.				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AAGAGTTACTGGAAAAATATG	0.318													15	49	---	---	---	---	PASS
KIAA0776	23376	broad.mit.edu	37	6	96982207	96982207	+	Intron	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96982207G>T	uc003por.2	+						KIAA0776_uc010kck.2_Intron	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376						negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TGTGAGTTTGGTTTAAATTAT	0.259													5	26	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136596829	136596829	+	Missense_Mutation	SNP	A	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136596829A>C	uc003qgx.1	-	6	1946	c.1693T>G	c.(1693-1695)TTG>GTG	p.L565V	BCLAF1_uc003qgw.1_Missense_Mutation_p.L392V|BCLAF1_uc003qgy.1_Missense_Mutation_p.L563V|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.L563V	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	565					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCTTTAGTCAAGGAAGCAGGT	0.378													5	115	---	---	---	---	PASS
TCP1	6950	broad.mit.edu	37	6	160200659	160200659	+	Nonsense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160200659C>T	uc003qsr.2	-	11	1689	c.1454G>A	c.(1453-1455)TGG>TAG	p.W485*	TCP1_uc003qss.2_Nonsense_Mutation_p.W330*|TCP1_uc010kjz.2_Intron|TCP1_uc003qst.2_Nonsense_Mutation_p.W261*	NM_030752	NP_110379	P17987	TCPA_HUMAN	T-complex protein 1 isoform a	485					'de novo' posttranslational protein folding|tubulin complex assembly	cell junction|Golgi apparatus	ATP binding|unfolded protein binding			breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		CCATGCTTACCATTTTAGATT	0.403													14	113	---	---	---	---	PASS
RPS6KA2	6196	broad.mit.edu	37	6	166918101	166918101	+	Splice_Site	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166918101C>A	uc003qvb.1	-	6	679	c.460_splice	c.e6-1	p.V154_splice	RPS6KA2_uc011ego.1_Splice_Site_p.V65_splice|RPS6KA2_uc010kkl.1_Splice_Site_p.V65_splice|RPS6KA2_uc003qvc.1_Splice_Site_p.V162_splice|RPS6KA2_uc003qvd.1_Splice_Site_p.V179_splice	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		TGAACATGACCTAGTAAGAAa	0.423													6	45	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50605613	50605613	+	Missense_Mutation	SNP	T	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50605613T>G	uc003tpf.3	-	4	466	c.380A>C	c.(379-381)GAA>GCA	p.E127A	DDC_uc010kza.2_Intron|DDC_uc003tpg.3_Missense_Mutation_p.E127A	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	127	2.|2 X approximate tandem repeats.				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	CTTTGGTAGTTCCAGCATCTT	0.567													13	18	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50605614	50605614	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50605614C>A	uc003tpf.3	-	4	465	c.379G>T	c.(379-381)GAA>TAA	p.E127*	DDC_uc010kza.2_Intron|DDC_uc003tpg.3_Nonsense_Mutation_p.E127*	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	127	2.|2 X approximate tandem repeats.				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	TTTGGTAGTTCCAGCATCTTC	0.567													12	20	---	---	---	---	PASS
TBL2	26608	broad.mit.edu	37	7	72985559	72985559	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72985559C>T	uc003tyh.2	-	6	972	c.838G>A	c.(838-840)GCG>ACG	p.A280T	TBL2_uc011kex.1_Missense_Mutation_p.A244T|TBL2_uc010lbg.2_Missense_Mutation_p.A185T|TBL2_uc003tyi.2_Missense_Mutation_p.A115T|TBL2_uc011key.1_Missense_Mutation_p.A151T|TBL2_uc010lbh.2_Missense_Mutation_p.A185T	NM_012453	NP_036585	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	280	WD 5.										0		Lung NSC(55;0.0659)|all_lung(88;0.152)				TGCACAGCCGCGGAGTGGCCC	0.567													11	22	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965880	88965880	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965880T>C	uc011khi.1	+	4	4122	c.3584T>C	c.(3583-3585)GTA>GCA	p.V1195A		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1195						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GCCTCAACCGTACAGACAGTT	0.507										HNSCC(36;0.09)			19	48	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91714871	91714871	+	Silent	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91714871T>C	uc003ulg.2	+	36	9120	c.8895T>C	c.(8893-8895)TAT>TAC	p.Y2965Y	AKAP9_uc003ulf.2_Silent_p.Y2957Y|AKAP9_uc003uli.2_Silent_p.Y2588Y|AKAP9_uc003ulj.2_Silent_p.Y735Y|AKAP9_uc003ulk.2_Silent_p.Y240Y	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2969					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTCTCCCTATAGTGATGGAG	0.413			T	BRAF	papillary thyroid								7	51	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93055820	93055820	+	Missense_Mutation	SNP	A	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93055820A>T	uc003umv.1	-	15	1636	c.1375T>A	c.(1375-1377)TCT>ACT	p.S459T	CALCR_uc011kia.1_Missense_Mutation_p.S239T|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.S425T|CALCR_uc003umw.2_Missense_Mutation_p.S425T	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	441	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	GCGCGAGCAGAGCGGTTGGAG	0.587													21	80	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123092884	123092884	+	Silent	SNP	A	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123092884A>T	uc003vkn.2	-	13	2866	c.2289T>A	c.(2287-2289)CTT>CTA	p.L763L	IQUB_uc011kny.1_Silent_p.L96L|IQUB_uc003vko.2_Silent_p.L763L|IQUB_uc010lkt.2_RNA	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	763										ovary(3)|large_intestine(1)	4						CACCATCATCAAGTATAAATG	0.403													11	31	---	---	---	---	PASS
ATP6V0A4	50617	broad.mit.edu	37	7	138429946	138429946	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138429946T>C	uc003vuf.2	-	13	1638	c.1400A>G	c.(1399-1401)AAT>AGT	p.N467S	ATP6V0A4_uc003vug.2_Missense_Mutation_p.N467S|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.N467S	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	467	Helical; (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						GAAGCAGTCATTGTAGATCAA	0.483													24	60	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142111478	142111478	+	Intron	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142111478G>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TAGGGAACTGGTGACCTGAGA	0.522													30	79	---	---	---	---	PASS
TAS2R60	338398	broad.mit.edu	37	7	143140680	143140680	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143140680G>T	uc011ktg.1	+	1	135	c.135G>T	c.(133-135)GAG>GAT	p.E45D	uc003wda.2_Intron	NM_177437	NP_803186	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	45	Helical; Name=2; (Potential).				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity			skin(6)	6	Melanoma(164;0.172)					TGGGCGTGGAGTGGGTGCTAC	0.488													16	109	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146818104	146818104	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146818104C>A	uc003weu.1	+	6	1304	c.788C>A	c.(787-789)ACA>AAA	p.T263K		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	263	Laminin G-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TATGGCCACACATCAGTGATG	0.507										HNSCC(39;0.1)			12	32	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154519510	154519510	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154519510G>T	uc003wlk.2	+	8	925	c.796G>T	c.(796-798)GCA>TCA	p.A266S	DPP6_uc003wli.2_Missense_Mutation_p.A202S|DPP6_uc003wlm.2_Missense_Mutation_p.A204S|DPP6_uc011kvq.1_Missense_Mutation_p.A159S	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	266	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTACTACTGTGCACATGTCGG	0.388													3	26	---	---	---	---	PASS
ESYT2	57488	broad.mit.edu	37	7	158557364	158557364	+	Intron	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158557364C>A	uc003wob.1	-						ESYT2_uc003woc.1_Intron|ESYT2_uc003wod.1_Intron|ESYT2_uc003woa.1_5'Flank	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain							integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3						ACACGACACCCCACCTCATAG	0.527													32	86	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39644560	39644560	+	Nonsense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39644560G>C	uc003xnj.2	-	10	899	c.824C>G	c.(823-825)TCA>TGA	p.S275*	ADAM2_uc003xnk.2_Nonsense_Mutation_p.S256*|ADAM2_uc011lck.1_Nonsense_Mutation_p.S275*|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	275	Extracellular (Potential).|Peptidase M12B.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AACATAATTTGACTTTTCTCT	0.254													7	55	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48794537	48794537	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48794537C>A	uc003xqi.2	-	38	4955	c.4898G>T	c.(4897-4899)TGG>TTG	p.W1633L	PRKDC_uc003xqj.2_Missense_Mutation_p.W1633L|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1633					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ATCTTTGGCCCACCATGAATC	0.428								NHEJ					12	52	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69050754	69050754	+	Splice_Site	SNP	T	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69050754T>A	uc003xxv.1	+	33	4114	c.4087_splice	c.e33+2	p.N1363_splice		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TGGTTGCAAGTAAGTAATTAG	0.279													21	35	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86044041	86044041	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86044041G>T	uc003ycw.2	+	12	1967	c.1813G>T	c.(1813-1815)GAT>TAT	p.D605Y	LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.D306Y|LRRCC1_uc003ycx.2_Missense_Mutation_p.D512Y|LRRCC1_uc003ycy.2_Missense_Mutation_p.D585Y	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	605	Potential.				cell division|mitosis	centriole|nucleus					0						TGACTTCCAGGATGCCTTAGC	0.358													10	36	---	---	---	---	PASS
CA3	761	broad.mit.edu	37	8	86354361	86354361	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86354361G>T	uc003ydj.2	+	3	375	c.292G>T	c.(292-294)GGC>TGC	p.G98C	CA3_uc011lfv.1_Intron	NM_005181	NP_005172	P07451	CAH3_HUMAN	carbonic anhydrase III	98					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0						TCTTCACTGGGGCTCTTCGGA	0.512													8	56	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89128950	89128950	+	Intron	SNP	T	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89128950T>A	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						AGGTGGACCTTTTGAAAATAT	0.473													27	62	---	---	---	---	PASS
RAD54B	25788	broad.mit.edu	37	8	95392644	95392644	+	Intron	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95392644A>G	uc003ygk.2	-						RAD54B_uc010may.1_Intron	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B						double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			CCTGTCAATCAAAAAGAAAGA	0.323								Direct_reversal_of_damage|Homologous_recombination					13	20	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131833626	131833626	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131833626C>A	uc003ytd.3	-	13	2972	c.2716G>T	c.(2716-2718)GCC>TCC	p.A906S	ADCY8_uc010mds.2_Missense_Mutation_p.A775S	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	906	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGGAACATGGCCATCAGTAGC	0.463										HNSCC(32;0.087)			11	22	---	---	---	---	PASS
ODF2	4957	broad.mit.edu	37	9	131261374	131261374	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131261374A>G	uc011mbd.1	+	20	2581	c.2270A>G	c.(2269-2271)GAA>GGA	p.E757G	ODF2_uc004bvb.2_Missense_Mutation_p.E733G|ODF2_uc011mbe.1_Missense_Mutation_p.E752G|ODF2_uc004bvc.2_Missense_Mutation_p.E733G|ODF2_uc004bvd.3_Missense_Mutation_p.E757G|ODF2_uc004bvh.2_Missense_Mutation_p.E163G	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	757	Potential.				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						ACCAAAACGGAATTGAGCCAG	0.607													7	41	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37442497	37442497	+	Intron	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37442497C>A	uc001iza.1	+							NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TTACTTTTAACAGAGTCTCTG	0.279													8	109	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108923977	108923977	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108923977G>T	uc001kym.2	-	1	316	c.308C>A	c.(307-309)GCA>GAA	p.A103E	SORCS1_uc001kyl.2_Missense_Mutation_p.A103E|SORCS1_uc009xxs.2_Missense_Mutation_p.A103E|SORCS1_uc001kyn.1_Missense_Mutation_p.A103E|SORCS1_uc001kyo.2_Missense_Mutation_p.A103E	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	103	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCCGGAGCGTGCAGCAACCGC	0.706													4	10	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1267306	1267306	+	Missense_Mutation	SNP	T	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1267306T>G	uc009ycr.1	+	49	11071	c.10945T>G	c.(10945-10947)TTT>GTT	p.F3649V	MUC5B_uc001ltb.2_Missense_Mutation_p.F3069V	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3066	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGCTACCAGCTTTACACCCAT	0.592													5	92	---	---	---	---	PASS
SLC22A18	5002	broad.mit.edu	37	11	2946385	2946385	+	Silent	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2946385C>G	uc001lwx.2	+	11	1451	c.1233C>G	c.(1231-1233)CTC>CTG	p.L411L	SLC22A18_uc001lwy.2_Silent_p.L411L|SLC22A18_uc001lwz.2_Silent_p.L313L	NM_183233	NP_899056	Q96BI1	S22AI_HUMAN	tumor suppressing subtransferable candidate 5	411	Helical; (Potential).				excretion|organic cation transport	apical plasma membrane|cytoplasmic part|integral to membrane|nuclear envelope	drug:hydrogen antiporter activity|symporter activity|ubiquitin protein ligase binding			central_nervous_system(2)|ovary(1)	3		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCCTGGTCCTCTGGAGGAAAC	0.597													12	51	---	---	---	---	PASS
OR51I2	390064	broad.mit.edu	37	11	5475341	5475341	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5475341G>T	uc010qzf.1	+	1	623	c.623G>T	c.(622-624)GGC>GTC	p.G208V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I,	208	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCACCTTTGGCATGGACCTG	0.483													54	83	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7063864	7063864	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7063864G>C	uc001mfb.1	+	4	930	c.607G>C	c.(607-609)GGC>CGC	p.G203R		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	203	NACHT.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TTGGGCAGAGGGCAGTCTCTA	0.453													3	64	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51515730	51515730	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51515730G>T	uc010ric.1	+	1	449	c.449G>T	c.(448-450)GGC>GTC	p.G150V		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TGGATGGGAGGCTTTCTTCAT	0.463													45	109	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57080481	57080481	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57080481G>C	uc001njr.2	-	4	1993	c.1681C>G	c.(1681-1683)CAA>GAA	p.Q561E	TNKS1BP1_uc001njs.2_Missense_Mutation_p.Q561E|TNKS1BP1_uc009ymd.1_Missense_Mutation_p.Q12E	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	561	Pro-rich.|Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				AATTGAGGTTGACTCTCCCCA	0.597													12	54	---	---	---	---	PASS
CLP1	10978	broad.mit.edu	37	11	57428849	57428849	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57428849C>T	uc001nkw.2	+	3	1358	c.1219C>T	c.(1219-1221)CGC>TGC	p.R407C	CLP1_uc010rjw.1_Missense_Mutation_p.R343C|CLP1_uc009yml.2_Missense_Mutation_p.R407C	NM_006831	NP_006822	Q92989	CLP1_HUMAN	ATP/GTP-binding protein isoform 1	407					mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity			ovary(1)	1						TCCAGCCCCTCGCCCACTGCC	0.512													44	70	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57958307	57958307	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57958307G>T	uc010rka.1	+	1	345	c.345G>T	c.(343-345)CTG>CTT	p.L115L		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				GCTACCTTCTGGCCATCATGG	0.592													34	97	---	---	---	---	PASS
PRPF19	27339	broad.mit.edu	37	11	60665722	60665722	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60665722A>G	uc001nqf.2	-	14	1369	c.1162T>C	c.(1162-1164)TTC>CTC	p.F388L		NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN	PRP19/PSO4 pre-mRNA processing factor 19	388					DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						TGGCCAGGGAAGTTGGCCACA	0.527													9	44	---	---	---	---	PASS
ANKRD13D	338692	broad.mit.edu	37	11	67059504	67059504	+	Missense_Mutation	SNP	T	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67059504T>G	uc001okc.1	+	7	834	c.323T>G	c.(322-324)GTG>GGG	p.V108G	ANKRD13D_uc001okd.1_Missense_Mutation_p.V195G|ANKRD13D_uc001oke.1_Missense_Mutation_p.V108G	NM_207354	NP_997237	Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	108										ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GACCGGCAGGTGGTGCATGTG	0.667													6	29	---	---	---	---	PASS
INPPL1	3636	broad.mit.edu	37	11	71939479	71939479	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71939479G>C	uc001osf.2	+	3	481	c.334G>C	c.(334-336)GCC>CCC	p.A112P	INPPL1_uc001osg.2_5'UTR	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	112	SH2.				actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						CCTTGTGTGCGCCCTGCTTCT	0.667													16	52	---	---	---	---	PASS
C11orf70	85016	broad.mit.edu	37	11	101946766	101946766	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101946766G>T	uc001pgp.2	+	5	626	c.598G>T	c.(598-600)GAT>TAT	p.D200Y	C11orf70_uc001pgo.2_3'UTR|C11orf70_uc001pgq.2_Missense_Mutation_p.D162Y	NM_032930	NP_116319	Q9BRQ4	CK070_HUMAN	hypothetical protein LOC85016	200										skin(1)	1	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		TATCTATAAGGATCTGGTGAG	0.348													18	58	---	---	---	---	PASS
TTC12	54970	broad.mit.edu	37	11	113235651	113235651	+	Silent	SNP	C	T	T	rs145338802	byFrequency	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113235651C>T	uc001pnu.2	+	21	2016	c.1911C>T	c.(1909-1911)AAC>AAT	p.N637N	TTC12_uc001pnv.2_Silent_p.N643N|TTC12_uc001pnw.2_RNA|TTC12_uc001pnx.2_Silent_p.N487N	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	637							binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		AGGTGCCCAACGTTGCGTCTT	0.557													15	30	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294718	124294718	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294718A>G	uc010sak.1	-	1	50	c.50T>C	c.(49-51)TTA>TCA	p.L17S		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTGTTCTGATAATCCCACAAG	0.483													11	35	---	---	---	---	PASS
PKNOX2	63876	broad.mit.edu	37	11	125267790	125267790	+	Silent	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125267790C>A	uc001qbu.2	+	7	734	c.420C>A	c.(418-420)GTC>GTA	p.V140V	PKNOX2_uc010saz.1_Silent_p.V111V|PKNOX2_uc010sba.1_Silent_p.V111V|PKNOX2_uc010sbb.1_Silent_p.V76V	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	140						nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CAATCCAGGTCCTGAGAATCC	0.552													10	35	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128844845	128844845	+	Silent	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128844845C>G	uc009zcp.2	-	20	2205	c.2205G>C	c.(2203-2205)CTG>CTC	p.L735L	ARHGAP32_uc009zcq.1_Silent_p.L695L|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Silent_p.L386L	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	735					cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						AAGAGGCAGACAGTGCATCAC	0.448													4	44	---	---	---	---	PASS
STYK1	55359	broad.mit.edu	37	12	10782146	10782146	+	Silent	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10782146C>A	uc001qys.2	-	6	1100	c.579G>T	c.(577-579)GTG>GTT	p.V193V		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	193	Protein kinase.					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						CATCCTCCAACACCATATAGA	0.527										HNSCC(73;0.22)			8	35	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15654584	15654584	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15654584G>A	uc001rcv.1	+	5	866	c.692G>A	c.(691-693)CGT>CAT	p.R231H	PTPRO_uc001rcw.1_Missense_Mutation_p.R231H|PTPRO_uc001rcu.1_Missense_Mutation_p.R231H	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	231	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				ATTTCCGTTCGTATCGTAAAC	0.328													14	33	---	---	---	---	PASS
YARS2	51067	broad.mit.edu	37	12	32906940	32906940	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32906940C>A	uc001rli.2	-	2	925	c.859G>T	c.(859-861)GGC>TGC	p.G287C		NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	287					tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	ACAGCGTTGCCAGCAGACTTT	0.418													36	115	---	---	---	---	PASS
PA2G4	5036	broad.mit.edu	37	12	56500497	56500497	+	Nonsense_Mutation	SNP	A	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56500497A>T	uc001sjm.2	+	2	633	c.214A>T	c.(214-216)AAA>TAA	p.K72*	PA2G4_uc009zol.2_Nonsense_Mutation_p.K72*|PA2G4_uc009zom.2_Nonsense_Mutation_p.K72*	NM_006191	NP_006182	Q9UQ80	PA2G4_HUMAN	ErbB3-binding protein 1	72					cell cycle arrest|cell proliferation|negative regulation of transcription, DNA-dependent|regulation of translation|rRNA processing	cytoplasm|nucleolus|ribonucleoprotein complex	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding				0			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			GGAAATGAAGAAAGGTAAAAA	0.249													7	43	---	---	---	---	PASS
MDM1	56890	broad.mit.edu	37	12	68715231	68715231	+	Intron	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68715231T>C	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		ACCTTCCTAATAGAAATGAAA	0.338													86	49	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70963467	70963467	+	Missense_Mutation	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70963467C>G	uc001swb.3	-	12	2998	c.2968G>C	c.(2968-2970)GTT>CTT	p.V990L	PTPRB_uc010sto.1_Missense_Mutation_p.V990L|PTPRB_uc010stp.1_Missense_Mutation_p.V900L|PTPRB_uc001swc.3_Missense_Mutation_p.V1208L|PTPRB_uc001swa.3_Missense_Mutation_p.V1120L|PTPRB_uc001swd.3_Missense_Mutation_p.V1207L|PTPRB_uc009zrr.1_Missense_Mutation_p.V1087L	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	990	Fibronectin type-III 11.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GTCCGCCCAACCACATTTATC	0.522													45	34	---	---	---	---	PASS
SART3	9733	broad.mit.edu	37	12	108936867	108936867	+	Silent	SNP	T	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108936867T>A	uc001tmz.1	-	6	1078	c.843A>T	c.(841-843)GTA>GTT	p.V281V	SART3_uc001tmy.1_5'Flank|SART3_uc009zux.1_5'UTR|SART3_uc010swx.1_Silent_p.V281V|SART3_uc010swy.1_Silent_p.V167V|SART3_uc010swz.1_Silent_p.V281V|SART3_uc001tna.1_RNA	NM_014706	NP_055521	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T	281					RNA processing	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding			pancreas(1)	1						AGTTCTGAATTACTGACTCTG	0.413									Porokeratosis				31	33	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124362328	124362328	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124362328T>C	uc001uft.3	+	47	7916	c.7891T>C	c.(7891-7893)TGC>CGC	p.C2631R		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2631	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCTGACATTCTGCACGCTAGC	0.398													19	31	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131561415	131561415	+	Missense_Mutation	SNP	T	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131561415T>A	uc001uit.3	+	14	2102	c.1543T>A	c.(1543-1545)TTC>ATC	p.F515I	GPR133_uc010tbm.1_Missense_Mutation_p.F547I|GPR133_uc009zyo.2_5'UTR|GPR133_uc001uiv.1_Missense_Mutation_p.F34I	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	515	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CTTCCTGGACTTCAGGTACCC	0.582													19	23	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29600146	29600146	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29600146G>T	uc001usl.3	+	1	1399	c.1341G>T	c.(1339-1341)GTG>GTT	p.V447V		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	437						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						ACAGTCATGTGGCTTTTATTC	0.483													5	20	---	---	---	---	PASS
LRCH1	23143	broad.mit.edu	37	13	47315771	47315771	+	Intron	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47315771G>T	uc001vbj.2	+						LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GCTGCCCTCGGAATAGGCTGA	0.473													100	265	---	---	---	---	PASS
ATP7B	540	broad.mit.edu	37	13	52548103	52548103	+	Missense_Mutation	SNP	T	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52548103T>G	uc001vfw.2	-	2	1410	c.1253A>C	c.(1252-1254)GAA>GCA	p.E418A	ATP7B_uc010adv.2_Missense_Mutation_p.E418A|ATP7B_uc001vfx.2_Missense_Mutation_p.E418A|ATP7B_uc001vfy.2_Missense_Mutation_p.E307A|ATP7B_uc010tgt.1_Missense_Mutation_p.E418A|ATP7B_uc010tgu.1_Missense_Mutation_p.E418A|ATP7B_uc010tgv.1_Missense_Mutation_p.E418A|ATP7B_uc010tgw.1_Missense_Mutation_p.E386A	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	418	HMA 4.|Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)		TCCCATGTCTTCTATAGCAGC	0.463									Wilson_disease				8	44	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58299291	58299291	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58299291G>T	uc001vhq.1	+	4	4235	c.3343G>T	c.(3343-3345)GGT>TGT	p.G1115C	PCDH17_uc010aec.1_Missense_Mutation_p.G1114C|PCDH17_uc001vhr.1_Missense_Mutation_p.G204C	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	1115	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAGTGAGATGGGTGCTGTTCT	0.512													36	99	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70535466	70535466	+	Nonsense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70535466C>T	uc001vip.2	-	3	1585	c.791G>A	c.(790-792)TGG>TAG	p.W264*	KLHL1_uc010thm.1_Nonsense_Mutation_p.W203*	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	264	BTB.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GACAAGGTCCCAGAGAGCATT	0.378													19	70	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109817407	109817407	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109817407G>C	uc001vqt.1	+	33	5383	c.5257G>C	c.(5257-5259)GGT>CGT	p.G1753R	MYO16_uc010agk.1_Missense_Mutation_p.G1775R	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1753					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CATCTCAAATGGTAAGCACTT	0.328													10	43	---	---	---	---	PASS
ARHGEF7	8874	broad.mit.edu	37	13	111944527	111944527	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111944527G>T	uc001vrs.2	+	20	2510	c.2260G>T	c.(2260-2262)GAC>TAC	p.D754Y	ARHGEF7_uc001vrr.2_Missense_Mutation_p.D733Y|ARHGEF7_uc001vrt.2_Missense_Mutation_p.D704Y|ARHGEF7_uc001vrv.3_Intron|ARHGEF7_uc001vrw.3_Intron|ARHGEF7_uc001vrx.3_Intron|ARHGEF7_uc010tjo.1_Intron|ARHGEF7_uc010tjp.1_Missense_Mutation_p.D498Y|ARHGEF7_uc001vry.1_Missense_Mutation_p.D170Y	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c	754					apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			ACCAAGCCTAGACTCCCTGGG	0.552													18	55	---	---	---	---	PASS
OR11H4	390442	broad.mit.edu	37	14	20711630	20711630	+	Missense_Mutation	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20711630C>A	uc010tld.1	+	1	680	c.680C>A	c.(679-681)TCC>TAC	p.S227Y		NM_001004479	NP_001004479	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H,	227	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		ATTCTTCGATCCTATATCCTG	0.438													93	201	---	---	---	---	PASS
RNASE12	493901	broad.mit.edu	37	14	21058696	21058696	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21058696T>C	uc001vxt.2	-	1	287	c.187A>G	c.(187-189)AAA>GAA	p.K63E	RNASE11_uc010ahv.2_5'Flank|RNASE11_uc010ahx.2_5'Flank|RNASE11_uc010ahw.2_5'Flank|RNASE11_uc001vxs.2_5'Flank|uc001vxu.1_RNA	NM_001024822	NP_001019993	Q5GAN4	RNS12_HUMAN	ribonuclease, RNase A family, 12 (non-active)	63						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(95;0.00238)		Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)		TGCTCCTTTTTACAAGTGTGG	0.453													39	61	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24529408	24529408	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24529408C>T	uc001wlj.2	+	24	2162	c.2005C>T	c.(2005-2007)CCC>TCC	p.P669S	LRRC16B_uc001wlk.2_5'Flank	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	669										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		CCAGACGTGCCCCCAGGAGCA	0.642													8	58	---	---	---	---	PASS
CMA1	1215	broad.mit.edu	37	14	24975443	24975443	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24975443A>G	uc001wpp.1	-	4	421	c.391T>C	c.(391-393)TTC>CTC	p.F131L	CMA1_uc010alx.1_Missense_Mutation_p.F20L	NM_001836	NP_001827	P23946	CMA1_HUMAN	chymase 1, mast cell preproprotein	131	Peptidase S1.			FP -> AV (in Ref. 3; AA sequence).	interleukin-1 beta biosynthetic process|proteolysis	extracellular region	serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.0271)		TGGGATGGGAAGGGGAGTGTC	0.567													7	27	---	---	---	---	PASS
FOXG1	2290	broad.mit.edu	37	14	29237474	29237474	+	Missense_Mutation	SNP	C	A	A	rs150277632		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29237474C>A	uc001wqe.2	+	1	1188	c.989C>A	c.(988-990)ACC>AAC	p.T330N		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	330					axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		TACAACGGCACCACGTCGGCC	0.647													35	83	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	38277929	38277929	+	Intron	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38277929T>C	uc001wug.2	+						uc001wuh.2_Intron|uc001wui.2_Intron|uc001wuj.2_Intron					Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		ATTACTTTTTTCTTTTTAGAC	0.269													56	84	---	---	---	---	PASS
CLEC14A	161198	broad.mit.edu	37	14	38724715	38724715	+	Silent	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38724715G>A	uc001wum.1	-	1	860	c.513C>T	c.(511-513)TGC>TGT	p.C171C		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	171	Extracellular (Potential).|C-type lectin.					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		ACTGGTACTTGCACAGGTAGC	0.577													24	59	---	---	---	---	PASS
SOS2	6655	broad.mit.edu	37	14	50585243	50585243	+	Missense_Mutation	SNP	C	A	A	rs58365465		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50585243C>A	uc001wxs.3	-	23	3916	c.3818G>T	c.(3817-3819)CGA>CTA	p.R1273L	SOS2_uc010ans.2_Missense_Mutation_p.R108L|SOS2_uc010tql.1_Missense_Mutation_p.R1240L|C14orf138_uc001wxn.1_5'Flank|C14orf138_uc001wxo.1_5'Flank|C14orf138_uc001wxp.1_5'Flank|C14orf138_uc001wxq.1_5'Flank	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	1273					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					CACATAGCATCGACGCGGTAC	0.517													12	37	---	---	---	---	PASS
MPP5	64398	broad.mit.edu	37	14	67768148	67768148	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67768148G>C	uc001xjc.2	+	5	1085	c.619G>C	c.(619-621)GAA>CAA	p.E207Q	MPP5_uc001xjd.2_Missense_Mutation_p.E173Q|ATP6V1D_uc001xje.2_Intron	NM_022474	NP_071919	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5	207	Interaction with LIN7C (By similarity).|L27 2.				tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		GGAAGGACAAGAACTAACTGC	0.318													7	38	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75265315	75265315	+	Silent	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75265315A>G	uc001xqj.3	+	5	3439	c.3315A>G	c.(3313-3315)GCA>GCG	p.A1105A	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	910	Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ACAGGGGTGCAGCTGGCAGCC	0.617													9	17	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	80319925	80319925	+	Intron	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80319925A>G	uc001xun.2	+						NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCGCCCTTACATGGACATGGC	0.468													19	106	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107083364	107083364	+	RNA	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107083364G>T	uc010tyt.1	-	113		c.5429C>A								Parts of antibodies, mostly variable regions.												0						TCTTGAGGGAGGGGTTGTAGT	0.542													27	81	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22848885	22848885	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22848885G>T	uc001yur.3	+	10	1062	c.932G>T	c.(931-933)CGA>CTA	p.R311L	TUBGCP5_uc001yuq.2_Missense_Mutation_p.R311L|TUBGCP5_uc010axz.1_5'UTR	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	311					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		AGCTGTTTACGATCTGTGCTG	0.423													11	48	---	---	---	---	PASS
SNORD116-5	100033417	broad.mit.edu	37	15	25304721	25304721	+	5'Flank	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25304721G>T	uc001yxo.2	+						SNORD116-4_uc001yxh.1_RNA|SNORD116-4_uc001yxj.1_RNA|SNORD116-4_uc001yxm.1_RNA|IPW_uc001yxn.3_RNA|SNORD116-4_uc001yxl.3_RNA	NR_003322				Homo sapiens small nucleolar RNA, C/D box 116-5 (SNORD116-5), non-coding RNA.												0						AACATTCCTTGGAAAAGCTGA	0.512													25	99	---	---	---	---	PASS
SLC12A6	9990	broad.mit.edu	37	15	34549958	34549958	+	Missense_Mutation	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34549958T>C	uc001zhw.2	-	5	739	c.575A>G	c.(574-576)TAC>TGC	p.Y192C	SLC12A6_uc001zhv.2_Missense_Mutation_p.Y141C|SLC12A6_uc001zhx.2_Missense_Mutation_p.Y177C|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.Y133C|SLC12A6_uc001zib.2_Missense_Mutation_p.Y183C|SLC12A6_uc001zic.2_Missense_Mutation_p.Y192C|SLC12A6_uc010bau.2_Missense_Mutation_p.Y192C|SLC12A6_uc001zid.2_Missense_Mutation_p.Y133C|SLC12A6_uc001zhu.2_Intron	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	192	Helical; (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	ACATGGGAGGTAGACACCCAT	0.393													6	16	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	64046826	64046826	+	Missense_Mutation	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64046826C>G	uc002amp.2	-	7	1800	c.1652G>C	c.(1651-1653)CGT>CCT	p.R551P	HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Missense_Mutation_p.R551P	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	551	RCC1 4.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						TGGAATGTTACGACTATTGCT	0.373													12	50	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72040852	72040852	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72040852G>A	uc002atb.1	+	13	2413	c.2334G>A	c.(2332-2334)ATG>ATA	p.M778I	THSD4_uc002ate.2_Missense_Mutation_p.M418I	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	778	TSP type-1 3.					proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						AATGCAACATGAAGCTCCGGC	0.572													13	25	---	---	---	---	PASS
RSL1D1	26156	broad.mit.edu	37	16	11941675	11941675	+	Intron	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11941675G>A	uc002dbp.1	-						RSL1D1_uc010buv.1_Intron|RSL1D1_uc010uyw.1_Intron|RSL1D1_uc010buw.2_Intron	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TACAAAATACGTGAAAAGAAA	0.338													7	44	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20441101	20441101	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20441101A>G	uc002dhe.2	+	8	1250	c.1103A>G	c.(1102-1104)GAA>GGA	p.E368G		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	368	ATP (By similarity).				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						GAGCTGTACGAAGGCTATGGC	0.617													5	33	---	---	---	---	PASS
KARS	3735	broad.mit.edu	37	16	75663434	75663434	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75663434C>T	uc002feq.2	-	12	1478	c.1430G>A	c.(1429-1431)CGC>CAC	p.R477H	KARS_uc002fer.2_Missense_Mutation_p.R505H|KARS_uc002fes.2_Missense_Mutation_p.R321H	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2	477					interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	CTCTTTAGAGCGGTGCCTAGG	0.403													18	131	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81151074	81151074	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81151074C>T	uc002fgh.1	-	41	6675	c.6675G>A	c.(6673-6675)CTG>CTA	p.L2225L	PKD1L2_uc002fgf.1_Silent_p.L25L|PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	2225	Helical; (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GGATGATGGCCAGCTCCAGAA	0.617													28	59	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578442	7578442	+	Missense_Mutation	SNP	T	C	C	rs148924904		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578442T>C	uc002gim.2	-	5	682	c.488A>G	c.(487-489)TAC>TGC	p.Y163C	TP53_uc002gig.1_Missense_Mutation_p.Y163C|TP53_uc002gih.2_Missense_Mutation_p.Y163C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y31C|TP53_uc010cng.1_Missense_Mutation_p.Y31C|TP53_uc002gii.1_Missense_Mutation_p.Y31C|TP53_uc010cnh.1_Missense_Mutation_p.Y163C|TP53_uc010cni.1_Missense_Mutation_p.Y163C|TP53_uc002gij.2_Missense_Mutation_p.Y163C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Y70C|TP53_uc002gio.2_Missense_Mutation_p.Y31C|TP53_uc010vug.1_Missense_Mutation_p.Y124C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	163	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y163C(95)|p.Y163N(17)|p.Y163H(17)|p.Y163*(7)|p.0?(7)|p.Y163S(4)|p.Y163Y(3)|p.Y163fs*1(2)|p.Y163D(2)|p.Y163fs*7(2)|p.V157_C176del20(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Y163fs*18(1)|p.I162_Y163delIY(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGACTGCTTGTAGATGGCCAT	0.622		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			14	27	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12626177	12626177	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12626177G>C	uc002gnn.2	+	5	566	c.267G>C	c.(265-267)GAG>GAC	p.E89D	MYOCD_uc002gno.2_Missense_Mutation_p.E89D|MYOCD_uc002gnp.1_5'UTR	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	89					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CCACTGCAGAGAGGTCCATTC	0.453													27	65	---	---	---	---	PASS
SLC5A10	125206	broad.mit.edu	37	17	18862955	18862955	+	Silent	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18862955G>C	uc002guu.1	+	4	368	c.327G>C	c.(325-327)GTG>GTC	p.V109V	SLC5A10_uc002gur.1_Silent_p.V53V|SLC5A10_uc002gut.1_Silent_p.V109V|SLC5A10_uc002guv.1_Silent_p.V109V|SLC5A10_uc010vyl.1_Silent_p.V109V	NM_001042450	NP_001035915	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose	109	Helical; (Potential).				sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1						GGGTGTTCGTGCCCATCTACA	0.592													11	30	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520469	33520469	+	Silent	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520469T>C	uc002hjd.2	-	1	944	c.858A>G	c.(856-858)CTA>CTG	p.L286L		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	286	DUF6 2.|Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		CCTCGGAATGTAGGACAGCGC	0.592													3	111	---	---	---	---	PASS
MYO19	80179	broad.mit.edu	37	17	34856770	34856770	+	Silent	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34856770C>G	uc010wcy.1	-	24	3269	c.2277G>C	c.(2275-2277)CGG>CGC	p.R759R	MYO19_uc002hmw.2_Silent_p.R559R|MYO19_uc010cuu.2_RNA	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2	759	IQ 1.					mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GCTCCAGCACCCGGGCACGCC	0.667													4	8	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57126641	57126641	+	Silent	SNP	T	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57126641T>C	uc002iwy.3	-	15	1872	c.1428A>G	c.(1426-1428)GCA>GCG	p.A476A	TRIM37_uc002iwz.3_Silent_p.A476A|TRIM37_uc002ixa.3_Silent_p.A354A|TRIM37_uc010woc.1_Silent_p.A442A	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	476						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TGTCAGAGCATGCAGACTTCT	0.453									Mulibrey_Nanism				63	36	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61959165	61959165	+	5'UTR	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61959165C>A	uc002jco.1	-	1					GH2_uc002jcj.2_5'UTR|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_5'UTR|GH2_uc002jcm.1_5'UTR|GH2_uc002jcn.1_5'UTR	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1							extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						CAGCCATTGCCGCTAGGTGAG	0.597													5	82	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67079035	67079035	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67079035G>A	uc002jhw.1	-	36	4770	c.4595C>T	c.(4594-4596)CCA>CTA	p.P1532L		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	1532					transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TGCAGCCTGTGGGAAAAGCTT	0.443													90	139	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5398051	5398051	+	Missense_Mutation	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5398051C>G	uc002kmt.1	-	17	2527	c.2441G>C	c.(2440-2442)GGG>GCG	p.G814A	EPB41L3_uc010wzh.1_Missense_Mutation_p.G645A|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Missense_Mutation_p.G119A|EPB41L3_uc010wzf.1_Missense_Mutation_p.G111A|EPB41L3_uc010wzg.1_Missense_Mutation_p.G86A|EPB41L3_uc010dkr.2_Missense_Mutation_p.G206A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	814	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AGAAGTAACCCCTCCTATGAA	0.448													49	95	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13089487	13089487	+	Missense_Mutation	SNP	A	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13089487A>C	uc010xac.1	+	33	6106	c.6026A>C	c.(6025-6027)CAG>CCG	p.Q2009P	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.Q1534P|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.Q431P|CEP192_uc002krw.2_Missense_Mutation_p.Q158P|CEP192_uc002krx.2_Missense_Mutation_p.Q13P|CEP192_uc002kry.2_RNA	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	2009										ovary(4)|pancreas(1)	5						ATGATAAAACAGATACTTCCA	0.313													16	41	---	---	---	---	PASS
PSMA8	143471	broad.mit.edu	37	18	23772372	23772372	+	Silent	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23772372C>G	uc002kvq.2	+	7	882	c.768C>G	c.(766-768)GTC>GTG	p.V256V	PSMA8_uc002kvo.2_Silent_p.V212V|PSMA8_uc002kvp.2_Silent_p.V250V|PSMA8_uc002kvr.2_Silent_p.V224V	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1	256					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			AGAAATCTGTCTAATTCTTAG	0.323													6	19	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28923950	28923950	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28923950A>G	uc002kwp.2	+	13	2095	c.1883A>G	c.(1882-1884)GAC>GGC	p.D628G	DSG1_uc010xbp.1_5'UTR	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	628	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GAATGCATTGACAACTCAGGT	0.294													20	53	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30321943	30321943	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30321943G>T	uc002kxm.1	-	3	1405	c.1017C>A	c.(1015-1017)AGC>AGA	p.S339R	KLHL14_uc010dmd.1_5'UTR	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	339	Kelch 1.					cytosol|endoplasmic reticulum membrane				ovary(1)	1						GAACCAAATTGCTGGGGAGCC	0.373													5	17	---	---	---	---	PASS
TCF4	6925	broad.mit.edu	37	18	52928689	52928689	+	Intron	SNP	T	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52928689T>A	uc002lfz.2	-						TCF4_uc002lfw.3_Intron|TCF4_uc010xdu.1_Intron|TCF4_uc010xdv.1_Intron|TCF4_uc002lfx.2_Intron|TCF4_uc010xdw.1_Intron|TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc002lgb.1_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lfv.2_Intron	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		AAGTCAATATTTCCTCACCGA	0.428													86	228	---	---	---	---	PASS
CREB3L3	84699	broad.mit.edu	37	19	4157049	4157049	+	Missense_Mutation	SNP	G	C	C			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4157049G>C	uc002lzl.2	+	3	330	c.214G>C	c.(214-216)GAC>CAC	p.D72H	CREB3L3_uc002lzm.2_Missense_Mutation_p.D62H|CREB3L3_uc010xib.1_Missense_Mutation_p.D63H|CREB3L3_uc010xic.1_Missense_Mutation_p.D63H	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	72	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCTCTGGAGACTCACTGCC	0.632													11	34	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5724856	5724856	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5724856A>G	uc002mda.2	+	2	170	c.109A>G	c.(109-111)ATA>GTA	p.I37V	TMEM146_uc010duj.1_Intron	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	37	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						GTTTAATCTGATACAGGACGT	0.338													46	76	---	---	---	---	PASS
STXBP2	6813	broad.mit.edu	37	19	7707385	7707385	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7707385G>T	uc002mha.3	+	10	910	c.865G>T	c.(865-867)GTG>TTG	p.V289L	STXBP2_uc002mhb.3_Missense_Mutation_p.V286L|STXBP2_uc010dvj.2_RNA|STXBP2_uc010xjr.1_Missense_Mutation_p.V300L|STXBP2_uc010dvk.2_Missense_Mutation_p.V257L|STXBP2_uc002mhc.3_Missense_Mutation_p.V57L|STXBP2_uc002mhe.1_5'Flank	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	289					leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						TGACTTGTGGGTGGAGCTTCG	0.662													20	58	---	---	---	---	PASS
CYP2B6	1555	broad.mit.edu	37	19	41522660	41522660	+	Missense_Mutation	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41522660C>G	uc002opr.1	+	9	1411	c.1404C>G	c.(1402-1404)ATC>ATG	p.I468M	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Missense_Mutation_p.I268M	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	468					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	CAGAAGACATCGATCTGACAC	0.577													6	14	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44512957	44512957	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44512957A>G	uc002oyb.1	+	3	282	c.31A>G	c.(31-33)AAG>GAG	p.K11E		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	11	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				AGTGACCTTCAAGGATGTGGC	0.522													39	128	---	---	---	---	PASS
ZNF473	25888	broad.mit.edu	37	19	50550200	50550200	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50550200A>G	uc002prn.2	+	5	2737	c.2500A>G	c.(2500-2502)AGA>GGA	p.R834G	ZNF473_uc002prm.2_Missense_Mutation_p.R834G|ZNF473_uc010ybo.1_Missense_Mutation_p.R822G	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN	zinc finger protein 473	834	C2H2-type 19.				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		CCAGCACCTGAGAGTTCACAC	0.517											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	43	---	---	---	---	PASS
SIGLEC7	27036	broad.mit.edu	37	19	51650535	51650535	+	Silent	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51650535C>A	uc002pvv.1	+	6	1251	c.1182C>A	c.(1180-1182)GGC>GGA	p.G394G	SIGLEC7_uc002pvw.1_Silent_p.G301G|SIGLEC7_uc010eoq.1_RNA|SIGLEC7_uc010eor.1_Intron	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	394	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GAGACATAGGCATGAAGGATG	0.577													6	21	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55512225	55512225	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55512225C>T	uc002qij.2	+	13	3234	c.3148C>T	c.(3148-3150)CCC>TCC	p.P1050S	NLRP2_uc010yfp.1_Missense_Mutation_p.P1027S|NLRP2_uc010esn.2_Missense_Mutation_p.P1026S|NLRP2_uc010eso.2_Missense_Mutation_p.P1047S|NLRP2_uc010esp.2_Missense_Mutation_p.P1028S	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	1050					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	p.P1050H(1)		ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GAAACATCATCCCTGGGCAGA	0.408													18	49	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56538983	56538983	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56538983C>T	uc002qmj.2	+	7	1384	c.1384C>T	c.(1384-1386)CGT>TGT	p.R462C	NLRP5_uc002qmi.2_Missense_Mutation_p.R443C	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	462	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CATGAACAACCGTGAGCTGCT	0.602													6	25	---	---	---	---	PASS
SLC9A8	23315	broad.mit.edu	37	20	48491342	48491342	+	Silent	SNP	C	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48491342C>A	uc002xuv.1	+	11	1269	c.1059C>A	c.(1057-1059)ACC>ACA	p.T353T	SLC9A8_uc010zym.1_Silent_p.T53T|SLC9A8_uc010gic.2_Silent_p.T53T|SLC9A8_uc010gid.2_Intron	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8	353						Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			CCCTCCGCACCGTGGCCTTCT	0.547													25	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10862789	10862789	+	IGR	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862789G>T								None (None upstream) : TPTE (43954 downstream)																							GTCTGGGGCTGAGGTGAAGAA	0.562													22	116	---	---	---	---	PASS
DYRK1A	1859	broad.mit.edu	37	21	38844986	38844986	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38844986G>A	uc002ywk.2	+	2	86	c.11G>A	c.(10-12)GGA>GAA	p.G4E	DYRK1A_uc002ywg.1_RNA|DYRK1A_uc010gno.1_RNA|DYRK1A_uc002ywh.1_5'UTR|DYRK1A_uc002ywi.2_Missense_Mutation_p.G4E|DYRK1A_uc002ywj.2_Missense_Mutation_p.G4E|DYRK1A_uc002ywl.2_Missense_Mutation_p.G4E|DYRK1A_uc002ywm.2_Missense_Mutation_p.G4E	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	4					nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						CTTCTTGTAGGAGGAGAGACT	0.393													8	40	---	---	---	---	PASS
PRODH	5625	broad.mit.edu	37	22	18912699	18912699	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18912699C>T	uc010grl.2	-	4	546	c.532G>A	c.(532-534)GAC>AAC	p.D178N	PRODH_uc002zoj.3_Missense_Mutation_p.D68N|PRODH_uc002zol.3_Missense_Mutation_p.D68N|PRODH_uc002zok.3_Missense_Mutation_p.D178N	NM_016335	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase 1	178					glutamate biosynthetic process|induction of apoptosis by oxidative stress|proline catabolic process	mitochondrial inner membrane|mitochondrial matrix	proline dehydrogenase activity			breast(1)	1					L-Proline(DB00172)	TATTGCTTGTCCCGCTTATTC	0.617													12	41	---	---	---	---	PASS
TPST2	8459	broad.mit.edu	37	22	26937357	26937357	+	Silent	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26937357G>T	uc003acv.2	-	2	408	c.240C>A	c.(238-240)GGC>GGA	p.G80G	TPST2_uc003acw.2_Silent_p.G80G|TPST2_uc003acx.2_Silent_p.G80G|TPST2_uc011akf.1_Silent_p.G80G	NM_003595	NP_003586	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	80	Lumenal (Potential).				peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1						TCAACGTGGTGCCACTGCGAG	0.677													6	27	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41670655	41670655	+	Silent	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41670655C>T	uc003azs.2	-	2	1659	c.189G>A	c.(187-189)GTG>GTA	p.V63V	RANGAP1_uc003azt.2_Silent_p.V63V|RANGAP1_uc003azu.2_Silent_p.V63V|RANGAP1_uc011aoz.1_Silent_p.V53V	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	63	LRR 1.				mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						TGGCTGCTTCCACGCCCACTG	0.537													16	46	---	---	---	---	PASS
BEND2	139105	broad.mit.edu	37	X	18198764	18198764	+	Missense_Mutation	SNP	A	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18198764A>G	uc004cyj.3	-	9	1449	c.1295T>C	c.(1294-1296)TTA>TCA	p.L432S	BEND2_uc010nfb.2_Missense_Mutation_p.L341S	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	432										ovary(3)|kidney(1)|central_nervous_system(1)	5						ATTCAGAGGTAACagtgctga	0.214													12	9	---	---	---	---	PASS
ATP7A	538	broad.mit.edu	37	X	77289124	77289124	+	Missense_Mutation	SNP	G	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77289124G>T	uc004ecx.3	+	17	3476	c.3316G>T	c.(3316-3318)GGT>TGT	p.G1106C		NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1106	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						TGAAACCTTGGGTACCTGCAT	0.403													17	13	---	---	---	---	PASS
IL1RAPL2	26280	broad.mit.edu	37	X	104984630	104984630	+	Missense_Mutation	SNP	C	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104984630C>T	uc004elz.1	+	8	1750	c.994C>T	c.(994-996)CAT>TAT	p.H332Y		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	332	Ig-like C2-type 3.|Extracellular (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						TTATACCTGCCATGTTGAAAA	0.383													34	29	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111020095	111020095	+	Missense_Mutation	SNP	C	G	G			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111020095C>G	uc004epl.1	-	11	3287	c.2368G>C	c.(2368-2370)GCT>CCT	p.A790P		NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	790	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						TTGGCCCGAGCCCCACCACTG	0.483													8	175	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125686548	125686548	+	Missense_Mutation	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686548G>A	uc004eul.2	-	1	295	c.44C>T	c.(43-45)GCG>GTG	p.A15V		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	15										skin(3)|ovary(1)	4						CGCCTCGACCGCGGGCGCTTT	0.512													4	18	---	---	---	---	PASS
SASH3	54440	broad.mit.edu	37	X	128925032	128925032	+	Silent	SNP	G	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128925032G>A	uc011mun.1	+	4	599	c.417G>A	c.(415-417)CCG>CCA	p.P139P	SASH3_uc004euu.2_Silent_p.P139P|SASH3_uc011muo.1_Silent_p.P56P	NM_018990	NP_061863	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	139										ovary(2)|pancreas(1)	3						ATGAACTTCCGGTGCTCAGCC	0.612													7	20	---	---	---	---	PASS
C1orf162	128346	broad.mit.edu	37	1	112019173	112019173	+	Intron	DEL	T	-	-	rs34481842		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112019173delT	uc001ebe.2	+							NM_174896	NP_777556	Q8NEQ5	CA162_HUMAN	hypothetical protein LOC128346							integral to membrane				ovary(1)	1		all_cancers(81;0.00116)|all_epithelial(167;0.000761)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0236)|Colorectal(144;0.0286)|all cancers(265;0.0572)|Epithelial(280;0.0862)|COAD - Colon adenocarcinoma(174;0.112)|LUSC - Lung squamous cell carcinoma(189;0.134)		ACATATGAGATTTTTTTTTTT	0.333													4	2	---	---	---	---	
CAPZA1	829	broad.mit.edu	37	1	113202197	113202198	+	Intron	DEL	TC	-	-	rs113906793		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113202197_113202198delTC	uc001ecj.1	+							NM_006135	NP_006126	P52907	CAZA1_HUMAN	F-actin capping protein alpha-1 subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex|WASH complex	actin binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGACAGTTTCTCTCTCTCTC	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	158146137	158146137	+	IGR	DEL	G	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158146137delG								KIRREL (80295 upstream) : CD1D (3600 downstream)																							TTTTTTATTTGGTCCTTTTCC	0.358													90	41	---	---	---	---	
SLC9A11	284525	broad.mit.edu	37	1	173490617	173490622	+	Intron	DEL	TATATA	-	-	rs146332693		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173490617_173490622delTATATA	uc001giz.2	-						SLC9A11_uc009wwe.2_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						AAATATTTTCtatatatatatatata	0.218													4	2	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	-	-	rs35817759		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240255569_240255571delGGC	uc010pyd.1	+	1	385_387	c.160_162delGGC	c.(160-162)GGCdel	p.G59del	FMN2_uc010pye.1_In_Frame_Del_p.G59del	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	59					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.557													8	7	---	---	---	---	
ADCY3	109	broad.mit.edu	37	2	25046361	25046362	+	Intron	INS	-	T	T	rs5829941		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25046361_25046362insT	uc002rfs.3	-						ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TTATTCCAGCAttttttttttt	0.223													5	3	---	---	---	---	
STK17B	9262	broad.mit.edu	37	2	197028246	197028246	+	Intron	DEL	A	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197028246delA	uc002utk.2	-						STK17B_uc010fsh.2_Intron	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			AAATACAACTAAAAAAAAAAA	0.308													7	4	---	---	---	---	
RBM5	10181	broad.mit.edu	37	3	50131006	50131007	+	Intron	INS	-	A	A			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50131006_50131007insA	uc003cyg.2	+						RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron|RBM5_uc003cyf.2_Intron|RBM5_uc011bdj.1_Intron|RBM5_uc011bdk.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		acccctgtctcaaaaaaaaaaa	0.198													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374552	149374553	+	Intron	DEL	TC	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374552_149374553delTC	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			tctctctctttctctctctctc	0.361													4	2	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3344470	3344470	+	Intron	DEL	T	-	-	rs112112932		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3344470delT	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc003ggx.1_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGGATGACTGTTTTTTTTTCA	0.219													4	2	---	---	---	---	
LIAS	11019	broad.mit.edu	37	4	39468962	39468962	+	Intron	DEL	T	-	-	rs78228460		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39468962delT	uc003guf.2	+						LIAS_uc003gug.2_Intron|LIAS_uc003guh.2_Intron	NM_006859	NP_006850	O43766	LIAS_HUMAN	lipoic acid synthetase isoform 1 precursor						inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)	AACGGTCTGCTTTTTTTTTTT	0.284													3	3	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39904143	39904143	+	Intron	DEL	T	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39904143delT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						TAAGAAGCAAttttttttttt	0.159													9	4	---	---	---	---	
MAP9	79884	broad.mit.edu	37	4	156274607	156274609	+	Intron	DEL	ATT	-	-	rs33994283		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156274607_156274609delATT	uc003ios.2	-						MAP9_uc011cin.1_Intron|MAP9_uc010iqa.1_Intron|MAP9_uc003iot.1_Intron	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein						cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TCTGATATTCATTATACTTAGAA	0.167													3	4	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70939896	70939899	+	Intron	DEL	GTGC	-	-	rs71859051		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70939896_70939899delGTGC	uc003kbs.3	+						MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	gtgtgtgtgtgtgcgcgcgtgtgt	0.201													4	2	---	---	---	---	
SLC25A46	91137	broad.mit.edu	37	5	110081875	110081896	+	Intron	DEL	TGTTTATACTGCAATTCCACCA	-	-	rs73230125	by1000genomes	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110081875_110081896delTGTTTATACTGCAATTCCACCA	uc003koz.2	+						SLC25A46_uc011cvi.1_Intron	NM_138773	NP_620128	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46						transport	integral to membrane|mitochondrial inner membrane					0		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)		AATTAACTTTTGTTTATACTGCAATTCCACCATATTTCTTTC	0.261													8	6	---	---	---	---	
KATNA1	11104	broad.mit.edu	37	6	149959866	149959866	+	5'Flank	DEL	G	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149959866delG	uc003qmr.1	-						KATNA1_uc003qms.2_Intron|KATNA1_uc003qmt.2_Intron|KATNA1_uc011eed.1_5'Flank	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		AAAAAACATTGtttttttttt	0.189													4	2	---	---	---	---	
TNPO3	23534	broad.mit.edu	37	7	128645359	128645359	+	Intron	DEL	T	-	-	rs142831893		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128645359delT	uc003vol.1	-						TNPO3_uc003vom.1_Intron|TNPO3_uc010lly.1_Intron|TNPO3_uc010llz.1_Intron	NM_012470	NP_036602	Q9Y5L0	TNPO3_HUMAN	transportin 3						splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5						AGTGTCACTGttttttttttt	0.204													11	5	---	---	---	---	
EPB49	2039	broad.mit.edu	37	8	21931158	21931164	+	Intron	DEL	AAAAAAG	-	-	rs58985524		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21931158_21931164delAAAAAAG	uc011kyt.1	+						EPB49_uc010ltl.2_Intron|EPB49_uc011kys.1_Intron|EPB49_uc010ltn.2_Intron|EPB49_uc011kyu.1_Intron|EPB49_uc011kyv.1_Intron|EPB49_uc010ltq.2_Intron	NM_001114136	NP_001107608	Q08495	DEMA_HUMAN	erythrocyte membrane protein band 4.9 isoform 1						actin filament bundle assembly|actin filament capping	actin cytoskeleton|nucleus	actin binding			central_nervous_system(1)	1				Colorectal(74;9.05e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0631)		aaaaaaaaaaaaaaaagaaagaaaaaa	0.159													13	6	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78686829	78686829	+	Intron	DEL	C	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78686829delC	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						GTTTTAAAAGCATGGAGGCTT	0.522													62	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19414308	19414311	+	IGR	DEL	TTCC	-	-	rs10450313	by1000genomes	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19414308_19414311delTTCC								ARL5B (447368 upstream) : PLXDC2 (691061 downstream)																							ctttctttctttccttccttcctt	0.069													2	4	---	---	---	---	
SLC16A9	220963	broad.mit.edu	37	10	61444172	61444172	+	Intron	DEL	A	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61444172delA	uc010qig.1	-							NM_194298	NP_919274	Q7RTY1	MOT9_HUMAN	solute carrier family 16 (monocarboxylic acid						urate metabolic process	integral to membrane|plasma membrane	symporter activity			skin(2)|ovary(1)	3						TCCTAAAGTGAAAAAAAAAAA	0.323													4	2	---	---	---	---	
C10orf58	84293	broad.mit.edu	37	10	82186899	82186900	+	Intron	DEL	AA	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82186899_82186900delAA	uc001kcc.3	+						C10orf58_uc001kcd.3_Intron|C10orf58_uc001kce.3_Intron|C10orf58_uc001kcf.3_Intron	NM_032333	NP_115709	Q9BRX8	CJ058_HUMAN	hypothetical protein LOC84293 precursor							extracellular region					0			Colorectal(32;0.229)			actccatctcaaaaaaaaaaaa	0.223													4	2	---	---	---	---	
ANO5	203859	broad.mit.edu	37	11	22225269	22225270	+	Intron	INS	-	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22225269_22225270insT	uc001mqi.2	+						ANO5_uc001mqj.2_Intron	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						TTCAATTCCTATTTTTTCCTTA	0.272													14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89385933	89385937	+	Intron	DEL	TATTT	-	-	rs148851366		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89385933_89385937delTATTT	uc001pcz.2	+											Homo sapiens mRNA for hypothetical protein, partial cds, clone:Hsa11-digit35-15-11-R.																		ATATTGATTATATTTTATTAATGGT	0.141													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80650276	80650277	+	IGR	INS	-	CAAA	CAAA	rs147846753	by1000genomes	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80650276_80650277insCAAA								PPP1R12A (321041 upstream) : PTPRQ (187849 downstream)																							TTTCTTTACATcaaacaaacaa	0.322													3	3	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132396531	132396535	+	Frame_Shift_Del	DEL	GGCTG	-	-	rs56390341		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132396531_132396535delGGCTG	uc001uje.2	+	13	1261_1265	c.993_997delGGCTG	c.(991-999)CCGGCTGACfs	p.P331fs		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	331_333	Interaction with GABARAP and GABARAPL2.				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		TGGCCTCCCCGGCTGACACCGCTGG	0.639													14	10	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422594	55422595	+	Intron	INS	-	TTCAGA	TTCAGA	rs140324706	by1000genomes	TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422594_55422595insTTCAGA	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AAAAACTACACTTCAGATTCCA	0.168													4	2	---	---	---	---	
MTHFD1	4522	broad.mit.edu	37	14	64921264	64921265	+	Intron	INS	-	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64921264_64921265insT	uc001xhb.2	+						MTHFD1_uc010aqf.2_Intron|ZBTB25_uc001xhc.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	CCCAACAGTTCTTTTTTTTTTT	0.307													4	2	---	---	---	---	
GPHN	10243	broad.mit.edu	37	14	67567581	67567581	+	Frame_Shift_Del	DEL	G	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67567581delG	uc001xiy.2	+	12	2268	c.1147delG	c.(1147-1149)GGCfs	p.G383fs	GPHN_uc001xix.2_Frame_Shift_Del_p.G416fs|GPHN_uc010tss.1_Frame_Shift_Del_p.G429fs|GPHN_uc010tst.1_Frame_Shift_Del_p.G352fs|GPHN_uc010tsu.1_Frame_Shift_Del_p.G306fs	NM_001024218	NP_001019389	Q9NQX3	GEPH_HUMAN	gephyrin isoform 2	383	MPT adenylyltransferase.				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AGCTGCTGATGGCCCAGGAGA	0.443			T	MLL	AL								37	16	---	---	---	---	
PDIA2	64714	broad.mit.edu	37	16	332559	332559	+	Intron	DEL	G	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:332559delG	uc002cgn.1	+						ARHGDIG_uc002cgm.1_Intron|PDIA2_uc010bqt.1_5'Flank|PDIA2_uc002cgo.1_5'Flank	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase A2 precursor						apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)|skin(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GGAACGGGGCGGGGGGGGGAA	0.692													3	3	---	---	---	---	
DECR2	26063	broad.mit.edu	37	16	460794	460794	+	Intron	DEL	C	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:460794delC	uc002chb.2	+						DECR2_uc002chc.2_Intron|DECR2_uc010bqv.2_Intron|DECR2_uc002chd.2_Intron|DECR2_uc002che.1_Intron	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2							peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				GGTATGACCACCCCCCCCCGC	0.677													4	2	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4936223	4936223	+	Intron	DEL	G	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4936223delG	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						CAACTAGTTTGGGGTTTTTTT	0.463													4	3	---	---	---	---	
UBE2Z	65264	broad.mit.edu	37	17	47000129	47000129	+	Intron	DEL	A	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47000129delA	uc002ioi.2	+							NM_023079	NP_075567	Q9H832	UBE2Z_HUMAN	ubiquitin-conjugating enzyme E2Z						apoptosis	cytoplasm|nucleus	ATP binding|ubiquitin-protein ligase activity				0						actccatctgaaaaaaaaaaa	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62932555	62932556	+	IGR	DEL	GT	-	-	rs35142297		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62932555_62932556delGT								LRRC37A3 (16969 upstream) : AMZ2P1 (30112 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.238													4	2	---	---	---	---	
SRP68	6730	broad.mit.edu	37	17	74066321	74066321	+	Intron	DEL	C	-	-	rs72040456		TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74066321delC	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						aaaaaaaaaacaaagcaaaca	0.129													4	2	---	---	---	---	
ZNF230	7773	broad.mit.edu	37	19	44514331	44514332	+	Intron	INS	-	AGTTGAATGC	AGTTGAATGC			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44514331_44514332insAGTTGAATGC	uc002oyb.1	+							NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				ACATTCATTAAAGTTGAATGCC	0.351													9	4	---	---	---	---	
VSX1	30813	broad.mit.edu	37	20	25060243	25060243	+	Intron	DEL	T	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25060243delT	uc002wuf.2	-						VSX1_uc002wue.2_Intron|VSX1_uc010gdd.1_Intron|VSX1_uc010gde.1_Intron|VSX1_uc010gdf.1_Intron|VSX1_uc002wug.1_Intron	NM_014588	NP_055403	Q9NZR4	VSX1_HUMAN	visual system homeobox 1 isoform a						response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TATGAACCTCTTGGGTACTTA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21112407	21112408	+	IGR	DEL	GA	-	-			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21112407_21112408delGA								None (None upstream) : None (None downstream)																							aaagaacaaggagagaaaaaaa	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17061715	17061716	+	IGR	INS	-	T	T			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17061715_17061716insT								OR11H1 (611911 upstream) : CCT8L2 (9932 downstream)																							TACATTGTTAGTTTGCAGACAG	0.337													54	25	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1501563	1501564	+	3'UTR	INS	-	TT	TT			TCGA-56-5898-01A-11D-1632-08	TCGA-56-5898-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1501563_1501564insTT	uc004cps.2	+	12					IL3RA_uc011mhd.1_3'UTR	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGATAAAGTGATTTTTTTTTTT	0.426													4	2	---	---	---	---	
